Department Of Medical Education - Rajasthan

34173859 supply of rate contract for medicine for mndy supply of rate contract for medicine for mndy , laying and jointing pvc pipe. heading , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , sevoflurane , atropine sulphate injection 0.6mg / ml , liquid medical oxygen ( lmo ) , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , fentanyl citrate injection ip 2 ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , morphine sulphate inj ip 10mg / ml , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , levetiracetam injection 500mg / 5ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amphotericin b inj ip 50 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg / cefixime dispersible tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , meropenem inj ip 500 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , piperacillin + tazobactum for injection ip 4gm+500mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , meropenem inj. ip 1gm , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , linezolid inj 200mg / 100ml , mefloquine tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , aztreonam injection 1gm , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , piperacillin injection 2 gm + tazobactom 250mg ip , ceftriaxone 1 gm + tazobactum 125 mg injection , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , clindamycin phosphate injection ip 300 mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , polymixin sulphate b injection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , voriconazole injection 200mg / vial , terbinafine hydrochloride tablet 250 mg , valganciclovir tablet 450 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , azathioprine tab ip 50 mg , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , chlorambucil tab ip 5 mg , cisplatin inj ip 50 mg / 50 ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cytarabine injection bp 500mg , danazol cap ip 50 mg , daunorubicin inj ip 20 mg , doxorubicin inj ip 50 mg / 25 ml , etoposide inj ip 100 mg , fluorouracil inj ip 250 mg / 5ml , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , tamoxifen tab ip 10 mg , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , dacarbazine injection 500 mg usp / bp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , methotrexate tablets ip 10 mg , oxaliplatin injection usp 50 mg , cyclosporin capsule usp / ip 50 mg , bendamustine injection 100 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , bortezomib injection 2mg , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bevacizumab injection 400 mg , bevacizumab injection 100 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg vial , dasatinib tab 100 mg , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , bromocriptine tablets ip 2.5 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , human albumin solution ip 20% , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , rh erythropoetin inj 4000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , recombinant f ix 500 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , esmolol hydrochloride injection 10mg / ml 10ml size , sodium nitroprusside injection 25mg / ml 2ml size , carvedilol tablet 3.125 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , oitment mupirocin ip 2% , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , vdrl antigen ( with + ve and ve control ) / rpr slide kit , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , multistix test strip , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , spironolactone tablets ip 50 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp / ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o eye drops / ear drops , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , sulfasalazine gastroresistant tablets ip 500 mg ip , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , glucagon for injection usp 1 mg / ml , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , octreotide injection 50 mcg / ml , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , diphtheria antitoxin 10000 iu , hepatitis b immunologlobin injection ip 200 i.u , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , cis atracurium besylate injection 2 mg / ml in 5 ml vial , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , acyclovir eye ointment ip 3% w / w 5gm size , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , human chorionic gonadotropin injection ip 5000 i.u. , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , quetiapine tablet ip 50mg , quetiapine tablet ip 25mg , clonazepam tablet 0.5 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , conc haemodialysis fluid b.p acetate concentrate 10 litre can , peritonial dialysis solution ip , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , alendronate sodium tablets usp / bp 35 mg , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , normal human intravenous immunoglobulin 5g / 100ml , pregabalin cap ip 75 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , intravenous fat emulsion 20% w / v 250ml , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , vitamin e capsule 400 mg , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , liposomol amphotericine injection b 50mg , amphotericin b ip gel 1.0 mg each gm contain amphotericin b 1.0mggel , crotamiton 10% + hydrocortisone 0.25% cream , methotrexate gel 1% , eflornithine hydrochloride cream 139 mg, each gm contain eflornithine hydrochloride139 mg , beclomethasone dipropionate0.064%+ salycylic acid 3% lotion , methoxsalen 1% lotion. each ml contain methoxsalen 1% , deca peptide 6 mg lotion. each ml contain deca peptide 6 mg , minocycline 50mg , trioxsalen 5mg tab. each film coated tablet contain trioxsalen 5mg , trioxsalen 25mg tab. each film coated tablet contain trioxsalen 25mg , trichloroacetic acid ( tca ) 50% w / v lotion , inj.hylan g f 20 , hepato protective tablet each film coated tablet to contain: matadoxine 500mg, silymarin 140mg, l ornithine l aspartate 150mg, pyridoxine hydrochloride 3mg, folic acid 1.5mg , spores of polyantibiotic resistant bacillus clausii 2 billion capsules , iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains:ferric saccharate ( in micro encapsulated form ) 75 mg eq. to elemental iron 30 mg phospholipid 167 mg eq. to phosphatidylserine100 mg , cojugated estrogen 0.3 mg tab.each tablet contain 0.3 mg cojugated estrogen , telmisartan40mg + hydroclorothiazide12.5 mg, i.p.each tablet contain telmisartan40mg + hydroclorithiazide12.5 mg, , telmisartan80mg + hydroclorothiazide25 mg, i.p.each tablet contain telmisartan80mg + hydroclorithiazide 25 mg, , mefenamic acid 250mg+ dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg+ dicyclomine hydrochloride10mg , combikit of ( tab fluconazole150mg + azithromycin 1gm & secnidazole1gm ) each kit contain 1tab fluconazole150mg + 1 tab.azithromycin 1gm & 2 tab.secnidazole1gm . , dolutegravir 50, each film coated tablet contain dolutegravir sodium 50 mg , tenofovir 300+lamivudine300, each film coated tablet contain tenofovir disoproxil fumerate300mg& lamivudine300 mg , efavirenz 600 each film coated tablet contain efavirenz 600 mg , nevirapine 200 each tablet contain nevirapine 200mg , atazanavir300+ritonavir100, each tablet contain atazanavir sulphate ip 300mg+ritonavir ip100mg , tenofovir alafinamide25+emtricitabine200+ doultegravir 50 each tablet contain tenofovir alafinamide25 mg +emtricitabine200mg+ doultegravir 50mg , abacavir300 eachtablet contain abacavir 300mg ip , lamivudine 100 eachtablet contain lamivudine 100 mg , raltegravir 400each film coated tablet contain raltegravir 400 mg , zideovudine 60+ lamivudine 30 , ultrasound contrast agent ( sulphur hexafluoride ) sonovue , contrast for ct scan / ivp / special investigations , iopamidol ct contrast solution for injectiuon , iopamidol ct contrast solution for injectiuon , contrast for special investigations ( barium sulphate powder ) , contrast for special investigations ( barium sulphate powder ) , contrast for special investigations ( barium sulphate suspension ) high density low viscosity , contrast for special investigations ( barium sulphate suspension ) high density low viscosity , contrast for special investigations ( barium sulphate paste ) , oral contrast for mri ( ferric ammonium citrate / mineral oil / corn oil ) , oral contrast forct ( diatrozoate sodium & diatrozoate meglumine ) , iopromide ct contrast usfda / ce approved , iopromide ct contrast usfda / ce approved , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iotrolon ct contrastusfda / ce approved , iotrolon ct contrast usfda / ce approved , venlafaxime tab. , olanzapineinj. , flupentixol inj. , memantine tab. , glycopyrrolate tab. , pramipexole tab. , pramipexole tab. , pramipexole tab. , inj. propofol mct / lct with oleic acid inj.iv , inj.paracetamol infusion 1000 mg in double sterilised closed system 100% biodegradable eco friendly polyolefin 100 ml bag , nalbuphine inj. , chlorprocaine inj , desflurane, 100ml , gelofusion infusion , albumin 5% infusion , inj.0.9% normal saline500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 0.9% normal saline 1000 ml in100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate1000 ml in 100% biodegradablenon dehp double sterilized polyolefin closed system bag , inj. 5% dextrose 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , balance salt solution with ph. of 7.2 to 7.4 osmolarity 292 to 294 in 100% biodegradable double sterilised closed systempolyolefin 500 ml bag , inj. balance hydroxy ethyl 6% tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100% biodegradable bag with polyolefin , inj.hydroxy ethyl 6% tetra starch 130 / 0.4 in nacl 500 ml 100% biodegradable bag , nifedipine sublingual , nifedipine sublingual , papaverine inj. , nicardipine tab. , topical heparin solution 1000iu / ml , anti gasgangrene sera 25000 iu / 10ml each vial contains clostridium perferingens anti toxin 10000 iu + clostridium oedematiens anti toxin 10000 iu + clostridium septicumanti toxin 5000 iu ) , basiliximab 20 mg inj , betamethasone and neomycin cream ( 0.10%+0.5% ) , solution silver nitrate 2% , solution silver nitrate 5% , solution silver nitrate 10% , alkaline nasal douches ( sodium bicarbonate+ sodium biborate+ sodium chloride ) , ear drops hydrocortisone 1%w / v+ acetic acid 2%w / v , ear drops each ml contain chloramphenicol 4mg + dexamethasone 1mg + polymyxin b ( 5000iu ) , nasal drops haemcoagulase topical solutioneach ml contain aqueous solution of haemocoagluase 0.2 cu , triamcinolone oromucosal paste bp 0.1% w / w , ethiodized oil ( lipiodol ) inj. , htk solution1 lit ( histidine tryptophan ketoglutarate solution ) , glycopegylated extended half life nonacog beta pegol f ix , glycopegylated extended half life nonacog beta pegol f ix , glycopegylated extended half life factor viii , glycopegylated extended half life factor viii , tenofovir alafenamidefumerate ( taf ) 25 mgtab. / cap , entecavir 1mg tab. / cap film coated , dacalatasvir 30 mgtab. / cap , dacalatasvir 60 mgtab. / cap , sofosbuvir 400 mg tab. / cap , ribavirin 200 mg tab. / cap film coated , artificial saliva , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg ( monopoly ) , all trans retinoic acid 10 mg , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder110 / 50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , / ointment ( modified lanolin ) , aloe vera moisturizing , amophous hydrogel with colloid silver wound dressing , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin, niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene ( 0.1% w / w ) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg / ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec ( vitamin c+ essential amino acid ) , enzyme , iron ( ferrous ascorbate ) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007 ml 30 ml , vitamin – e50mg / ml, 400 iu , vitamin d3 400iu / ml , vitamin d3 800iu / ml , cefpodoxime oral suspension 20mg / ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w / v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p / r , nifedipine + lidocaine p / r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg / vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg / ml , aminocaproicacid 20ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg ( monopoly ) , avelumab 200 mg ( monopoly ) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25, 000 iu , bortezomib 2.5 mg , botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , busulfan 60mg / 1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg / ml , calcium chloride 5ml vial , calcium gluconate / folinate , carbetocin 1ml / 100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm / vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg / 4ml , clonidine 150mcg / ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg ( monopoly ) , daratumumab 400 mg ( monopoly ) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu / 3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg / ml , dextran 40 , diazoxide 300 mg / 20ml , digoxin 2mg , diltiazem 25 mg , docetaxel 120 mg , doxycycline for injection 100 mg , durvalumab 120 mg ( monopoly ) , durvalumab 500mg ( monopoly ) , enalapril1.25 mg 1 ml , ephedrine 30 mg / ml , epirubicin 50mg / ml , epirubicin 150mg / ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct / lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection ( long acting ) 25mg / ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg / ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol ( long acting ) 50mg / ml ampoule , horse atg ( anti thymocyte globulin ) 250 mg , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , hydralazine 20mg / ml , indomethacin lyophilized powder 1mg , inotuzumab 1 mg ( monopoly ) , insulinaspart , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds 20% , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg / 5ml , irinotecan 100 mg / 5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% ( 20mg / 4ml ) ampule , levofloxacine 500mg / 100 ml , levosulpride 12.5 mg / ml , lignocaine ( preservative free ) 2% , lignocaine + adrenaline ( 1:10000, 2:10000 ) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , l orinithine l aspartate 10 ml , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , meropenem 2gm , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , milrinone 10 mg , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , moxifloxin 400mg / 100ml , multivitamin 10 ml , nabpaclitaxel ( paclitaxel nano particle ) 100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg ( monopoly ) , neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , netilmycin 300mg / 3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg / 50 ml , nimotuzumab 50 mg , nivolumab 40 mg ( monopoly ) , nivolumab 100 mg ( monopoly ) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar ( long acting release ) 20 mg , octreotide lar ( long acting release ) 30 mg , lidocaine 1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg ( monopoly ) , pembrolizumab 100 mg ( monopoly ) , pemetrexed 100mg , pemetrexed 500 mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg / ml , pilocarpine 0.5% w / v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , protamine sulphate 5ml , rabbit atg ( anti thymocyte globulin ) 100 mg , ramucirumab 100 mg ( monopoly ) , ramucirumab 500 mg ( monopoly ) , ranizumab 10mg / ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75 iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rituximab 100 mg , rituximab500 mg , rocuronium 100mg / 10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule ( heavy ) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 200 mg , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , thiamine 100ml , ticarcillinand clavulanic acid , tigecycline for injection 50mg , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg / 5ml , trastuzumab 440 mg , trastuzumab 150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg / ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 , clotrimazole 10mg , ( medium chain triglyceride ) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml / gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg / 5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine ( nac ) 200mg / ml , budesonide 0.5mg / ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30 / pack , revolizer / rotahaler device , root canal sealer ( calcium carbonate ) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg / 0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm / ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg / ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg / ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg / 5ml , clarithromycin for oral suspension 125mg / 5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg / ml , rabbit atg ( anti thymocyte globulin ) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg / 30ml , l carnitine 500mg / 5ml in 30 ml , l carnosine 100mg / 5ml in 200ml , levofloxacin oral solution , linezolid 100mg / 5ml in 30ml , mefenamice acid 100mg / 5ml , mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg / 5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension 5 ml , phenobarbitone 20mg / 5ml in 100ml , prednisoloneip 50mg , piracetam 500mg / 5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg / 5mlin 30ml , ursodeoxycholic oral suspension 125mg / 5ml in 100ml , zinc oral suspension 20 mg / 100 ml , susp. azithromycin oral suspension 100mg / 5ml , susp. azithromycin oral suspension 200mg / 5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg ( monopoly ) , alpelisib 200 mg ( monopoly ) , alpelisib 250 mg ( monopoly ) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg ( trientine hcl ) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg ( monopoly ) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cefuroxime axetil500 mg. , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg ( monopoly ) , dacomitinib 30 mg ( monopoly ) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside ( 60+8 mg ) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivabradine 5mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg ( monopoly ) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg ( monopoly ) , nilotinib200 mg ( monopoly ) , nilotinib 300mg ( monopoly ) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg ( monopoly ) , olaparib 150 mg ( monopoly ) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg ( monopoly ) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release / sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg / ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg ( monopoly ) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin ( 50 / 500 ) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tenofovir 300mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg ( monopoly ) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , trypsin chymotripsin , ulipristal 5mg , voriconazole 200 mg , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) , nicumalone 1 mg , nicumalone 4 mg , chymotrysin , citicoline , clarithromycin 500mg , dapagliflozin 10mg , deflazacort 6 mg , esomeprazole 40 mg , febuxastat 40 mg , febuxastat 80 mg , glucosamine + diacerein 50 mg tab , ketorolac 10 mg , levothyroxine sodium tablet 25 mcg , methylpredinisolone 16 mg , methylpredinisolone 8 mg , moxifloxacin400 mg , nitrazepam 10 mg , paracetamol 650 mg , pentoprazole 40 + levosulpiride 150 mgcap , propylthiouracial 100 mg , repaglinide and voglibose ( 0.5+0.3 ) , rifaximin 500mg , rosuvastatin 10mg + finofib 60mg , serratiopeptidase 10mg , silodocin 4 mg cap , silodocin 8 mg cap , sitagliptin 50mg , sulphasalazine 500 mg , thiocolchicosite 4 mg , vildagliptine 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , zinc 50mg , azithromycine 100 mg , azithromycine 200 mg , cefpodoxime 100 mg , cyproheptidine , mefenamice acid 100mg / 5ml , montelucast+levocetrizine , phenobarbitone 20mg / 5ml, 100 ml , levofloxacine , ondansetron , zink 20 mg, 100 ml , cream luliconazole 1% w / w , lignocain mouth paint , alpha beta arteether [ lp.26 ] [ m ] , multivitamine , azithromycin 10 ml vial equivalent to 500 mg , caffein 10 mg , citicoline 250 / 500 mg , colistine 10 lakh unit , compound sodium 500ml, glass bottel , dexmedetomidine 100mcg / ml , doxcyline100 mg , etomidate 10ml , etomidate 20 mg , ferric carbo maltose 500mg / 10 ml vial , fluconazole 200mg , gdw 5% glass bottle , levofloxacine 100 ml , l ornithine l aspartate 10 ml , mephentermine 30ml / ml , methylprednisolon injection 40mg , moxifloxacin 100ml , nandrolone decanoate 50 mg inj , nicorandil 48 mg , normal saline 500 ml glass bottle , ondansetron 8 mg , pilocarpine 0.5 %v / v , piracetam 200 mg , ravici 5 ml , reteplase 18 mg , tirofiban 0.5 mg , vitamin d ( 600000 iu ) , chloramphenicol +polymycine , chloramphenicol +polymycine + dexamethason , carboxymethylcellulose + glycerin , gatifloxacin and prednisolone , moxifloxacilline+ dyliprednate , moxifloxacilline+ prednisone , natamycin 5% , sodium chloride 5% , tropicamide + phenlyephrine , dorzolamide , moxifloxacin and prednisolone eye drop , olaptadine & ketrolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , anti cold15 ml , calcium30 ml , diastasepepsin with simethicone 15 ml , digestive enzyme 15 ml , hydroxyzine 15 ml , ondensetrone 30 ml , prednisolone 10 ml , terbutalin , vitamind3 400 iu , vitamind3 800 iu , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprebitant 125 / 80 , dulexitim 20mg , dulexitim 30mg , glucosamine + chloride +msm , racecadotril 100mg , rebeprazole +levosulpiride...

Medical And Health Services - Rajasthan

34045858 rate contract for medicine for mndy 2 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 4ml amp ( 10 ampoules ) 2 4 bupivacaine inj ip 0.5% 20 ml vial 3 6 halothane bp 250 ml in amber colour bottle 4 7 isoflurane usp 100 ml bottle 5 8 ketamine inj ip 50 mg / ml 10 ml vial 6 9 lignocaine ointment 5 o / o 10 gm tube in unit carton 7 10 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 30 ml vial 8 12 lignocaine gel ip 2% 30gm tube in a unit carton 9 13 lignocaine inj ip 2 o / o 30 ml vial 10 14 propofol inj ip 10 mg / ml 20 ml vial / ampoule 11 15 thiopentone inj ip 0.5 g vial 12 491 sevoflurane 250 ml bottle 13 654 atropine sulphate injection 0.6mg / ml 1ml amp 25 ampoules 14 799 liquid medical oxygen ( lmo ) rc not exists 15 19 diclofenac sodium inj ip 25 mg / ml ( im / iv use ) 3 ml amp ( 10 amp ) 16 20 diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) 10x10 tab strip / blister 17 21 fentanyl citrate injection ip 2 ml 2 ml amp 10 ampoules 18 22 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 10x10 tab blister 19 23 ibuprofen tab ip 200 mg ( coated ) 10x10 tab blister 20 24 ibuprofen tab ip 400 mg ( coated ) 10x10 tab blister 21 25 morphine sulphate inj ip 10mg / ml 1 ml 10 ampoules 22 26 paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 23 27 paracetamol syrup ip 125 mg / 5ml ( detail in rc ) 60 ml bottle ( with measuring cap ) 24 28 paracetamol tab ip 500 mg 10x10 tab blister 25 29 paracetamol inj. 150 mg / ml 2 ml amp 50 ampoules 26 30 pentazocine inj ip 30mg / ml ( im / iv use ) 1ml amp 25 ampoules 27 32 tramadol cap ip 50 mg 10x10 cap strip / blister 28 33 tramadol inj 50 mg / ml 2 ml amp 10 ampoules 29 436 indomethacin cap ip 25 mg 10x10 cap strip 30 437 diclofence prolonged release tablet ip 100 mg 10x10 tab strip 31 477 ibuprofen oral suspension bp / usp 100 mg / 5 ml 60 ml bottle ( with measuring cap ) 32 483 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 10x10 tab blister 33 492 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 10x10 tab blister 34 493 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 20 gm tube in unit carton 35 495 etoricoxib tab ip 120mg 10x10 tab blister 36 496 mefenamic acid tablets bp 500 mg 10x10 tablets 37 655 fentanyl citrate injection 50mcg / ml 10ml vial / amp 38 656 naproxen tablet ip 500mg 10x10 tab blister 39 657 naproxen tablet ip 250mg 10x10 tab blister 40 658 etoricoxib tablet ip 90 mg 10x10 tablets 41 679 aspirin tablet ip ( gastro resistant ) 150 mg 14x10 tablet 42 695 diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use 1 ml. ampoule 43 696 paracetamol infusion ip 1% w / v 100ml size 100 ml bottle 44 697 ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) 10x10 tablets 45 698 baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) 10x10 tablets 46 699 tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) 10x10 tablets 47 34 adrenaline injection ip 1mg / ml im / iv use 1ml amp ( ambercolor ) 25 amp 48 35 betamethasone tab ip 0.5mg 10x10 tab blister 49 37 chlorpheniramine maleate tab ip 4mg 10x10 tab strip / blister 50 39 dexamethasone inj ip 8mg / 2ml 2 ml vial ( usp type i vial ) 51 40 dexamethasone tab ip 0.5 mg 10x10 tab strip 52 42 hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) vial 53 43 hydroxyzine tab ip 25 mg 10x10 tab strip / blister 54 44 methyl prednisolone sodium succinate for injection usp 500 mg vial 55 45 pheniramine inj ip 22.75mg / ml 2 ml amp 25 ampoules 56 47 prednisolone tab ip 5 mg 10x10 tab strip / blister 57 48 promethazine syrup ip 5 mg / 5ml 60 ml bottle ( with measuring cap ) 58 49 promethazine inj ip 25mg / ml 2 ml amp ( amber color ) ( 10 ampoules ) 59 50 promethazine tab ip 25 mg 10x10 tab strip 60 418 betamethasone sod phos inj ip 4mg / ml 1 ml ampoule / vial 61 469 prednisolone tablet ip 10 mg 10x10 tab strip / blister 62 470 prednisolone tab ip 20 mg 10x10 tab strip / blister 63 497 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg rc not exists 64 498 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab 10x10 tablets 65 499 cetirizine syrup ip 5mg / 5 ml 30 ml bottle with measuring cap 66 659 levoceitrizine tablet 5mg 10x10 tablets 67 660 montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 10x10 tablet blister / strip / alu alu pack 68 700 dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) 10x10 tablets 69 51 naloxone inj ip 0.4mg / ml 1 ml 10 ampoules 70 52 pralidoxime chloride injection ip 25 mg / ml / 500 mg vial 71 500 acetylcystine solution usp ( injection ) 200 mg / ml 2 ml ampoule ( 5 ampoules ) 72 53 carbamazepine tab ip 200 mg 10x10 tab strip / blister 73 54 carbamazepine tab ip 100 mg 10x10 tab strip / blister 74 56 phenobarbitone tab ip 30 mg 10x10 tab strip 75 57 phenytoin injection bp 50mg / ml 2 ml amp ( amber colour ) ( 25 ampoules ) 76 58 phenytoin oral suspension ip 25mg / ml 100 ml bottle ( with measuring cap ) 77 59 phenytoin tab ip 100 mg ( film coated ) 10x10 tab strip 78 61 sodium valproate gastro resistant tablets ip 200 mg 10x10 tab strip 79 420 phenobarbitone inj ip 200mg / ml 1 ml ampoule / vial 80 474 carbamazepine oral suspension usp 100 mg / 5ml 100 ml bottle ( with measuring cap ) 81 479 sodium valproate oral solution ip 200 mg / 5 ml 100 ml bottle ( with measuring cap ) 82 661 sodium valproate tablet ( gastro resistant ) ip 500mg 10x10 tab strip 83 662 clobazam tablet / capsule 5 mg 10x10 tablet / capsule blister 84 663 clobazam tablet / capsule 10 mg 10x10 tablet / capsule blister 85 664 levetiracetam tablet ip 500 mg 10x10 tab blister 86 665 levetiracetam oral solution / suspension 100mg / ml 100ml 87 666 levetiracetam injection 500mg / 5ml vial 88 667 gabapentine tablet / capsule 100mg 10x10 tablet / capsule blister / strip 89 668 gabapentine tablet / capsule 300mg 10x10 tablet / capsule blister / strip 90 701 lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) rc not exists 91 702 divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) 10x10 tablets 92 703 oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) 10x10 tablets 93 704 lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 10x10 tablets 94 705 topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) 10x10 tablets 95 62 acyclovir oral suspension ip 400mg / 5ml 60 ml bottle ( with measuring cap ) 96 63 acyclovir tab ip 200 mg 10x10 tab blister 97 64 acyclovir tab ip 800 mg 10x10 tab strip 98 65 albendazole oral suspension ip 400 mg / 10ml 10 ml bottle 99 66a albendazole tablets ip 400 mg ( detail in rc ) 10*10*1 tablet strip / blister 100 67 amikacin inj ip 100 mg 2 ml vial 101 68 amikacin inj ip 500 mg 2 ml vial 102 69 amoxycillin and cloxacillin cap 250 + 250 mg 10x10 cap strip 103 70 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg rc not exists 104 71 amoxycillin cap ip 250mg 10x10 cap strip / blister 105 72 amoxycillin cap ip 500mg rc not exists 106 73 amoxycillin dispersible tablets ip 125 mg 10x10 tab strip 107 74 amphotericin b inj ip 50 mg vial 108 75 ampicillin injection ip 500 mg vial 109 78a azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 110 79a azithromycin tablets ip 250mg 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 111 80a azithromycin tab ip 500 mg no. 112 81 benzathine benzylpenicillin inj ip 12 lac units rc not exists 113 82 benzathine benzylpenicillin inj ip 6 lac units rc not exists 114 84 cefixime tab ip 100 mg / cefixime dispersible tab ip 100 mg 10x10 tab strip 115 85 cefixime tab ip 200 mg rc not exists 116 86 cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) rc not exists 117 87 cefotaxime injection ip 1 g rc not exists 118 88 cefotaxime inj ip 250 mg vial 119 89 ceftazidime inj ip 1g vial 120 90 ceftazidime inj ip 250 mg vial 121 91 ceftazidime inj ip 500 mg vial 122 93 ceftriaxone inj ip 1g / vial vial ( packed in monocarton ) 123 94 ceftriaxone inj ip 250 mg / vial vial ( amber colour ) 124 95 ceftriaxone inj ip 500mg / vial vial ( packed in monocarton ) 125 96 cephalexin cap ip 250 mg 10x10 cap blister 126 97 cephalexin cap ip 500 mg rc not exists 127 98 chloroquine phosphate inj ip 40 mg / ml 5 ml amp ( 25 amp ) 128 99 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 10x10 tab strip / blister 129 100a chloroquine phosphate suspension ip 50 mg / 5ml 60 ml bottle ( with measuring cap ) 130 101 ciprofloxacin injection ip 200mg / 100ml 100 ml ffs / bfs bottle 131 102 ciprofloxacin tablets ip 250 mg film coated rc not exists 132 103 ciprofloxacin tablet ip 500 mg film coated rc not exists 133 104 clotrimazole cream ip 2% w / w 15gm tube in a unit carton 134 105 clotrimazole vaginal tab ip 500mg single tablet ( 10 tabs with an applicator ) 135 107 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 50 ml bottle ( with measuring cap ) 136 108 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 10x10 tab blister 137 110 diethylcarbamazine tab ip 100 mg 10x10 tab blister 138 111 doxycycline cap ip 100 mg 10x10 cap strip / blister 139 114a fluconazole tablets ip 150mg 10*10*1 tab strip ( perforated ) 140 116 gentamycin injection ip 80mg / 2ml ( im / iv use ) 2 ml amp 50 ampoules 141 117 griseofulvin tab ip 125 mg rc not exists 142 118 itraconazole cap 100 mg 10x4 cap strip 143 119 meropenem inj ip 500 mg vial 144 120 metronidazole inj ip 500 mg / 100ml 100 ml ffs / bfs bottle 145 121 metronidazole benzoate oral suspension ip 100 mg of base / 5ml 60 ml bottle ( amber colour ) with measuring cap 146 122 metronidazole tablets ip 200 mg ( film coated ) 10x10 tab blister 147 123 metronidazole tablets ip 400 mg ( film coated ) rc not exists 148 124 norfloxacin tab ip 400mg film coated 10x10 tab blister 149 125 ofloxacin tab ip 200 mg 10x10 tab blister 150 128 primaquine tab ip 2.5 mg 10x10 tab strip / blister 151 129 primaquine tab ip 7.5 mg 10x10 tab strip / blister 152 131 quinine dihydrochloride inj ip 300 mg / ml 2 ml amp 25 ampoules 153 132 quinine sulphate tablets ip 300 mg ( film coated ) 10x10 tab blister 154 412 ampicillin cap ip 500mg rc not exists 155 413 nitrofurantoin tab ip 100mg 10x10 tab blister 156 417 cloxacillin sodium inj ip 500mg vial 157 427 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 30 ml bottle with measuring cap 158 428 ofloxacin oral suspension ip 50mg / 5ml 30 ml. bottle 159 430 tinidazole tab ip 300 mg ( film coated ) 10x10 tab blister 160 431 tinidazole tab ip 500 mg ( film coated ) 10x10 tab blister 161 468 piperacillin + tazobactum for injection ip 4gm+500mg vial 162 473 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml 30 ml bottle with measuring cap 163 475 cefpodoxime dispersible tab 50 mg 10x10 tab strip 164 476 cephalexin tablets 125 mg ( dispersible tablets ) 10x10 tab strip 165 481 meropenem inj. ip 1gm vial 166 502 acyclovir intravenous infusion ip 250mg vial 167 503 acyclovir intravenous infusion ip 500mg vial 168 504 amikacin inj ip 250 mg vial 169 505 amoxicillin and potassium clavulanic ip inj 600mg 10 ml vial 170 506 amoxicillin and potassium clavulanate inj ip 1.2gm vial 171 507 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) 30 ml bottle with measuring cap 172 508a artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) each combo pack in a unit carton 173 509 aztreonam injection usp 500 mg rc not exists 174 510 cefepime injection ip 500 mg vial 175 511 cefixime oral suspension ip 25mg / ml ( paediatric drops ) 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 176 512 cefuroxime axetil tab ip 250 mg 10x10 tab strip 177 513 clindamycin capsule ip 150mg 10x10 cap strip / blister 178 514 clindamycin capsule ip 300 mg 10x10 cap strip / blister 179 515 levofloxacin tablets ip 250 mg rc not exists 180 516 linezolid tablets ip 600 mg 10x10 tablets 181 517 linezolid inj 200mg / 100ml 100ml 182 518 mefloquine tablets ip 250 mg 10x6 tablet blister 183 520 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 10x10 tab blister 184 521 ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) 100 ml bottle 185 523 vancomycin for intravenous infusion ip 500 mg vial 186 524 vancomycin for intravenous infusion ip 1 gm vial 187 651 artemether and leumefantrine tablet ( 80 mg and 480 mg ) 1x6 tablet blister 188 669 co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) 10x10 tablets 189 683 aztreonam injection 1gm vial 190 684 framycetin sulphate cream 1 o / o 30gm pack 30gm pack 191 685 framycetin sulphate cream 1 o / o 100 gm pack 100gm pack 192 686 artemether and leumefantrine tablet ( 40 mg and 240 mg ) 1x6 tablet blister 193 706 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg rc not exists 194 707 piperacillin injection 2 gm + tazobactom 250mg ip rc not exists 195 708 ceftriaxone 1 gm + tazobactum 125 mg injection vial 196 709 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) 10x10 tablets 197 710 cefadroxil tablet 500 mg rc not exists 198 711 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size rc not exists 199 712 levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 10x10 tablets 200 713 faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) 10x10 tablets 201 714 clindamycin phosphate injection ip 300 mg vial / ampoules 202 715 imipenem + cilastatin injection 500mg / 500mg ip powder for solution vial 203 716 polymixin sulphate b injection usp 5 lac i.u. vial 204 717 meropenem injection ip 250 mg rc not exists 205 718 colistimethate injection ip 1m iu powder for solution vial 206 720 voriconazole injection 200mg / vial vial 207 721 terbinafine hydrochloride tablet 250 mg 10x10 tablets 208 722 valganciclovir tablet 450 mg 10x10 tablets 209 723 entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) 10x10 tablets 210 724 ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) vial 211 133 azathioprine tab ip 50 mg 10x10 tab strip 212 134 bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) vial 213 136 chlorambucil tab ip 5 mg rc not exists 214 137 cisplatin inj ip 50 mg / 50 ml 50 ml vial 215 138 cyclophosphamide inj ip 200 mg 10 ml glass vial 216 139 cyclophosphamide inj ip 500 mg 25ml glass vial 217 141 cytarabine injection bp 500mg 5 ml vial 218 142 danazol cap ip 50 mg 10x10 cap blister 219 143 daunorubicin inj ip 20 mg 10 ml glass vial 220 144 doxorubicin inj ip 50 mg / 25 ml vial 221 146 etoposide inj ip 100 mg 5 ml glass vial 222 148 fluorouracil inj ip 250 mg / 5ml 5 ml ampoule 223 149 l asparaginase inj 10000 iu vial 224 150 leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml 5 ml vial 225 151 melphalan tab ip 5 mg 25 tab bottle 226 152 mercaptopurine tab ip 50 mg 10x10 tab strip 227 153 methotrexate inj ip 50 mg / 2 ml rc not exists 228 154 methotrexate tab ip 2.5 mg 10x10 tab strip 229 155 paclitaxel inj ip 260 mg 43.4 ml vial 230 156 paclitaxel inj ip 100 mg 16.7 ml vial 231 157 tamoxifen tab ip 10 mg 10x10 tab strip 232 158 vinblastine inj ip 10mg / 10ml vial 233 159 vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) vial / ampoules 234 525 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million vial 235 526 carboplatin injection ip 150 mg 15 ml vial 236 527 carboplatin injection ip 450 mg 45 ml vial 237 528 cisplatin inj ip 10 mg / 10 ml 10 ml vial 238 529 dacarbazine injection 500 mg usp / bp rc not exists 239 530 filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 pre filled syringe / vial 240 531 gemcitabine for injection 200 mg vial 241 532 gemcitabine for injection ip 1gm vial 242 533 ifosfamide injection ip / bp / usp 1gm vial 243 534 imatinib tab ip 400mg 10x10 caps / tab 244 536 methotrexate tablets ip 10 mg 10x10 tab strip 245 538 oxaliplatin injection usp 50 mg 25 ml vial 246 677 cyclosporin capsule usp / ip 50 mg 50 caps pack 247 726 bendamustine injection 100 mg vial 248 727 capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) 10x10 tablets 249 728 letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) 10x10 tablets 250 729 temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) strip of 5 cap / bottele of 5 cap 251 730 bortezomib injection 2mg vial 252 731 abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) bottle of 30 tablets 253 733 thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) 10x10 cap strip / blister 254 734 bevacizumab injection 400 mg vial 255 735 bevacizumab injection 100 mg vial 256 736 cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 10x10 tablets 257 737 gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) 10x10 tablets 258 738 mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) 10x10 caps / tab 259 739 tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) 10 x 10 capsule 260 740 mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) 10x10 tablets 261 741 bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) 10x10 tablets 262 742 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) rc not exists 263 743 zoledronic acid injection ip 4mg vial vial 264 797 dasatinib tab 100 mg 60 tablet 265 160 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg rc not exists 266 161 levodopa and carbidopa tab 250 mg+ 25 mg rc not exists 267 162 trihexyphenidyl hcl tab ip 2 mg 10x10 tab blister 268 540 bromocriptine tablets ip 2.5 mg 10x10 tab strip 269 163 acenocoumarol tab ip / nicoumalone tab ip 2 mg 10x10 tab strip 270 165 deferasirox tab 100 mg 30 tablets 271 166 deferasirox tab 500 mg 30 tablets 272 167 deferiprone cap 250 mg 50 caps 273 168 deferiprone cap 500 mg 50 caps 274 169 desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) vial 275 171 dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) vial with diluent 276 172 enoxaparin sodium inj ip 60 mg vial / pfs 277 173 ethamsylate inj 250 mg / 2ml ( im / iv ) 2 ml amp 10 ampoules 278 174 heparin sodium inj ip 5000 iu / ml ( im / iv use ) 5 ml vial 279 175 human albumin solution ip 20% 100 ml bottle 280 176 rh erythropoetin inj ip 10000 iu vial / pfs 281 177 rh erythropoetin inj ip 2000iu vial / pfs 282 179 rh erythropoetin inj 4000 iu vial / pfs 283 180 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 1ml amp ( ambercolor ) 25 amp 284 405 polygeline 3.5% solution with electrolytes for i.v. infusion rc not exists 285 406 factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) 500 iu vial with solvent 286 407 anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) vial with 20ml solvant 287 416 hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 500 ml plastic bottle / 500 ml free flex 288 545 tranexamic acid tablets ip 500 mg 10x6 tablet blister 289 546 warfarin sodium. tab ip 5mg 10x10 tablets 290 644 vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) each pack along with syringe in a unit carton 291 688 dried factor viii fraction ip ( iv use ) 500 iu / vial vial with diluent 292 689 dried factor viii fraction ip ( iv use ) 1000 iu / vial rc not exists 293 690 recombinant coagulation factor viia 1mg vial 294 691 recombinant coagulation factor viia 2mg vial 295 745 ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) rc not exists 296 746 feracrylum 1% w / v sterile solution 100 ml 100ml 297 747 tranexamic acid injection ip 100mg / ml 5ml size 5ml vial / amp 298 748 recombinant f ix 500 iu with diluent vial with diluent 299 749 3rd generation recombinant f viii 250 iu with diluent vial with diluent 300 750 3rd generation recombinant f viii 1000 iu with diluent vial with diluent 301 181 amiodarone tab ip 100 mg 10x10 tablets 302 182 amiodarone tab ip 200 mg 10x10 tab strip 303 183 amiodarone hydrochloride inj 50 mg / ml 3 ml amp ( 10 amp ) 304 184 amlodipine tab ip 2.5 mg 10x10 tab strip / blister 305 185 amlodipine tablets ip 5 mg 10x10 tab blister 306 186 atenolol tab ip 50 mg 10x14 tab blister 307 187 atorvastatin tab ip 10mg 10x10 tab strip / blister 308 188 clopidogrel tab ip 75 mg 10x10 tab strip 309 189 digoxin inj ip 0.25 mg / ml rc not exists 310 190 digoxin tab ip 0.25 mg. 10x10 tab strip 311 191 diltiazem tabs ip 30 mg film coated 10x10 tab blister 312 192 dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) 10 vial / amp 313 193 dopamine hydrochloride inj ip 40 mg / ml 5 ml amp ( amber colour ) 25 ampo 314 194 enalapril maleate tab ip 5mg 10x10 tab strip 315 195 enalapril maleate tab ip 2.5mg 10x10 tab strip 316 197 isosorbide dinitrate tab ip 5 mg 10x10 tab blister 317 198 isosorbide mononitrate tabs ip 20 mg 10x10 tab strip 318 199 lisinopril tab ip 5 mg 10x10 tab strip 319 200 losartan tab ip 50 mg 10x10 tab strip 320 201 magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) 2 ml amp 25 ampoules 321 202 methyldopa tab ip 250mg film coated rc not exists 322 203 nifedipine cap ip 5mg 10x10 cap strip 323 204 nifedipine tablets ip 10 mg ( sustained release ) 10x10 tab blister 324 205 nitroglycerin inj 5 mg / ml 5 ml amp ( 10 ampoules ) 325 207 propranolol tab ip 40 mg 10x10 tab strip / blister 326 209 streptokinase injection 15 lac units ip vial 327 211 verapamil tab ip 40 mg film coated 10x10 tab strip 328 410 labetalol tab ip 100mg 10x10 tab blister 329 411 labetalol hcl inj ip 20mg / 4ml 4 ml ampules 330 444 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 10x14 tab strips 331 457 amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) 10x10 tab strip 332 458 losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) 10x10 tab strip / blister 333 459 losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) 10x10 tab blister 334 460 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg 10x10 tab strip / blister 335 461 amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) 10x10 tab blister 336 462 atenolol tab ip 25 mg 10x14 tab blister 337 463 enalapril maleate tablets ip 10 mg 10x10 tab strip 338 465 lisinopril tablets ip 10 mg 10x10 tab strip / blister 339 466 lisinopril tab ip 2.5 mg 10x10 tab strip / blister 340 467 losartan tab ip 25 mg 10x10 tab blister 341 547 adenosine injection ip 6 mg / 2ml 2ml vial / ampoule 342 548 atorvastatin tablets ip 40 mg 10x10 tablets 343 549 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 10x10 tab strip 344 550 fenofibrate capsules / tab ip 200 mg 10 x 10 capsule 345 551 isoprenaline injection ip 2mg / ml rc not exists 346 552 metoprolol tablets ip 25 mg 10x10 tablets 347 553 metoprolol succinate extended release tablets ip 50 mg 10x10 tablets 348 554 noradrenaline injection ip 2 mg / ml 2ml vial / ampoule 349 555 prazosin tablets ( extended release ) 2.5 mg 10x15 tablet strip / blister 350 556 telmisartan tablets ip 40 mg 10x10 tablets 351 557 urokinase injection 5 lac unit ( lyophilized ) rc not exists 352 636 ramipril tablets ip 2.5 mg 10x10 tablets 353 650 glyceryl trinitrate tablets 2.6 mg controlled release tablets 30 tab bottles 354 751 clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) 10x10 tablets 355 752 sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) 10x10 tablets 356 753 esmolol hydrochloride injection 10mg / ml 10ml size 10 ml vial 357 754 sodium nitroprusside injection 25mg / ml 2ml size 2ml vial / ampoule 358 755 carvedilol tablet 3.125 mg 10x10 tablets 359 756 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 10x10 tablets 360 757 rosuvastatin tablet 10 mg 10x10 tablets 361 758 sacubitril 24 mg and valsartan 26 mg tablet 14x2 tablets 362 580 chlorhexidine mouthwash ip 0.2 o / o 50 ml bottle 363 581 dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) 10 gm tube 364 582 tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) 50 gm tube in unit carton 365 583 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 15 ml squeeze vial 366 584 metronidazole 1% and chlorhexidine gluconade 0.25% gel 10 gm tube in unit carton 367 106 compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o 15gm tube in mono carton 368 213 acyclovir cream 5% 5 gm tube in unit carton 369 215a cetrimide cream ip 15 gm 15gm tube in a unit carton 370 216a fusidic acid cream ip 2% 10gm tube in mono carton 371 217 glycerin ip 400 gm rc not exists 372 218 liquid paraffin ip 400 ml 400 ml bottle 373 220 miconazole nitrate cream ip 2% 15gm tube in a unit carton 374 221 povidone iodine ointment 5% 15 gm rc not exists 375 223 neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) 10 gm plastic bottle with nozzle to sprinkle powder 376 224 silver sulphadiazine cream ip 1% 50gm tube 50 gm tube 377 246 gentian violet topical solution usp 1o / o 200 ml bottle 378 443 clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) 15 ml squeeze bottle 379 445 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) 10 gm tube in unit carton 380 446 gamma benzene hexachloride lotion 1% ( lindane lotion usp ) 100 ml bottle 381 558 betamethasone dipropionate cream ip 0.05% 15gm tube in a unit carton 382 559 betamethasone lotion ip 0.05 o / o 50ml 383 560 clindamycin phosphate gel usp 1 o / o 20gm tube in mono carton 384 561 clobetasol propionate cream ip 0.05 o / o 20 gm tube 385 564 glycerin ip 100 ml rc not exists 386 565 ketoconazole cream 2% 15gm tube in mono carton 387 568 permethrin lotion 5% 30 ml 388 569 permethrin cream 5% 30gm tube in a unit carton 389 570 tretenoin cream usp 0.025% 20 gm tube in unit carton 390 670 coal tar 6% & salicylic acid 3% ointment 20gm 391 671 calamine lotion ip 100ml 100 ml bottle 392 759 powder clotrimazole 1% w / w 30 gm 30 gm bottle 393 760 terbinafine cream 1%w / w ( 10 gm tube ) 10 gm tube 394 761 olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size 5ml bottle 395 762 oitment mupirocin ip 2% 5 gm tube 396 225 anti a blood grouping serum ip ( anti a monoclonal serum ) 10 ml vial 397 226 anti b blood grouping serum ip ( anti b mono clonal serum ) 10 ml vial 398 227 anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip 10 ml vial 399 232 diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) 20 ml vial / ampoule 400 233 diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) 20 ml ampoule 401 235 gadodiamide inj. 0.5mml / ml vial 10 ml vial 402 242 vdrl antigen ( with + ve and ve control ) / rpr slide kit 100 test kits 403 482 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 20 ml pack 404 672 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. 50 ml pack 405 801 multistix test strip each piece 406 222 povidone iodine solution ip 5 % 500 ml 500 ml bottle 407 244 compound benzoin tincture ip 500 ml bottle 408 245 formaldehyde solution ( 34.5 per. 38 per. ) rc not exists 409 247 gluteraldehyde solution 2% 5 ltrs can 410 248 hydrogen peroxide solution ip 6 o / o ( 20 vol ) rc not exists 411 249 lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) 5 ltrs can 412 250 povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 500 ml bottle 413 252 surgical spirit ip ( 500 ml ) 500 ml opaque white bottle with inner cap 414 447 chlorhexidine gluconate solution 5% 250 ml 250 ml bottle 415 449 surgical spirit ip ( 100 ml ) 100ml opaque white bottle with inner cap 416 450 povidone iodine solution ip 5% 100ml bottle 100 ml bottle 417 571 povidone iodine ointment usp 250 gm rc not exists 418 572 povidone iodine solution ip 10 % 100 ml bottle 419 573 silver sulphadiazine cream ip 1% 500 gm jar 500 gm jar 420 253 acetazolamide tab ip 250mg 10x10 tab blister 421 254 frusemide tab ip 40 mg 10x10 tab strip 422 255 furosemide injection ip 10mg / ml ( im and iv use ) 2 ml ampoule 423 256 hydrochlorthiazide tab ip 12.5 mg 10x10 tab strip 424 257a mannitol inj ip 20% w / v 100 ml ffs / bfs bottle 425 258 spironolactone tab ip 25mg 10x10 tab blister 426 259 torsemide tab 10 ip mg 10x10 tab strip / blister 427 464 hydrochlorthiazide tab ip 25mg 10x10 tab strip 428 574 spironolactone tablets ip 50 mg 10x10 tablets 429 585 ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp / ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o eye drops / ear drops 5 ml. vial with sterilized dropper, or squeeze vial 430 586 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 5 ml ear drops 431 588 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 5 ml vial / bottle with a seperate dropper 432 589 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o 10ml bottle / vial ( with a seperate dropper which should be able to screw&cap the bottle ) in unit carton 433 5 drotaverine hydrochloride inj 40 mg / 2 ml 2 ml amp 10 ampoules 434 219 ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o 15gm tube in a unit carton 435 260a antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 10x10 tab blister 436 261a antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 60 ml bottle ( with measuring cap ) 437 262 bisacodyl tab ip 5 mg 10x10 tab strip 438 263 dicyclomine tab ip 10 mg 10x10 tab strip / blister 439 264 dicyclomine inj ip 10 mg / ml 2 ml amp 25 ampoules 440 265 dicyclomine hydrochloride oral solution ip 10mg / 5ml 30 ml bottle with measuring cap 441 266 domperidone suspension ip 5mg / 5ml rc not exists 442 267 domperidone tab ip 10 mg 10x10 tab blister 443 268 hyoscine butylbromide inj ip 20 mg / ml 1ml amp 25 ampoules 444 269 loperamide tab ip 2 mg 10x10 tab strip 445 270 metoclopramide inj ip 10mg / 2ml 2 ml amp 25 ampoules 446 271 metoclopramide tab ip 10 mg 10x10 tab blister 447 272 omeprazole cap ip 20 mg 10x10 cap strip / blister 448 273 ondansetron inj ip 2mg / ml 2 ml amp 10 ampoules 449 274 ors powder ip pouches 20.5 gms 450 275 pentoprazole inj 40 mg vial 451 276 ranitidine hcl injection ip 50mg / 2ml 2 ml amp ( amber colour ) ( 25 ampoules ) 452 277 ranitidine tab ip 150mg film coated rc not exists 453 278 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o 100 ml polypropylene pack 454 414 hyoscine butyl bromide tablets ip 10mg 10x10 tab blister 455 415 drotaverine tab ip 40 mg 10x10 tab blister 456 433 ranitidine tab ip 300mg film coated 10x10 tab strip 457 438 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 458 439a dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 10x10 tab blister 459 478 metoclopramide hydrochloride syrup ip 5 mg / 5ml 30 ml bottle ( with a seperate dropper which should be able to screw & cap the bottle ) in unit carton 460 590 domperidone oral drops 10mg / ml ( 10ml ) 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 461 591 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 10x10 tablets 462 592 lactic acid bacillus tab 60 million spores 10x10 tablets 463 593 lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml 100 ml bottle ( with measuring cap ) 464 594 liquid paraffin ip 100 ml 100 ml bottle 465 595 ondansetron orally disintegrating tablets ip 4mg 10x10 tab strip 466 596 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 10x10 cap strip 467 597 ursodeoxycholic acid tablets ip 300 mg 10x10 tab strip / blister 468 763 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 10x10 tablets 469 765 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) 1 gm each sachet 470 766 mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) 10x10 tablets 471 598 allopurinol tablets ip 100 mg 10x10 tablets 472 599 hydroxychloroquine sulphate tablets 200mg 10x10 tablets 473 600 leflunomide tablets ip 10mg ( film coated ) 10x10 tablets 474 601 leflunomide tablets ip / usp 20mg ( film coated ) 10x10 tablets 475 602 sulfasalazine gastroresistant tablets ip 500 mg ip 10x10 tablets 476 279 biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) 10 ml vial 477 280 carbimazole tabs ip 5 mg ( film coated ) 10x10 tab blister 478 281 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 1 ml amp / vials ( 25 ampoule / vial ) 479 282 clomifene tab ip 25 mg 10x10 tab strip 480 283 clomiphene tab ip 50 mg 10x10 tab strip 481 284 conjugated estrogen tabs usp 0.625 mg. rc not exists 482 285 dinoprostone cream / gel 0.5 mg dinoprostone in syringe syringe 483 286 ethinyloestradiol tabs ip 50 mcg 10x10 tab strip 484 287 glibenclamide tab ip 5 mg 10x10 tab strip / blister 485 288 gliclazide tab ip 40 mg 10x10 tab strip / blister 486 289 glimepiride tab ip 2 mg 10x10 tab strip / blister 487 290 glimepiride tab ip 1mg 10x10 tab strip / blister 488 291 glipizide tab ip 5mg 10x10 tab blister 489 293 hydroxyprogesterone inj ip 250mg / ml 1ml amp 25 ampoules 490 294 isophane insulin inj ip 40 iu / ml 10 ml vial 491 295 metformin tab ip 500 mg 10x10 tab blister 492 296 norethisterone tab ip 5 mg 10x10 tab strip 493 297 pioglitazone tab ip 15 mg 10x10 tab blister 494 298 progesterone inj 200 mg / 2ml 2 ml amp 10 ampoules 495 300 insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna 10 ml vial 496 301 thyroxine sodium tablets ip 100mcg 100 tablet in a bottle 497 451 metformin hydrochloride ( sustained release tablets ip 1000 mg 10x10 tab blister 498 452 glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) 10x10 tab blister 499 453 glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) 10x10 tab blister 500 454 metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg 10x10 tab blister 501 455 metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) 10x10 tab blister 502 456 glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 10x10 tab blister 503 603 gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) 10x10 tablets 504 604 glucagon for injection usp 1 mg / ml vial 505 605 medroxyprogesterone acetate tablets ip 10 mg 10x10 tablets 506 607 thyroxine tablets ip 50 mcg 100 tablet in a bottle or 10x10 tablet 507 608 octreotide injection 50 mcg / ml 1 ml. ampoule 508 680 insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges 3ml vial 509 682 tenaligliptin tablet ip 20mg 10x10 tablet blister / alu alu pack 510 693 insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle 10 ml vial 511 303 human anti d immunoglobulin injection 300mcg ( im use ) pre filled syringe / vial 512 304 human anti d immunoglobulin 150 mcg pre filled syringe / vial 513 305 human rabies immunoglobulin inj 150 iu / ml rc not exists 514 306 rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu 1 ml vial with 1.0 ml diluent 515 307 rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose single tablet ( 10 tabs with an applicator ) 516 308 snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) vial 517 309 tetanus immunoglobulin ip 250 iu / vial vial / ampoules 518 310 tetanus vaccine ( adsorbed ) ip 5 ml vial rc not exists 519 408 rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) 5 ml vial 520 480 diphtheria antitoxin 10000 iu vial 521 767 hepatitis b immunologlobin injection ip 200 i.u vial / pfs 522 798 human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) 10ml vial ( 0.5gm ) 523 311 atracurium inj 10 mg / ml 2.5 ml amp ( 10 ampoules ) 524 312 glycopyrrolate inj ip 0.2 mg / ml 1 ml amp ( 10 amp ) 525 313 midazolam inj ip 1 mg / ml 5 ml vial 526 314 neostigmine inj ip 0.5 mg / ml 1 ml 10 ampoules 527 317 succinylcholine inj. ip 50 mg / ml ( iv use ) 10 ml vial 528 318 valethamate bromide inj 8mg / ml rc not exists 529 419 vecuronium bromide for injection 4mg ( freeze dried ) each vial / ampoule 530 610 chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) 10x10 tablets 531 638 neostigmine injection ip 2.5mg / 5ml 5 ml amp ( 10 ampoules ) 532 768 cis atracurium besylate injection 2 mg / ml in 5 ml vial 5 ml vial 533 241 tropicamide eye drop ip 1o / o 5 ml. vial with sterilized dropper, or squeeze vial 534 319 atropine eye ointment ip 1% rc not exists 535 320 atropine sulphate ophthalmic solution usp 1% 5 ml. vial with sterilized dropper, or squeeze vial 536 321 chloramphenicol eye drops ip 0.5 0 / 0 5 ml. vial with sterilized dropper, or squeeze vial 537 322 ciprofloxacin eye drops ip 0.3 o / o w / v 5 ml squeeze vial 538 323 ciprofloxacin ophthalmic ointment usp 0.3% 5 gm tube in unit carton 539 324 hydroxypropylmethyl cellulose solution 20 mg / ml rc not exists 540 330 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o 5ml vial with sterilized dropper packed in seperate polythene pack 541 331 tobramycin eye drops 0.3% [ 331 ] 5 ml. vial with sterilized dropper, or squeeze vial 542 332 tobramycin ophthalmic ointment usp 0.3% rc not exists 543 421 flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v 5 ml squeeze vial 544 423 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. vial 545 424 lidocaine hcl topical solution usp 4% rc not exists 546 425 fluconazole eye drops 0.3% 5 ml. vial with sterilized dropper, or squeeze vial 547 484 timolol eye drops ip 0.5 o / o w / v 5 ml squeeze vial 548 485 homatropine eye drops ip 2% 5 ml squeeze vial 549 486 travoprost eye drops ip 0.004 o / o 3 ml squeeze vial 550 487 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5 ml squeeze vial 551 612 betaxolol eye drops 0.5 o / o rc not exists 552 613 carboxymethylcellulose eye drops ip 0.5% 10 ml squeeze vial 553 769 acyclovir eye ointment ip 3% w / w 5gm size 5 gm tube 554 770 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size 5 ml. vial with sterilized dropper, or squeeze vial 555 771 chloramphenicol 1% w / w eye ointment ip, 3gm size 3 gm tube 556 333 isoxsuprine inj ip 5 mg / ml 2 ml amp 10 ampoules 557 334 isoxsuprine tab ip 20 mg 10x10 tab strip 558 335 methylergometrine inj ip 0.2 mg / ml 1ml amp ( ambercolor ) 25 amp 559 336 methylergometrine tab ip 0.125 mg 10x10 tab strip 560 337 misoprostol tab ip 200 mcg 10x10 tablets 561 338 oxytocin inj ip 5 iu / ml 1 ml ampoule ( single unit in blister pack ) 562 615 mifepristone tab ip 200mg single tablet 563 772 natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 10x10 tablet / capsule blister / strip 564 773 cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 10x10 tablets 565 774 human chorionic gonadotropin injection ip 5000 i.u. vial 566 775 leurprolide acetate depot 3.75 mg vial 567 776 leurprolide acetate depot 11.25 mg vial 568 339 alprazolam tab ip 0.25 mg 10x10 tab strip / blister 569 340 alprazolam tab ip 0.5mg 10x10 tab strip / blister 570 341 amitriptyline tab ip 25mg film coated 10x10 tab strip 571 342 chlordiazepoxide tablets ip 10mg 10x10 tab strip 572 343 chlorpromazine tablets ip 100 mg ( coated tablet ) 10x10 tab strip 573 344 chlorpromazine tablets ip 25 mg ( sugar coated ) 10x10 tab strip 574 345 chlorpromazine tablets ip 50 mg ( coated tablets ) 10x10 tab strip 575 349 diazepam inj ip 10mg / 2ml ( 1m / iv use ) 2 ml amp 25 ampoules 576 350 diazepam tab ip 5 mg 10x10 tab strip / blister 577 351 escitalopram tab ip 10 mg 10x10 tab strip / blister 578 352 fluoxetine cap ip 20 mg 10x10 cap strip / blister 579 353 haloperidol inj ip 5 mg / ml 1 ml amp ( 10 amp ) 580 354 haloperidol tab ip 1.5 mg 10x10 tab strip 581 355 haloperidol tab ip 5 mg 10x10 tab strip 582 356 imipramine tab ip 25 mg ( coated tab ) 10x10 tab blister 583 357 imipramine tab ip 75 mg ( coated ) 10x10 tab blister 584 358 lithium carbonate tab ip 300 mg 10x10 tab strip 585 359 lorazepam inj ip 2 mg / ml 2 ml amp 25 ampoules 586 360 olanzapine tab ip 5 mg 10x10 tab strip 587 361 risperidone tab 2mg 10x10 tab strip / blister 588 362 risperidone tab 1 mg 10x10 tab strip / blister 589 363 sertraline tab ip 50 mg 10x10 tab strip / blister 590 364 trifluperazine tab ip 5 mg coated, 591 674 quetiapine tablet ip 50mg 10x10 tab blister 592 675 quetiapine tablet ip 25mg 10x10 tab blister 593 678 clonazepam tablet 0.5 mg 10x10 tablets 594 777 levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) 10x10 tablets 595 778 lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) 10x10 tablets 596 779 zolpidem tablet 5 mg 10x10 tablets 597 365 aminophylline inj ip 25 mg / ml 10 ml amp 25 ampoules 598 366 beclomethasone inhalation ip 200 mcg / dose 200metered dose container 599 367 budesonide nebulizer suspension 0.25mg / ml 2 ml amp 10 ampoules 600 368 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. 50 ml bottle ( with measuring cap ) 601 369 ipratropium bromide nebulizer solution 250 mcg / ml 15 ml glass bottle 602 370 salbutamol tablet ip 4 mg 10x10 tab strip / blister 603 371 salbutamol inhalation 100 mcg / dose 200metered dose container 604 372 salbutamol nebuliser solution bp 5 mg / ml 10 ml vial 605 373 salbutamol tab ip 2 mg 10x10 tab strip / blister 606 374 theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 2 ml amp 25 ampoules 607 375 theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) rc not exists 608 376 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) rc not exists 609 432 salbutamol syrup ip 2mg / 5ml 100 ml bottle ( with measuring cap ) 610 440 dextromethorphan hbr syrup ip 13.5mg / 5ml 30 ml. bottle 611 442 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 10 ml bottle with dropper / squeeze bottle 612 616 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 30 capsules 613 617 budesonide powder for inhalation 200 mcg 30 capsule ( rota caps ) 614 618 ipratropium powder for inhalation ip 40 mcg 30 capsule ( rota caps ) 615 619 terbutaline tablets ip 2.5 mg 10x10 tablets 616 620 xylometazoline nasal drops ip 0.1% 5ml vial / bottle ( with a seperate dropper ) in a unit carton 617 692 cough syrup / expectorant ( 50 ) ml 50 ml bottle ( with measuring cap ) 618 780 acebrophylline tablet / capsule 100 mg 10x10 tablets 619 377 compound sodium lactate inj. ip 500 ml ffs / bfs bottle 620 378 dextrose inj ip 25% w / v 100 ml ffs / bfs bottle 621 379 dextrose inj ip 10% 500 ml ffs / bfs bottle 622 380 dextrose inj ip 5% 500 ml ffs / bfs bottle 623 381 multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) 500 ml ffs / bfs bottle 624 382 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 500 ml ffs / bfs bottle 625 383 potassium chloride inj. 0.15 gm / ml 10 ml amp 10 ampoules 626 384 potassium chloride oral solution u.s.p 500mg / 5ml 200ml bottle ( amber color ) 627 385 sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 500 ml ffs / bfs bottle 628 386 sodium chloride inj ip 500 ml 500 ml ffs / bfs bottle 629 621 sodium chloride injection ip 100 ml 100 ml bottle 630 781 ringer acetate infusion 500 ml 500 ml bottle 631 782 sodium chloride 0.45% w / v polypack 500 ml 500 ml bottle 632 575 finasteride tablets ip 5 mg 10x10 tab strip / blister 633 576 tamsulosin hcl tablets / capsule 0.4 mg 10x10 tablet / cap strip 634 579 flavoxate tablets ip 200 mg ( coated tablet ) 10x10 tablets 635 783 savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) 10x10 tablets 636 784 sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) 10x10 tablets 637 785 levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) 10x10 tablets 638 787 dutasteride tablet 0.5 mg 10x10 tablets 639 788 alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) rc not exists 640 541 betahistine tab ip 8 mg 10x10 tablets 641 542 betahistine tab ip 16 mg 10x10 tablets 642 543 cinnarizine tablets ip 25 mg 10x10 tab blister 643 544 cinnarizine tablet ip 75 mg 10x10 tab blister 644 387 ascorbic acid tab ip 500 mg 10x10 tab strip 645 388 calcium gluconate inj ip 10% ( iv use ) rc not exists 646 390 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 10x10 tab strip / blister 647 391 ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 10x10 tab strip / blister 648 392 folic acid tab ip 5 mg 10x10 tab blister 649 393 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 650 394 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 10x10 tab strip / blister 651 395 vitamin b complex inj nfi 10 ml vial 652 397 vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) 10x10 tab strip / blister 653 409 vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu 100 ml bottle and spoon with marking 1 ml / 2ml in unit carton 654 441 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 100 ml bottle ( with measuring cap ) 655 448 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 100 ml bottle in a unit carton with a separate dropper ( details in rc ) 656 472 zinc sulphate dispersible tablets ip elemental zinc 10 mg 10x10 tab strip / blister 657 488 iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 5 ml ampoule ( amber colour ) 658 622 calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) 10x10 tablets 659 623 cholecalciferol granules 60, 000 iu / gm 1 gm sachet ( 50 sachets ) 660 624 mecobalamin inj 500 mcg / ml 1 ml. ampoule 661 627 pyridoxine tablet ip 40mg 10x10 tab strip 662 629 thiamine tablets ip 100 mg 10x10 tab strip 663 630 calcitriol capsules ip 0.25 mcg 10x10 cap strip / blister 664 652 methyl cobalmine tablet 500mcg 10x10 tab strip / blister 665 653 methyl cobalmine tablet 1500mcg 10x10 tab strip / blister 666 676 vitamin d3 oral solution 60000 iu 5ml glass bottle in unit carton 667 789 ferric carboxymaltose injection 50 mg / ml 10 ml size 10 ml vial 668 790 multi vitamin syrup 100ml 669 147 flunarizine tab 5 mg 10x10 tab blister 670 398 black disinfectant fluid ( phenyl ) as per schedule o grade iii 5 ltrs can 671 399 conc haemodialysis fluid b.p acetate concentrate 10 litre can rc not exists 672 401 peritonial dialysis solution ip 1000 ml ffs / bfs pack 673 402 sodium bicarbonate inj ip 7.5% w / v 10 ml amp 25 ampoules 674 404 water for inj ip rc not exists 675 631 alendronate sodium tablets usp / bp 35 mg 4 tablets ( 20 *4tablet ) 676 632 mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml ffs / bfs bottle 677 633 normal human intravenous immunoglobulin 5g / 100ml 100 ml vial 678 634 pregabalin cap ip 75 mg 10 x 10 capsule 679 635 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 4ml vial 680 687 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans rc not exists 681 791 intravenous fat emulsion 20% w / v 250ml 250 ml bottle 682 792 pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) 10x10 tablets 683 793 caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 3ml vial 684 794 amino acid 10% injection 100ml size 100 ml bottle 685 795 vitamin e capsule 400 mg 10x10 cap strip / blister 686 796 inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) 1.5ml vial 687 639 oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) strip / blister of 10 capsule 688 640 oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) strip / blister of 10 capsule 689 641 oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) strip / blister of 10 capsule 690 642 oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) 75 ml bottle with measuring cap 691 645 act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) one combi blister pack 692 646 act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) rc not exists 693 647 act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) one combi blister pack 694 648 act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) rc not exists 695 649 each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg rc not exists 696 800 liposomol amphotericine injection b 50mg vial 697 nrd 15 amphotericin b ip gel 1.0 mg each gm contain amphotericin b 1.0mg gel 15 gm tube 698 nrd 16 crotamiton 10% + hydrocortisone 0.25% cream 10 gm tube 699 nrd 17 methotrexate gel 1% 20 gmtube 700 nrd 57 eflornithine hydrochloride cream 139 mg, each gm contain eflornithine hydrochloride139 mg 15 gm tube 701 nrd 59 beclomethasone dipropionate 0.064%+ salycylic acid 3% lotion 50 ml lotion 702 nrd 63 methoxsalen 1% lotion. each ml contain methoxsalen 1% 30 ml lotion 703 nrd 68 deca peptide 6 mg lotion. each ml contain deca peptide 6 mg 6 ml lotion 704 nrd 72 minocycline 50mg capsule 705 nrd 73 trioxsalen 5mg tab. each film coated tablet contain trioxsalen 5mg 10*10 706 nrd 75 trioxsalen 25mg tab. each film coated tablet contain trioxsalen 25mg 10*10 707 nrd 111 trichloroacetic acid ( tca ) 50% w / v lotion lotion 708 nrd 168 inj.hylan g f 20 6 ml prefiled syringe 709 nrd 171 hepato protective tablet each film coated tablet to contain: matadoxine 500mg, silymarin 140mg, lornithine l aspartate 150mg, pyridoxine hydrochloride 3mg, folic acid 1.5mg tablet 710 nrd 213 spores of polyantibiotic resistant bacillus clausii 2 billion capsules hard gelatin capsules 711 nrd 218 iron as ferric saccharate and phospholipid chewable tabletseach chewable tablet contains: ferric saccharate ( in micro encapsulated form ) 75 mg eq. to elemental iron 30 mg phospholipid 167 mg eq. to phosphatidylserine 100 mg tablet 712 nrd 235 cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg cojugated estrogen 1x28 tab 713 nrd 247 telmisartan40mg + hydroclorothiazide12.5 mg, i.p. each tablet contain telmisartan40mg + hydroclorithiazide12.5 mg, 10x10 714 nrd 248 telmisartan80mg + hydroclorothiazide25 mg, i.p. each tablet contain telmisartan80mg + hydroclorithiazide 25 mg, 10x10 715 nrd 259 mefenamic acid 250mg+ dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg+ dicyclomine hydrochloride10mg 10x10 716 nrd 270 combikit of ( tab fluconazole150mg + azithromycin 1gm & secnidazole1gm ) each kit contain 1tab fluconazole150mg + 1 tab.azithromycin 1gm & 2 tab.secnidazole1gm . kit 717 nrd 388 dolutegravir 50, each film coated tablet contain dolutegravir sodium 50 mg 30 tab in bottle 718 nrd 405 tenofovir 300+lamivudine300, each film coated tablet contain tenofovir disoproxil fumerate300mg & lamivudine300 mg 30 tab in bottle 719 nrd 455 efavirenz 600 each film coated tablet contain efavirenz 600 mg tab 720 nrd 457 nevirapine 200 each tablet contain nevirapine 200mg 10x10 tab 721 nrd 470 atazanavir300+ritonavir100, each tablet contain atazanavir sulphate ip 300mg+ritonavir ip100mg 30 tab in bottle 722 nrd 641 tenofovir alafinamide25+emtricitabine200+ doultegravir 50 each tablet contain tenofovir alafinamide25 mg +emtricitabine200mg+ doultegravir 50mg tab 723 nrd 825 abacavir300 each tablet contain abacavir 300mg ip 60 tab in bottle 724 nrd 826 lamivudine 100 each tablet contain lamivudine 100 mg 10x10 725 nrd 827 raltegravir 400 each film coated tablet contain raltegravir 400 mg 60 tab in bottle 726 nrd 828 zideovudine 60+ lamivudine 30 tab 727 nrd 829 ultrasound contrast agent ( sulphur hexafluoride ) sonovue 8 micro ltr. per ml 728 nrd 830 contrast for ct scan / ivp / special investigations 729 nrd 831 iopamidol ct contrast solution for injectiuon 50 ml, vial 730 nrd 832 iopamidol ct contrast solution for injectiuon 100 ml 731 nrd 833 contrast for special investigations ( barium sulphate powder ) 100gm 732 nrd 834 contrast for special investigations ( barium sulphate powder ) 100gm 733 nrd 835 contrast for special investigations ( barium sulphate suspension ) high density low viscosity 100ml 734 nrd 836 contrast for special investigations ( barium sulphate suspension ) high density low viscosity 300ml 735 nrd 837 contrast for special investigations ( barium sulphate paste ) 100ml 736 nrd 838 oral contrast for mri ( ferric ammonium citrate / mineral oil / corn oil ) 100ml 737 nrd 839 oral contrast for ct ( diatrozoate sodium & diatrozoate meglumine ) 738 nrd 840 iopromide ct contrast usfda / ce approved 50 ml 739 nrd 841 iopromide ct contrast usfda / ce approved 100 ml 740 nrd 842 iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved 50 ml 741 nrd 843 iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved 100 ml 742 nrd 844 iotrolon ct contrast usfda / ce approved 50 ml 743 nrd 845 iotrolon ct contrast usfda / ce approved 100 ml 744 nrd 846 venlafaxime tab. 37.5 mg 745 nrd 847 olanzapine inj. 5 mg 746 nrd 848 flupentixol inj. 20 mg 747 nrd 849 memantine tab. 5 mg 748 nrd 850 glycopyrrolate tab. 1 mg 749 nrd 851 pramipexole tab. 0.125 mg 750 nrd 852 pramipexole tab. 0.25mg 751 nrd 853 pramipexole tab. 0.5 mg 752 nrd 854 inj. propofol mct / lct with oleic acid inj.iv inj. iv 753 nrd 855 inj.paracetamol infusion 1000 mg in double sterilised closed system 100% biodegradable eco friendly polyolefin 100 ml bag 754 nrd 856 nalbuphine inj. iv / im, 1ml 755 nrd 857 chlorprocaine inj 20ml vial 756 nrd 858 desflurane, 100ml inhalational agent 757 nrd 859 gelofusion infusion 500ml 758 nrd 860 albumin 5% infusion 100ml 759 nrd 861 inj.0.9% normal saline 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 760 nrd 862 inj. 0.9% normal saline 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 761 nrd 863 inj. ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 762 nrd 864 inj. ringers lactate 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 763 nrd 865 inj. 5% dextrose 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 764 nrd 866 inj. 5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 765 nrd 867 inj. 0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 766 nrd 868 balance salt solution with ph. of 7.2 to 7.4 osmolarity 292 to 294 in 100% biodegradable double sterilised closed system polyolefin 500 ml bag infusion 767 nrd 869 inj. balance hydroxy ethyl 6% tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100% biodegradable bag with polyolefin infusion 768 nrd 870 inj.hydroxy ethyl 6% tetra starch 130 / 0.4 in nacl 500 ml 100% biodegradable bag infusion 769 nrd 871 nifedipine sublingual 5mg, capsule 770 nrd 872 nifedipine sublingual 10mg, capsule 771 nrd 873 papaverine inj. 2ml 772 nrd 874 nicardipine tab. 10mg 773 nrd 875 topical heparin solution 1000iu / ml 1 glass bottle with dropper 5ml 774 nrd 876 anti gasgangrene sera 25000 iu / 10ml each vial contains clostridium perferingens anti toxin 10000 iu + clostridium oedematiens anti toxin 10000 iu + clostridium septicum anti toxin 5000 iu ) 775 nrd 877 basiliximab 20 mg inj inj. 776 nrd 878 betamethasone and neomycin cream ( 0.10%+0.5% ) cream 777 nrd 879 solution silver nitrate 2% cream 778 nrd 880 solution silver nitrate 5% cream 779 nrd 881 solution silver nitrate 10% cream 780 nrd 882 alkaline nasal douches ( sodium bicarbonate+ sodium biborate+ sodium chloride ) 781 nrd 883 ear drops hydrocortisone 1%w / v+ acetic acid 2%w / v 782 nrd 884 ear drops each ml contain chloramphenicol 4mg + dexamethasone 1mg + polymyxin b ( 5000iu ) 5 ml 783 nrd 885 nasal drops haemcoagulase topical solution each ml contain aqueous solution of haemocoagluase 0.2 cu 10 ml 784 nrd 886 triamcinolone oromucosal paste bp 0.1% w / w 5 gm tube 785 nrd 887 ethiodized oil ( lipiodol ) inj. 10 ml 786 nrd 888 htk solution 1 lit ( histidine tryptophan ketoglutarate solution ) 1 liter 787 nrd 889 glycopegylated extended half life nonacog beta pegol f ix 500 iu 788 nrd 890 glycopegylated extended half life nonacog beta pegol f ix 1000 iu 789 nrd 891 glycopegylated extended half life factor viii 500 iu 790 nrd 892 glycopegylated extended half life factor viii 1000 iu 791 nrd 893 tenofovir alafenamide fumerate ( taf ) 25 mg tab. / cap 1 bottle of 30 tab. / cap 792 nrd 894 entecavir 1mg tab. / cap film coated 1 bottle of 30 tab. / cap 793 nrd 895 dacalatasvir 30 mg tab. / cap 1 bottle of 28 tab. / cap 794 nrd 896 dacalatasvir 60 mg tab. / cap 1 bottle of 28 tab. / cap 795 nrd 897 sofosbuvir 400 mg tab. / cap 1 bottle of 28 tab. / cap 796 nrd 898 ribavirin 200 mg tab. / cap film coated 1 bottle of 42 tab. / cap 797 nrd 1 artificial saliva solution 798 nrd 2 balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag solution 799 nrd 3 alpha+lipoic acid + leycopen +multivitamin and miltiminerals cap. 800 nrd 4 glucosamine + hydrochloride +methylsulfonylmethane cap. 801 nrd 5 racecadotril 100mg cap. 802 nrd 6 rabeprazole +levosulpiride cap. 803 nrd 7 acitretin 10 mg cap. 804 nrd 8 acitretin 25 mg cap. 805 nrd 9 alectinib 150 mg ( monopoly ) cap. 806 nrd 10 all trans retinoic acid 10 mg cap. 807 nrd 11 anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) cap. 808 nrd 12 aprepitant 125 mg cap. 809 nrd 13 budesonide 9 mg cap. 810 nrd 14 calcium dobesilate 500mg cap. 811 nrd 15 ceritinib 50 mg cap. 812 nrd 16 ceritinib 100 mg cap. 813 nrd 17 ceritinib 200 mg cap. 814 nrd 18 ceritinib 250mg cap. 815 nrd 19 clomipramine ip 25 mg cap. 816 nrd 20 cyclosporine 100 mg cap. 817 nrd 21 dacarbazine 200 mg inj. 818 nrd 22 danazol 100mg cap. 819 nrd 23 evening primosa 1000 mg cap. 820 nrd 24 formetrol 12mcg + budesonide 400 mcg. respule 821 nrd 25 indacaterol and glycopyronium inhalation powder 110 / 50 mcg cap. 822 nrd 26 isotretinoin 10mg cap. 823 nrd 27 isotretinoin 20 mg cap. 824 nrd 28 lomustine 40 mg cap. 825 nrd 29 minocycline 100mg. cap. 826 nrd 30 mycophenolate mofetil 500mg cap. 827 nrd 31 netupitant + palonosetron 300 mg + 0.5 mg cap. 828 nrd 32 ramipril ip 5 mg cap. 829 nrd 33 rucaparib 200 mg cap. 830 nrd 34 rucaparib 300 mg cap. 831 nrd 35 silodosin 4 mg cap. 832 nrd 36 silodosin 8 mg cap. 833 nrd 37 temozolamide 250 mg cap. 834 nrd 38 vitamin a 25000 iu cap. 835 nrd 39 carbolic acid 50% in 500 ml solution 836 nrd 40 carbolic acid 100% in 500 ml solution 837 nrd 41 continuous ambulatory peritoneal dialysis fluid 2 ltr 838 nrd 42 lidocaine 25 mg + prilocaine 25mg cream 839 nrd 43 / ointment ( modified lanolin ) cream 840 nrd 44 aloe vera moisturizing cream 841 nrd 45 amophous hydrogel with colloid silver wound dressing cream 842 nrd 46 amorolfine 0.25% cream 843 nrd 47 azelaic acid 20% cream 844 nrd 48 benzoyl peroxide 2.5 % cream 845 nrd 49 desonide 0.05% cream 846 nrd 50 fenticonazole 2% cream 847 nrd 51 glycolic acid 6% cream 848 nrd 52 hydrocortisone 1% cream 849 nrd 53 hydroquinone 2% cream 850 nrd 54 kojic acid 2%, arbutin, niacinamide cream 851 nrd 55 luliconazole 1% cream 852 nrd 56 mometasone 0.1 % cream 853 nrd 57 mometasone 2% cream 854 nrd 58 neomycin sulphate cream cream 855 nrd 59 permethrin 1% rinse cream 856 nrd 60 adaplene ( 0.1% w / w ) gel 857 nrd 61 desflurane usp 240 ml bottle solution 858 nrd 62 dextrose with sod.chloride polypack 5% 500ml inj. 859 nrd 63 distilled water 10ml inj. 860 nrd 64 sodium chloride and dextrose 0.45% infusion 500ml inj. 861 nrd 65 salmetrol 50mcg+fluticasone 500 mcg dpi 862 nrd 66 budesonide 400 mcg dpi 863 nrd 67 glycopyrronium 25 + formoterol 6 mcg dpi 864 nrd 68 glycopyrronium 25 dpi 865 nrd 69 glycopyrronium 50 dpi 866 nrd 70 levosalbutamol 100mcg+ ipratropium bromide 40mcg dpi 867 nrd 71 diastase pepsin with simethicone 15 ml drop 868 nrd 72 furosemide 10mg / ml drop 869 nrd 73 ondansetron oral solution 30 ml drop 870 nrd 74 prednisolone acetate opthalmic suspension 10 ml eye drop 871 nrd 75 terbutalin drop 872 nrd 76 hydroxyzine oral solution 15 ml drop 873 nrd 77 ambroxol drop 874 nrd 78 anticold drop 875 nrd 79 astymine c ( vitamin c+ essential amino acid ) drop 876 nrd 80 enzyme drop 877 nrd 81 iron ( ferrous ascorbate ) drop 878 nrd 82 simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml drop 879 nrd 83 vitamin – e 50mg / ml, 400 iu drop 880 nrd 84 vitamin d3 400iu / ml drop 881 nrd 85 vitamin d3 800iu / ml drop 882 nrd 86 cefpodoxime oral suspension 20mg / ml drops 883 nrd 87 lactulose enema 884 nrd 88 docosahexaenoic 30ml drops 885 nrd 89 acetic acid otic solution 2% ear drop 886 nrd 90 gentamycin ear drop 887 nrd 91 digoxin 0.25% elixir 888 nrd 92 carboxymethylcellulose + glycerin eye drop 889 nrd 93 moxifloxacin+ difluoprednate eye drop 890 nrd 94 natamycin opthalmic suspension 5% eye drop 891 nrd 95 olaptadine & ketorolac eye drop 892 nrd 96 polymyxin b 10000iu / gm + neomycin 3400iu / gm eye drop 893 nrd 97 betadin 5% eye drop 894 nrd 98 brinozolamide+brimonidine eye drop 895 nrd 99 cpm+cmc+nephazoline eye drop 896 nrd 100 cyclopentolate 1% eye drop 897 nrd 101 dorzolamide 2% eye drop 898 nrd 102 fluromethalone 0.1% eye drop 899 nrd 103 gatifloxacin+prednisolone eye drop 900 nrd 104 hpmc 0.3% eye drop 901 nrd 105 itraconazole 1% eye drop 902 nrd 106 loteprednol 0.25% eye drop 903 nrd 107 moxifloxacin 0.5%+ketorolac tromethamine 0.5% eye drop 904 nrd 108 moxifloxacin and dexamethasone eye drop 905 nrd 109 moxifloxacin and prednisolone eye drop 906 nrd 110 nepafenac 0.1% eye drop 907 nrd 111 oloptadine opthalmic solution 0.1% eye drop 908 nrd 112 pilocarpine eye drop 909 nrd 113 prednisolone sodium phosphate 1% eye / ear drop 910 nrd 114 proparacaine 0.5% w / v eye drop 911 nrd 115 sodium chloride 5 % eye drop 912 nrd 116 sulfacetamide 20% eye drop 913 nrd 117 travapost+timolol eye drop 914 nrd 118 tropicamide+phenylepherine eye drop 915 nrd 119 voriconazole eye drop 916 nrd 120 azithromycin 1% eye ointment 917 nrd 121 chloramphenicol 0.5% eye ointment 918 nrd 122 chloramphenicol +polymycin eye ointment 919 nrd 123 chloramphenicol +polymycine + dexamethasone eye ointment 920 nrd 124 ganciclovir 0.15% eye ointment 921 nrd 125 itraconazole 1% eye ointment 922 nrd 126 moxifloxacin 0.5% eye ointment 923 nrd 127 sodium chloride 6% eye ointment 924 nrd 128 povidone iodine gargle 925 nrd 129 gatifloxacin 0.3% eye drop 926 nrd 130 diltiazem 2% p / r gel 927 nrd 131 nifedipine + lidocaine p / r gel 928 nrd 132 glycine irrigation solution 1.5% 3ltr solution 929 nrd 133 esmoprazole 10mg granules 930 nrd 134 hormonal intra uterine device 931 nrd 135 hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg tab. 932 nrd 136 hydrocortisone oromucosal 5 mg tab. 933 nrd 137 hydrocortisone oromucosal 10 mg tab. 934 nrd 138 hydrocortisone oromucosal 20 mg tab. 935 nrd 139 hydrogen 11% + silver nitrate .01% solution 936 nrd 140 tiotropium + glycopyrolate 25mg inhaler 937 nrd 141 metoprolol 5ml vial inj 938 nrd 142 docetaxel 20mg inj. 939 nrd 143 docetaxel 80 mg inj. 940 nrd 144 folinic acid 200mg / vial inj. 941 nrd 145 sodium chloride 3% 100ml inj. 942 nrd 146 acth synacthen 250 mcg inj. 943 nrd 147 adalimumab 40 mg inj. 944 nrd 148 ado trastuzumab 100 mg945 nrd 149 ado trastuzumab 160 mg inj. 946 nrd 150 alpha beta arteether 2 ml inj. 947 nrd 151 prostaglandin 500mcg / ml inj. 948 nrd 152 aminocaproic acid 20ml inj. 949 nrd 153 amoxycillin & clavulanic acid 300 mg inj. 950 nrd 154 ampicillin + salbactum 1.5g inj. 951 nrd 155 progesterone injection 50 inj. 952 nrd 156 artesunate 120 mg inj. 953 nrd 157 atezolizumab 1200 mg ( monopoly ) inj. 954 nrd 158 avelumab 200 mg ( monopoly ) inj. 955 nrd 159 azacitidine 50mg inj. 956 nrd 160 azacitidine 100mg inj. 957 nrd 161 azithromycin 10 ml vial equaivelent to 500 mg inj. 958 nrd 162 bacitracin for injection 25, 000 iu inj. 959 nrd 163 bortezomib 2.5 inj. 960 nrd 164 botulinum toxin type a for injection / botulinum toxin type b for injection 100 inj. 961 nrd 165 botulinum toxin type a for injection / botulinum toxin type b for injection 50 iu inj. 962 nrd 166 busulfan 60mg / 1ml inj. 963 nrd 167 cabazitaxel 20 mg inj. 964 nrd 168 cabazitaxel 40 mg inj. 965 nrd 169 caffeine cirate 20mg / ml inj. 966 nrd 170 calcium chloride 5ml vial inj. 967 nrd 171 calcium gluconate / folinate inj. 968 nrd 172 carbetocin 1ml / 100micro. inj. 969 nrd 173 carfilzomib 20 mg inj. 970 nrd 174 carfilzomib 60 mg inj. 971 nrd 175 carmustine 100 mg inj. 972 nrd 176 caspofungin 50 mg inj. 973 nrd 177 caspofungin 70 mg inj. 974 nrd 178 cefipime 1000mg + tazobactum 125mg inj. 975 nrd 179 cefoperazone 1gm+tazobactum 125mg inj. 976 nrd 180 cefoperazone 500mg inj. 977 nrd 181 ceftazidime 1gm+sulbactam500 mg inj. 978 nrd 182 ceftazidime+ avibactum 2gm+500mg inj. 979 nrd 183 ceftizoxime 1 gm inj. 980 nrd 184 ceftriaxone ip 125 mg inj. 981 nrd 185 ceftriaxone +salbactum+ disodium edta inj. 982 nrd 186 ceftriaxone and sulbactam 1.5g inj. 983 nrd 187 ceftriaxone1000mg+ tazobactom125mg inj. 984 nrd 188 cefuroxime 1gm inj. 985 nrd 189 cetrorelix acetate 0.25 mg inj. 986 nrd 190 cetuximab 100 mg inj. 987 nrd 191 cetuximab 500mg inj. 988 nrd 192 chloramphenicol 1gm / vial inj. 989 nrd 193 cladrabine 10 mg inj. 990 nrd 194 clarithromycin 500mg inj. 991 nrd 195 clindamycin 600mg / 4ml inj. 992 nrd 196 clonidine 150mcg / ml inj. 993 nrd 197 compound sodium lactate ( ringer lactate ) in glass bottle 500ml inj. 994 nrd 198 crystilline penicillin 2 lakh inj. 995 nrd 199 cytarabine 1000 mg inj. 996 nrd 200 d penicillamine 250mg cap. 997 nrd 201 dextrose 5% 500 ml glass bottle inj. 998 nrd 202 daratumumab 100 mg ( monopoly ) inj. 999 nrd 203 daratumumab400 mg ( monopoly ) inj. 1000 nrd 204 darbepoietin alfa 100mcg inj. 1001 nrd 205 darbepoietin alfa 200 mcg inj. 1002 nrd 206 darbepoietin alfa 500mcg inj. 1003 nrd 207 decitabine 50 mg inj. 1004 nrd 208 decitabine 100 mg inj. 1005 nrd 209 degarelix 80 mg inj. 1006 nrd 210 degarelix 120 mg inj. 1007 nrd 211 degludec insulin 300iu / 3ml inj. 1008 nrd 212 denosumab 120 mg inj. 1009 nrd 213 deriphylline 1 ampul inj. 1010 nrd 214 detemir insuline inj. 1011 nrd 215 dexmedetomidine 100mcg / ml inj. 1012 nrd 216 dextran 40 inj. 1013 nrd 217 diazoxide 300 mg / 20ml inj. 1014 nrd 218 digoxin 2mg inj. 1015 nrd 219 diltiazem 25 mg inj. 1016 nrd 220 docetaxel 120 mg inj. 1017 nrd 221 doxycycline for injection 100 mg inj. 1018 nrd 222 durvalumab 120 mg ( monopoly ) inj. 1019 nrd 223 durvalumab 500mg ( monopoly ) inj. 1020 nrd 224 enalapril 1.25 mg 1 ml inj. 1021 nrd 225 ephedrine 30 mg / ml inj. 1022 nrd 226 epirubicin 50mg / ml inj. 1023 nrd 227 epirubicin 150mg / ml inj. 1024 nrd 228 eribulin 0.5mg inj. 1025 nrd 229 eribulin 1 mg inj. 1026 nrd 230 ertapenem sodium 1gm = ertapenem 1.046 gm inj. 1027 nrd 231 etomidate 20 mg inj. 1028 nrd 232 etomidate mct / lct 10ml vial inj. 1029 nrd 233 fentanyl 25iu patch patch 1030 nrd 234 fentanyl 50iu patch patch 1031 nrd 235 fluconazole 100mg inj. 1032 nrd 236 fluconazole 200 mg inj. 1033 nrd 237 fludarabine phosphate injection 100mg inj. 1034 nrd 238 fludarabine phosphate injection 50mg inj. 1035 nrd 239 fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien inj. 1036 nrd 240 fluphenazine deconate injection ( long acting ) 25mg / ml ampule inj. 1037 nrd 241 folic acid +methylcobalamine 10 ml pack inj. 1038 nrd 242 fondaparinux 2.5mg inj. 1039 nrd 243 fosphenytoin sodium 150mg / ml inj. 1040 nrd 244 fsh 75 iu inj. 1041 nrd 245 fsh 150 iu inj. 1042 nrd 246 fulvestrant 250mg inj. 1043 nrd 247 gdw 5% glass bottle / 500ml inj. 1044 nrd 248 glyceryl trinitrate injection, diluted 5mg / ml inj. 1045 nrd 249 goserelin acetate implant 3.6 mg inj. 1046 nrd 250 haemocoagulase 1 ml inj. 1047 nrd 251 haloperidol ( long acting ) 50mg / ml ampoule inj. 1048 nrd 252 horse atg ( anti thymocyte globulin ) 250 mg inj. 1049 nrd 253 hp hmg ( highly human menopausal parodied gonadotropin ) 150 iu inj. 1050 nrd 254 hp hmg ( highly human menopausal parodied gonadotropin ) 75 iu inj. 1051 nrd 255 hydralazine 20mg / ml inj. 1052 nrd 256 indomethacin lyophilized powder 1mg inj. 1053 nrd 257 inotuzumab1 mg ( monopoly ) inj. 1054 nrd 258 insulin aspart inj. 1055 nrd 259 insulin glulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges inj. 1056 nrd 260 insulin glulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen inj. 1057 nrd 261 insulin lispro inj. 1058 nrd 262 interferon beta 1 a 30mg inj. 1059 nrd 263 intralipds inj. 1060 nrd 264 invert sugar 10% ( fructodex 10% ) 500 cc inj. 1061 nrd 265 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml inj. 1062 nrd 266 ipilimumab 50 mg inj. 1063 nrd 267 irinotecan 40mg / 5ml inj. 1064 nrd 268 irinotecan 100 mg / 5ml inj. 1065 nrd 269 isolyte g inj. 1066 nrd 270 isolyte p 10% 500 ml inj. 1067 nrd 271 lacosamide infusion inj. 1068 nrd 272 levobupivacaine 0.5% ( 20mg / 4ml ) ampule inj. 1069 nrd 273 levofloxacine 500mg / 100 ml inj. 1070 nrd 274 levosulpride 12.5 mg / ml inj. 1071 nrd 275 lignocaine ( preservative free ) 2% inj. 1072 nrd 276 lignocaine + adrenaline ( 1:10000, 2:10000 ) inj. 1073 nrd 277 lignocaine 10% spray inj. 1074 nrd 278 lignocaine hydrochloride 2% 50ml vial inj. 1075 nrd 279 liposomal doxorubicin 20mg inj. 1076 nrd 280 liposomal doxorubicin 50 mg inj. 1077 nrd 281 lorazepam 1.0 mg inj. 1078 nrd 282 lorazepam 5 mg inj. 1079 nrd 283 l orinithine l aspartate 10 ml inj. 1080 nrd 284 low molecular wt. heparin 0.4mg inj. 1081 nrd 285 mephentermine 50mg / ml inj. 1082 nrd 286 meropenem 2gm inj. 1083 nrd 287 mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) inj. 1084 nrd 288 methotrexate 250 mg inj. 1085 nrd 289 methotrexate 1000 mg inj. 1086 nrd 290 methylene blue inj. 1087 nrd 291 methylprednisolon acetate 40mg inj. 1088 nrd 292 methylprednisolon acetate 125mg inj. 1089 nrd 293 metotrexate 15mg ( preservative free ) inj. 1090 nrd 294 midazolam 5mg / ml 1 ml inj. 1091 nrd 295 milrinone 10 mg inj. 1092 nrd 296 mitomycin 2 mg inj. 1093 nrd 297 mitomycin 40 mg inj. 1094 nrd 298 mitoxanthrone infusion 10 mg inj. 1095 nrd 299 mitoxanthrone infusion 20mg inj. 1096 nrd 300 moxifloxacin intra cameral 0.5% inj. 1097 nrd 301 moxifloxin 400mg / 100ml inj. 1098 nrd 302 multivitamin 10 ml inj. 1099 nrd 303 nabpaclitaxel ( paclitaxel nano particle ) 100 mg inj. 1100 nrd 304 nandrolone decanoate 100mg inj. 1101 nrd 305 nandrolone decanoate 50 mg inj. 1102 nrd 306 natalizumab 300 mg ( monopoly ) inj. 1103 nrd 307 neostigmine+ glycopyrrolate 2.5 mg / 0.5 mg inj. 1104 nrd 308 netilmycin 300mg / 3ml inj. 1105 nrd 309 nicardipin 10mg inj. 1106 nrd 310 nicorandil 48 mg inj. 1107 nrd 311 nimodipine infusion 10mg / 50 ml inj. 1108 nrd 312 nimotuzumab 50 mg inj. 1109 nrd 313 nivolumab 40 mg ( monopoly ) inj. 1110 nrd 314 nivolumab 100 mg ( monopoly ) inj. 1111 nrd 315 normal saline 500 ml glass bottle inj. 1112 nrd 316 normal saline 1000 ml glass bottle inj. 1113 nrd 317 octreotide 100mg inj. 1114 nrd 318 octreotide lar ( long acting release ) 20 mg inj. 1115 nrd 319 octreotide lar ( long acting release ) 30 mg inj. 1116 nrd 320 lidocaine1% intra cameral inj. 1117 nrd 321 omalizumab 150 mg vial inj. 1118 nrd 322 ornidazole 500mg inj. 1119 nrd 323 palonosetron 0.25mg inj. 1120 nrd 324 paracetamol infusion 500 mg with both temper evident caps spray 10% inj. 1121 nrd 325 paracetamol infusion 1000 mg with both temper evident caps spray 10% inj. 1122 nrd 326 peg asparaginase 3750 iu 5 ml inj. 1123 nrd 327 peg filgrastim injection 6mg inj. 1124 nrd 328 pembrolizumab 50 mg ( monopoly ) inj. 1125 nrd 329 pembrolizumab100 mg ( monopoly ) inj. 1126 nrd 330 pemetrexed 100mg inj. 1127 nrd 331 pemetrexed 500 mg inj. 1128 nrd 332 pertuzumab 100 mg inj. 1129 nrd 333 phenylephrine hydrochloride 10 mg / ml inj. 1130 nrd 334 pilocarpine 0.5% w / v inj. 1131 nrd 335 piperacillin 1 gm + tazobactum 125 mg inj. 1132 nrd 336 piracetam 200mg inj. 1133 nrd 337 placental extract 2ml inj. 1134 nrd 338 plerixafor 24 mg inj. 1135 nrd 339 polymyxin b for injection 1 million inj. 1136 nrd 340 potassium chloride for injection inj. 1137 nrd 341 procaine penicillin fortified 2 lack inj. 1138 nrd 342 protamine sulphate 5ml inj. 1139 nrd 343 rabbit atg ( anti thymocyte globulin ) 100 mg inj. 1140 nrd 344 ramucirumab 100 mg ( monopoly ) inj. 1141 nrd 345 ramucirumab 500 mg ( monopoly ) inj. 1142 nrd 346 ranizumab 10mg / ml inj. 1143 nrd 347 rasburicase 1.5 mg inj. 1144 nrd 348 recombinant fsh 150 iu inj. 1145 nrd 349 recombinant fsh 300iu inj. 1146 nrd 350 recombinant hcg 250 iu inj. 1147 nrd 351 recombinant lh 75iu inj. 1148 nrd 352 reteplase 18 mg inj. 1149 nrd 353 risperidone prolonged released depot 25 mg inj. 1150 nrd 354 risperidone prolonged released depot 50mg inj. 1151 nrd 355 rituximab 100 mg inj. 1152 nrd 356 rituximab 500 mg inj. 1153 nrd 357 rocuronium 100mg / 10ml inj. 1154 nrd 358 romiplostim 125 mcg inj. 1155 nrd 359 romiplostim 250 mcg inj. 1156 nrd 360 romiplostim 500 mcg inj. 1157 nrd 361 ropivacaine 0.75% 20ml vial inj. 1158 nrd 362 ropivacaine 0.75% 3 ml ampule ( heavy ) inj. 1159 nrd 363 secukinumab 150 mg inj. 1160 nrd 364 sildenafil 0.8mg inj. 1161 nrd 365 sodium bicarbonate injection inj. 1162 nrd 366 sodium fluroresceine dye 20% inj. 1163 nrd 367 sodium hyaluronate 1.4mg inj. 1164 nrd 368 streptomycin 1gm inj. 1165 nrd 369 streptomycin 500mg inj. 1166 nrd 370 sugmadex inj. 1167 nrd 371 teicoplanin 200 mg inj. 1168 nrd 372 teicoplanin 400 mg inj. 1169 nrd 373 tenecteplase 20mg inj. 1170 nrd 374 tenecteplase 40 mg inj. 1171 nrd 375 testosteron propionate 50mg inj. 1172 nrd 376 testosteron propionate 250mg inj. 1173 nrd 377 thiamine 100ml inj. 1174 nrd 378 ticarcillin and clavulanic acid inj. 1175 nrd 379 tigecycline for injection 50mg inj. 1176 nrd 380 tigecycline for injection 100mg inj. 1177 nrd 381 tobaramycin 80mg inj. 1178 nrd 382 topotecan 1 mg inj. 1179 nrd 383 topotecan 2.5 mg inj. 1180 nrd 384 topotecan 4 mg inj. 1181 nrd 385 t pa 20mg alteplase for injection inj. 1182 nrd 386 t pa 50mg alteplase for injection inj. 1183 nrd 387 trabectedin 1 mg inj. 1184 nrd 388 tranexamic acid 500mg / 5ml inj. 1185 nrd 389 trastuzumab 440 mg inj. 1186 nrd 390 trastuzumab150mg inj. 1187 nrd 391 triamcinolone acetonide 10 mg per ml inj. 1188 nrd 392 triamcinolone acetonide 40 mg per ml inj. 1189 nrd 393 trypan blue 0.6% inj. 1190 nrd 394 triptorelin 0.1 mg inj. 1191 nrd 395 triptorelin 3.75 mg inj. 1192 nrd 396 triptorelin 11.25 mg inj. 1193 nrd 397 varicella immunoglobulin for iv use inj. 1194 nrd 398 vasopressin 3ml inj. 1195 nrd 399 verapamil 2.5 mg / ml inj. 1196 nrd 400 vinorelbine 10mg inj. 1197 nrd 401 vinorelbine 50mg inj. 1198 nrd 402 vitamin d ( 600000 iu ) inj. 1199 nrd 403 insulin glargine 300 iu per ml / prefilled pen inj. 1200 nrd 404 insuline 50 / 50 inj. 1201 nrd 405 xylocaine lubricating 30gm jelly 1202 nrd 406 lignocaine 4% 30ml 1203 nrd 407 lignocaine viscous 1204 nrd 408 liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) inj. 1205 nrd 409 l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) cap. 1206 nrd 410 asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl 17% lotion 1207 nrd 411 clotrimazole 1%+beclomethasone 0.25% lotion 1208 nrd 412 ketaconazole 2% lotion 1209 nrd 413 minoxidil 2% lotion 1210 nrd 414 minoxidil 5% lotion 1211 nrd 415 minoxidil 10 % lotion 1212 nrd 416 podophyliin toxin lotion 1213 nrd 417 sulphur + calamine lotion 1214 nrd 418 sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 lotion 1215 nrd 419 clotrimazole 10mg lozenses 1216 nrd 420 ( medium chain triglyceride ) oil 1217 nrd 421 budesonide 200 mcg. mdi 1218 nrd 422 formeterol 6mcg.+ fluticasone 250 mcg. inhalation, etc...

Medical And Health Services - Rajasthan

34044600 supply of medicine 6 halothane isoflurane ketamine injection 50 mg / m1 propofal injection 10 mg / m1 thiopentone injection 0.5 g sevofluranc 7 799 liquid medical oxygen ( lmo ) , i 9 12 lignocaine gel ip 2% i 0 13 lignocaine injection 2% 11 10 lignocaine and adrenaline injection 20mg + 0.01mg 12 11 lignocaine and dextrose injection 50mg + 75mg per ml 13 2 bupivacaine hydrochloride in dextrose injection song + ro mg per ml 14 4 bupivacaine injection 0.50% .3 pre operative hledicatiou 15 654 atropine sulphate injection 0.6 mg / ml 16 313 midatolam injection ip i mg / nil 2. ana sesic, antipyretic & anti inflammatory drugs 2.1 opiold analgesics morphine sulphate injection ip 10 mg / m1 tramadol capsule 50 mg tramadol injection 50 mg / mi pentazocinc injection 30 mg / m1 fentanyl citrate injection 50 meg / gni fentanyl citrate injection 50 mcg / m1 naproxen tablet ip 500 mg naproxen tablet ip 250 mg ink butorphanol tartrate usp img / milml size 2.2 non.steroldal anti inflammatory drugs & antipyretics aspirin tablet ip ( gasyo resistant ) 150 mg aceclofenac and paracetamol tablet 100 mg + 325 mg 17 25 is 32 19 33 20 30 21 21 •v1 655 23 656 24 657 25 694 26 679 27 492 28 493 29 483 30 19 31 20 32 437 33 658 34 495 35 22 36 23 37 38 39 40 41 24 477 436 496 26 42 27 diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+31144 5% diclofenac sodium and paracetamol tablet 50+ 325 mg diclofenac sodium injection for im and iv 25 mg / ml diclofenac sodium tablet 50 mg diclofenac tablet ( sr ) 100 mg etoricoxib tablet 90 mg etoricoxib tablet ip 120 mg ibuprofen and paracetamol tablet 400 mg 4 325 mg ibuprofen tablet 200 mg ibuprofen tablet 400 mg ibuprofen oral suspension 100 mg / 5ml indomethacin capsule 25 mg mefenamic acid tablet 500 mg paracetamol drops 150 mg / ml paracetamol syrup ip 125 mg / 5m1 43 28 44 29 paracetamol tablet 500 mg paracetamol injection 150 mg / ml 45 695 46 696 47 697 2.3 must inj diclofenac sodium aqueous 75mg / m1 1ml size, iv & im use paracetamol infusion ip i% w / v 100ml sire lab. ketorolac 10 mg it relaxants 48 610 49 698 50 699 3. drugs for c 51 598 52 599 chlortoxatune. i ) iclofenue sodium & paracetamol tablet 250mg+50mg+325 n tab liaclofen ip 10 mg ( each uncoated tablet contains baclofen ip 10 nog ) tab tizanidine i lydrochloride ip 2 mg ( each uncoated tablet contains tizamdine hydrochloride ip 2 mg ) out & itil etim at ( ) 11 ) a rthritis allopu11101 tablet 10► mg i lydroxychloroquine sulphate tablet 20 ) mg lellunornide phosphate tablet 10 mg lellunomide phosphate tablet 20 mg sulfasalazine delayed release tablet 500 mg 4. antiallergics & drugs used in anaphylaxis 4.1 c.orficosterolds 35 betamethasone tablet 0.5 mg 418 betamethasone sodium phosphate injection 4 mg / m1 58 39 dexamothasone injection 8 mg / 2m1, 44 methyl prednisolonc sodium succinate for injection 500 mg 47 prednisolone tablet 5 mg a 469 prednisolone tablet 10 mg 64 470 prednisolone tablet 20 mg 65 700 tab dexamethasone ip 4 mg ( each uncoated tablet contains dexarnethasone ip 4 mg ) 4.2 anti istaminics & drugs used in anaphylaxis 66 34 adrenaline injection i mg / m1 67 37 chlorphcniramme mateate tablet 4 mg 68 43 i lydroxyzine tablet 25 mg 69 45 pheniramine injection 22.75 mg / ml 70 48 promethatine syrup ip $ mg / 5m1 71 49 promethazine injection 25 mg / m1 72 50 promethanne fablet 2$ mg 73 497 anticold syrup: phcnylcphrine 110 , chlorpheniramme maleatc, and paracetamol 2.5 mg+ 1 mg+125 mg / 5m1 74 498 cetirizine, phenylephrine& paracetamol tablet 5 mg + 10 mg+ 325 mg 75 499 cetirizinc syrup 5 mg / m1 76 659 levoceitrizine tablet 5mg 77 660 montelukast 10 mg + levocetrizine sing tablet 5, antidotes and other substances used in poisoning 78 51 naloxone injection ip 0.4 mg / mi 79 52 pralidoxime chloride injection 25 mg / m1 80 500 n. acetyleystine injection 200 mg / mi 6. anti epileptic drugs si 53 carbamazepine tablet 200 mg 82 54 carbamazepine tablet ip 100 mg 83 474 carbamazepine oral suspension usp 100 mg / 5 ml 84 56 phenobarbitone tablet 30 mg 85 420 phenobarbitone injection ip 200 mg / ml 86 57 phenytoin injection 50 mg / m1 87 58 phenytoin oral suspension 25 mg / m l 88 59 phenytoin tablet 100 mg 89 634 pregabalin capsule ip 75 mg 90 60 sodium valproate ip injection 100 mg / m1 91 61 sodium valproate tabkt 200 mg 92 479 sodium valproate oral solution ip 200 mg / 5 ml 93 661 sodium valproate ( gastro resistant ) ip tablet 500 mg clobazam tablet / capsule 5 mg 94 662 95 663 clobazam tablet / capsule 10 mg 96 664 leyetiracetam tablet 500 mg 97 665 levetiracetam oral solution suspension 100 mg / mi 98 666 1..evetirucetarn injection 500 mg / 5m1 99 667 gabapentine tablet / capsule 100 mg 1; 668 gabapentine tablet / capsule 300 mg 101 701 tab lamotrigine ip 50 mg ( each sustained releasetablel contains lamotrigine ip 50 mg ) 02 702 tab divalproex extended release ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) 03 703 tab oxcarbazepine ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) 05 705 tab topiramate ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , 106 67 amikumn injection 100 mg 107 504 amikacin injection 250 mg 108 68 amikacin injection 500 mg 109 116 gentamycin injection 80 mg / 2m1 7.1.2 betalactain 7.1.2.1 penkillias 110 71 amoxycillin capsule 250 mg iii 72 amoxycillin capsule 500 mg 112 73 amoxycillin trihydrate dispersible tablet 125 mg 113 473 amoxycillin oral suspension ( ply syrup ) 125 mg / 5m1 114 69 amoxycillin and cloxacillin capsule 250 mg + zso mg _ 115 70 amoxycillin and potassium clavulanate tabs 500 mg + 125 mg 116 505 amoxicillin and clavulanie acid injection 600 mg 117 506 amoxicillin and potassium clavulanate injection 1.2 gin 118 507 amoxycillin & clovulanic acid syrup 200 mg + 28.5 mg i 5 ml 119 412 ampicil lin capsule 500 rag 120 75 ampicillin injection ip.500 mg 121 81 benzathinc benzylpenicillin injection 1p12 lac units 122 82 l3enzathine benzylpenicillin injection 6 lac units 123 417 cloxacillin sodium injection 500 mg 124 468 piperacillin and tazobactum for injection 4 gm + 500 mg 125 706 tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 7.1.2.2 cephalosporins 127 510 cefepime injection 500 mg 128 84 cefixime tablet 100 mg 129 85 cetixime tablet 200 mg 130 511 cefixime oral susp ( drops ) 25 mg / m1 131 86 cefopenizone and sulbactum for injection i g + 0.5 g 132 87 cefotaxime injection i g 133 88 cefotaxime injection 250 mg 134 475 cefpodoxime dispersible tablet 50 mg 135 89 ceftazidime injection i g 136 90 ceftazidime injection 250 mg 137 91 ceftazidime injection 500 mg 138 93 ceftriaxone injection ip i g / vial 139 94 ceftriaxone injection 250 mg 140 95 ceftriaxone injection ip 500 mg / vial 141 512 cefuroxime tablet 250 mg 142 96 cephalexin capsule 250 mg 143 97 cephalexin capsule ip 500 mg 144 427 cephalexin oral suspension ( cephalexin dry syrup ) 125 mg / 5m1 145 476 cephalexin tablet ( dt ) 125 mg 146 708 lnj. ceftriaxone 1 gm + tazobactum 125 mg 147 709 tab.cefadroxil 250 mg 148 710 tab.cefadroxil 500 mg 7.1.3 maerolides 149 78 azithromycin tablet ( dt ) 100 mg 150 79 azithromycin tablet ip 250 mg 151 80 azithromycin tablet 500 mg 7.1.4 quinolones 152 101 ciprofloxacin injection 200 mg / 100 ml 153 102 ciprofloxacin tablet 250 mg 154 103 ciprofloxacin tablet 500 mg 155 515 levolloxacin tablet 250 mg 156 124 norfloxacin tablet 400 mg 157 125 ofloxacin tablet 200 mg 158 428 ofloxacin suspension 50 mg / 5 ml 159 521 ofloxacin injection 200mg / 100 ml 160 520 ofloxacin and omidazole tablet 200 mg + 500 mg 161 711 ofloxacin oral suspension ip ( each 5m1 contains ofloxacin ip 100 mg ) 30 ml size 162 712 tab. levolloxacin ip 500 mg ( each film coated tablet contains levolloxacin hemihydrate ip soo mg ) , 7.1.5 other anti %aerials 513 clindamycin capsule 150 mg 165 514 i clindamyan capsule 300 mg 166 107 co trimozazole oral suspension 40 mg + 200 mg per 5m1 167 108 i co trimoitazole tablet 40 mg + 200 mg 168 669 co trimoxazole tablet 160 mg + 800 mg 169 iii doxycycline capsule 100 mg 170 516 linezolid tablet ip 600 mg 171 517 i linezolid injection 200 mg / 100 mil 172 119 i meropenem injection 500 mg 173 481 meropenem injection 1 g 174 413 i nitrofurantoin tablet 100 mg 175 523 i vancomycin injection 500 mg 178 684 framycetin sulphate cream 1% 179 685 framycetin sulphate cream 1% 181 714 i inj clindamycin phosphate ip 300 mg 7.2 anti amoebic 186 187 188 189 190 120 metronidazole injection soo mg / 100 ml 121 metronidazole benzoate oral suspension 100 mg / 5 ml 122 metronidazole tablet 200 mg 123 metronidazole tablet 400 mg 430 tinidazole tablet ip 300 mg ( film coated ) 191 431 tinidazole tablet ip 500 mg ( film coated ) 73 anthelmintics 192 65 albendazole oral suspension 400 mg / 10 ml 193 66 albendazole tablet ip 400 mg 194 110 diethylearbamazine tablets ip 100 mg 7.4 anti fungals 195 104 clotrimazole cream ip 2% w / w 196 105 clotrimazole vaginal tablet 500 mg 197 114 flueonazole tablet 150 mg 198 117 j griseofulvin tablets 125 mg 199 118 itraconazole capsule 100 mg 203 721 tab. terbinafine hydrochloride 250 mg 73 anti malarlals anisunate injection 60 mg ( combo pack with i ml ampoule of 5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection ) 207 209 210 211 212 chloroquine phosphate injection 40 mg / ml chloroquine phosphate tablet 250mg ( =155 mg of chloroquine base ) chloroquine phosphate suspension 50 mg / 5m1 128 primaquine tablet 2.5 mg 129 primaquine tablet 7.5 mg 131 quinine dihydrochloride injection 300 mg / ml 132 quinine sulphate tablet 300 mg 213 214 645 215 646 i 647 217 218 219 648 649 act kit containing 3 tablet of artesunate ( each tablet of artesunate 25mg strength ) and i tablet of sulphadoxine pyremethamine ( 250 mg+ 12.5 mg ) act kit containing 3 tablet of artesunate ( 50mg each ) and itablet of sulphadox ine pyremethamine ( 500+25 ) mg act kit containing 3 tablet of artesunate ( 100 mg each ) and i tablet of sulpha doxinepyremethamine ( 750 + 37.5 ) mg act kit containing 3 tablet of artesunate iso mg and 2 tablet of sulphadoxine pyremethamine ( 500 mg+ 25 mg ) act kit containing 3 tablet of artesunate ( each 200 mg ) and 2 tablet of sulpha. doxine pyremethamine ( 750 + 37.5 ) mg each or 3 tablet sulphadoxine pyreme thamine ( 500+25 ) mg each 686 artanether + leumefantrine tablet ( 40 mg and 240 mg ) 651 artemether + leumefantrine tablet ( 80 mg and 480 mg ) 7.6 anti viral 220 63 acyclovir tablet 200 mg 221 64 aeyelovir tablet 800 mg 222 62 acyclovir suspension 400 mg / 5m1 223 502 acyclovir injection 250 mg, 28 133 azathioprine tablet ip 50 mg 229 134 bleomycin injection 15 units 230 136 chlorambucil tablet 5 mg —231 137 cisplatin injection 50 mg / 50 ml 232 138 cyclophosphamide injection 200 mg 233 139 cyclophosphamide injection ip 500 mg 234 677 cyclosporine capsule usp 50 mg 235 141 cytarabine injection 100 mg / 5 ml 236 142 danazol capsule ip 50mg 237 143 daunoruhicin injection 20 mg 238 144 doxorubicin injection 50 mg / 25 ml 239 146 etoposide injection 100 mg / 5 ml 240 148 fluorouracil injection 250 mg / 5 ml 241 149 l asparaginase injection 10000 iv 242 150 leucovorin calcium injection 10 mg / m1 243 151 mclphalan tablet 5 mg 244 152 mercaptopurine tablet ip 50 mg 245 153 methotrexate injection 50 mg / 2 ml 246 154 methotrexate tablet 25 mg 247 155 paclitasct injection 260 mg 248 156 paclitaxel injection 100 mg 249 157 tamoxifen tablet 10 mg 250 158 vinblastine injection 10 mg / 10 ml 251 159 vincristine injection 1 mg / ml 252 525 alpha interferon injection 3 million unit 253 526 carboplatin injection 150mg 254 527 carboplatin injection 450mg 255 528 cisplatin injection 10 mg / i0 ml 256 529 dacarbazine injection 500 mg 257 530 filgrastim injection 300mcg / m1 258 531 gemcitabine injection 200 mg 259 532 gemcitabine injection ism 260 533 ifosfamide injection i gin 261 534 imatinib tablet 400 mg 262 536 methotrexate tablet ip 10 mg 263 537 mitomycin c injection 10 mg 264 538 oxaliplatin injection 50 mg . 267 727 tab capecitabine ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) 268 728 tab letrozole usp 2.5 mg ( each film coated tablet contains letrozole usp 22 mo 269 729 capsule temozolomide ip 100 mg ( each hard gelatin capsule contains temozo. lornide ip 100mg ) 273 733 cap thalidomide usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) 281 741 tab. bicalutamide usp 50 mg ( each film tablet contains bicalutamide usp 50 mg ) 282 742 tab. 6 thioguanine usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) 283 743 inj zokdronic acid ii 4mg vial 9. anti parkinsonlsm drugs 286 160 levodopa and carbidopa tablet 100 mg + 10 mg 287 161 levodopa and carbidopa tablet 250 mg + 25mg 288 162 trihexyphenidyl i lydrochluride tablet 2 mg 10. drugs affecting blood 10.1 an coagulant . 289 163 acenocoumarol tablet 2 mg 290 172 enoxaparin sodium injection 60 mg 291 174 heparin sodium injection 5000 illiml — 292 546 warfarin sod. tablet 5 mg 293 744 inj. n butyl alcohol 0.26m8 / 5m1, citric acid 2.5mg / 5m1and sod. chloride solution 5 ml size 10.2 haemostatic 294 173 ethamsylate injection 250 mg / 2mt 545 tranexamic acid tablet 500 mg 46 180 vitamin k injection 10 mg / mi 297 745 tab ethamsylate bp 500 mg ( each uncoated coated tablet contains etharnsylate bp 500 mg ) 298 746 feracrylum i% w / w sterile solution 100 ml 299 747 1w tranexamic acid ip 100mwm1 5mistte 10.3 drugs used in haemophilia 300 171 dried factor viii fraction ( iv use ) 2501u 301 688 dried factor viii fraction ( iv use ) 500 iu 302 689 dried factor viii fraction ( iv use ) 1000 1u 303 406 factor ix concentrate 6001u 307 748 recombinant f ix 500 111 with diluent 308 749 3rd generation recombinant f viii 2501u with diluent 309 750 3rd generation recombinant f viii 1000 iu with diluent 10.41 ) rugts used is thalassaemia 310 165 deferasirox tablet iou mg 311 166 deferasirox tablet 500 mg 312 167 delcriprone capsule 250 mg 313 168 deferiprone capsule 500 mg 314 169 desferrioxamine injection ( for i.m. inj and i.v., s.c. infusion ) sod mg 10.5 erytropoetias 315 176 th erythropoetin injection 10000 111 316 177 rh erythropoetin injection 20001u 317 179 rh erythropoetin injection 400010 10.6 plasma expanders 318 175 human albumin solution 20% 319 416 hydroxyethyl starch ( 130 / 4 ) 6% wlv with sodium chloride 0.9% vdv intravenous infusion 320 405 polygelinc 3.5% solution with electrolytes for i.v. infusion ii. cardio vascular drugs 11.1 an larrhythmie 321 547 adenosine injection 6 mg / 2m1 322 181 amiodarone tablet 100 mg 323 182 amiodarone tablet 200 mg 324 183 amiodarone hydrochloride injection 50 mg / ml 325 211 veraparnil tablets ip 40 mg • 11.2 thrombolytic 326 209 streptokinase injection 15 lac units . 327 557 urokinase injection 5 lac unit 113 an iplatelet 328 444 aspirin delayed release tablet ( enteric coated ) 75 mg 329 188 clopidogrel tablet ip 75 mg 330 549 clopidogrel and aspirin tablet 75 mg + 75 mg 11.4 a dbyperteashre 331 184 amlodipine tablet ip 2.5 mg 332 185 amlodipine tablet 5 mg 333 186 atenolol tablet 50 mg 334 462 atenolol tablet 25 mg 335 191 datiazem tablet 30 mg 336 463 enalapril maleate tablet 10 mg 337 194 enalapril maleate tablet 5mg 338 195 enalapril placate tablet 2.5 mg 339 410 labetalol tablet 100 mg 340 411 labetalol hydrochloride injection 20 mg / 4m1 341 466 lisinopril tablet 2.5 mg 342 199 lisinopril tablet 5 mg 343 465 lisinopril tablet 10 mg 344 467 losartan tablet 25 mg 345 200 losartan tablet 50 mg 346 457 amlodipine and enalapril maleate tablet 5 mg +5mg 347 458 losartan potassium & amlodipine tablet 50 mg + 5mg 348 459 losartan potassium & hydroehlorothiazide tablet so mg + 12.5mg 349 460 amlodipine and lisinopril tablet smg +5 mg , etc....

Sawai Man Singh Medical College - Rajasthan

33980601 tender for supply of generic drugs and medicines for hospital use tender for supply of generic drugs and medicines for hospital use , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) tab. , calcium phosphate 200 ml syrup , cefipime 1000mg + tazobactum 125mg inj. , cefoperazone 1gm+tazobactum 125mg inj. , cefpodoxime proxetil oral suspension 50mg syrup , cefuroxime 1gm inj. , cefuroxime axetil oral suspension 125mg / 5ml syrup , cetrorelix acetate 0.25 mg inj. , diltiazem 25 mg inj. , dydrogesterone 10mg tab. , estradiolvalerate 2 mg tab. , etomidate 20 mg inj. , etomidate mct / lct 10ml vial inj. , fluconazole 100mg inj. , fsh 150 iu inj. , fsh 75 iu inj. , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu inj. , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu inj. , inositol + myoinositol 1000mg tab. , invert sugar 10% ( fructodex 10% ) 500 ml inj. plastic bottle , isolyte p 10% 500 ml inj. glass bottle , low molecular wt. heparin 0.4mg inj. , mephentermine 50mg / ml inj. , meropenem 2gm inj. , methotrexate 1000 mg inj. , methylene blue inj. , normal saline 1000 mlglass bottle inj. , ondansetron oral suspension syrup , pheniramine 25 mg tab. , phenobarbitone 20mg / 5ml in 100ml syrup , placental extract 2ml inj. , prostaglandin 500mcg / ml inj. , recombinant fsh 150 iu inj. , recombinant fsh 300iu inj. , recombinant hcg 250 iu inj. , recombinant lh 75iu inj. , sildenafil 0.8mg inj. , sildenafil 20 mg tab. , teicoplanin 200 mg inj. , triptorelin 0.1 mg inj. , triptorelin 3.75 mg inj. , vasopressin 3ml inj. , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg [ 492 ] , acyclovir sodium 500mg inj. , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , adenosine injection ip 6 mg / 2ml , adrenaline injection ip 1mg / ml im / iv use , albendazole oral suspension ip 400 mg / 10ml [ 65 ] , albendazole tablets ip 400 mg ( detail in rc ) [ 66a ] , alcoholic anticeptic hand rub sol. 500ml , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , aloe vera mosituzing cream , alprazolam tab ip 0.5mg , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , amino acid 10% injection 100ml size , amino acid cap , amino acid withour sorbitol 250ml inj. , amino acid withour sorbitol 500ml inj. , amiodarone hydrochloride inj 50 mg / ml , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) [ 461 ] , amlodipine tablets ip 5 mg , amophous hydrogel with colloid silver wond dressing cream , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) [ 507 ] , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , amphotericin b inj ip 50 mg , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg [ 261a ] , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg [ 497 ] , antiseptic surgical and scrub composition: chlorohexidine gluconate 20% v / w with organic surfactants and free from sls with moisture and skin softener test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , aqueous progesterone 50mg inj. , argininesachets 10 gm , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , aspirin tablet ip ( gastro resistant ) 150 mg [ 679 ] , atracurium besylate 25mg / 2.5ml inj. , atracurium inj 10 mg / ml , atropine sulphate injection 0.6mg / ml , azithromycin 100mg / 5ml oral syrup / suspension [ nrd [ dh ] , azithromycin tab ip 500 mg , aztreonam injection 1gm , aztreonam injection usp 500 mg , balance hydroxy ethyl 6% tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100% biodegradable bag with polyolefin inj. , balance salt solution with ph. of 7.2 to 7.4 osmolarity 292 to 294 in 100% biodegradable double sterilised closed system polyolefin 500 ml bag , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) [ 445 ] , benzathine benzylpenicillin inj ip 12 lac units [ 81 ] , benzathine benzylpenicillin inj ip 6 lac units [ 82 ] , betahistine tab ip 16 mg , betahistine tab ip 8 mg , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bisacodyl tab ip 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , budesonide nebulizer suspension 0.25mg / ml , budesonide powder for inhalation 200 mcg [ 617 ] , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% 20ml ( without preservative ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) [ 773 ] , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size [ 793 ] , caffiene citrate oral solution oraldrop 03 ml , caffine citrate 02ml inj. , calamine lotion ip 100ml , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) [ 441 ] , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , cefixime tab ip 200 mg [ , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) [ 86 ] , cefotaxime injection ip 1 g , ceftriaxone 1 gm + tazobactum 125 mg injection , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 500mg / vial , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , chlorhexidine gluconate solution 5% 250 ml [ 447 ] , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chlorpheniramine maleate tab ip 4mg , cholecalciferol granules 60, 000 iu / gm , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablet ip 500 mg film coated , cis atracurium besylate injection 2 mg / ml in 5 ml vial , clindamycin capsule ip 300 mg , clindamycin phosphate injection ip 300 mg , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , clotrimazole cream ip 2% w / w , cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg cojugated estrogen , colistimethate injection ip 1m iu powder for solution , combikit of ( tab fluconazole150mg and azithromycin 1gm and secnidazole1gm ) each kit contain 1tab fluconazole150mg and 1 tab.azithromycin 1gm and 2 tab.secnidazole1gm . , compound sodium lactate inj. 500 ml ip ffs bottle , conjugated estrogen tabs usp 0.625 mg. , copper sulpate ( cuso4 ) , cough syrup / expectorant ( 50 ) ml , cyproterone acetate 2 mg and ethynil estradiol. 035mg tab bp [ nrd , danazol cap ip 50 mg , desflurane, 100ml inj , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , dextrose 5% 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , dextrose inj ip 10%500mlffs bottle , dextrose inj ip 25% w / v 500mlffs bottle , dextrose inj ip 5% 500mlffs bottle , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diclofenac each transdermal patch contain 200 mg diclofenac patch , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg [ 483 ] , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) [ 19 ] , diclofence 50 mg + paracetamol 325 mg+ serratiopeptidase 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine tab ip 10 mg , digoxin inj ip 0.25 mg / ml , diltiazem tabs ip 30 mg film coated , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , distilled water 10ml inj. , distilled water 500ml bottle inj. , dns 5% 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , domperidone oral drops 10mg / ml ( 10ml ) , domperidone tab ip 10 mg , dopamine hydrochloride inj ip 40 mg / ml , doxycycline cap ip 100 mg , doxycycline for injection 100 mg , drotaverine hydrochloride inj 40 mg / 2 ml , drotaverine tab ip 40 mg , enoxaparim inj. 20mg / 0.2ml , enoxaparim inj. 40mg / 0.4ml , enzymatic instrument cleaner enzymatic detergent consists of neutral ph. or low alkaline to which one or more enzyme have been added tosurfactant and stabilizing agent. protease, lipaseamylase cellulose. test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. , escitalopram tab ip 10 mg , esmolol hydrochloride injection 10mg / ml 10ml size , ethamsylate inj 250 mg / 2ml ( im / iv ) , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) [ 745 ] , ethynil estradiol 0.02mg and desogestral 0.15mg tablets [ nrd 628 ] [ m ] , eusol soluction 500 ml , fentanyl citrate injection 50mcg / ml , fentanyl citrate injection ip 2 ml , feracrylum 1% w / v sterile solution 100 ml , ferric carboxymaltose injection 50 mg / ml 10 ml size , fluconazole tablets ip 150mg , folic acid tab ip 5 mg , folinic acid injection , formaldehyde solution ( 34.5 per. 38 per. ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , framycetin sulphate cream 1 o / o 100 gm pack [ 685 ] , framycetin sulphate cream 1 o / o 30gm pack [ 684 ] , frusemide tab ip 40 mg , fumigation 1 ltr sol. , furosemide injection ip 10mg / ml ( im and iv use ) , fusidic acid cream ip 2% , gentamycin injection ip 80mg / 2ml ( im / iv use ) [ 116 ] , gluteraldehyde solution 2% , glycerin ip 100 ml , glycopyrrolate inj ip 0.2 mg / ml , goserelin acetate implant 3.6 mg inj. , haloperidol inj ip 5 mg / ml , halothane bp solution , hand sanitizer total + 50ml , heparin 50 iu benzyl nicotinate 2 mg ointment [ nrd 436 ] [ m ] 20 gm , heparin sodium inj ip 5000 iu / ml ( im / iv use ) [ 174 ] , hormonalintra uterine contraceptive device , human chorionic gonadotropin injection ip 10000 i.u. , human chorionic gonadotropin injection ip 5000 i.u. , human milk fortyfier hmf 05 mg , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydrogen peroxide solution ip 6 o / o ( 20 vol ) [ 248 ] , hydroxychloroquine sulphate tab 200 mg , hydroxychloroquine sulphate tab 400 mg , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , hydroxyprogesterone inj ip 250mg / ml , hyoscine butyl bromide tablets ip 10mg , hyoscine butylbromide inj ip 20 mg / ml , ibuprofen tab ip 400 mg ( coated ) , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , instrument rust removerphosphoric acid 25% and cleaner. instrument strains rust remover with chelating agent with amphoteric solution compatible with manual and ultrasonic machine. test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges [ 680 ] , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , ipratropium bromide nebulizer solution 250 mcg / ml , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , isoflurane usp inj. 100ml , isophane insulin inj ip 40 iu / ml , isoprenaline injection ip 2mg / ml , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , itraconazole cap 100 mg [ 118 ] [ p ] , ivermectioni.p. tab 12 mg , ketamine inj ip 50 mg / ml [ 8 ] , labetalol hcl inj ip 20mg / 4ml , labetalol tab ip 100mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , l arginine+proanthocynadine granules 3mg sachet , legols iodine soluction100 ml , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levetiracetam injection 500mg / 5ml , levetiracetam tablet ip 500 mg , levoceitrizine tablet 5mg , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , levofloxacin tablets ip 250 mg , levofloxacine 500mg / 100 ml injection , lignocaine ( preservative free ) 2% injection [ nrd [ m ] 10ml , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , linezolid inj 200mg / 100ml , liposomol amphotericine injection b 50mg , liquid medical oxygen ( lmo ) , liquid paraffin ip 100 ml , liquid paraffin ip 400 ml , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , luprolide multidose vial 04 mg , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , mannitol inj ip 20% w / v , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , mct oil 100ml , medical device sterlization solution nabo3 nh2o 50% w / w aldehyde free, biodegradable, safe and non hazardous. it can be used for sterilization in all medical device and instrument test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , medroxyprogesterone acetate tablets ip 10 mg [ 605 ] , mefenamic acid 250mg and dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg and dicyclomine hydrochloride10mg , meropenem inj ip 500 mg , meropenem inj. ip 1gm , metformin tab ip 500 mg , methotrexate inj ip 50 mg / 2 ml , methyl prednisolone sodium succinate for injection usp 500 mg , methyldopa tab ip 250mg film coated , methyle blue stain powder 25 gm , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , methylprednisolone acetate40mg inj. , methylprednisolone acetate 125mg inj. , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , metoprolol tablets ip 25 mg , metronidazole inj ip 500 mg / 100ml , midazolam inj ip 1 mg / ml , mifepristone tab ip 200mg , mifepristone tab ip 25 mg , milk low birth formula powder , misoprostol tab ip 100 mcg , misoprostol tab ip 200 mcg , misoprostol tab ip 25 mcg , misoprostol tab ip 600 mcg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size [ dh ] , nalbuphine inj. 10mg / ml01 ml , nanosol gel polymer disinfectant 60%c14, 30% c16, 5% c12, 5% c18, …….10% 68%c12, 32% c14………10% inert ingredient ………80% usepa registration number mandatory. usepa certificate claim on n corona virus to be submitted. test report from internationally acclaimed certified lab to be submitted. the product should be ce / iso certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. certificate should be authorized by a member of multilateral recognition arrangement. american / european certificate of free sale mandatory. product should be registered under fifra section 3 ( c. ) 9 under the provisions of pr notice 98 10. , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / , natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , neostigmine inj ip 0.5 mg / ml , neostigmine injection ip 2.5mg / 5ml , nifedipine sublingualtab , nitrofurantoin tab ip 100mg , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , norethisterone tab ip 5 mg [ 296 ] , normal saline 0.9% 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , normal saline 0.9% 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , normal saline 0.9% 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin tab ip 200 mg [ , oitment mupirocin ip 2% , olanzapine tab ip 5 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ondansetron orally disintegrating tablets ip 4mg , ors powder ip , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) [ , oxytocin inj ip 5 iu / ml , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol infusion 1000 mg in double sterilised closed system 100% biodegradable eco friendly polyolefin 100 ml bag inj. , paracetamol infusion ip 1% w / v 100ml size , paracetamol inj. 150 mg / ml , paracetamol tab ip 500 mg , pentazocine inj ip 30mg / ml ( im / iv use ) , pentoprazole inj 40 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone inj ip 200mg / ml , phenytoin syrup 125 mg , phenytoin tab ip 100 mg ( film coated ) , piperacillin + tazobactum for injection ip 4gm+500mg , piperacillin injection 2 gm + tazobactom 250mg ip , polymixin sulphate b injection usp 5 lac i.u. [ 716 ] , polymyxin b for injection 1 million inj. , potassium chloride inj. 0.15 gm / ml10ml , povidone iodine ointment 5% 15 gm , povidone iodine pessary , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 500ml , povidone iodine solution ip 10 % 100ml bottle , povidone iodine solution ip 5 % 500 ml , povidone iodine solution ip 5% 100ml bottle [ 450 ] , prednisolone tab ip 20 mg , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , preglac powder , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , progesterone inj 200 mg / 2ml , propofol inj ip 10 mg / ml , propofol mct / lct with oleic acid iv inj. , propranolol tab ip 40 mg , protein powder 200 gm , pulmosil 10ml inj. , racecadotril sachet 30 mg sachet , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , ranizumab 10mg / ml injection , remdesivir injection 100mg / 20ml , ringer acetate infusion 500 ml , ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , ropivacaine 0.75% 20ml vial inj. ip [ nrd 361 ] [ m ] , ropivacaine 0.75% 3 ml ampule ( heavy ) injection [ nrd 362 ] [ m ] , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , sapagard gel ( feracrylum ) , serrapiopeptidase tab. 10 mg , serrapiopeptidase tab. 20 mg , sildenafil 10mg / 12.5 ml for iv inj. , soda lime specification: • it should be medical grade sodalime • its granules should be of “d” shape • its dust content should be less than 0.25 % • it should contain sodium hydroxide 0 4% by weight and calcium hydroxide over 85% by weight • it should consistently absorb 150 litres of co2 per kg of sodalimebefore experiencing 0.5% co2 breakthrough • its hardness should be of optimum level ( 99% uspxxii ) • it should change color from white to violet • it should be iso and ce. , sodium chloride 0.3 % 100ml inj. , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 500mlffs bottle , sodium chloride inj 0.9 %ip 500 mlffs bottle , sodium chloride inj 0.9 % ip 1000 ml ffs bottel , sodium chloride injection 0.9 % ip 100 ml ffs bottle , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 04 ml ( natural surfactant ) , surgical spirit ip ( 100 ml ) , surgical spirit ip ( 500 ml ) , telmisartan tablets ip 40 mg , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml inj. , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) [ 374 ] , thiopentone inj ip 0.5 g , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , ticyline inj. , tocilizumab 400 mg inj. , topical heparin solution 1000iu / ml , torsemide tab 10 ip mg , tramadol inj 50 mg / ml , tranexamic acid injection ip 100mg / ml 5ml size , tranexamic acid tablets ip 500 mg , trypsin chymotripsin tablet ( each enteric coated tablet contains 1 lacks unit of enzymetic activity ) , ursodeoxycholic acid tablets ip 300 mg , vancomycin for intravenous infusion ip 1 gm [ 524 ] , vancomycin for intravenous infusion ip 500 mg [ 523 ] , vecuronium bromide for injection 4mg ( freeze dried ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) [ 397 ] , vitamin d3 800iu / ml drop 15ml , vitamin d3 oral solution 60000 iu , vitamin e capsule 400 mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection , water for inj ip , xylocard 2% 50ml inj. , zinc oxide ointment , zinc sulphate dispersible tablets ip elemental zinc 10 mg...

Sms Medical College - Rajasthan

33971959 tender invited for supply of generic drug and medicine at zenana hospital jaipur 1. bupivacaine inj. ip 0.5% 2. drotavering hydrochloride inj 40 mg / 2 mi 3• inj.halothane bp 4. inpsoflurane usp 5. ketamine inj ip 50 mg / mi 6. lignocaine inj ip 2 0 / 0 7. propofol inj ip 10 mg / mi 8. thiopentone inj ip 0.5 g 9. diclofenac sodium inj ip 25 mg / mi ( im / iv use ) 10. fentanyl citrate injection ip 2 ml 11. morphone sulphate inj ip 10mg / mi 12. paracetamol inj, 150 mg / mi 13. pentazocine inj ip 30 mg / mi ( im / iv use ) 14. adrenaline injection ip 1mg / ml im / iv use 15. dexamethasone inj ip 8mgj2mi 16. hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) 17. pheniramine inj ip 22.75 mg / mi 18. promethazing inj ip 25mg / ml 19. naloxone inj ip 0.4mg / ml 20. amikacin inj ip 100 mg 21. amikacin inj ip 500 mg lir. nmphotericin b inj ip 50 mg 4. i arnold11in injection ip 500 mg benzathine benzylpenicillin inj ip 12 lac units 25. benzathine benzylpenicillin inj ip 6 lac _ units 26. cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium _ eq. to sulbactum 0.5gm ) ( im / iv use ) 27. cefotaxime injection ip 1 g 28. cefotaxime inj ip 500 mg / 250 mg 29. ceftazidime inj ip lg 30. ceftazidime inj ip 250 mg 31. ceftazidime inj ip 500 mg 32. ceftriaxone inj ip lg / vial 33. chloroquine phosphate inj ip 40 mg / ml 34. ciprofloxacin injection ip 200mg / 100m1 35. gentamycin injection ip 80mg / 2m1 ( im / iv use ) 36. meropenem inj ip 500 mg 37. meropenem inj ip 250 mg 38. metronidazole inj ip 500 mg / 100m1 39. bleomycin injection ip 15mg ( bleomycin sulphate injection 15units ) 40. leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml 41. methotrexate inj ip 50 mg / 2 ml 42. paclitaxel inj ip 260 mg 43. paclitaxel inj ip 100 mg 44. enoxaparin sodium inj ip 60 mg 45. ethamsylate inj 250 mg / 2m1 ( 1m / iv ) 46. heparin sodium inj ip 5000 iu / m1 ( 1m / iv use ) 47. vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) or amiodarone hydrochloride inj 50mg / m1 i.; digoxin inj ip 0.25 mg / ml 50. dobutamine inj ip 50mg / m1 / 250mg ( vial / ) dobutamine inj ip 250 mg / 5m1 ( amp ) 51. dopamine hydrochloride inj ip 40 mg / ml 52. magnesium sulphate inj. ip 500mg / m1 ( 50%w / v ) 53. nitroglycerin inj 5 mg / ml 54. diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) 55. gadodiamide inj. 0.5mml / m1vial 56. furosemide injection ip 10mg / mi ( im and iv use ) 57. mannitol inj ip 20% w / v 58. dicyclomine inj ip 10 mg / m1 59. hyoscine butylbromide inj ip 20 mg / ml 60. metoclopramide inj ip 10mg / 2m1 61. ondansetron inj ip 2mg / mi 62. pentoprazole inj 40mg 63. ranitidine hcl injection ip 50mg / 2m1 64. biphasic isophane insulin inj ip ( 30 % soluble insulin and 70% isophane insulin ) inj. 40 iu / ml ( r dna origin ) 65. carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 66. hydroxyprogesterone inj ip 250mg / m1 67. isophane insulin inj ip 40 iu / m1 68. progesterone inj 200 mg / 2m1 69. insulin injection ip ( soluble insulin / neutral nsu . j . 1 .dna • • 70. human anti d immunoglobulin injection 300mcg ( im use ) 71. atracurium inj 10 mg / ml 72. glycopyrrolate inj ip 0.2 mg / ml 73. midazolam inj ip 1 mg / ml 74. neostigmine inj ip 0.5 mg / ml 75. succinylcholine _ inj. ip 50 mg / ml ( iv use ) 76. valethamate bromide inj 8mg / ml 77. isoxsuprine inj ip 5 mg / ml 78. methylergometrine inj ip 0.2 mg / ml 79. oxytocin inj ip 5 iu / m1 80. diazepam inj ip 10mg / 2m1 ( 1m / iv use ) 81. aminophylline inj ip 25 mg / ml 82. compound sodium lactate inj. ip 83. dextrose inj ip 25% w / v 84. dextrose inj ip 10% 85. dextrose in ] ip 5% 86. multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) 87. multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 88. potassium chloride inj. 0.15 gm / ml 89. sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 90. sodium chloride in ] ip 500 ml 91. calcium gluconate inj ip 10% ( iv use ) 92. vitamin b complex inj nfi 93. sodium bicarbonate inj ip 7.5% w / v 94. water for inj ip 95. labetalol hci in } ip 20mg / 4m1 96. betamethasone sod phos inj ip 4mg / m1 97. vecuronium bromide for injection 4mg ( freeze dried ) 98. phenobarbitone inj ip 200mg / m1 99. hyaluronidase injection ip each vial contains hyaluronidase ip 1500i.u. 100. piperacillin + tazobactum for injection ip 4gm+500mg 101. torsemide inj 10 mg / ml y .02. meropenem inj. ip 1gm 103 lohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 104. iron sucrose injection usp / bp 20mg / m1 ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 105. 106. acetylcystine solution usp ( injection ) 200 mg / ml amikacin inj ip 250 mg 107. amoxicillin and potassium clavulanate inj ip 1.2gm 108. artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1m1 ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5mlampoule ) 109. aztreonam injection usp 500 mg 110. linezolid inj 200mg / 100m1 111. ofloxacin infusion ip 200mg / 100 ml ( in naci inj ) 112. carboplatin injection ip 150 mg 113. carboplatin injection ip 450 mg 114. cisplatin inj ip 10 mg / 10 ml 115. adenosine injection ip 6 mg / 2m1 116. isoprenaline injection ip 2mg / ml 117. noradrenaline injection ip 2 mg / ml 118. sodium chloride injection ip 100 ml 119. mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 120. neostigmine injection ip 2.5mg / sml vitamin k 1 ( phytomenadione ) ip 1mg / 0.5m1 injection with syringe ( detail in rc ) 121. 122. atropine sulphate injection 0.6mg / m1 123. fentanyl citrate injection 50mcg / m1 124. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous 0........, solution 350 mg iodine / ml. lir levetiracetam injection 500mg / 5m1 126 aztreonam injection 1gm 4 , , , clindamycin phosphate injection ip 300 mg 128. polymixin sulphate b injection usp 5 lac i.u. 129. meropenem injection ip 250 mg 130. colistimethate injection ip 1m iu powder for solution 131. n butyl alcohol injection 0.26mg / smi, citric acid 2.5mg / 5m1 and sod. chloride solution 5 ml size 132. tranexamic acid injection ip 100mg / m1 5misize 133. i esmolol hydrochloride injection 10mg / m1 10mi size 134. i hepatitis b immunologlobin injection ip 200 i.0 135. hepatitis b immunologlobin injection ip 100 i.0 136. human chorionic gonadotropin injection ip 5000 i.u. 137. ferric carboxymaltose injection 50 mg / ml 10 ml size 138. caffeine citrate usp injection 20mg / m1 ( equivalent to 10 mg caffeine base / mi ) 3mi size 139. amino acid 10% injection 100mi size 140. amino acid 10% injection 250m1 size 141. inj poractant alpha 80 mg / mil in pack of 1.5 ml ( detail in rc ) 142. human immunoglobulin inj with 12%igm, 12%iga, 76%i gg in pack of 10m1 ( 0.5gm ) 143. human immunoglobulin inj with 12%igm, 12%ig4, 76%1 gg in pack of 10m1 ( 0.5gm ) 144. kabalyte ( multipal electrolyte inj ) 145. inj mephentermine 146. amphotericin b inj . ( iiposonal ) 147. fluconazole inj .48. 149. inj propfol with mct+ict isolyte —p inj 150 inj teicoplain 151. 152. inj sidenafil 10mg !nj prostagladine 500mg 153. inj placentrax 154. inj sodium chloride 1000m1 155. inj insulin detemir / levemir ( long aceting ) 156. inj tt 0.5 ml 157. inj leuprolide 158. inj xylocard 159. inj metoprolol 160. inj fentanyl 161. inj esmlol 162. progesterone injection 50 163. glyceryl trinitrate injection, diluted 5mg / m1 164. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg iodine / ml non ionic 50m1 165. polymyxin b for injection 1 million 166. potassium chloride for injection 167. sodium bicarbonate injection 168. inj. dopamine 169. inj.adrenaline 170. inj.dobutamine 171. inj.phenobarbitone 172. inj.midazolam 173. inj.calcium gluconate 174. inj.caffine citrate 175. inj.amikacin 177 inj amphoterlcin b ( liposomal ) inj.surfactant ( porectent ) 179 inj.human albumin 180. inj.prostoglandin 181. inj.linazolid 182. inj.ciplox 183. inj.levofloxacin 184. polygeline 3.5% solution with electrolytes for i.v. infusion 185. hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 186. ofloxacin infusion ip 200mg / 100 ml ( in naci inj ) 187. vancomycin for intravenous infusion ip 500 mg 188. vancomycin for intravenous infusion ip 1 gm 189. mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 190. hepatitis b immunoglobulin 2001110.4mi. im / sc pfs vial 191. paracetamol infusion ip 1% w / v 100m1 size 192. instrument rust remover composition: phosphoric acid 25% and cleaner. instrument strains rust remover with chelating agent with amphoteric solution compatible with manual and ultrasonic machine. test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 193. medical device sterlizat►on solution nabo3 nh2o 50% w / w aldehyde free, biodegradable, safe and non hazardous it can be used for sterilization in all medical device and instrument test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499 2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries 194. enzymatic instrument cleaner enzymatic detergent consists of neutral ph. or low alkaline to which one or more enzyme have been added to surfactant and stabilizing agent. protease, lipase amylase cellulose. test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 90012015 by a notified body in regulated countries. 5lit 5 medical device sterlization solutio 195. nanosol gel polymer disinfectant 60%c14, 30% c16, 5% c12. 5% c18 10% 68%c12, 32% c14 10% inert ingredient 80% usepa registration number mandatory usepa certificate claim on n corona virus to be submitted. test report from internationally acclaimed certified lab to be submitted. the product should be ce / iso certified the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 :2015 by a notified body in regulated countries. certificate should be authorized by a member of multilateral recognition arrangement. american / european certificate of free sale mandatory product should be registered under fifra section 3 ( c. ) 9 under the provisions of pr notice 98 10. 196. antiseptic surgical and scrub composition: chlorohexidine gluconate 20% v / w with organic surfactants and free from sls with moisture and skin softener test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries 197. ringer acetate infusion 500 ml itnioil sot ( infusion set ) with airway m1, 1 needle ( paediatric llie ) ster110 111110%.111le 1111thioti ••i %%fill alk roc.. ) starlio 1.11 to amy sodium 1. 111011, 1r and 0extrose 0 .0.. ) , immo!, won, pal a, et.ilika illtml, , 11 410 n►g with both i empri e idollt ‘ aw. ..tilay 10% 1`, 11, 1 ( ot.ffilol tiltwooli i000 rug with both i olupel e% mott caps spray 10% ki161% al spirit ip ( 100 ml ) . 204• surgical spirit ip ( 500 ml ) 205. savalon 11. 206, savlon 500 ml 207. dextrose with sod.chlorlde polypack 5% soomi 208. distilled water 10m1 209. 210. distilled water 500m1 distilled water 5 ltr — 211. sodium chloride and dextrose 0.45% infusion 500m1 212. folinic acid 200mg / vial 213, sodium chloride 3% 100m1 214. prostaglandin 500mcg / m1 215. azithromycin 10 ml vial equalvelent to 500 mg 216. caffeine cirate 20mg / mi 217. carbetocin 1m1 / 100micro. 218. ceftriaxone and sulbactam 1.5g 219. clindamycin 600mg / 4m1 220. compound sodium lactate ( ringer lactate ) in glass bottle 500m1 221. folinic acid 200mg / vial 222. azithromycin 10 ml vial equaivelent to 500 m 223. fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography 224. folic acid +methylcobalamine 10 ml pack fsh 150 ill gdw 5% glass bottle / 500m1 228. glyceryl trinitrate injection, diluted 5mg / m1 229. hp hmg ( highly human menopausal parodied gonadotropin ) 150 iu 230. insulin aspen 231. insulin lispro 232. i invert sugar 10% ( fructodex 10% ) 500 cc 233. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg iodine / ml non ionic 50 ml 234. isolyte p 10% 500 ml 235. levofloxacine 500mg / 100 ml 236. lignocaine ( preservative free ) 2% 237. low molecular wt. heparin 0.4mg 238. mephentermine 50mg / m1 239. methylene blue 240. metotrexate 15mg ( preservative free ) 241. midazolam 5mg / m11 ml 242. multivitamin 10 ml 243. nandrolone decanoate 100mg 244. nandrolone decanoate 50 mg 245. normal saline 500 nil glass bottle 246. normal saline 1000 ml glass bottle 247. paracetamol infusion 500 mg with both temper evident caps spray 10% 248. paracetamol infusion 1000 mg with both temper evident caps spray 10% 249. procaine penicillin fortified 2 lack 250. teicoplanln 200 mg 251. teicoplanln 400 mg 7 vitt / min 0 ( 600000 iu ) insulin glargine 100 iu per mlinrefilled pen ____ _. insulin. 50 / 50 — as human albumin 20% in 50 ml vial 25 8. tetanus vaccine ( adsorbed ) ip in 0.5 ml 257. in ) . propofol mctact with olelcacid in ) . iv 258. in ) . paracetamol infusion 1000 mg in double sterilized closed system 100 % biodegradable eco friendly polyolefin 100 ml bag 259. inj.0.9% normal saline 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 260. inj.0.9% normal saline 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 261. in ) . ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag_ 262. int ringers lactate 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 263. inj.5% dextrose 500 ml in 100% .., , r tail biodegradable non dehp double sterilized polyolefin closed system bag 264. inj.5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 265. inj.0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 266. inf. balance hydroxy ethyl 6 % tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin 267. inj. hydroxy ethyl 6%o tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin ablets 268. amlodlpine tab ip 2.5 mg 269. amiodipine tablets ip 5 mg 270. atenolol tab ip 50 mg 271. atorvastatin tab ip 10 mg 272. clopidogrel tab ip 75 mg digoxin tab ip 0.25 mg. 274. diltiatem tabs ip 30 mg film coated 27, enalaprll maleate tab ip 5mg — 276. enalaprll maleate tab ip 2.5mg 277. isosorbide dlnitrate tab ip 5 mg 278. isosorblde mononitrate tabs ip 20 mg 279. usinopril tab ip 5mg 280. losartan tab ip 50 mg 281. methyldopa tab ip 250mg film coated 282. propranolol tab ip 40 mg 283. verapamil tab ip 40 mg film coated 284. povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 285. frusemide tab ip 40 mg 286. hydrochlorthiazide tab ip 12.5 mg 287. torsemlde tab 10 ip mg 288. antacid tablets.formula, each chewable tablet contains magnesium trisllicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 289. blsacodyl tab ip 5mg 290. dicyclomine tab ip 10 mg 291. domperldone tab ip 10 mg 292. loperamide tab ip 2 mg 293. metoclopramide tab ip 10 mg 294. ranitidine tab ip 150mg 500. glimepiride tab ip 1mg 301. metformin tab ip 500 mg ( film coated ) 302. norethisterone tab ip 5 mg 303. thyroxine sodium tablets ip 100mcg 304. thyroxine sodium tablets ip 50mcg 305. neostigmine tab ip 15 mg 306. isoxsuprine tab ip 20 mg 307. methylergometrine tab ip 0.125 mg 308. misoprostol tab ip 200 mcg 309. alprazolam tab ip 0.25 mg 310. alprazolam tab ip 0.5mg 311. salbutamol tablet ip 4 mg 312. salbutamol tab ip 2 mg 313. theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) 314. theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 315. tinidazole tab ip 300 mg 316. tinidazole tab ip 500 mg 317. ranitidine tab ip 300mg 318. dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 319. aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 320. metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg 211 athaffnern;n 1 liselrnekinrirla ici ietaineta • release ) and glimepiride tablets ip ( metformin hydrochloride ( sustain ed release ) 500 mg, glimipiride 2mg ) 322. glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 323. losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) 324. losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) 325. amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine smg, atenolol 50mg ) 326. atenolol tab ip 25 mg 327. hydrochlorthiazide tab ip 25mg 328. losartan tab ip 25 mg 329. ascorbic acid tab ip 500 mg 330. ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 331. ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 332. folic acid tab ip 5 mg 333. multivitamin tablets nfi formula sugar coated vit a 2500 iu vit 81 2mg vit b6 0.5mg vit c 50mg calcium pantothenate lmg vit d3 2001u vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 334. vitamin b complex tablet nfi ( prophylactic ) 81 2mg 82 2mg 86 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) 335. labetalol tab ip 100mg 336. nitrofurantoin tab ip 100mg 337. hyoscine butyl bromide tablets ip 10mg 338. drotaverine tab ip 40 mg 339. zinc sulphate dispersible ta blets ip elemental zinc 10 mg 340. diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 341. aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 342. mefenamic acid tablets bp 500 mg 343. 344. cetirizine, phenylephri ne & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab levofloxacin tablets ip 250 mg 345. linezolid tablets ip 600 mg 346. ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 347. methotrexate tablets ip 10 mg 348. bromocriptlne tablets ip 2.5 mg 349. atorvastatin tablets ip 40 mg 350. clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 351. metoprolol tablets ip 25 mg 352. metoprolol succinate extended release tablets ip 50 mg 353. telmisartan tablets ip 40 mg 354. finasteride tablets ip 5 mg 355. flavoxate tablets ip 200 mg ( coated tablet ) 356. drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 357. lactic acid bacillus tab 60 million spores 358. ondansetron orally disintegrating tablets ip 4mg 359. ursodeoxycholic acid tablets ip 300 mg 360. medroxyprogesterone acetate tablets ip 10 mg 361. chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) 362. mifepristone tab ip 200mg 363. calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) 364. ramipril tablets ip 2.5 mg 365. levoceitrizine tablet 5mg 366. montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 367. levetiracetam tablet ip 500 mg 368. levetiracetam oral solution / suspension 100mg / m1 369. co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethox azole 800mg ) 370. tenaligliptin tablet ip 20mg 371. levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 372. letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) 373. ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) 374. rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20mg ) 375. rosuvastatin tablet 10 mg 376. doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 377. natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 378. cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 379. diclofenac+ parcetamol+ serratiopeptidsase tab 380. dehydrogestrone tab 381. estradiol tab 382. povidon vaginal pessaries tab 383. vit b 12 tab 384. tab levtiracetcetam 500 mg 385. tab conjugated estrogen 386. tab mirabegum 387. tab derifenacin 388. tab propar 389. tab alone / ramloxifene 390. tab cyproterone acetate & ethinyloestradiol 391. tab centchronam 392. tab dinogest 393. progestron only pills 394. tab chymoral forte 395. lasix tab 396. tab lactare 397. faskit ( fluconazole / azthomycine & secnidazole tab 398. tab telmisarton +hidrocylorthiaozide 399. tab mefenamic acid +dicyclomine hydro 400. coq 300mg ( capsule of coenzyme 010 with lycopene, selenium & omega 3 fatty acid ) 401. clindamycin capsule ip 150mg 402. clindamycin capsule ip 300 mg 403. oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) 404. oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) 405. oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) 406. natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 407. vitamin e capsule 400 mg 408. coq 300mg ( capsule of coenzyme q10 with lycopene, selenium & omega 3 fatty acid ) 409. aceclofenac+paracetamoi+ serratiopeptidase ( 100+325+15 mg ) 410. cefpodoxime 200mg cefpodoxime cv 375 cyproheptadine 4mg 411. 412. 413. cyproterone acetate 2 mg +ethynil estradiol. 035mg 414. dienogest 2mg 415. dydrogesterone 10mg 416. estradiol valerate 2 mg 417. ethynil estradiol 0.02mg+ tab desogestral 0.15mg 418. inositol + myoinositol 1000rng 419. levetiracetam ip 250 mg 420. mirabegeron 25 mg 421. mifepristone 25mg 422. nifidipine 20mg 423. paracetomol 650 mg 424. progesterone only pills 425. propranolol 40 mg sr 426. rosuvastatin 10mg + fenofibrate 160mg 427. serratiopeptidase 10mg 428. serratiopeptidase 20 mg 429. tramadol 37.5mg + paracetamol 325mg 430. trypsin chymotripsin 431. ulipristal 5mg 432. hepato protective tablet each film coated tablet to contain matadoxine 500mg silymarin 140mg l ornithine l•aspartate 150mg pyridoxine hydrochloride 3 mg 433. spores of polyantibiotic resistant bacillus clausii 2 billion capsules 434. iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains ferne saccharate ( in micro encapsulated form ) 75mg eq. to elemental iron 30mg phospholopid 167 mg eq. to phosphatidylserine 100 mg 435. cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg conjugated cstrogen 436. telmisartan40mg + hydroclrothaizide 12.5 mg i.p. each tablet contain telmisartan40mg + hydroclrothaizide 12.5 mg 437. telmisartan80mg + hydroclrothaizide 25 mg i.p. each tablet contain telmisartan80mg + hydroclrothaizide 25 mg 438. 439. mefonamic acid 250mg+ dicyclomine hydrochloride each tablet contain mefonamic acid 250mg+ dicyclomine hydrochloride cornbitkit of ( tab ) fluconazole150mg + azithromycin 1 gm 7 secnidazole 1 gm each kit contain tab fluconazolelsomg + azithromycin 1 gm 7 secnidazole 1 gm 440. zideovudine 60 + lamivudine 30 441. lung surfactent 1.2 ml ( 50 mg ) lypholised 442. amphotericin b lipid complex 10 mg 443. ionic solution of silver nutrate with tween twenty 100 ml :ream 444. 445. 446. 447. 448. 449. 450. clotrimazole cream ip 2% w / w acyclovir cream 5% cetrimide cream ip 15 gm fusidic acid cream ip 2% silver sulphadiazine cream ip 1% 50gm tube dinoprostone cream / gel 0.5 mg dinoprostone in syringe beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) 451. betamethasone diproplonate cream ip 0.05% 452. silver sulphadiazine cream ip 1% 500 gm jar 453. framycetin sulphate cream 1 0 / 0 30gm pack 454. framycetin sulphate cream 10 / 0 100 gm pack 455. 456. 457. estradiol cream estrogen cream sumag cream 458. neomycin sulphate cream ointment 459. neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 ili / gm 460. lignocaine gel 1p 2% a 461. compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 0 / 0 462. ointment containing lidocaine ip 3 0 / 0 zinc oxide ip 5 ao , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o [ 219 ) 463. povidone iodine ointment 5% 15 gm 464. povidone iodine ointment usp 250 gm 465. coal tar 6% & salicylic acid 3% ointment 466. acyclovir eye ointment ip 3% w / w 5gm size 467. chloramphenicol 1% w / w eye ointment ip, 3gm size 468. thrombophobe ointment gel 469. i 470. f r` cc is antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil antacid liquid, each 5mi contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 471. diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 472. clindamycin phosphate gel usp 10 / 0 473. i metronidazole 1% and chlorhexidine gluconade 0.25% gel drops 474. ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / 0, enzocaine 2.7 0 / 0 , chlorbutol 5 olo, turpentine oil 15 o / o 475. domperidone oral drops 10mg / ml ( 10m1 ) 476. carboxymethylcellulos e eye drops ip 0.5% 477. phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% 478. kylometazoline nasal drops ip 0.1% 479. paracetamol drops paediatric paracetmol oral suspension ip ( each mi contains paracetamol 150mg ) 480. ciprofloxacin eye drops ip 0.3 o / o w / v 481. saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 482. multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 lmg, riboflavine phosphate sodium 2mg, d•panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl lmg, cyanocobalamin lmcg, lysine hcl 10mg 483. lactulose solution 484. i digoxin 0.25% solution 485. vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 486. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 487. acetylcystine solution usp ( injection ) 200 mg / ml 488. colistimethate injection ip 1m iu powder for solution 489. n butyl alcohol injection 0.26mg / 5m1, citric acid 2.smg / smi and sod. chloride solution 5 ml size ecaffiene citrate oral solution human albumin solution ip 20% 490. x491. 492. povidone iodine solution ip 5 % 500 ml 493. formaldehyde solution ( 34.5 per. — 38 per. ) 494. gentian violet topical solution usp lob 495. gluteraldehyde solution 2% 496. hydrogen peroxide solution ip 6 % ( 20vol ) 497. lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) ( 249 ] 498. povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 499. dicyclomine hydrochloride oral solution ip 10mg / 5m1 500. ipratropium bromide nebulizer solution 250 mcg / ml 501. salbutamol nebuliser solution bp 5 mg / ml 502. saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 503. chlorhexidine gluconate solution 5% 250 ml 504. povidone iodine solution ip 5% 100m1 bottle 505. potassium chloride oral solution u.s.p 500mg / 5m1 506. vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu 507. hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 508. povidone iodine solution ip 10 % 509. lactulose solution usp / bp 10gm / 15ml or 3.35 gm / sml 510. vitamin d3 oral solution 60000 iu 511. concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10litre cans 512. feracrylum 1% w / v sterile solution 100 ml 513 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5misize 514. balancesalt solution with ph.of 7.2 to 7.4 osrnolarity 292 to294 in 100% biodegradable bag with potyofin syrup 515. i cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, arlip ‘4. ) . 516. cough syrup / expectorant ( 50 ) ml 517. alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate 518. multi vitamin syrup 519. b. complex 520. calcium phosphate 200 ml 521. dextromethorphan hcl + chlorpheniramine 522. each 15 ml contains: milk of magnesia 11.25 ml• liquid paraffin 3.75 ml 170 ml 523. each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml 524. linezolid 100mg / 5m1in 30m1 525. sodium picosulphate oral suspension 526. sorbitol + tricholine citrate suspension 527. 528. 529. paracetamol drops paediatric paracetmol oral suspension ip ( each mi contains paracetamol 150mg ) albendazole oral suspension 1p 400 mg / 10m1 domperidone suspension ip 5mg / 5m1 530. 531. budesonide nebulizer suspension 0.25mg / m1 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 532. 533. 535. surgical cap disposable ( for surgeons ) ampicillin cap ip 500mg pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets pregabalin cap ip 7s m8 536. tramadol cap ip 50 mg — _ 537. tramadol cap ip 50 mg 538. amoxycillin cap ip 250mg 539. amoxycillin cap ip 500mg 540. doxycycline cap ip 100 mg 541. itraconazole cap 100 mg 542. danazol cap ip 50 mg 543. deferiprone cap 250mg 544. deferiprone cap 500mg 545. nifedipine cap ip 5mg 546. omeprazole cap ip 20 mg 547. l•ornithine l•aspartate ( 150mg ) + pancreatin ( 100mg ) 548. nifedipine sublingual pessary 549. povidone iodine powder 550. infant milk formula term 400 gm 551. infant milk pre trem baby ( lbw ) 400 gm sachet 552. hmf for pretem 553. l arginine+proanthocynadine granules 3mg / 5 mg tablets and in cation 554. 1 l arginine 3 gm + proantho cyaniding 75 mg 555. tab dehydro epiondrosterone sr 75 mg 556. tab anastrozole 3. mg 557. tab letrozole 2.5 mg 558. inj. certrorelix acetate 0.25 mg 559. lnj. menotropin 150 re 0.5 nil 560. lnj. menotropin 225 iu / 0.75 ml 561. highly purified hmg 75 / 150 iu 562. highly purified follicle stimulating hormone 75 / 150 iu 563. highly purified hcg 2000 / 5000 / 7500 / 10000 iu 564. natural microhized progesterone soft caps 100 / 200 mg 565. natural microhized progesterone soft caps 200 / 400 mg 566. inj enoxaparin 40 mg et 567. estradiol & dydrogesterone tab. 1 / 5 mg 568. combipack of estradiol and estradiol & dydrogesterone tab. 1 / 10 mg 569. combipack of estradiol and estradiol & dydrogesterone tab. 2 mg 2 / 10 mg 570. ubidecarenone capsules lisp 0100 / q300 ( co enzyme 010 ) 571. inj leuprolide acetate 3.75 mg 572. inj leuprolide acetate 1 mg / 0.5 ml 573. inj leuprolide acetate 4 mg / 4 ml 574. inj. buserlin acetate 0.5 mg / 0.5 ml 575. inj. buserlin acetate 7 mg / 7 ml 576. tab. diclofenac gastro resistant ip so mg 577. tab. ibuprofen and paracetamol ip ibuprofen 400 mg+ paracetamol 325 mg 578. tab. ibuprofen ip 400 mg 579. tab. paracetamol ip 500mg 580. tab. paracetamol ip 650mg 581. cap. tramadol ipsomg 582. tab. chlorpheniramine maleate ip 4mg 583. tab. prednisolone ip smg 584. tab. acyclovir 200mg 585. tab. albendazole ip 400mg 586. tab. amoxycillin and potassium clavulamate ip 500mg+125mg 587. cap. amoxycillin ipsoomg 588. tab. azithromycin ip 500mg 589. tab. cefixime ip 200mg 590. tab. chloroquine phosphate ip 250mg eq tov155mg of chloroquine base film coated 591. tab. ciproflixacin ip 500mg 592. capometrazole ip 20mg 593. tab. clotrimazole vaginal ip 500mg 594. cap. doxycycline ip 100mg 4011frar 70 595. tab. fluconazone ip150mg 596. cap. itraconazole ip 100mg 597. tab. metronidazole ip 200mg 598. tab. metronidazole ip 400mg 599. tab. norfloxacin ip 400mg 600. cap nifedipine ip 5mg 601. tab. nitedipine ip 10mg 602. dinoprostone cream / gel 0.5mg dinoprostone in syringe 603. tab. trenexamic acid 604. tab. clindamycin 150mg 605. tab. clindamycin 300mg 606. inj. bupivacaine hydochloride in dextrose usp each ml contains bupivacaine hydrochloride 5.0mg dextrose 80.0mg 607. inj. phenytoin 50mg 608. inj. cisplatin 50mg 609. inj. vancomycin 500mg 610. inj. vancomycin 1 gm 611. inj, normal human intravenous immunoglobuline 612. inj. surfactant 3m1 613. inj. feracrylum 1% w / v solution 614. dinoprostone gel 615. tab. ramipril tablets ip 5mg 616. cap. evening primosa 1000mg...

North Western Railway - Rajasthan

33970315 supply of clindamycin 300mg. inj. with solventclindamycin 300mg. inj. with solvent, clindamycin 300mg. inj. with solvent => limited...

Medical College - Rajasthan

33970279 tender invited for supply of generic drug and medicine at zenana hospital, jaipur , bupivacaine inj. ip 0.5% , drotavering hydrochloride inj 40 mg / 2 ml , inj.halothane bp , inj.isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , fentanyl citrate injection ip 2 ml , morphone sulphate inj ip 10mg / ml , paracetamol inj, 150 mg / ml , pentazocine inj ip 30 mg / ml ( im / iv use ) , adrenaline injection ip 1mg / ml im / iv use , dexamethasone inj ip 8mg / 2ml , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , pheniramine inj ip 22.75 mg / ml , promethazing inj ip 25mg / ml , naloxone inj ip 0.4mg / ml , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amphotericin b inj ip50 mg , ampicillin injection ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 500 mg / 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , chloroquine phosphate inj ip 40 mg / ml , ciprofloxacin injection ip 200mg / 100ml , gentamycin injection ip 80mg / 2ml ( im / iv use ) , meropenem inj ip 500 mg , meropenem inj ip 250 mg , metronidazole inj ip 500 mg / 100ml , bleomycin injection ip 15mg ( bleomycin sulphate injection 15units ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , methotrexate inj ip 50 mg / 2 ml , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , amiodarone hydrochloride inj 50mg / ml , digoxin inj ip 0.25 mg / ml , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , nitroglycerin inj 5 mg / ml , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , furosemide injection ip 10mg / ml ( im and iv use ) , mannitol inj ip 20% w / v , dicyclomine inj ip 10 mg / ml , hyoscine butylbromide inj ip 20 mg / ml , metoclopramide inj ip 10mg / 2ml , ondansetron inj ip 2mg / ml , pentoprazole inj 40mg , ranitidine hcl injection ip 50mg / 2ml , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70% isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , human anti d immunoglobulin injection 300mcg ( im use ) , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , isoxsuprine inj ip 5 mg / ml , methylergometrine inj ip 0.2 mg / ml , oxytocin inj ip 5 iu / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , aminophylline inj ip 25 mg / ml , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , calcium gluconate inj ip 10% ( iv use ) , vitamin b complex inj nfi , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , labetalol hcl inj ip 20mg / 4ml , betamethasone sod phos inj ip 4mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , phenobarbitone inj ip 200mg / ml , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , piperacillin + tazobactum for injection ip 4gm+500mg , torsemide inj 10 mg / ml , meropenem inj. ip 1gm , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , acetylcystine solution usp ( injection ) 200 mg / ml , amikacin inj ip 250 mg , amoxicillin and potassium clavulanate inj ip 1.2gm , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , linezolid inj 200mg / 100ml , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , adenosine injection ip 6 mg / 2ml , isoprenaline injection ip 2mg / ml , noradrenaline injection ip 2 mg / ml , sodium chloride injection ip 100 ml , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , neostigmine injection ip 2.5mg / 5ml , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection with syringe , atropine sulphate injection 0.6mg / ml , fentanyl citrate injection 50mcg / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , levetiracetam injection 500mg / 5ml , aztreonam injection 1gm , clindamycin phosphate injection ip 300 mg , polymixin sulphate binjection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , tranexamic acid injection ip 100mg / ml 5ml size , esmolol hydrochloride injection 10mg / ml 10ml size , hepatitis b immunologlobin injection ip 200 i.u , hepatitis b immunologlobin injection ip 100 i.u , human chorionic gonadotropin injection ip 5000 i.u. , ferric carboxymaltose injection 50 mg / ml 10 ml size , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , amino acid 10% injection 250ml size , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , kabalyte ( multipal electrolyte inj ) , inj mephentermine , amphotericin b inj . ( liposonal ) , fluconazole inj , inj propfolwith mct+lct , isolyte –p inj , inj teicoplain , injsidenafil 10mg , inj prostagladine 500mg , inj placentrax , inj sodium chloride 1000ml , inj insulin detemir / levemir ( long aceting ) , injtt0.5 ml , inj leuprolide , inj xylocard , inj metoprolol , inj fentanyl , inj esmlol , progesterone injection 50 , glyceryl trinitrate injection, diluted 5mg / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50ml , polymyxin b for injection 1 million , potassium chloride for injection , sodium bicarbonate injection , inj. dopamine , inj.adrenaline , inj.dobutamine , inj.phenobarbitone , inj.midazolam , inj.calcium gluconate , inj.caffine citrate , inj.amikacin , inj.polymixin b , inj.amphotericin b ( liposomal ) , inj.surfactant ( porectent ) , inj.human albumin , inj.prostoglandin , inj.linazolid , inj.ciplox , inj.levofloxacin , polygeline 3.5% solution with electrolytes for i.v. infusion , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , hepatitis b immunoglobulin 200iu 0.4ml im / sc pfs vial , paracetamol infusion ip 1% w / v 100ml size , instrument rust remover composition: phosphoric acid 25% and cleaner. instrument strains rust remover with chelating agent with amphoteric solution compatible with manual and ultrasonic machine. test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 , medical device sterlization solution nabo3 nh2o 50% w / w aldehyde free, biodegradable, safe and non hazardous. it can be used for sterilization in all medical device and instrument test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , enzymatic instrument cleaner enzymatic detergent consists of neutral ph. or low alkaline to which one or more enzyme have been added to surfactant and stabilizing agent. protease, lipase amylase cellulose. test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. 5lit 5 medical device sterlization solutio , nanosol gel polymer disinfectant 60%c14, 30% c16, 5% c12, 5% c18, …….10% 68%c12, 32% c14………10% inert ingredient ………80% usepa registration number mandatory. usepa certificate claim on n corona virus to be submitted. test report from internationally acclaimed certified lab to be submitted. the product should be ce / iso certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. certificate should be authorized by a member of multilateral recognition arrangement. american / european certificate of free sale mandatory. product should be registered under fifra section 3 ( c. ) 9 under the provisions of pr notice 98 10. , antiseptic surgical and scrub composition: chlorohexidine gluconate 20% v / w with organic surfactants and free from sls with moisture and skin softener test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , ringer acetate infusion 500 ml , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable , infusion set with microdrip, ( i.v. ) sterile disposable , sodium chloride and dextrose 0.45% infusion 500ml , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , surgical spirit ip ( 100 ml ) , surgical spirit ip ( 500 ml ) , savalon1 l , savlon 500 ml , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , distilled water 500ml , distilled water 5 ltr , sodium chloride and dextrose0.45% infusion 500ml , folinic acid 200mg / vial , sodium chloride 3% 100ml , prostaglandin 500mcg / ml , azithromycin 10 ml vial equaivelent to 500 mg , caffeine cirate 20mg / ml , carbetocin 1ml / 100micro. , ceftriaxone and sulbactam 1.5g , clindamycin 600mg / 4ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , folinic acid 200mg / vial , azithromycin 10 ml vial equaivelent to 500 mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , folic acid +methylcobalamine 10 ml pack , fsh 75 iu , fsh 150 iu , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , hp hmg ( highly human menopausal parodied gonadotropin ) 150 iu , insulin aspart , insulin lispro , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , isolyte p 10% 500 ml , levofloxacine 500mg / 100 ml , lignocaine ( preservative free ) 2% , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , methylene blue , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , multivitamin 10 ml , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , normal saline 500 ml glass bottle , normal saline 1000 ml glass bottle , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , procaine penicillin fortified 2 lack , teicoplanin 200 mg , teicoplanin 400 mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in0.5 ml , inj. propofol mct / lct with oleicacid inj. iv , inj. paracetamol infusion 1000 mg in double sterilized closed system 100 % biodegradable eco friendly polyolefin 100 ml bag , inj.0.9% normal saline 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.0.9% normal saline 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 500 mlin 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 1000 mlin 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.5% dextrose 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. balance hydroxy ethyl 6 % tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin , inj. hydroxy ethyl 6 % tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10 mg , clopidogrel tab ip 75 mg , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , methyldopa tab ip 250mg film coated , propranolol tab ip 40 mg , verapamil tab ip 40 mg film coated , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , frusemide tab ip 40 mg , hydrochlorthiazide tab ip 12.5 mg , torsemide tab 10 ip mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , domperidone tab ip 10 mg , loperamide tab ip 2 mg , metoclopramide tab ip 10 mg , ranitidine tab ip 150mg film coated , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , ethinyloestradiol tabs ip 50 mcg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , metformin tab ip 500 mg ( film coated ) , norethisterone tab ip 5 mg , thyroxine sodium tablets ip 100mcg , thyroxine sodium tablets ip 50mcg , neostigmine tab ip 15 mg , isoxsuprine tab ip 20 mg , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , salbutamol tablet ip 4 mg , salbutamol tab ip 2 mg , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , tinidazole tab ip 300 mg , tinidazole tab ip 500 mg , ranitidine tab ip 300mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustain ed release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , hydrochlorthiazide tab ip 25mg , losartan tab ip 25 mg , ascorbic acid tab ip 500 mg , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , labetalol tab ip 100mg , nitrofurantoin tab ip 100mg , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mgand paracetamol 325 mg , mefenamic acid tablets bp 500 mg , cetirizine, phenylephri ne & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , methotrexate tablets ip 10 mg , bromocriptine tablets ip 2.5 mg , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , telmisartan tablets ip 40 mg , finasteride tablets ip 5 mg , flavoxate tablets ip 200 mg ( coated tablet ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , ondansetron orally disintegrating tablets ip 4mg , ursodeoxycholic acid tablets ip 300 mg , medroxyprogesterone acetate tablets ip 10 mg , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , mifepristone tab ip 200mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , ramipril tablets ip 2.5 mg , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethox azole 800mg ) , tenaligliptin tablet ip 20mg , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20mg ) , rosuvastatin tablet 10 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , diclofenac+ parcetamol+ serratiopeptidsase tab , dehydrogestrone tab , estradiol tab , povidon vaginal pessaries tab , vit b 12 tab , tab levtiracetcetam 500 mg , tab conjugated estrogen , tab mirabegum , tab derifenacin , tab propar , tab alone / ramloxifene , tab cyproterone acetate & ethinyloestradiol , tab centchronam , tab dinogest , progestron only pills , tab chymoral forte , lasix tab , tab lactare , faskit ( fluconazole / azthomycine & secnidazole tab , tab telmisarton +hidrocylorthiaozide , tab mefenamic acid +dicyclomine hydro , coq 300mg ( capsule of coenzyme q10 with lycopene, selenium & omega 3 fatty acid ) , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , vitamin e capsule 400 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , cefpodoxime 200mg , cefpodoxime cv 375 , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dienogest 2mg , dydrogesterone 10mg , estradiol valerate 2 mg , ethynil estradiol 0.02mg+ tab , desogestral 0.15mg , inositol + myoinositol 1000mg , levetiracetam ip 250 mg , mirabegeron 25 mg , mifepristone 25mg , nifidipine 20mg , paracetomol 650 mg , progesterone only pills , propranolol 40 mg sr , rosuvastatin 10mg + fenofibrate 160mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , tramadol 37.5mg + paracetamol 325mg , trypsin chymotripsin , ulipristal 5mg , hepato protective tablet each film coated tablet to contain matadoxine 500mg silymarin 140mg l ornithine l aspartate 150mg pyridoxine hydrochloride 3 mg , spores of polyantibiotic resistant bacillus clausii 2 billion capsules , iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains ferne saccharate ( in micro encapsulated form ) 75mgeq. to elemental iron 30mg phospholopid 167 mgeq. to phosphatidylserine 100 mg , cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg conjugated cstrogen , telmisartan40mg + hydroclrothaizide 12.5 mg i.p. each tablet containtelmisartan40mg + hydroclrothaizide 12.5 mg , telmisartan80mg + hydroclrothaizide 25 mg i.p. each tablet containtelmisartan80mg + hydroclrothaizide 25 mg , mefonamic acid 250mg+ dicyclominehydrochloride each tablet contain mefonamic acid 250mg+ dicyclominehydrochloride , combitkit of ( tab ) fluconazole150mg + azithromycin 1 gm 7 secnidazole 1 gm each kit contain tab fluconazole150mg + azithromycin 1 gm 7 secnidazole 1 gm , zideovudine 60 + lamivudine 30 , lung surfactent1.2 ml ( 50 mg ) lypholised , amphotericin b lipid complex 10 mg , ionic solution of silver nutrate with tween twenty 100 ml , clotrimazole cream ip 2% w / w , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , silver sulphadiazine cream ip 1% 50gm tube , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , betamethasone dipropionate cream ip 0.05% , silver sulphadiazine cream ip 1% 500 gm jar , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , estradiol cream , estrogen cream , sumag cream , neomycin sulphate cream , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , lignocaine gel ip 2% , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o [ 219 ] , povidone iodine ointment 5% 15 gm , povidone iodine ointment usp 250 gm , coal tar 6% & salicylic acid 3% ointment , acyclovir eye ointment ip 3% w / w 5gm size , chloramphenicol 1% w / w eye ointment ip, 3gm size , thrombophobe ointment , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , clindamycin phosphate gel usp 1 o / o , metronidazole 1% and chlorhexidine gluconade 0.25% gel , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , domperidone oral drops 10mg / ml ( 10ml ) , carboxymethylcellulos e eye drops ip 0.5% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , xylometazoline nasal drops ip 0.1% , paracetamol drops paediatric paracetmol oral suspension ip ( each ml contains paracetamol 150mg ) , ciprofloxacin eye drops ip 0.3 o / o w / v , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , lactulose solution , digoxin 0.25% , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , acetylcystine solution usp ( injection ) 200 mg / ml , colistimethate injection ip 1m iu powder for solution , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , caffiene citrate oral solution , human albumin solution ip 20% , povidone iodine solution ip 5 % 500 ml , formaldehyde solution ( 34.5 per. – 38 per. ) , gentian violet topical solution usp 1o / o , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 % ( 20vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) [ 249 ] , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , dicyclomine hydrochloride oral solution ip 10mg / 5ml , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol nebuliser solution bp 5 mg / ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , chlorhexidine gluconate solution 5% 250 ml , povidone iodine solution ip 5% 100ml bottle , potassium chloride oral solution u.s.p 500mg / 5ml , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , povidone iodine solution ip 10 % , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , vitamin d3 oral solution 60000 iu , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10litre cans , feracrylum 1% w / v sterile solution 100 ml , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , balancesalt solution with ph.of 7.2 to 7.4 osmolarity 292 to294 in 100 % biodegradable bag with polyofin , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cough syrup / expectorant ( 50 ) ml , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate , multi vitamin syrup , b. complex , calcium phosphate 200 ml , dextromethorphan hcl + chlorpheniramine , each 15 ml contains: milk of magnesia 11.25 ml+ liquid paraffin3.75 ml 170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen100 mg 60 ml , linezolid 100mg / 5ml in 30ml , sodium picosulphate oral suspension , sorbitol + tricholine citrate , paracetamol drops paediatric paracetmol oral suspension ip ( each ml contains paracetamol 150mg ) , albendazole oral suspension ip 400mg / 10ml , domperidone suspension ip 5mg / 5ml , budesonide nebulizer suspension 0.25mg / ml , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , ampicillin cap ip 500mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , pregabalin cap ip 75 mg , surgical cap disposable ( for surgeons ) , tramadol cap ip 50 mg , tramadol cap ip 50 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , doxycycline cap ip 100 mg , itraconazole cap 100 mg , danazol cap ip 50 mg , deferiprone cap 250mg , deferiprone cap 500mg , nifedipine cap ip 5mg , omeprazole cap ip 20 mg , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , nifedipine sublingual , povidone iodine , infant milk formula term 400 gm , infant milk pre trem baby ( lbw ) 400 gm , hmf for pretem , l arginine+proanthocynadine granules 3mg / 5 mg , l arginine 3 gm + proantho cyaniding 75 mg , tab dehydro epiondrosterone sr 75 mg , tab anastrozole 1 mg , tab letrozole 2.5 mg , inj. certrorelix acetate 0.25 mg , inj. menotropin 150 iu / 0.5 ml , inj. menotropin 225 iu / 0.75 ml , highly purified hmg 75 / 150 iu , highly purified follicle stimulating hormone 75 / 150 iu , highly purified hcg 2000 / 5000 / 7500 / 10000 iu , natural microhized progesterone soft caps 100 / 200 mg , natural microhized progesterone soft caps 200 / 400 mg , inj enoxaparin 40 mg , estradiol & dydrogesterone tab. 1 / 5 mg , combipack of estradiol and estradiol & dydrogesterone tab. 1 / 10 mg , combipack of estradiol and estradiol & dydrogesterone tab. 2 mg 2 / 10 mg , ubidecarenone capsules usp q100 / q300 ( co enzyme q10 ) , inj leuprolide acetate 3.75 mg , inj leuprolide acetate 1 mg / 0.5 ml , inj leuprolide acetate 4 mg / 4 ml , inj. buserlin acetate 0.5 mg / 0.5 ml , inj. buserlin acetate 7 mg / 7 ml , tab. diclofenac gastro resistant ip 50 mg , tab. ibuprofen and paracetamol ip ibuprofen 400 mg+ paracetamol 325 mg , tab. ibuprofen ip 400 mg , tab. paracetamol ip 500mg , tab. paracetamol ip 650mg , cap. tramadol ip50mg , tab. chlorpheniramine maleate ip 4mg , tab. prednisolone ip 5mg , tab. acyclovir 200mg , tab. albendazole ip 400mg , tab. amoxycillin and potassium clavulamate ip 500mg+125mg , cap. amoxycillin ip500mg , tab. azithromycin ip 500mg , tab. cefixime ip 200mg , tab. chloroquine phosphate ip 250mg eq tov155mg of chloroquine base film coated , tab. ciproflixacin ip 500mg , capometrazole ip 20mg , tab. clotrimazole vaginal ip 500mg , cap. doxycycline ip 100mg , tab. fluconazone ip150mg , cap. itraconazole ip 100mg , tab. metronidazole ip 200mg , tab. metronidazole ip 400mg , tab. norfloxacin ip 400mg , cap nifedipine ip 5mg , tab. nitedipine ip 10mg , dinoprostone cream / gel 0.5mg dinoprostone in syringe , tab. trenexamic acid , tab. clindamycin 150mg , tab. clindamycin 300mg , inj. bupivacaine hydochloride in dextrose usp each ml contains bupivacaine hydrochloride 5.0mg dextrose 80.0mg , inj. phenytoin 50mg , inj. cisplatin 50mg , inj. vancomycin 500mg , inj. vancomycin 1 gm , inj, normal human intravenous immunoglobuline , inj. surfactant 3ml , inj. feracrylum 1% w / v solution , dinoprostone gel , tab. ramipril tablets ip 5mg , cap. evening primosa 1000mg...

Medical And Health Services - Rajasthan

33919321 supply of medicine halothane 1w 161 isollurane usp 171 3 ketamine inj ip 50 mg / m1 181 4 lignocaine ointment 5 0 / 0 191 lil lignocaine and adrenaline inj ip each ml. contains i dignocainel lydrochloride ip 20 mgadrcnaline ip 0.01 mg 1101 6 i ignocaine gel ip 2% 1121 7 lignocaine inj ip 2 0 / 01131 8 propolol inj ip 10 mg / ml 1141 9 thiopentone inj ip 0.5 g [ is ] 10 atropine sulphate injection 0.6mg / m116541 11 diclofenac sodium injip 25 mg / ml ( im / iv use ) [ 191 12 diclofenac gastro resistant tablet ip 50 mgenteric coated ) 1201 13 ibuprofen and paracetamol tablets iplbuprofen 400 mg+ paracetamol 325 mg [ 22 ] 14 ibuprofen tab ip 200 15 ibuprofen tab ip 400 mg ( coated ) [ 24 ] 16 paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) [ 26 ] 17 paracetamol syrup ip 125 mg / 5m1 ( detail in rc ) [ 27 ] 18 paracetamol tab ip 500 mg [ 28 ] 19 paracetamol inj. 150 mg / ml [ 29 ] 20 pentazocine inj ip 30mg / m1 ( 1m / iv use ) [ 30 ] 21 tramadol cap ip 50 mg [ 32 ] 22 tramadol inj 50 mg / m1 [ 33 ] 1 23 indomethacin cap ip 25 mg [ 436 ] 25 ibuprofen oral suspension bp / usp100 mg / 5 ml [ 477 ] lk diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg +paracetamol 325 mg [ 483 ] 27 aceclofenac and paracetamol tablets aceclofenac 100 mg andparacetamol 325 mg [ 4921 24 diclofence prolonged release tablet ip 100 mg [ 4371 25 ibuprofen oral suspension bp / usp100 mg / 5 ml 1477 ] 1 26 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg +paracetamol 325 mg 1 4831 27 aceclofenac and paracetamol tablets aceelolenac 100 mg andparacetamol 325 mg 1 4921 dielofenae ( ;c1: 1 ) ietnicaac dicshylaminct.i” • sane ) late to%. i mseed oit 3%. menthol 5% 1 491 etorieinib lab 11120111g 14951 niefenamic acid lableislip 500 mg 14961 napninen fable! 111500111g 16561 naprown tablet ip250mg 16571 2; 1, torteo.ib tablet 90 mg16581 34 aspirin tablet ii ( gastro 12csistant ) 150 mg 16791 35 diclofenac sodium aqueous injection 75mg / m1 iml size. iv & im use 16951 36 paracetamol inillni011 ii 1%w / v 100mi size 1696 1 37 ketorolac tromethaminedispersible tablet 10 mg ( cach uncoated dispersible tablet contains ketorolac trometharnine 10 mg ) 1 6971 adrenaline injection ip i mg / ml im / iv use [ 34 ] betamethasonc tab 1p0.5me [ 35 ] 40 chlorpheniraminc maleate tab ip 4mg [ 37 41 1 dexamethasone inj ip8me / 2m1 [ 39 ] 42 dexamethasone tab ip0.5 mg [ 40 ] 43 i hydrocortisone sodiumsuccinate injection ip 100 mg base / vial ( im / iv use ) [ 42 ] 44 hydroxyzine tab ip 25mg [ 43 ] 45 methyl prednisolone sodium succinate for injection usp 500 mg [ 44 ] 46 pheniramine inj ip22.75mg / m1 [ 45 ] 17 prednisolone tab ip 5mg 147 ] promethazine syrup ips mg / 5m11481 9 promethazine inj ip25mg / m1 [ 491 3 promethazine tab ip 25mg [ 50 i 1 betamethasonc sod phos inj ip 4mg / m1 ( 418 j 2 prednisolone tablet !pio mg [ 4691 3 prednisolone tab ip 20mg [ 470 ] 4 anticold syrup each 5m1 contains phenylephrine i lydrochloride 2.5ing, , chi° heniramine maleate i m ) and paracetamol 125 mg 14971 5 cetirizine.phenylephrine& paracetamol tablets cetirizinc 5 mg, phenylephrine 10 mg & paracetamol 325 mg tah14981 cetirizine syrup ip 5mg / 5 ml [ 499j levoceitrizine tab1et5mg [ 659 ] montelucast ( i onig ) + levocetrizine tablet ( 5m01660 ) 59 naloxone lnj ip 0.4mg / m1 [ 511 60 pralidoxime chloride injection ip 25 mg / m1 / 500 mg 152 ] 61 carbamazepine tab ip 200 mg ( film coated ) 1531 62 carbamazepine tab ip 100 mg ( film coated ) [ 541 63 phenobarbitone tab ip30 mg 1561 64 phenytoin injection 131150111g / 1w [ 57 ] 65 phenvtoin oral suspension ip 25ing / m11581 66 phenytoin tab ip 100 mg ( film coated ) [ 591 67 sodium valproate inj 100 mg / ml [ 601 68 sodium valproate gastro resistant tablets1p 200 mg [ 61 ] 69 phenobarbitone lnj ip200mg / m1 [ 420 ] 70 carbamazepine oral suspension usp 100 mg / 5m1 [ 474 ] 71 sodium valproate oralsolution ip 200 mg / 5 ml [ 479 ] 72 sodium valproate tablet ( gastro resistant ) ip 500mg [ 661 ] 73 clobazam tabled capsule 5 mg [ 662 ] 74 clobazam tablet / capsule 10 mg [ 663 ] 75 levetiracetam tablet ip500 mg [ 664 ] 76 levetiracetam oral solution / suspension100mg / m1 [ 665 ] 77 gabapentine tablet / capsule 100mg [ 667 ] 78 acyclovir oral suspension ip 400mg / 5m1 [ 62 ] 79 acyclovir tab ii 200mg 163 ] 80 acyclovir tab ip 800mg [ 64 ] 81 albendazole oral suspension ip 400 mg / loinl [ 65 ] 82 albendazole tablets 1p400 mg ( detail in rc ) [ 66a ] 83 amikacin inj ip 100 mg167 ] 84 amikacin ini ip 500 mp 1681 , 85 amoxycillin and cloxacillin cap 250 +250 mg [ 69 ] + 125 86 amoxvcillin and potassium clavulanatctabs ip 500 mg nig 1701 87 amoxycillin cap 113250mg 171 ] amoxycillin cap 1p500mg [ 721 89 amoxycillin dispersibletablets ip 125 mg 1731 90 ampicillin injection 1p500 mg [ 751 91 azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) 178a ] 92 azithromycin tablets ip250mg [ 79a ] 93 azithromycin tab 1p500 mg [ 80a ] 94 benzathine benzylpenicillin inj ip12 lac units [ 81 ] 95 benzathine benzylpenicillin inj ip 6iac units [ 82 ] 96 cefixime tab ip 100 mg [ 84 ] .....„cor cefixime tab ip 200 mg [ 85 ] 98 cefotaxime injection ip1 g [ 87 ] 99 cefotaxime inj ip 250mg [ 88 ] —.400 ceftriaxone inj ip lg / vial [ 93 ] 101 ceftriaxone inj ip 250mg / vial [ 94 ] 102 ceftriaxone inj ip500mg / vial [ 95 ] 103 cephalexin cap ip 250mg [ 96 ] 104 cephalexin cap ip 500mg [ 97 ] 105 chloroquine phosphatelnj ip 40 mg / ml [ 98 ] 106 chloroquine phosphatetab. ip 250mg eq to 155 mg of chloroquinebase film coated [ 99 ] 107 chloroquine phosphatesuspension ip 50 mg / 5m1 [ 100a ] 108 ciprofloxacin injectionip 200mg / 100m111011 109 ciprofloxacin tablets ip250 mg film coated 1 102 ] 110 ciprofloxacin tablet 1p500 mg film coated 1 103 ] iii clotrimazole cream ip2% w / w 1104 ] 112 clotrimazole vaginaltab ip 500mg 1105 ] 113 co trimoxazole oral suspension ii each 5 mlcontains trimethoprim 40 mg and sulphamethosazole 200 mg [ 1071 114 co trimovizole tablets 1p trimethoprim 40 mg at siiipimilletho a / ole 200 me 1108 ] 115 dietlo icarbamazine tabip 100 mg 11101 116 do‘ycycline cap ip 100114=11111 117 fluconazole tablets 11150mg 1114a ] 118 gentamyein injection 1180111g / 2ml ( im / iv use ) 1116 ] 119 griscolulvin tab ip 125mg 1117 ] 120 metronidazole inj ip500 mg / i 00m111201 121 metronidazole benzoateoral suspension ip 100mg of base / 5ml [ 121 ] 122 mctronidazolc tablets ip 200 mg ( film coated 1 1122 ] 123 n4etronidazole tablets ip 400 mg ( film coated ) [ 123 ] 124 norfloxacin tab ip 400mg film coated [ 124 ] 125 ofloxacin tab ip 200mg [ 125 ] 126 primaquine tab ip 2.5mg [ 128 ] 127 primaquine tab ip 7.5mg [ 129 ] 128 quinine dihydrochloridelnj ip 300 mg / ml [ 131 ] 129 quinine sulphate tablets ip 300 mg ( filmcoated ) [ 132 ] 130 ampicillin cap ip 500mg [ 412 ] 131 nitrofurantoin tab ip100mg [ 413 ] 132 cloxacillin sodium injip 500mg [ 417 ] 133 cephalexin oral suspension ip ( cephalexin dry syrupip ) 125mg / 5 ml 14271 134 ofloxacin oral suspension ip 50mg / 5m11428 ] 135 tinidazole tab ip 300 mg ( film coated ) 14301 136 tinidazole tab ip 500 mg ( film coated ) 14311 137 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5m1 ( 473 i 138 cefpodoxime dispersible tab 50 mg ( 4751 , 139 140 cephalexin tablets 125 mg ( dispersible tablets ) 14761 amikacin !ri w 250 mg15041 141 amoxicillin and potassium clavulanic illinj 600mg 15051 l20115061 142 amoxicillin and potassium clavulanatelnj ip 143 amoxycillin and potassium clavunate oral suspension ip 200mi +28.5 mg / 5 ml ( 30m1 bottle ) [ 507 ] 144 artesunate injection 60 mg ( i.m. i.v.t ise ) each combo pack contains artcsunate injection 60 mgvial. sodium bicarbonate injection ip5 o / o w / v ( 1m1 ampoule ) sodium chloride injection ip 0.9o / o w / v ( 5m1 ampoule ) [ 508a ] 145 cefixime oral suspension ip 25mg / ml ( paediatric drops ) [ 5111 146 cefuroxime axetil tabip 250 mg [ 512 ] 147 clindamycin capsule ipi50mg [ 5131 148 clindamycin capsule ip300 mg [ 514 ] 149 lootloxacin tablets ip250 mg [ 515 ] 150 ofloxacin and omidazole tablets ofloxacin 200 mg and ornidazole 500 mg [ 520 1 151 ofloxacin infusion ip 200mg / 100 ml ( in nacltnj ) [ 5211 152 artemether and leumefantrine tablet ( 80 mg and 480 mg ) [ 651 i 153 co trimoxazole tabletip ( trimethoprim 160mg+ sulphamethoxazole 800mg ) [ 669 ] 154 framycetin sulphate cream 1 o / o 30gm pack [ 684 ] 155 framycetin sulphatecream i o / o 100 gm pack [ 685 ] 156 artemether and leumefantrine tablet ( 40 mg and 240 mg ) [ 686 1 157 amoxycillin tablet 250mg+calvulanic acid 125 mg ip each hit coated tab conatin amoxycillin trihydrate ip 250 mg & potassiumclavulanate ip 125 mg 17061 158 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxilequivalent to anhydrous c:efadroxi1250 mg ) [ 7091 159 cefadroxil tablet 500 mg 1710 ] 160 levofloxacin tablet ip 500 mg ( each film coated tablet contain levofloxacin ilemihydrate 11 500 mg ) 17121 161 methotrexate tab ip 2.5mg 11541 162 methotrexate tablets ip 10 mg 15361 163 levodopa and carhidopa tab 250 mg+25 mg 11611 164 trihexyphenidyl 1 icitab ip 2 mg 11621 165 ethamsylate inj 250 mg / 2mi ( im / iv ) 11731 166 licparin sodium itti ip 5000 i t l / m1 ( 1m / iv usc ) 11741 167 vitamin k injection each nil contains tvlenadione sodium bisii1phi 10mg equivalent to 5.2 mg ofmenadione. ( aqueous solution ) 1180 168 polygeline 3.5% solution with electrolytes ibr 1.v.inlbsion 14051 169 liydroxyeth ) 1 starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0. ( . o ow ∎ lntracnous illillsi011 / balanced electrolyte solution of sodiu chloride. sodiumacetate, potassium chloride, magnesium chloride intravenous infusion [ 416 ] 170 tranexamic acid tablets ip 500 mg [ 545 ] 171 warfarin sodium. tabip 5mg [ 546 ] 172 vitamin k i ( phytomenadione ) ip i mg / 0.5ml injection ( detail in rc [ 644 ] 173 ethamsylate tablet 500mg ( each uncoated coated tablet contains ethamsylate 500 mg ) [ 745 ] 174 feracrylum 1% w / v sterile solution 100 ml [ 746 ] 175 amlodipine tab ip 2.5mg [ 184 ] 176 amlodipine tablets ips mg [ 185 ] 177 atenolol tab ip 50 mg [ 186 ] 78 atorvastatin tab 1p10mg [ 187 ] 79 clopidogrel tab ip 75mg 11881 80 digoxin inj ip 0.25 mg / ml 11891 31 digoxin tab ii 0.25 mg. [ 190 [ 12 diltiazem tabs ip 30 mgfilm coated 1191 ) 3 dohutamine inj ip 50mg / mi / 250mg ( vial! ) dobutamine inj ip 250mg / 5m1 ( amp ) [ 1971 , etc....

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical And Health Services - Rajasthan

33821302 supply of generic drugs & medicine antacid liquid, each 5mi contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated •ol dimeth i siloxane 50m• beclomethasone inhalation ip 200 mcg / dose o o o o a_ c o o a ) c o fd j c 4a ; e ro 4 c ) cd cr 4 black disinfectant fluid ( phenyl ) as per schedule 0 grade iii 5 budesonide nebulizer suspension 0.25mg / m1 6 budesonide powder for inhalation 200 mcg 7 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 8 cap amoxycillin ip 500mg 9 cap amoxycillin and cloxacillin 250 + 250 mg 1° cap cephalexin ip 250 mg 11 cap cephalexin ip 500 mg 12 cap clindamycin ip 300 mg 13 cap doxycycline ip 100 mg 14 cap itraconazole 100 mg 15 cap omeprazole ip 20 mg 16 cap pantoprazole 40mg and domperidone 30mg sr ip 17 cap pregabalin ip 75 mg 18 cap vitamin e 400 mg, 19 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 0 / 0 , chlorbutol 5 o / o, turpentine oil 15 o / o 20 chlorhexidine mouthwash ip 0.2 0 / 0 21 cholecalciferol granules 60, 000 iu / gm 22 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 23 compound benzoin tincture ip 24 cough syrup / expectorant ( 50 ) ml 25 dental gel choline salicylate 8.7 0 / 0, benzalkonium chloride 0.01 0 / 0, lignocaine hci 2 0 / 0 ( flavoured gel base ) 26 dinoprostone cream / gel 0.5 mg dinoprostone in syringe 27 domperidone oral drops 10mg / ml ( 10m1 ) 28 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5m1 size 29 eye drop.ciprofloxacin 0.3 o / o and dexamethasone 0.1 30 eye drops carboxymethylcellulose ip 0.5% 31 eye drops chloramphenicol ip 0 5 0 / 0 32 eye drops ciprofloxacin ip 0.3 o / o w / v 33 eye dropstimolol ip 0.5 o / o w / v 34 eye dropstobramycin 0.3% [ 331 ) 35 formaldehyde solution ( 34.5 per. 38 per. ) 36 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 37 gluteraldehyde solution 2% 38 human albumin solution ip 20% 39 hydrogen peroxide solution ip 6 0 / 0 ( 20 vol ) 40 hydroxypropylmethyl cellulose solution 20 mg / ml 41 inj. acetylcystine solution usp 200 maim 42 inj. adenosine ip 6 mg / 2m1 43 inj. adrenaline ip 1mg / mi im / iv use 44 inj. amikacin ip 500 mg 45 inj. amikacin ip 100 mg 46 inj. aminophylline ip 25 mg / ml 47 inj. amiodarone hydrochloride 50 mg / ml 4s inj. amoxicillin and potassium clavulanate ip 1.2gm 49 inj. artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate 60 mgvial, sodium bicarbonate injection ip 5 0 / 0 w / v ( 1m1 ampoule ) , sodium chloride ip 0.9o / o w / v ( 5mlampoule ) 50 inj. atracurium 10 mg / ml 51 inj. atropine sulphate 0.6mg / m1 52 inj. benzathine benzylpenicillin ip 12 lac units 53 inj. benzathine benzylpenicillin ip 6 lac units 5 4 inj. biphasic isophane insulin ip ( 30 % soluble insulin and 70 % isophane insulin ) 40 iu / ml ( r dna origin ) 55 inj. bupivacaine hydochloride in dextrose usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 56 inj. bupivacaine ip 0.5% 57 inj. caffeine citrate usp 20mg / m1 ( equivalent to 10 mg caffeine base / ml ) 3m1 size in i. calcium gluconatelp 10% ( iv use ) inj. carboprost tromethamine ip each r contains carboprost 0.25 main, 0 inj. cefoperazone and sulbactum for ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodlu eq. to sulbactum 0.5gm ) ( im / iv use ) 61 inj. cefotaxlme ip 1 g 62 inj. cefotaxime ip 250 mg 63 inj. ceftazidime ip ig 31 inj. ceftazidlme ip 500 mg 65 in ) . ceftaziclime ip 250 mg inj. ceftriaxone ip 500mg / vial 67 inj. ceftriaxone 1 gm + tazobactum 125 mg inj. ceftriaxone ip lg / vial 69 ire ceftriaxone ip 250 mg / vial 70 inj. chloroquine phosphate ip 40 mg / ml 71 inj. ciprofloxacin ip 200mg / 100m1 72 inj. compound sodium lactate . ip 73 inj. dexamethasone ip 8mgam1 74 inj. dextrose ip 25% w / v 75 inj. dextrose ip 10% 76 inj. dextrose ip 5% 77 inj. diazepam ip 10mg / 2m1 ( 1m / iv use ) 78 inj. diclofenac sodium ip 25 mg / ml ( im / iv use ) 79 inj. dicyclomine ip 10 mg / ml 8° inj. dobutamine inj ip 50mg / m1 / 250mg ( vialndobutamine ip 250 mg / 5m1 ( amp ) 81 inj. dopamine hydrochloride ip 40 mg / ml 82 inj. dried factor viii fraction ip ( iv use ) 1000 iu / vial 83 inj. dried factor viii fraction ip ( iv use ) 500 iu / vial 84 inj. dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) 85 inj. drotaverine hydrochloride 40 mg / 2 ml 86 inj. enoxaparin sodium ip 60 mg 87 inj. esmolol hydrochloride 10mg / m110m size 88 inj. ethamsylate 250 mg / 2m1 ( im / iv ) 89 inj. factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) 90 inj. fentanyl citrate 50mcg / m1 91 inj. fentanyl citrate ip 2 ml 92 inj. furosemide ip 10mg / m1 ( im and iv use ) 93 inj. gentamycin ip 80mg / 2m1 ( im / iv use ) 94 inj. glycopyrrolate ip 0.2 mg / ml 95 inj. haloperidon ip 5 mg / ml 96 inj. heparin sodium ip 50001u / m1 ( im / iv use ) 97 inj. hepatitis b immunologlobin ip 200 i.0 98 inj. human albumin solution ip 20% 99 inj. human anti d immunoglobulin 300mcg ( im use ) 100 inj. human anti d immunoglobulin 150 mcg 101 inj. human rabies immunoglobulin 150 iu / ml 102 inj. hyaluronidase ip each vial contains hyaluronidase ip 1500 i.u. 103 inj. hydrocortisone sodium succinate ip 100 mg base / vial ( im / iv use ) 104 inj. hydroxyprogesterone ip 250mg / ml 105 inj. hyoscine butylbromide ip 20 mg / ml 106 inj. iron sucrose usp / bp 20mg / mi ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 107 inj. isophane insulin ip 401u / m1 1°8 inj. isoprenaline ip 2mg / ml 1°9 inj. ketamine ip 50 mg / ml 110 inj. labetalol hci ip 20mg / 4m1 111 !nj. levetiracetam 500mg / 5m1 112 inj. lignocaine ip 2 0 / 0 113 inj. lignocaine and adrenaline ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 114 inj. linezolid 200mg / 100m1 115 inj. lorazepam ip 2 mg / ml 116 inj. magnesium sulphate. ip 500mg / m1 ( 50%w / v ) 117 inj. mannitol ip 20% w / v 118 inj. mecobalamin 500 mcg / ml 119 inj. meropenem ip 500 mg 120 inj. methyl prednisolone sodium succinate for usp 500 mg 121 inj. methylergometrine ip 0.2 mg / ml 122 inj. metoclopramide in ) ip 10mg / 2m1 123 inj. metronidazole ip 500 mg / 100ml 124 inj. midazolam ip 1 mg / ml 125 inj. morphine sulphate ip 10mg / m1 126 inj. multiple electrolytes and dextrose type i ip ( electrolyte ip 127 inj. multiple electrolytes and dextrose type iii ip electroylte m ( i.v. ) 128 inj. naloxone ip 0.4mg / ml 129 inj. neostigmine ip 0.5 mg / ml no inj. neostigminelp 2.smg / smi 131 inj. nitroglycerin 5 mg / ml 132 inj. noradrenaline ip 2 mg / ml 133 inj. normal human intravenous immunoglobulin 5g / 100m1 134 inj. ondansetron ip 2mg / m1 135 inj. oxytocin ip 5 iu / m1 136 inj. paracetamol . 150 mg / ml 137 inj. pentazocine ip 30mg / mi ( im / iv use ) 138 inj. pentoprazole 40 mg 139 inj. pheniramine ip 22.75mg / ml 140 inj. phenobarbitone ip 200mg / mi 141 inj. phenytoin bp 50mg / m1 142 mil piperacillin + tazobactum for ip 4gm+500mg 143 inj. potassium chloride . 0.15 gm / ml 144 inj. pralidoxime chloridelp 25 mg / ml / 500 mg 145 inj. progesterone 200 mg / 2m1 146 inj. promethazine ip 25mg / m1 147 inj. propofol ip 10 mg / ml 148 inj. rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies 149 inj. rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu 150 inj. rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose 151 inj. ranitidine hcl ip 50mg / 2m1 152 inj. rh erythropoetin 4000 iu 153 inj. rh erythropoetin ip 10000 iu 154 inj. rh erythropoetin ip 2000iu 155 inj. snake venum anti serum ip ( lyophilized ) polyvalent anti snake 156 inj. sodium bicarbonatelp 7.5% w / v 157 inj. sodium chloride and dextrose ip 0.9 o / o + 5 0 / 0 158 inj. sodium chloride ip 100 ml 159 inj. sodium chloride ip 500 ml 160 inj. streptokinase 15 lac units ip 161 inj. succinylcholine. ip 50 mg / ml ( iv use ) 162 inj. surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 163 inj. tetanus immunoglobulin ip 250 iu / vial 164 inj. tetanus vaccine ( adsorbed ) ip 5 ml vial 165 inj. theophylline and etofylline ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 166 in1. tramadol 50 mg / ml 167 inj. tranexamic acid ip 100mg / m15m1 size 168 inj. urokinase 5 lac unit ( lyophilized ) 169 inj. valethamate bromide 8mg / ml 170 inj. vancomycin for intravenous infusion ip 500 mg 171 inj. vecuronium dried ) bromide for 4mg ( freeze 172 inj. vitamin b complex nfi 173 inj. vitamin k 1 ( phytomenadione ) ip lmg / 0.5m1 ( detail in rc ) 174 insulin glargine 10 ml vial ( 100 iu / m1 ) with 30 insuline syringes with needle 175 insulin glargine 3m1 ( 100iu / mi ) with 15 insulin syringes and needles / cartridge 3m1 ( 1001u / m1 ) with 15 needles and 1 pen per 20 cartridges 176 insulin insulin / neutral iu / ml ( r.dna injection ip ( soluble insulin injection ) 40 origin ) 177 ipratropium bromide nebulizer solution 250 mcg / ml 178 iron and folic acid suspension. each 5m1 contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 179 liquid paraffin ip 400 ml 18° lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) 181 metronidazole 1% and chlorhexidine gluconade 0.25% gel 182 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin lmc& lysine hcl 10mg, 183 , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 100001u, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 184 ofloxacin infusion ip 200mg / 100 ml ( in naci inj ) 185 oint. beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % 186 oint. framycetin sulphate 10 / 0 100 gm pack 187 oint. framycetin sulphate 10 / 0 30gm pack 188 oint. fusidic acid ip 2% 189 oint. ketoconazole 2% 190 oint. miconazole nitrate ip 2% 191 oint. povidone iodine 5% 15 gm 197 oint. povidone iodine usp 250 gm 193 oint. silver sulphadiazine ip 1% 50gm tube 194 oint. silver sulphadiazine ip 1% 500 gm jar 195 oint.clotrimazole ip 2% w / w 196 oint.diclofenac gel: diclofenac aicithulmminn. 1 1col hantkul cmlinelktn 197 ointment containing lidocaine ip 3 ao zinc oxide ip 5 o / o, hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o 198 ors powder ip 20.5 grm 199 paracetamol infusion ip 1% w / v 100m1 size 700 potassium chloride oral solution u.s.p 500me 5m1 201 povidone iodine ointment usp 250 gm , 202 povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 203 povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 204 povidone iodine solution ip 10 % 205 povidone iodine solution ip 5 % 500 ml 20€ povidone iodine solution ip 5% 100m1 bottle 201 salbutamol inhalation 100 mcg / dose 208 salbutamol nebuliser solution bp 5 mg / n 209 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 210 silver sulphadiazine cream ip 1% 500 gm jar 211 sodium phosphates enema bp each 100n contains sodium dihydrogen phosphate dihydrate 10 cilo disodium hydrogen phosphate dodecahydrate 8 o / o 212 surgical spirit ip ( 100 ml ) 213 surgical spirit ip ( 500 ml ) 214 syp albendazole oral ip 400 mg / 10m1 215 syp amoxycillin and potassium clavunate oral ip 200 mg +28.5 mg / 5 ml ( 30m1 bottle ) 216 syp amoxycillin oral ip 125 mg / 5m1 217 syp anticold each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg 218 syp cefixime oral ip 25mg / ml ( paediatric drops ) 41° syp cephalexln oral 12smg / s ml 228 syp cetiritine ip 5mg / 5 ml 221 syp cough each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodiun citrate 65 mg, menthol 0.5 mg, syrup q.1 222 syp dextromethorphan hbr ip 13.5mg / 5m1 223 syp dicyclomine hydrochloride 10mg activated dimethicone 40mg 224 syp dicyclomine hydrochloride oral solution ip 10mg / 5m1 syp domperidone ip 5mg / 5m1 225 226 syp lactulose solution usp / bp 10gm / 15m1or 3.35 gm / 5m1 227 syp metronidazole benzoate oral ip 100 mg of base / sml 228 syp multi vitamin 229 syp ofloxacin oral ip ( each 5m1 contains ofloxacin ip 100 m • 30m1 size 230 syp salbutamol ip 2mg / 5m1 231 syp metoclopramide hydrochloride ip s mg / 5m1 232 syrup alkylizer 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate 233 tab aceclofenac 100 mg and paracetamol 325 m: 234 tab diclofenac sod 50 mg + paracetamo 325 mg 235 tab acebrophylline 100 mg 236 tab acetazolamide ip 250mg 237 tab acyclovir ip 800 mg 238 tab albendazole ip 400 mg ( detail in rc ) i239 tab alprazolam ip 0.25 mg , 240 tab alprazolam ip 0.5mg 241 tab amitriptyline ip 25mg film coated 242 tab amlodipine and atenolol amlodi sine besilate e • uivalent to 243 tab amlodipine ip 5 mg 244 tab amoxycillin and potassium clavulanate ip 500 mg + 125 mg 245 tab amoxycillin tablet 250 mg+calvulan acid 125 mg ip 246 tab antacid .formula, each chewable tablet contains magnesium trisilicate 251 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 247 tab ascorbic acid ip 500 mg 248 tab aspirin delayed release / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acic 75 mg ) 249 tab atenolol ip 50 mg 250 tab atenolol ip 25 mg 251 tab atorvastatin ip 10mg 252 tab azithromycin ip 500 mg 253 tab betahistine ip 16 mg 254 tab betahistine ip 8 mg 255 tab bisacodyl ip 5 mg 256 tab calcitriol ip 0.25 mcg 257 tab calcium with vitamin d usp / calciui and colecalciferol bp / calcium and vitamin d3 ip ( elemental calcium 500 in vitamin d3 250 iu ) ( non chewable ) 258 tab carbamazepine ip 200 mg 259 tab cefixime ip 200 mg 260 tab cefixime tab ip 100 mg / cefixime dispersible ip 100 mg 261 tab cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg 262 tab chlordiazepoxide ip 10mg 263 tab chloroquine phosphate . ip 250mg eq to 155 mg of chloroquine base film coated 264 tab chlorpheniramine maleate ip 4mg 265 tab chlorpromazine ip 50 mg 266 tab chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg 267 tab cinnarizine ip 25 mg 268 tab cinnarizine ip 75 mg 269 tab ciprofloxacin ip 500 mg film coated 270 tab clonazepam 0.5 mg 271 tab clopidogrel ip 75 mg 272 tab clopidogrel 75 mg and aspirin 75 mg 273 tab dexamethasone ip 0.5 mg 274 tab diclofence prolonged release tablet ip 100 mg 275 tab dicyclomine ip 10 mg 276 tab dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 277 tab domperidone ip 10 mg 278 tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg ( each enteric coated contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 279 tab drotaverine 80 mg and mefenamic acid 250 mg 280 tab drotaverine ip 40 mg....

Sms Medical College - Rajasthan

33788066 rate contract for drug medicines 1 3 way stop cock • non pyrogenic: and single use, should be leak proof, with smooth movements ( detail in rc ) 91 2 3 way stop cook with extension tube ( vein•o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) 91 3 3 way stop cock with extension tube ( vein 0 extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) 4 3 way stop cock with extension tube ( vein•° extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) 5 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) 6 3rd generation recombinant f viii 250 iu with diluent 7 and generation recombinant f viii 1000 iu with diluent 8 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thloguanine usp 40 mg ) absorbable surgical sutures sterilised needled 9 monofilamentpoiyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, r suture length of 70cm ) 10 abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) 11 abdominal drain kit. sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) 12 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) i 1 13 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) r..■1 14 abdominal drain kit, sterile, having drainage gather and collection bag ( 2000 ) ml size 32 ( details in rc ) absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture 15 ( braided coated polyglactin / polyglycolic add vlolet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm 16 absorbable gelatin sponge 80 x 50x 10rnm ( details in rc ) absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable 17 haemostatic bactericidal property ( details in rc ) absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 clr 18 rb needle 20 mm length 76 cm ) size 3 / 0 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir 19 rb needle 30 mm length 76 cm ) size 2 / 0 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir 20 rb needle 40mm length 76 an ) size 1 / 0 21 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromlc ( 1 / 2 cir rp nterdie ec mm 1 ennth 100 cm ) sibs 1 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir 22 rb needle 30 mm length 76 cm ) size 2 / 0 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 6 cir 23 rb needle 40 mm length 76 cm ) size 1 / 0 absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir 24 rcutting needle 26mm. length 76 cm ) absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin 25 / polyglycolic acid / pory ( glycolide co l lactide ) size 210 1 / 2 cir rb needle 30mm absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin polyglycolic acid / poly ( glycolide co l lactide ) size 210 1 / 2 cir rb needle 40mm l 90cm absorbable surgical suture ( synthetic ) sterilised needled suture monofilament 27 payd4oxanone violet size 1 / 0 ( 112 cede rb 30rnm needle, length 70cm ) 1, 30 jr 28 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolideco l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm ri 90 cm absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin 29 / polyglycolic acid / poly ( glycolide co liactide ) size • 3 / 0 1 / 2cir rb needle 20mm r9 length 70 cm 31 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic add / poly ( glycolide co l lactide ) size 1 1 / 2 clr rb needle40mm length ri 90 cm absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid i poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 clr rb needle 40mm r1 length 90 cm ) absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin 32 / polyglycolic acid / poly ( glycollde co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm r1 length 70 cm ) absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided 33 coated polyglactin / polyglycolic add violet ) size 1 / 0 1 / 2 circle ct round bodied r6 40mm, gs needle, suture length 90 cm absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated 34 polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional r1 25mm length 90 cm ) undyed 35 absorbent cotton wool ip 500 gm s2 36 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 37 acenocoumarol tab ip / nicoumalone tab ip 2 mg 38 acetylcystine solution usp ( injection ) 200 mg / ml 39 acyclovir cream 5% 40 acyclovir eye ointment ip 3% why 5gm size 41 acyclovir intravenous infusion ip 250mg 42 acyclovir intravenous infusion ip 500mg 43 acyclovir oral suspension ip 400mg / 5m1 44 acyclovir tab ip 200 mg 45 acyclovir tab ip 800 mg 46 adenosine injection ip 6 mg / 2m1 47 adrenaline injection ip 1mg / mi im / iv use 48 albendazole oral suspension ip 400 mg / 10m1 49 albendazole tablets ip 400 mg ( detail in rc ) 6 50 nkylizer syrup 1.4 gm / 5 m1 ( 100 ml ) ( disodium hydrogen citrate ) 51 allopunnol tablets ip 100 mg 52 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit 53 ajprazolam tab ip 0.25 mg 54 ajpraz_olam tab ip 0.5mg 55 arnikacin in ip 100 mg 56 amikacin inj ip 500 mg 57 arnikacin inj ip 250 mg 58 aminophylline in ) ip 25 mg / ml 59 amiodarone tab ip 100 mg 60 amiodarone hydrochloride in ) 50 mg / ml 61 amiodarone tab ip 200 mg 62 amitriptyline tab ip 25mg film coated 63 amlodipine tab ip 2.5 mg 64 amlodipine tablets ip 5 mg 65 66 67 amlodipine and atomic, tablet ( amiodipine besllate equivalent to amlodipine 5mg, atenold 50mg ) amoxicillin and potassium clavulanate inj ip 1.2gm, 68 arnoxlcillin and potassium clavulank ip inj 600mg 69 amoxycillin cap ip 250rng 70 arnoxycillin cap ip 500mg 71 arnoxycillin dispersible tablets ip 125 mg 72 arnoxycillin oral suspension ip ( dry syrup ) 125 mg / 5m1 13 amoxyallin tablet 250 rrig+calyulanic acid 125 mg ip each film coaled tab cortatin amoxyallin tnhydrate ip 250 mg b potassium clavulanate ip 125 mg 74 arnoxycillin and cloxacillin cap 250 + 250 mg 75 amoxyallin and potassium clavulanate tabs ip 500 mg + 125 mg 76 arnoxycillin and potassium clavunate dal suspension ip 200 mg +28.5 mg / 5 ml ( 30m1 bottle ) 77 arnpicillin cap ip 500mg 78 79 antacid liqukl, each 5m1 contains dried aluminium hydroxide gel 250 mg. maginesitxr hydroxide 250rng, activated polydimethyt siloxane 50mg antacid tablets. formula each chewable tablet contains magnesium trisilicate 250 mg urteu puuminium hyoroxicie lief tzu mg, i yeppenrwit ui 80 mb a blood grouping serum ip ( anti a monoclonal serum ) 81 anti b blood grouping serum ip ( anti b mono clonal serum ) 82 and d ( rh ) blood grouping serum ip / anti d blood grouping serum ip 83 anticold syrup each 5 ml contains phertylephrine hydrochloride 2.5mg . chiorpheniramine maleate 1 mg, and paracetamol 125 mg 84 artemether and leumefantrine tablet ( 40 mg and 240 mg ) 85 artemether and leumefantrine tablet ( 80 mg and 480 mg ) i 1 i 1 7, 1 a is 1° ) 1 j 7; e : g 2 • 8 :i 5— i 8 c ? ! 1 1 8 87 ascorbic acid tab ip 500 mg 88 asepto syringe with transparent bulb sterile, 60 ml 89 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 90 aspirin tablet ip ( gastro resistant ) 150 mg 91 atenolol tab ip 25 mg 92 atendol tab ip 50 mg 93 atorvastabn tab ip 10mg 94 atorvastatin tablets ip 40 mg 95 atracurium inj 10 mg / ml 96 atropine sulphate injection 0.6mg / ni 97 azithrornycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) 98 azithromycin tab ip 500 mg 99 azithrornycin tablets ip 250mg 100 aztreonam injection usp 500 mg 101 b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 an size 470 ( details in rc ) 102 badolen tablet ip 10 mg ( each uncoated tablet contains backifen ip 10 mg ) 103 beclorrietnasone inhalation ip 200 mcg / dose 184 beckimethasone, neomycin and clotrknazoie cream ( beclomethasone depropionate 0.025 %. neomycin sulphate 0.5 % and clo ( nmazole 1 % ) 105 bendamustine injection 100 mg 106 benzathine benzylpenicillin inj ip 12 lac units 107 betahistine tab ip 16 mg 108 betahistine tab ip 8 mg 109 betamethasone dipropionate cream ip 0.05% 110 betamethasone lotion ip 0.05 do 111 betamethasone sod phos inj ip 4rnakni 112 betamethasone tab ip 0.5mg, 113 betaxolol eye drops 0.5 no 114 bicalutamide tablet ip 50 mg ( each film tablet ( villains rkaltilamide ip no mg ) 115 blphasic isophane insulin by ip ( 30 % soluble insulin and pt ) % reviews insulin ) inj 40 iu / ml ( r dna origin ) 116 bisecodyl tab ip 5 mg ___ 117 black disinfectant fluid ( phenyl ) as per &twin* 0 grote iii 118 bleomydn injection ip 15mg ( bleomycin sulphate injectkin 15 unite ) 119 blood administration set blood tranatuakmi set ( details in rc ) 120 bone cement 121 bone wax sterilised 122 budesonide nebuilzer suspension 0.25mgmil 12 bupivacaine hydochloride in dextrose injection usp eech ml contains buphiscalne hydrochloride 5.0 mg dextrose 80.0 mg 124 buplvacaine inj ip 0.5% 125 butorphand tartrate injection usp 1mg / m1 1m1 size 126 cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 127 caffeine citrate usp injection 20mg / m1 ( equivalent to 10 mg caffeine swaim! ) 3m1 size 128 calamine lotion ip 100m1 129 calcitriol capsules ip 0.25 mcg 130 calcium giuconate inj ip 10% ( iv use ) 131 calcium vitamin d3 suspension ( each 5 rill contains calcium carbonate and equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 132 calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calclum and vitamin 03 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) 1 capedtabine tablet ip 500 mg ( each film coated tablet contains capecitablne ip 500 ni9 ) 134 carbamazepine tab ip 200 mg 135 carboplatin injection ip 150 mg 136 carboplatin injection ip 450 mg 137 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 138 carboxymethylcellulose eye drops ip 0.5% 139 carvedilol tablet 3.125 mg 1 i catheter, size 10 ( foleys balton catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 141 catheter, size 16 ( foleys gallon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 142 catheter, size 18 ( foleys gallon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 143 catheter, size 20 ( foleys gallon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 144 catheter, size 22 ( foleys gallon catheter sterile, 2 way for urinary dralnage, single use, ) silicon coated natural latex material ( details in rc ) 145 catheter, size 8 ( foleys balton catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 146 cefepime injection ip 500 mg 147 cefixime oral suspension ip 25mg / mi ( paediatric drops ) 148 cefixime tab ip 100 mg 149 cefixime tab ip 200 mg 160 cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( iwiv use ) 151 cefotaxime inj ip 250 mg 152 cefotaxime injection ip 1 g , 154 ceftazidime inj ip 250 mg 155 ceftazidime inj ip 500 mg 156 cettazidime inj ip 1g 157 ceftriaxone in ) ip 1g / vial 158 ceftriaxone inj ip 250 mg / vial 159 ceftriaxone inj ip 500mg / vial 1601 cefuroxime axetil tab ip 250 mg 161 cephalexin cap ip 250 mg 162 cephalexin cap ip 500 mg 163 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 1641 cephalexin tablets 125 mg ( dispersible tablets ) 165 ceruninolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 do 166 catirizine syrup ip 5mg / 5 ml cebrizinephenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg 167 & paracetamol 325 mg tab 168 chlorambucil tab ip 5 mg 169 chioramphenicol eye drops ip 0.5 0 / 0 170 chlorhexidine mouthwash ip 0.2 no 171 chloroquine phosphate in ) ip 40 mg / ml 172 173 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coate ( chlorpheniramine maleate tab ip 4mg 174 175 chlorzoxazone diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mq paracetamol 325 rig ) chotecalciferol granules 60, 000 iu / gm 176 chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) 177 chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) 178 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) 179 cinnarizine tablet ip 75 mg 1801 cinnarizine tablets ip 25 mg 181 ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otto suspension usp 182 ciprofloxacin eye drops ip 0.3 o / o w / v 183 ciprofloxacin injection ip 200mg / 100m1 184 ciprofloxacin ophthalmic ointment usp 0.3% 185 ciprofioxacin tablet ip 500 mg film coated 186 ciprofloxacin tablets ip 250 mg film coated 187 cisplatin inj ip 10 mg / 10 ml 188 cisplatin inj ip 50 mg / 50 ml 189 clindamycin capsule ip 150mg 190 clindamycin capsule ip 300 mg 191 clindamycin phosphate gel usp 1 o / o 192 clindamycin phosphate injection ip 300 mg 193 clobazam tablet / capsule 10 mg 194 clobazam tablet / capsule 5 mg 195 clobetasol propionate cream ip 0.05 o / o 196 clomiphene tab ip 50 mg 197 clopidogrel tab ip 75 mg....

Government Medical College - Rajasthan

33780704 supply of medicine and surgical items in bangur hospital pali for the year 2022 23 , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) , 3rd generation recombinant f viii 1000 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm , absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) , absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) , absorbent cotton wool ip 500 gm , acebrophylline tablet / capsule 100 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , acetazolamide tab ip 250mg , acetylcystine solution usp ( injection ) 200 mg / ml , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir cream 5% , acyclovir eye ointment ip 3% w / w 5gm size , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , adenosine injection ip 6 mg / 2ml , adrenaline injection ip 1mg / ml im / iv use , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , alendronate sodium tablets usp / bp 35 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , allopurinol tablets ip 100 mg , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , amino acid 10% injection 100ml size , aminophylline inj ip 25 mg / ml , amiodarone hydrochloride inj 50 mg / ml , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amitriptyline tab ip 25mg film coated , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , amphotericin b inj ip 50 mg , ampicillin cap ip 500mg , ampicillin injection ip 500 mg , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , ascorbic acid tab ip 500 mg , asepto syringe with transparent bulb sterile, 60 ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , aspirin tablet ip ( gastro resistant ) 150 mg , atenolol tab ip 25 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , atorvastatin tablets ip 40 mg , atracurium inj 10 mg / ml , atropine eye ointment ip 1% , atropine sulphate injection 0.6mg / ml , atropine sulphate ophthalmic solution usp 1% , azathioprine tab ip 50 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tab ip 500 mg , azithromycin tablets ip 250mg , aztreonam injection 1gm , aztreonam injection usp 500 mg , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) , b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , beclomethasone inhalation ip 200 mcg / dose , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , bendamustine injection 100 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , betahistine tab ip 16 mg , betahistine tab ip 8 mg , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , betamethasone sod phos inj ip 4mg / ml , betamethasone tab ip 0.5mg , betaxolol eye drops 0.5 o / o , bevacizumab injection 100 mg , bevacizumab injection 400 mg , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bisacodyl tab ip 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , blood administration set blood transfusion set ( details in rc ) , bone cement , bone wax sterilised , bortezomib injection 2mg , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , bromocriptine tablets ip 2.5 mg , budesonide nebulizer suspension 0.25mg / ml , budesonide powder for inhalation 200 mcg , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , butorphanol tartrate injection usp 1mg / ml 1ml size , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , calamine lotion ip 100ml , calcitriol capsules ip 0.25 mcg , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , calcium gluconate inj ip 10% ( iv use ) , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , carbamazepine oral suspension usp 100 mg / 5ml , carbamazepine tab ip 100 mg , carbamazepine tab ip 200 mg ( film coated ) , carbimazole tabs ip 5 mg ( film coated ) , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , carboxymethylcellulose eye drops ip 0.5% , carvedilol tablet 3.125 mg , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , cefpodoxime dispersible tab 50 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone 1 gm + tazobactum 125 mg injection , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cefuroxime axetil tab ip 250 mg , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , cephalexin tablets 125 mg ( dispersible tablets ) , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , cetirizine syrup ip 5mg / 5 ml , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetrimide cream ip 15 gm , chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) , chemotherapy port and non coring needles ( adult ) ( detail in rc ) , chlorambucil tab ip 5 mg , chloramphenicol 1% w / w eye ointment ip, 3gm size , chloramphenicol eye drops ip 0.5 0 / 0 , chlordiazepoxide tablets ip 10mg , chlorhexidine gluconate solution 5% 250 ml , chlorhexidine mouthwash ip 0.2 o / o , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate suspension ip 50 mg / 5ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chlorpheniramine maleate tab ip 4mg , chlorpromazine inj. ip 25mg / ml , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , cholecalciferol granules 60, 000 iu / gm , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) , cinnarizine tablet ip 75 mg , cinnarizine tablets ip 25 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin ophthalmic ointment usp 0.3% , ciprofloxacin tablet ip 500 mg film coated , ciprofloxacin tablets ip 250 mg film coated , cis atracurium besylate injection 2 mg / ml in 5 ml vial , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , clindamycin phosphate gel usp 1 o / o , clindamycin phosphate injection ip 300 mg , clobazam tablet / capsule 10 mg , clobazam tablet / capsule 5 mg , clobetasol propionate cream ip 0.05 o / o , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , clonazepam tablet 0.5 mg , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , clopidogrel tab ip 75 mg , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , clotrimazole cream ip 2% w / w , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , clotrimazole vaginal tab ip 500mg , cloxacillin sodium inj ip 500mg , coal tar 6% & salicylic acid 3% ointment , colistimethate injection ip 1m iu powder for solution , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , compound benzoin tincture ip , compound sodium lactate inj. ip , conc haemodialysis fluid b.p acetate concentrate 10 litre can , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , conjugated estrogen tabs usp 0.625 mg. , corrugated drainage sheet all sizes ( details in rc ) , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cough syrup / expectorant ( 50 ) ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , cyclosporin capsule usp / ip 50 mg , cytarabine injection bp 500mg , dacarbazine injection 500 mg usp / bp , danazol cap ip 50 mg , dasatinib tab 100 mg , daunorubicin inj ip 20 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , dextromethorphan hbr syrup ip 13.5mg / 5ml , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofence prolonged release tablet ip 100 mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine hydrochloride oral solution ip 10mg / 5ml , dicyclomine inj ip 10 mg / ml , dicyclomine tab ip 10 mg , diethylcarbamazine tab ip 100 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , diphtheria antitoxin 10000 iu , disposable sterile surgical rubber gloves size 8 inches, powder free , disposable sterile surgical rubber gloves size 8 inches, powdered , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , domperidone oral drops 10mg / ml ( 10ml ) , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , dopamine hydrochloride inj ip 40 mg / ml , double j stent, sterile, both ends open size 4f, length 16 cm , double j stent, sterile, both ends open, size 5f, length 20 cm , double j stent, sterile, one end closed size 4f, length 16 cm , double j stent, sterile, one end closed, size 5f, length 20 cm , doxorubicin inj ip 50 mg / 25 ml , doxycycline cap ip 100 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , drotaverine hydrochloride inj 40 mg / 2 ml , drotaverine tab ip 40 mg , dutasteride tablet 0.5 mg , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , ecg electrode ( detail in rc ) , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) , enalapril maleate tab ip 2.5mg , enalapril maleate tab ip 5mg , enalapril maleate tablets ip 10 mg , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, plain size 2.5 ( details in rc ) , endotracheal tube, plain size 3 ( details in rc ) , endotracheal tube, plain size 3.5 ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 7 ( details in rc ) , endotracheal tube, plain size 7.5 ( details in rc ) , endotracheal tube, plain size 8 ( details in rc ) , endotracheal tube, plain size 8.5 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , enoxaparin sodium inj ip 60 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) , escitalopram tab ip 10 mg , esmolol hydrochloride injection 10mg / ml 10ml size , ethamsylate inj 250 mg / 2ml ( im / iv ) , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , ethinyloestradiol tabs ip 50 mcg , etoposide inj ip 100 mg , etoricoxib tab ip 120mg , etoricoxib tablet 90 mg , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , face mask, disposable ( details in rc ) , factor ix concentrate ( purified ) ip 600 i.u. ( human coagulation factor ix ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , fenofibrate capsules / tab ip 200 mg , fentanyl citrate injection 50mcg / ml , fentanyl citrate injection ip 2 ml , feracrylum 1% w / v sterile solution 100 ml , ferric carboxymaltose injection 50 mg / ml 10 ml size , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , finasteride tablets ip 5 mg , flavoxate tablets ip 200 mg ( coated tablet ) , fluconazole eye drops 0.3% , fluconazole tablets ip 150mg , flunarizine tab 5 mg , fluorouracil inj ip 250 mg / 5ml , fluoxetine cap ip 20 mg , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 , foldable intra ocular lense with injector ( details in rc ) 18 to 24 , foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 , foleys catheter no. 14 ( detail in rc ) , folic acid tab ip 5 mg , formaldehyde solution ( 34.5 per. 38 per. ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , framycetin sulphate cream 1 o / o 100 gm pack , framycetin sulphate cream 1 o / o 30gm pack , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , fusidic acid cream ip 2% , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , gadodiamide inj. 0.5mml / ml vial , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , gentamycin injection ip 80mg / 2ml ( im / iv use ) , gentian violet topical solution usp 1o / o , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , glibenclamide tab ip 5 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , gliclazide tab ip 40 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glipizide tab ip 5mg , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , glucagon for injection usp 1 mg / ml , gluteraldehyde solution 2% , glycerin ip 100 ml , glycerin ip 400 gm , glyceryl trinitrate tablets 2.6 mg controlled release tablets , glycopyrrolate inj ip 0.2 mg / ml , griseofulvin tab ip 125 mg , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , halothane bp , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis b immunologlobin injection ip 200 i.u , homatropine eye drops ip 2% , human albumin solution ip 20% , human anti d immunoglobulin 150 mcg , human anti d immunoglobulin injection 300mcg ( im use ) , human chorionic gonadotropin injection ip 5000 i.u. , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , human rabies immunoglobulin inj 150 iu / ml , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrochlorthiazide tab ip 12.5 mg , hydrochlorthiazide tab ip 25mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , hydroxychloroquine sulphate tablets 200mg , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , hydroxyprogesterone inj ip 250mg / ml , hydroxypropylmethyl cellulose solution 20 mg / ml , hydroxyzine tab ip 25 mg , hyoscine butyl bromide tablets ip 10mg , hyoscine butylbromide inj ip 20 mg / ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , indomethacin cap ip 25 mg , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , intravenous fat emulsion 20% w / v 250ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , ipratropium bromide nebulizer solution 250 mcg / ml , ipratropium powder for inhalation ip 40 mcg , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , isoflurane usp , isophane insulin inj ip 40 iu / ml , isoprenaline injection ip 2mg / ml , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , itraconazole cap 100 mg , k wire, length 375 mm; 1.6mm ( details in rc ) , k wire, length 375 mm; 1.8mm ( details in rc ) , k wire, length 375 mm; 1mm ( details in rc ) , ketamine inj ip 50 mg / ml , ketoconazole cream 2% , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , labetalol hcl inj ip 20mg / 4ml , labetalol tab ip 100mg , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , l asparaginase inj 10000 iu , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , levetiracetam injection 500mg / 5ml , levetiracetam oral solution / suspension 100mg / ml , levetiracetam tablet ip 500 mg , levoceitrizine tablet 5mg , levodopa and carbidopa tab 250 mg+ 25 mg , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , levofloxacin tablets ip 250 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lidocaine hcl topical solution usp 4% , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , lignocaine ointment 5 o / o , linezolid inj 200mg / 100ml , linezolid tablets ip 600 mg , liposomol amphotericine injection b 50mg , liquid medical oxygen ( lmo ) , liquid paraffin ip 100 ml , liquid paraffin ip 400 ml , lisinopril tab ip 2.5 mg , lisinopril tab ip 5 mg , lisinopril tablets ip 10 mg , lithium carbonate tab ip 300 mg , lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) , loperamide tab ip 2 mg , lorazepam inj ip 2 mg / ml , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , mannitol inj ip 20% w / v , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , mecobalamin inj 500 mcg / ml , medroxyprogesterone acetate tablets ip 10 mg , mefenamic acid tablets bp 500 mg , mefloquine tablets ip 250 mg , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , meropenem inj ip 500 mg , meropenem inj. ip 1gm , meropenem injection ip 250 mg , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin tab ip 500 mg ( film coated ) , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , methotrexate tablets ip 10 mg , methyl cobalmine tablet 1500mcg , methyl cobalmine tablet 500mcg , methyl prednisolone sodium succinate for injection usp 500 mg , methyldopa tab ip 250mg film coated , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , metoclopramide hydrochloride syrup ip 5 mg / 5ml , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , metoprolol succinate extended release tablets ip 50 mg , metoprolol tablets ip 25 mg , metronidazole 1% and chlorhexidine gluconade 0.25% gel , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole inj ip 500 mg / 100ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , miconazole nitrate cream ip 2% , midazolam inj ip 1 mg / ml , mifepristone tab ip 200mg , misoprostol tab ip 200 mcg , mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , morphine sulphate inj ip 10mg / ml , mucus extractor sterile ( details in rc ) , multi vitamin syrup , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , multistix test strip , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , naloxone inj ip 0.4mg / ml , naproxen tablet ip 250mg , naproxen tablet ip 500mg , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , nebulization mask adult ( detail in rc ) , nebulization mask paediatric ( detail in rc ) , nelaton catheter size 14 fg ( detail in rc ) , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , neostigmine inj ip 0.5 mg / ml , neostigmine injection ip 2.5mg / 5ml , neostigmine tab ip 15 mg , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitrofurantoin tab ip 100mg , nitroglycerin inj 5 mg / ml , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , noradrenaline injection ip 2 mg / ml , norethisterone tab ip 5 mg , norfloxacin tab ip 400mg film coated , normal human intravenous immunoglobulin 5g / 100ml , octreotide injection 50 mcg / ml , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , ofloxacin oral suspension ip 50mg / 5ml , ofloxacin tab ip 200 mg , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , oitment mupirocin ip 2% , olanzapine tab ip 5 mg , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ondansetron orally disintegrating tablets ip 4mg , ors powder ip , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oxaliplatin injection usp 50 mg , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , oxygen mask ( adult ) , oxygen mask ( pediatric ) , oxytocin inj ip 5 iu / ml , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol infusion ip 1% w / v 100ml size , paracetamol inj. 150 mg / ml , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , pentazocine inj ip 30mg / ml ( im / iv use ) , pentoprazole inj 40 mg , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) , peritonial dialysis solution ip , permethrin cream 5% , permethrin lotion 5% , phenazopyridine tablet 5 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone inj ip 200mg / ml , phenobarbitone tab ip 30 mg , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , pioglitazone tab ip 15 mg , piperacillin + tazobactum for injection ip 4gm+500mg , piperacillin injection 2 gm + tazobactom 250mg ip , plaster of paris bandage 10cm x 2.7mts , plaster of paris bandage 15cm x 2.7 mts / roll , polygeline 3.5% solution with electrolytes for i.v. infusion , polymixin sulphate b injection usp 5 lac i.u. , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , povidone iodine ointment 5% 15 gm , povidone iodine ointment usp 250 gm , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , povidone iodine solution ip 10 % , povidone iodine solution ip 5 % 500 ml , povidone iodine solution ip 5% 100ml bottle , powder clotrimazole 1% w / w 30 gm , pralidoxime chloride injection ip 25 mg / ml / 500 mg , prazosin tablets ( extended release ) 2.5 mg , prednisolone tab ip 20 mg , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , pregabalin cap ip 75 mg , pressure monitoring line / high pressure extension line ( details in rc ) , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , prochlorperazine mesylate injection 12.5mg / ml 5ml size , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , promethazine syrup ip 5 mg / 5ml , promethazine tab ip 25 mg , propofol inj ip 10 mg / ml , propranolol tab ip 40 mg , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , quetiapine tablet ip 25mg , quetiapine tablet ip 50mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , ramipril tablets ip 2.5 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , rh erythropoetin inj 4000 iu , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , ringer acetate infusion 500 ml , risperidone tab 1 mg , risperidone tab 2mg , rosuvastatin tablet 10 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) , rubber examination gloves, non sterile, extra small ( details in rc ) , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves, size small ( details in rc ) , ryles tube / nasogastric tube size: 10 ( details in rc ) , ryles tube / nasogastric tube size: 12 ( details in rc ) , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , ryles tube / nasogastric tube size:14 ( details in rc ) , sacubitril 24 mg and valsartan 26 mg tablet , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol syrup ip 2mg / 5ml , salbutamol tab ip 2 mg , salbutamol tablet ip 4 mg , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , sanitary napkin beltless with wings ( details in rc ) , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , scalp vein set ( disposable ) size 18g ( details in rc ) , scalp vein set ( disposable ) size 20g ( details in rc ) , scalp vein set ( disposable ) size 22g ( details in rc ) , scalp vein set ( disposable ) size 24 g ( details in rc ) , sertraline tab ip 50 mg , sevoflurane , silver sulphadiazine cream ip 1% 500 gm jar , silver sulphadiazine cream ip 1% 50gm tube , skin graft knife blade ( sterile ) ( details in rc ) , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , sodium bicarbonate inj ip 7.5% w / v , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , sodium chloride 0.45% w / v polypack 500 ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium nitroprusside injection 25mg / ml 2ml size , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , sodium valproate gastro resistant tablets ip 200 mg , sodium valproate inj 100 mg / ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , standard pama intra ocular lenses ( details in rc ) 11 to 17.5 , standard pama intra ocular lenses ( details in rc ) 18 to 24 , standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , streptokinase injection 15 lac units ip , succinylcholine inj. ip 50 mg / ml ( iv use ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , surgical spirit ip ( 100 ml ) , surgical spirit ip ( 500 ml ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , tamoxifen tab ip 10 mg , tamsulosin hcl tablets / capsule 0.4 mg , telmisartan tablets ip 40 mg , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm , tenaligliptin tablet ip 20mg , terbinafine cream 1%w / w ( 10 gm tube ) , terbinafine hydrochloride tablet 250 mg , terbutaline tablets ip 2.5 mg , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , thiamine tablets ip 100 mg , thiopentone inj ip 0.5 g , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , timolol eye drops ip 0.5 o / o w / v , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , torsemide inj 10 mg / ml , torsemide tab 10 ip mg , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , tracheostomy tube, plain all sizes ( details in rc ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , tranexamic acid injection ip 100mg / ml 5ml size , tranexamic acid tablets ip 500 mg , travoprost eye drops ip 0.004 o / o , tretenoin cream usp 0.025% , trifluperazine tab ip 5 mg coated , trihexyphenidyl hcl tab ip 2 mg , tropicamide eye drop ip 1o / o , t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) , urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , urokinase injection 5 lac unit ( lyophilized ) , ursodeoxycholic acid tablets ip 300 mg , vaccum suction set, 2.5 meter length ( detail in rc ) , valethamate bromide inj 8mg / ml , valganciclovir tablet 450 mg , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vdrl antigen ( with + ve and ve control ) / rpr slide kit , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil tab ip 40 mg film coated , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin d3 oral solution 60000 iu , vitamin e capsule 400 mg , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , voriconazole injection 200mg / vial , warfarin sodium. tab ip 5mg , water for inj ip , xylometazoline nasal drops ip 0.1% , zinc sulphate dispersible tablets ip elemental zinc 10 mg , zoledronic acid injection ip 4mg vial , zolpidem tablet 5 mg , amino acid drop , amino acid inj. ( astamin ) , aminorich drop / astymen c / amenovik , amoxycillin and potassium clavulanate drop , ampilox 250 ml inj. , aquasop inj. , arichitol inj. , arodesin solution , augpen 150 mg ( amoxycilline + pot. clavulanate ) inj. , augpen 300 mg ( amoxycilline + pot. clavulanate ) inj. , auto clave tape ( stera tape ) , b.p. instument with mercuary , b.p. instument with mercuary standing , b.p. instument without mercuary , bains circuit adult , bains circuit pediatric , betnisol inj. , biotax 125 mg ( ceftoxyn ) inj. , cabergolin 0.25 mg tab. , candid lotion , citric acid , dettol 100 ml , disposable baby kit , disposable needle no 16 11 / 2inch , disposable razor , dressing drum all sizes , drop sodabicarb , erofer l drops 15 ml , evion drop , ezithromycin 15ml sy , formalin 1 ltr , formalin 5 ltr , glucometer strip , gluco one strip ( dr. morepen ) , hand sanitizer , inj. citicholin , inj. hepamerz , inj. nootrophil , inj. strocit , intralipid inj. , k 90 catheter , lactodex lbw with micronutrients , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small , lilan thread 40 , lilan thread 60 , mackintosh , mucus sucker set , multivitamin with zinc syp. , multizec trop 15 ml , neasphine oint. , needle no. 211 / 2 , needle order , neosprin eye oint. , netromycine 10 mg. inj. ( netromax 10 mg inj. ) , nuclovate cream 15 gm , oxygen double stage ragulator , pedia set 100 ml , pepericilline + tezobactum 1.125 mg inj. , pressure monitoring line / high pressure extension line ( pmo line ) length 150 cm, prime volume 1.40 ml , prochlorpertine tab. , re breathing bag adult , re breathing bag pediatric , rubber face mask 0 5 , sevlon lotion 100 ml. , simyl mct powder , star plast ( adhesive plaster ) , caffeine citrate 20 mg / ml injection 2 ml vial , vit. a syp. , vit. c drop , vit. c syp. , vit. c tab. , zinc 200 ml syp , zinc 60 ml / 100 ml sy. , zincovit syp. , zincula drop , mouth airway ( all size ) , inj. n.s.500 m.l. ( in glass bottle ) , inj. n.s.100 m.l. ( in glass bottle ) , cidex 5 ltr , blanisol plus , alcohal based hand rub , surgical hand & skin disinfactent , antiseptic surgical hand rub , povidine iodine 5% & 10% , high level instrument disinfactent , multi eyzymetic instrument cleaner , surgical instrument rust, spot & stain remover , rejuventate dialysis reprocessing , disinfectent & decalcification of haemodialysis machine , d 125 disinfectent 1 ltr. , 5 fu 500 mg , capcetabin 500 mg , carboplatin 150 mg , carboplatin 450 mg , cisplatin 10 mg , codon iv set , cyclophosphamide 500mg , danazole 50 mg cap. , docetaxel 120 mg , docetaxel 80 mg , doxorubicine 10 mg , doxorubicine 50 mg , epirubicine 50 mg , filgrastin 300 mg , inj. gemcitabin 1 gm , inj. gemcitabin 2 mg , ieucovorin 50 mg , tab. imatinib 400 mg , inj. mesna 100 mg , inj. botrezumib , inj. bleomycin , oxaliplatin 50 mg , pacletaxel 260 mg , tamoxifen 10 mg , zolidronic acid 4 mg , inj. vetneuren 2 ml , inj. vanomycin , inj. surfactant , human hepatitis b immunoglobulin 100 i.u. injection ( 100 i.u. / 0.5 ml ) , three way adopter , inj. milriuon , inj. decarbazine ( dtic ) ...

Medical And Health Services - Rajasthan

33776214 supply of medicine and surgical items in bangur hospital pali for the year 2022 23 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) each piece 2 s122 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) each piece 3 s120 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) each piece 4 s123 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) each piece 5 s121 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) each piece 6 750 3rd generation recombinant f viii 1000 iu with diluent vial with diluent 7 749 3rd generation recombinant f viii 250 iu with diluent vial with diluent 8 742 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) each piece 9 s47.a abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) each piece 10 s124 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) each piece 11 s125 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) each piece 12 s47.b abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) each piece 13 s47.c abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) each piece 14 731 abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) bottle of 30 tablets 15 s1 absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) piece 16 s95 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) each pcs. 17 r2 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 1x12 foils 18 r4 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 1x12 foils mndy tender list 2022 19 r3 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 20 r5 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 1x12 foils 21 r7 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 1x12 foils 22 r6 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 23 r1 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 1x12 foils 24 r8 absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) 1x12 foils 25 r72 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm 1x12 foils 26 r70 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm 1x12 foils 27 r71 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm 1x12 foils 28 r73 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm 1x12 foils 29 r10 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size2 / 0 1 / 2 cir rb needle 30mm length 90 cm 1x12 foils 30 r16 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size2 / 0 1 / 2 cir rb needle 40mm l 90cm 1x12 foils 31 r65 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) 1x12 foils 32 r67 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) 1x12 foils 33 r66 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) 1x36 foils 34 r11 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm 1x12 foils 35 r9 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm 1x12 foils 36 r13 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm 1x12 foils 37 r17 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) 1x12 foils 38 r15 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) 1x12 foils 39 r18 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm 1x12 foils 40 r74 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm 1x12 foils 41 r12 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide col lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm 1x12 foils 42 r68 absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 43 r69 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 44 r14 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed 1x12 foils 45 r19 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm 1x12 foils 46 r62 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) 1x12 foils 47 r64 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) 1x12 foils 48 r63 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) 1x12 foils 49 r61 absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) 1x12 foils 50 s2 absorbent cotton wool ip 500 gm each pcs. 51 780 acebrophylline tablet / capsule 100 mg 10x10 tablets 52 492 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg each pcs. 53 163 acenocoumarol tab ip / nicoumalone tab ip 2 mg 10x10 tab strip 54 253 acetazolamide tab ip 250mg 10x10 tab blister 55 500 acetylcystine solution usp ( injection ) 200 mg / ml each pcs. 56 647 act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) one combi blister pack 57 648 act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) one combi blister pack 58 645 act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) one combi blister pack 59 646 act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) one combi blister pack 60 213 acyclovir cream 5% each pcs. 61 769 acyclovir eye ointment ip 3% w / w 5gm size 5 gm tube 62 502 acyclovir intravenous infusion ip 250mg each pcs. 63 503 acyclovir intravenous infusion ip 500mg vial 64 62 acyclovir oral suspension ip 400mg / 5ml 60 ml bottle ( with measuring cap ) 65 63 acyclovir tab ip 200 mg 10x10 tab blister 66 64 acyclovir tab ip 800 mg 10x10 tab strip 67 547 adenosine injection ip 6 mg / 2ml each pcs. 68 34 adrenaline injection ip 1mg / ml im / iv use 1ml amp ( ambercolor ) 25 amp 69 65 albendazole oral suspension ip 400 mg / 10ml 10 ml bottle 70 66a albendazole tablets ip 400 mg ( detail in rc ) each pcs. 71 631 alendronate sodium tablets usp / bp 35 mg 4 tablets ( 20 *4tablet ) 72 788 alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) 1 73 598 allopurinol tablets ip 100 mg 10x10 tablets 74 525 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit each pcs. 75 339 alprazolam tab ip 0.25 mg each pcs. 76 340 alprazolam tab ip 0.5mg 10x10 tab blister 77 67 amikacin inj ip 100 mg 2 ml vial 78 504 amikacin inj ip 250 mg vial 79 68 amikacin inj ip 500 mg 2 ml vial 80 794 amino acid 10% injection 100ml size 100 ml bottle 81 365 aminophylline inj ip 25 mg / ml 10 ml amp 25 ampoules 82 183 amiodarone hydrochloride inj 50 mg / ml 3 ml amp ( 10 amp ) 83 181 amiodarone tab ip 100 mg 10x10 tablets 84 182 amiodarone tab ip 200 mg 10x10 tab strip 85 341 amitriptyline tab ip 25mg film coated 10x10 tab strip 86 461 amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) 10x10 tab blister 87 457 amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) 10x10 tab strip 88 460 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg 10x10 tab strip / blister 89 184 amlodipine tab ip 2.5 mg each pcs. 90 185 amlodipine tablets ip 5 mg 10x10 tab blister 91 506 amoxicillin and potassium clavulanate inj ip 1.2gm vial 92 505 amoxicillin and potassium clavulanic ip inj 600mg each pcs. 93 69 amoxycillin and cloxacillin cap 250 + 250 mg 10x10 cap strip 94 70 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg each pcs. 95 507 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) each pcs. 96 71 amoxycillin cap ip 250mg 10x10 cap strip / blister 97 72 amoxycillin cap ip 500mg 10x10 cap strip / blister 98 73 amoxycillin dispersible tablets ip 125 mg 10x10 tab strip 99 473 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml each pcs. 100 706 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 10x10 tablets 101 74 amphotericin b inj ip 50 mg vial 102 412 ampicillin cap ip 500mg 10x10 cap blister 103 75 ampicillin injection ip 500 mg vial 104 261a antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 60 ml bottle ( with measuring cap ) 105 260a antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 10x10 tab blister 106 225 anti a blood grouping serum ip ( anti a monoclonal serum ) each pcs. 107 226 anti b blood grouping serum ip ( anti b mono clonal serum ) each pcs. 108 227 anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip each pcs. 109 407 anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) each pcs. 110 497 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg each pcs. 111 686 artemether and leumefantrine tablet ( 40 mg and 240 mg ) 1x6 tablet blister 112 651 artemether and leumefantrine tablet ( 80 mg and 480 mg ) 1x6 tablet blister 113 508a artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) each combo pack in a unit carton 114 387 ascorbic acid tab ip 500 mg 10x10 tab strip 115 s3 asepto syringe with transparent bulb sterile, 60 ml each pcs. 116 444 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 117 679 aspirin tablet ip ( gastro resistant ) 150 mg 14x10 tablet 118 462 atenolol tab ip 25 mg each pcs. 119 186 atenolol tab ip 50 mg each pcs. 120 187 atorvastatin tab ip 10mg each pcs. 121 548 atorvastatin tablets ip 40 mg each pcs. 122 311 atracurium inj 10 mg / ml 2.5 ml amp ( 10 ampoules ) 123 319 atropine eye ointment ip 1% each pcs. 124 654 atropine sulphate injection 0.6mg / ml each pcs. 125 320 atropine sulphate ophthalmic solution usp 1% 5 ml. vial with sterilized dropper, or squeeze vial 126 133 azathioprine tab ip 50 mg 10x10 tab strip 127 78a azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 128 80a azithromycin tab ip 500 mg 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 129 79a azithromycin tablets ip 250mg 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 130 683 aztreonam injection 1gm vial 131 509 aztreonam injection usp 500 mg vial 132 r79 b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) 1x12 foils 133 r78 b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) 1x12 foils 134 698 baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) 10x10 tablets 135 366 beclomethasone inhalation ip 200 mcg / dose each pcs. 136 445 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) each pcs. 137 726 bendamustine injection 100 mg vial 138 81 benzathine benzylpenicillin inj ip 12 lac units vial 139 82 benzathine benzylpenicillin inj ip 6 lac units vial 140 542 betahistine tab ip 16 mg 10x10 tablets 141 541 betahistine tab ip 8 mg 10x10 tablets 142 558 betamethasone dipropionate cream ip 0.05% 15gm tube in a unit carton 143 559 betamethasone lotion ip 0.05 o / o each pcs. 144 418 betamethasone sod phos inj ip 4mg / ml each pcs. 145 35 betamethasone tab ip 0.5mg each pcs. 146 612 betaxolol eye drops 0.5 o / o each pcs. 147 735 bevacizumab injection 100 mg vial 148 734 bevacizumab injection 400 mg vial 149 741 bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) 10x10 tablets 150 279 biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) each pcs. 151 262 bisacodyl tab ip 5 mg 10x10 tab strip 152 398 black disinfectant fluid ( phenyl ) as per schedule o grade iii 5 ltrs can 153 134 bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) each pcs. 154 s4 blood administration set blood transfusion set ( details in rc ) unit 155 s98 bone cement each pcs. 156 s80 bone wax sterilised 2.5 gram / packet 157 730 bortezomib injection 2mg vial 158 487 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% each pcs. 159 540 bromocriptine tablets ip 2.5 mg 10x10 tab strip 160 367 budesonide nebulizer suspension 0.25mg / ml each pcs. 161 617 budesonide powder for inhalation 200 mcg 30 capsules 162 2 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 4ml amp ( 10 ampoules ) 163 4 bupivacaine inj ip 0.5% each pcs. 164 694 butorphanol tartrate injection usp 1mg / ml 1ml size each pcs. 165 773 cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 10x10 tablets 166 793 caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 3ml vial 167 671 calamine lotion ip 100ml 100 ml bottle 168 630 calcitriol capsules ip 0.25 mcg 10x10 cap strip / blister 169 441 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 100 ml bottle ( with measuring cap ) 170 388 calcium gluconate inj ip 10% ( iv use ) 10 ml amp 25 ampoules 171 622 calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) each pcs. 172 727 capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) 10x10 tablets 173 474 carbamazepine oral suspension usp 100 mg / 5ml 100 ml bottle ( with measuring cap ) 174 54 carbamazepine tab ip 100 mg 10x10 tab strip / blister 175 53 carbamazepine tab ip 200 mg ( film coated ) each pcs. 176 280 carbimazole tabs ip 5 mg ( film coated ) each pcs. 177 526 carboplatin injection ip 150 mg 15 ml vial 178 527 carboplatin injection ip 450 mg 45 ml vial 179 281 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 1 ml amp / vials ( 25 ampoule / vial ) 180 613 carboxymethylcellulose eye drops ip 0.5% each pcs. 181 755 carvedilol tablet 3.125 mg 10x10 tablets 182 s9.b catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 183 s9.c catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 184 s9.d catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 185 s9.e catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 186 s9.f catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 187 s9.g catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 188 s9.a catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 189 709 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) 10x10 tablets 190 710 cefadroxil tablet 500 mg 10x10 tablets 191 510 cefepime injection ip 500 mg vial 192 511 cefixime oral suspension ip 25mg / ml ( paediatric drops ) each pcs. 193 84 cefixime tab ip 100 mg 10x10 tab strip 194 85 cefixime tab ip 200 mg each pcs. 195 86 cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) vial 196 88 cefotaxime inj ip 250 mg each pcs. 197 87 cefotaxime injection ip 1 g each pcs. 198 475 cefpodoxime dispersible tab 50 mg each pcs. 199 89 ceftazidime inj ip 1g vial 200 90 ceftazidime inj ip 250 mg each pcs. 201 91 ceftazidime inj ip 500 mg each pcs. 202 708 ceftriaxone 1 gm + tazobactum 125 mg injection each pcs. 203 93 ceftriaxone inj ip 1g / vial vial ( packed in monocarton ) 204 94 ceftriaxone inj ip 250 mg / vial each pcs. 205 95 ceftriaxone inj ip 500mg / vial vial ( packed in monocarton ) 206 512 cefuroxime axetil tab ip 250 mg 10x10 tab strip 207 96 cephalexin cap ip 250 mg 10x10 cap blister 208 97 cephalexin cap ip 500 mg 10x10 cap blister 209 427 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 30 ml bottle with measuring cap 210 476 cephalexin tablets 125 mg ( dispersible tablets ) each pcs. 211 589 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 212 499 cetirizine syrup ip 5mg / 5 ml each pcs. 213 498 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab 10x10 tablets 214 215a cetrimide cream ip 15 gm 15gm tube in a unit carton 215 s137 chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) each piece 216 s136 chemotherapy port and non coring needles ( adult ) ( detail in rc ) each piece 217 136 chlorambucil tab ip 5 mg each pcs. 218 771 chloramphenicol 1% w / w eye ointment ip, 3gm size 3 gm tube 219 321 chloramphenicol eye drops ip 0.5 0 / 0 each pcs. 220 342 chlordiazepoxide tablets ip 10mg 10x10 tab strip 221 447 chlorhexidine gluconate solution 5% 250 ml 250 ml bottle 222 580 chlorhexidine mouthwash ip 0.2 o / o each pcs. 223 98 chloroquine phosphate inj ip 40 mg / ml 5 ml amp ( 25 amp ) 224 100a chloroquine phosphate suspension ip 50 mg / 5ml 60 ml bottle ( with measuring cap ) 225 99 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 10x10 tab strip / blister 226 37 chlorpheniramine maleate tab ip 4mg each pcs. 227 346 chlorpromazine inj. ip 25mg / ml each pcs. 228 343 chlorpromazine tablets ip 100 mg ( coated tablet ) 10x10 tab strip 229 344 chlorpromazine tablets ip 25 mg ( sugar coated ) 10x10 tab strip 230 345 chlorpromazine tablets ip 50 mg ( coated tablets ) 10x10 tab strip 231 610 chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) each pcs. 232 623 cholecalciferol granules 60, 000 iu / gm each pcs. 233 r77 chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) each pcs. 234 r80 chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) 1x12 foils 235 r76 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) 1x12 foils 236 544 cinnarizine tablet ip 75 mg 10x10 tab blister 237 543 cinnarizine tablets ip 25 mg 10x10 tab blister 238 585 ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp 5 ml. vial with sterilized dropper, or squeeze vial 239 322 ciprofloxacin eye drops ip 0.3 o / o w / v 5 ml squeeze vial 240 101 ciprofloxacin injection ip 200mg / 100ml 100 ml ffs / bfs bottle 241 323 ciprofloxacin ophthalmic ointment usp 0.3% 5 gm tube in unit carton 242 103 ciprofloxacin tablet ip 500 mg film coated each pcs. 243 102 ciprofloxacin tablets ip 250 mg film coated each pcs. 244 768 cis atracurium besylate injection 2 mg / ml in 5 ml vial 5 ml vial 245 528 cisplatin inj ip 10 mg / 10 ml each pcs. 246 137 cisplatin inj ip 50 mg / 50 ml each pcs. 247 513 clindamycin capsule ip 150mg each pcs. 248 514 clindamycin capsule ip 300 mg each pcs. 249 560 clindamycin phosphate gel usp 1 o / o 20gm tube in mono carton 250 714 clindamycin phosphate injection ip 300 mg vial / ampoules 251 663 clobazam tablet / capsule 10 mg 10x10 tablet / capsule blister 252 662 clobazam tablet / capsule 5 mg 10x10 tablet / capsule blister 253 561 clobetasol propionate cream ip 0.05 o / o each pcs. 254 282 clomifene tab ip 25 mg 10x10 tab strip 255 283 clomiphene tab ip 50 mg each pcs. 256 678 clonazepam tablet 0.5 mg each pcs. 257 751 clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) each pcs. 258 549 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg each pcs. 259 188 clopidogrel tab ip 75 mg 10x10 tab strip 260 s96.a close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) each piece 261 s96.b close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) each piece 262 586 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 5 ml ear drops 263 104 clotrimazole cream ip 2% w / w 15gm tube in a unit carton 264 443 clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) each pcs. 265 105 clotrimazole vaginal tab ip 500mg single tablet ( 10 tabs with an applicator ) 266 417 cloxacillin sodium inj ip 500mg vial 267 670 coal tar 6% & salicylic acid 3% ointment 20gm 268 718 colistimethate injection ip 1m iu powder for solution vial 269 106 compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o 15gm tube in mono carton 270 244 compound benzoin tincture ip 500 ml bottle 271 377 compound sodium lactate inj. ip 500 ml ffs / bfs bottle 272 399 conc haemodialysis fluid b.p acetate concentrate 10 litre can each pcs. 273 687 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans each pcs. 274 284 conjugated estrogen tabs usp 0.625 mg. each pcs. 275 s48 corrugated drainage sheet all sizes ( details in rc ) each pcs. 276 107 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 50 ml bottle ( with measuring cap ) 277 669 co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) each pcs. 278 108 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 10x10 tab blister 279 368 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. 50 ml bottle ( with measuring cap ) 280 692 cough syrup / expectorant ( 50 ) ml 50 ml bottle ( with measuring cap ) 281 138 cyclophosphamide inj ip 200 mg 10 ml glass vial 282 139 cyclophosphamide inj ip 500 mg 25ml glass vial 283 736 cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) each pcs. 284 677 cyclosporin capsule usp / ip 50 mg 50 caps pack 285 141 cytarabine injection bp 500mg each pcs. 286 529 dacarbazine injection 500 mg usp / bp each pcs. 287 142 danazol cap ip 50 mg 10x10 cap blister 288 797 dasatinib tab 100 mg each pcs. 289 143 daunorubicin inj ip 20 mg 10 ml glass vial 290 165 deferasirox tab 100 mg each pcs. 291 166 deferasirox tab 500 mg 30 tablets 292 167 deferiprone cap 250 mg 50 caps 293 168 deferiprone cap 500 mg 50 caps 294 581 dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) 295 169 desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) vial 296 39 dexamethasone inj ip 8mg / 2ml 2 ml vial ( usp type i vial ) 297 40 dexamethasone tab ip 0.5 mg 10x10 tab strip 298 700 dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) 10x10 tablets 299 440 dextromethorphan hbr syrup ip 13.5mg / 5ml 30 ml. bottle 300 379 dextrose inj ip 10% 500 ml ffs / bfs bottle 301 378 dextrose inj ip 25% w / v 100 ml ffs / bfs bottle 302 380 dextrose inj ip 5% 500 ml ffs / bfs bottle 303 232 diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) 20 ml vial / ampoule 304 233 diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) 20 ml ampoule 305 349 diazepam inj ip 10mg / 2ml ( 1m / iv use ) 2 ml amp 25 ampoules 306 350 diazepam tab ip 5 mg 10x10 tab strip / blister 307 20 diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) each pcs. 308 493 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 20 gm tube in unit carton 309 483 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg each pcs. 310 695 diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use 1 ml. ampoule 311 19 diclofenac sodium inj ip 25 mg / ml ( im / iv use ) 3 ml amp ( 10 amp ) 312 437 diclofence prolonged release tablet ip 100 mg 10x10 tab strip 313 439a dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 10x10 tab blister 314 438 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 315 265 dicyclomine hydrochloride oral solution ip 10mg / 5ml 30 ml bottle with measuring cap 316 264 dicyclomine inj ip 10 mg / ml 2 ml amp 25 ampoules 317 263 dicyclomine tab ip 10 mg each pcs. 318 110 diethylcarbamazine tab ip 100 mg 10x10 tab blister 319 189 digoxin inj ip 0.25 mg / ml each pcs. 320 190 digoxin tab ip 0.25 mg. 10x10 tab strip 321 191 diltiazem tabs ip 30 mg film coated each pcs. 322 285 dinoprostone cream / gel 0.5 mg dinoprostone in syringe syringe 323 480 diphtheria antitoxin 10000 iu vial 324 s89.b disposable sterile surgical rubber gloves size 8 inches, powder free pair 325 s89.a disposable sterile surgical rubber gloves size 8 inches, powdered pair 326 702 divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) 10x10 tablets 327 192 dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) each pcs. 328 590 domperidone oral drops 10mg / ml ( 10ml ) 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 329 266 domperidone suspension ip 5mg / 5ml each pcs. 330 267 domperidone tab ip 10 mg each pcs. 331 193 dopamine hydrochloride inj ip 40 mg / ml 5 ml amp ( amber colour ) 25 ampo 332 s41.a double j stent, sterile, both ends open size 4f, length 16 cm each pcs. 333 s41.b double j stent, sterile, both ends open, size 5f, length 20 cm each pcs. 334 s42.a double j stent, sterile, one end closed size 4f, length 16 cm each pcs. 335 s42.b double j stent, sterile, one end closed, size 5f, length 20 cm each pcs. 336 144 doxorubicin inj ip 50 mg / 25 ml each pcs. 337 111 doxycycline cap ip 100 mg 10x10 cap strip / blister 338 763 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 10x10 tablets 339 689 dried factor viii fraction ip ( iv use ) 1000 iu / vial vial with diluent 340 688 dried factor viii fraction ip ( iv use ) 500 iu / vial each pcs. 341 171 dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) each pcs. 342 591 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 10x10 tablets 343 5 drotaverine hydrochloride inj 40 mg / 2 ml 2 ml amp 10 ampoules 344 415 drotaverine tab ip 40 mg each pcs. 345 787 dutasteride tablet 0.5 mg 10x10 tablets 346 649 each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg one combi blister pack 347 s104 ecg electrode ( detail in rc ) each piece 348 s127 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) each piece 349 195 enalapril maleate tab ip 2.5mg 10x10 tab strip 350 194 enalapril maleate tab ip 5mg 10x10 tab strip 351 463 enalapril maleate tablets ip 10 mg 10x10 tab strip 352 s44.b endotracheal tube, cuff size 4.5 ( details in rc ) each piece 353 s44.c endotracheal tube, cuff size 5 details in rc each piece 354 s44.d endotracheal tube, cuff size 6 ( details in rc ) each piece 355 s44.f endotracheal tube, cuff size 7 ( details in rc ) each piece 356 s44.g endotracheal tube, cuff size 7.5 ( details in rc ) each piece 357 s44.h endotracheal tube, cuff size 8 ( details in rc ) each piece 358 s44.i endotracheal tube, cuff size 8.5 ( details in rc ) each piece 359 s44.j endotracheal tube, cuff size 9 ( details in rc ) each piece 360 s44.e endotracheal tube, cuff size 6.5 ( details in rc ) each piece 361 s44.a endotracheal tube, cuffed size 4 ( details in rc ) each piece 362 s43.a endotracheal tube, plain size 2.5 ( details in rc ) each piece 363 s43.b endotracheal tube, plain size 3 ( details in rc ) each piece 364 s43.c endotracheal tube, plain size 3.5 ( details in rc ) each piece 365 s43.d endotracheal tube, plain size 4 ( details in rc ) each piece 366 s43.e endotracheal tube, plain size 4.5 ( details in rc ) each piece 367 s43.f endotracheal tube, plain size 5 ( details in rc ) each piece 368 s43.g endotracheal tube, plain size 5.5 ( details in rc ) each piece 369 s43.h endotracheal tube, plain size 6 ( details in rc ) each piece 370 s43.j endotracheal tube, plain size 7 ( details in rc ) each piece 371 s43.k endotracheal tube, plain size 7.5 ( details in rc ) each piece 372 s43.l endotracheal tube, plain size 8 ( details in rc ) each pcs. 373 s43.m endotracheal tube, plain size 8.5 ( details in rc ) each piece 374 s43.i endotracheal tube, plain size 6.5 ( details in rc ) each piece 375 172 enoxaparin sodium inj ip 60 mg each pcs. 376 723 entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) 10x10 tablets 377 s110 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) each piece 378 351 escitalopram tab ip 10 mg 10x10 tab strip / blister 379 753 esmolol hydrochloride injection 10mg / ml 10ml size 10 ml vial 380 173 ethamsylate inj 250 mg / 2ml ( im / iv ) each pcs. 381 745 ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) 10x10 tablets 382 286 ethinyloestradiol tabs ip 50 mcg 10x10 tab strip 383 146 etoposide inj ip 100 mg 5 ml glass vial 384 495 etoricoxib tab ip 120mg 10x10 tab blister 385 658 etoricoxib tablet 90 mg 10x10 tablets 386 770 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size 5 ml. vial with sterilized dropper, or squeeze vial 387 s85 face mask, disposable ( details in rc ) piece 388 406 factor ix concentrate ( purified ) ip 600 i.u. ( human coagulation factor ix ) each pcs. 389 713 faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) 10x10 tablets 390 550 fenofibrate capsules / tab ip 200 mg each pcs. 391 655 fentanyl citrate injection 50mcg / ml 10ml vial / amp 392 21 fentanyl citrate injection ip 2 ml 2 ml amp 10 ampoules 393 746 feracrylum 1% w / v sterile solution 100 ml 100ml 394 789 ferric carboxymaltose injection 50 mg / ml 10 ml size 10 ml vial 395 391 ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 10x10 tab strip / blister 396 390 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg each pcs. 397 530 filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg each pcs. 398 575 finasteride tablets ip 5 mg 10x10 tab strip / blister 399 579 flavoxate tablets ip 200 mg ( coated tablet ) each pcs. 400 425 fluconazole eye drops 0.3% 5 ml. vial with sterilized dropper, or squeeze vial 401 114a fluconazole tablets ip 150mg strip of 1 tablet ( 10x10x1 tab ) 402 147 flunarizine tab 5 mg each pcs. 403 148 fluorouracil inj ip 250 mg / 5ml 5 ml ampoule 404 352 fluoxetine cap ip 20 mg 10x10 cap strip / blister 405 421 flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v 5 ml squeeze vial 406 s87.a foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 each piece 407 s87.b foldable intra ocular lense with injector ( details in rc ) 18 to 24 each piece 408 s87.c foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 each piece 409 s102 foleys catheter no. 14 ( detail in rc ) each piece 410 392 folic acid tab ip 5 mg each pcs. 411 245 formaldehyde solution ( 34.5 per. 38 per. ) each pcs. 412 616 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 30 capsules 413 685 framycetin sulphate cream 1 o / o 100 gm pack 100gm pack 414 684 framycetin sulphate cream 1 o / o 30gm pack 30gm pack 415 254 frusemide tab ip 40 mg 10x10 tab strip 416 255 furosemide injection ip 10mg / ml ( im and iv use ) 2 ml ampoule 417 216a fusidic acid cream ip 2% 10gm tube in mono carton 418 667 gabapentine tablet / capsule 100mg 10x10 tablet / capsule blister / strip 419 668 gabapentine tablet / capsule 300mg 10x10 tablet / capsule blister / strip 420 235 gadodiamide inj. 0.5mml / ml vial 10 ml vial 421 446 gamma benzene hexachloride lotion 1% ( lindane lotion usp ) 100 ml bottle 422 724 ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) vial 423 737 gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) 10x10 tablets 424 531 gemcitabine for injection 200 mg vial 425 532 gemcitabine for injection ip 1gm vial 426 116 gentamycin injection ip 80mg / 2ml ( im / iv use ) 2 ml amp 50 ampoules 427 246 gentian violet topical solution usp 1o / o 200 ml bottle 428 453 glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) each pcs. 429 287 glibenclamide tab ip 5 mg 10x10 tab strip / blister 430 603 gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) 10x10 tablets 431 288 gliclazide tab ip 40 mg 10x10 tab strip / blister 432 290 glimepiride tab ip 1mg 10x10 tab strip / blister 433 289 glimepiride tab ip 2 mg each pcs. 434 456 glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 10x10 tab blister 435 452 glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) 10x10 tab blister 436 291 glipizide tab ip 5mg 10x10 tab blister 437 s5.b gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 438 s5.a gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 439 s7.b gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) pair 440 s6.b gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 441 s6.a gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 442 s7.a gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 443 604 glucagon for injection usp 1 mg / ml vial 444 247 gluteraldehyde solution 2% each pcs. 445 564 glycerin ip 100 ml each pcs. 446 217 glycerin ip 400 gm each pcs. 447 650 glyceryl trinitrate tablets 2.6 mg controlled release tablets 30 tab bottles 448 312 glycopyrrolate inj ip 0.2 mg / ml 1 ml 10 ampoules 449 117 griseofulvin tab ip 125 mg each pcs. 450 583 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 15 ml squeeze vial 451 353 haloperidol inj ip 5 mg / ml 1 ml 10 ampoules 452 354 haloperidol tab ip 1.5 mg 10x10 tab strip 453 355 haloperidol tab ip 5 mg 10x10 tab strip 454 6 halothane bp 250 ml in amber colour bottle 455 174 heparin sodium inj ip 5000 iu / ml ( im / iv use ) each pcs. 456 767 hepatitis b immunologlobin injection ip 200 i.u each pcs. 457 485 homatropine eye drops ip 2% 5 ml squeeze vial 458 175 human albumin solution ip 20% 100 ml bottle / flexible closed system bag 20o / o 100 ml 459 304 human anti d immunoglobulin 150 mcg pre filled syringe / vial 460 303 human anti d immunoglobulin injection 300mcg ( im use ) human chorionic gonadotropin injection ip 5000 i.u. vial 462 798 human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) 10ml vial ( 0.5gm ) 463 305 human rabies immunoglobulin inj 150 iu / ml each pcs. 464 423 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. vial 465 256 hydrochlorthiazide tab ip 12.5 mg 10x10 tab strip 466 464 hydrochlorthiazide tab ip 25mg 10x10 tab strip 467 42 hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) vial 468 248 hydrogen peroxide solution ip 6 o / o ( 20 vol ) each pcs. 469 599 hydroxychloroquine sulphate tablets 200mg 10x10 tablets 470 416 hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 500 ml plastic bottle / 500 ml free flex 471 293 hydroxyprogesterone inj ip 250mg / ml 1ml amp 25 ampoules 472 324 hydroxypropylmethyl cellulose solution 20 mg / ml 2ml glass syringe ( with cannula ) 473 43 hydroxyzine tab ip 25 mg 10x10 tab strip / blister 474 414 hyoscine butyl bromide tablets ip 10mg 10x10 tab blister 475 268 hyoscine butylbromide inj ip 20 mg / ml each pcs. 476 22 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 10x10 tab blister 477 477 ibuprofen oral suspension bp / usp 100 mg / 5 ml 60 ml bottle ( with measuring cap ) 478 23 ibuprofen tab ip 200 mg ( coated ) 10x10 tab blister 479 24 ibuprofen tab ip 400 mg ( coated ) each pcs. 480 533 ifosfamide injection ip / bp / usp 1gm vial 481 534 imatinib tab ip 400mg each pcs. 482 715 imipenem + cilastatin injection 500mg / 500mg ip powder for solution vial 483 356 imipramine tab ip 25 mg ( coated tab ) 10x10 tab blister 484 357 imipramine tab ip 75 mg ( coated ) 10x10 tab blister 485 436 indomethacin cap ip 25 mg 10x10 cap strip 486 s10.a infant feeding tube size 10fg ( details in rc ) each piece 487 s10.c infant feeding tube size 5fg ( details in rc ) each piece 488 s10.b infant feeding tube size 8fg ( details in rc ) each piece 489 s13 infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) unit 490 796 inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) 1.5ml vial 491 693 insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle 10 ml vial 492 680 insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges 3ml vial 493 300 insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) 10 ml vial 494 s14 insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 unit 495 791 intravenous fat emulsion 20% w / v 250ml 250 ml bottle 496 482 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 20 ml pack 497 672 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. 50ml 498 369 ipratropium bromide nebulizer solution 250 mcg / ml 15 ml glass bottle 499 618 ipratropium powder for inhalation ip 40 mcg each pcs. 500 448 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 100 ml bottle in a unit carton with a separate dropper ( details in rc ) 501 488 iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 5 ml ampoule ( amber colour ) 502 7 isoflurane usp each pcs. 503 294 isophane insulin inj ip 40 iu / ml 10 ml vial 504 551 isoprenaline injection ip 2mg / ml each pcs. 505 197 isosorbide dinitrate tab ip 5 mg 10x10 tab blister 506 198 isosorbide mononitrate tabs ip 20 mg 10x10 tab strip 507 333 isoxsuprine inj ip 5 mg / ml 2 ml amp 10 ampoules 508 334 isoxsuprine tab ip 20 mg 10x10 tab strip 509 118 itraconazole cap 100 mg 10x4 cap strip 510 s84.b k wire, length 375 mm; 1.6mm ( details in rc ) each pcs. 511 s84.c k wire, length 375 mm; 1.8mm ( details in rc ) each pcs. 512 s84.a k wire, length 375 mm; 1mm ( details in rc ) each pcs. 513 8 ketamine inj ip 50 mg / ml 10 ml vial 514 565 ketoconazole cream 2% 15gm tube in mono carton 515 697 ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) 10x10 tablets 516 411 labetalol hcl inj ip 20mg / 4ml 4 ml ampules 517 410 labetalol tab ip 100mg each pcs. 518 704 lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) each pcs. 519 592 lactic acid bacillus tab 60 million spores 10x10 tablets 520 593 lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml each pcs. 521 701 lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) 10x10 tablets 522 149 l asparaginase inj 10000 iu vial 523 600 leflunomide tablets ip 10mg ( film coated ) 10x10 tablets 524 601 leflunomide tablets ip / usp 20mg ( film coated ) 10x10 tablets 525 728 letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) 10x10 tablets 526 150 leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml each pcs. 527 776 leurprolide acetate depot 11.25 mg vial 528 775 leurprolide acetate depot 3.75 mg vial 529 785 levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) 10x10 tablets 530 666 levetiracetam injection 500mg / 5ml vial 531 665 levetiracetam oral solution / suspension 100mg / ml 100ml 532 664 levetiracetam tablet ip 500 mg 10x10 tab blister 533 659 levoceitrizine tablet 5mg 10x10 tablets 534 161 levodopa and carbidopa tab 250 mg+ 25 mg 10x10 tab strip 535 160 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg each pcs. 536 712 levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 10x10 tablets 537 515 levofloxacin tablets ip 250 mg each pcs. 538 777 levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) 10x10 tablets 539 424 lidocaine hcl topical solution usp 4% each pcs. 540 10 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 30 ml vial 541 11 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg each pcs. 542 12 lignocaine gel ip 2% 30gm tube in a unit carton 543 13 lignocaine inj ip 2 o / o 30 ml vial 544 9 lignocaine ointment 5 o / o 10 gm tube in unit carton 545 517 linezolid inj 200mg / 100ml each pcs. 546 516 linezolid tablets ip 600 mg 10x10 tablets 547 800 liposomol amphotericine injection b 50mg vial 548 799 liquid medical oxygen ( lmo ) each pcs. 549 594 liquid paraffin ip 100 ml each pcs. 550 218 liquid paraffin ip 400 ml each pcs. 551 466 lisinopril tab ip 2.5 mg 10x10 tab strip / blister 552 199 lisinopril tab ip 5 mg each pcs. 553 465 lisinopril tablets ip 10 mg 10x10 tab strip / blister 554 358 lithium carbonate tab ip 300 mg 10x10 tab strip 555 732 lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) each pcs. 556 269 loperamide tab ip 2 mg 10x10 tab strip 557 359 lorazepam inj ip 2 mg / ml each pcs. 558 778 lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) 10x10 tablets 559 458 losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) 10x10 tab strip / blister 560 459 losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) 10x10 tab blister 561 467 losartan tab ip 25 mg 10x10 tab blister 562 200 losartan tab ip 50 mg each pcs. 563 249 lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) 5 ltrs can 564 201 magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) 2 ml amp 25 ampoules 565 257a mannitol inj ip 20% w / v each pcs. 566 632 mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml ffs / bfs bottle 567 624 mecobalamin inj 500 mcg / ml 1 ml. ampoule 568 605 medroxyprogesterone acetate tablets ip 10 mg 10x10 tablets 569 496 mefenamic acid tablets bp 500 mg each pcs. 570 518 mefloquine tablets ip 250 mg each pcs. 571 151 melphalan tab ip 5 mg 25 tab bottle 572 152 mercaptopurine tab ip 50 mg 10x10 tab strip 573 119 meropenem inj ip 500 mg each pcs. 574 481 meropenem inj. ip 1gm each pcs. 575 717 meropenem injection ip 250 mg vial 576 766 mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) 10x10 tablets 577 454 metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg each pcs. 578 455 metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) 10x10 tab blister 579 451 metformin hydrochloride ( sustained release tablets ip 1000 mg each pcs. 580 295 metformin tab ip 500 mg ( film coated ) 10x10 tab blister 581 153 methotrexate inj ip 50 mg / 2 ml each pcs. 582 154 methotrexate tab ip 2.5 mg each pcs. 583 536 methotrexate tablets ip 10 mg 10x10 tab strip 584 653 methyl cobalmine tablet 1500mcg 10x10 tab strip / blister 585 652 methyl cobalmine tablet 500mcg 10x10 tab strip / blister 586 44 methyl prednisolone sodium succinate for injection usp 500 mg vial 587 202 methyldopa tab ip 250mg film coated each pcs. 588 335 methylergometrine inj ip 0.2 mg / ml 1ml amp ( ambercolor ) 25 amp 589 336 methylergometrine tab ip 0.125 mg 10x10 tab strip 590 478 metoclopramide hydrochloride syrup ip 5 mg / 5ml 30 ml bottle ( with a seperate dropper which should be able to screw & cap the bottle ) in unit carton 591 270 metoclopramide inj ip 10mg / 2ml 2 ml amp ( amber colour ) ( 25 ampoules ) 592 271 metoclopramide tab ip 10 mg 10x10 tab blister 593 553 metoprolol succinate extended release tablets ip 50 mg 10x10 tablets 594 552 metoprolol tablets ip 25 mg 10x10 tablets 595 584 metronidazole 1% and chlorhexidine gluconade 0.25% gel 10 gm tube in unit carton 596 121 metronidazole benzoate oral suspension ip 100 mg of base / 5ml 60 ml bottle ( amber colour ) with measuring cap 597 120 metronidazole inj ip 500 mg / 100ml 100 ml ffs / bfs bottle 598 122 metronidazole tablets ip 200 mg ( film coated ) each pcs. 599 123 metronidazole tablets ip 400 mg ( film coated ) each pcs. 600 220 miconazole nitrate cream ip 2% 15gm tube in a unit carton 601 313 midazolam inj ip 1 mg / ml 5 ml vial 602 615 mifepristone tab ip 200mg each pcs. 603 337 misoprostol tab ip 200 mcg each pcs. 604 537 mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg each pcs. 605 660 montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 10x10 tablet blister / strip / alu alu pack 606 25 morphine sulphate inj ip 10mg / ml 1 ml 10 ampoules 607 s16 mucus extractor sterile ( details in rc ) unit 608 790 multi vitamin syrup each pcs. 609 381 multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) 500 ml ffs / bfs bottle 610 382 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 500 ml ffs / bfs bottle 611 801 multistix test strip each pcs. 612 393 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 613 394 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vitb2 2 mg niacinamide 25mg folic acid 0.2 mg 10x10 tab strip / blister 614 738 mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) 10x10 caps / tab 615 740 mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) each pcs. 616 744 n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size each pcs. 617 51 naloxone inj ip 0.4mg / ml 1 ml 10 ampoules 618 657 naproxen tablet ip 250mg 10x10 tab blister 619 656 naproxen tablet ip 500mg 10x10 tab blister 620 s17.a nasal oxygen set, twin bore all sizes adult ( details in rc ) each piece 621 s17.b nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) each piece 622 s126 nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) each piece 623 772 natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 10x10 tablet / capsule blister / strip 624 s134 nebulization mask adult ( detail in rc ) each piece 625 s135 nebulization mask paediatric ( detail in rc ) each piece 626 s103 nelaton catheter size 14 fg ( detail in rc ) each piece 627 223 neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) 10 gm plastic bottle with nozzle to sprinkle powder 628 588 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 5 ml vial / bottle with a seperate dropper 629 314 neostigmine inj ip 0.5 mg / ml 1 ml 10 ampoules 630 638 neostigmine injection ip 2.5mg / 5ml 5 ml amp ( 10 ampoules ) 631 316 neostigmine tab ip 15 mg each pcs. 632 203 nifedipine cap ip 5mg 10x10 cap strip 633 204 nifedipine tablets ip 10 mg ( sustained release ) 10x10 tab blister 634 413 nitrofurantoin tab ip 100mg each pcs. 635 205 nitroglycerin inj 5 mg / ml 5 ml amp ( 10 ampoules ) 636 s131 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) each piece 637 s129 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) each piece 638 s132 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) each piece 639 s130 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) each piece 640 s133 niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) each piece 641 r55 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 642 r56 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 643 r22 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) 1x12 foils 644 r20 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) 1x12 foils 645 r21 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) 1x12 foils 646 r57 non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm 1x12 foils 647 r45 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) 1x12 foils 648 r46 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) 1x12 foils 649 r34 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) 1x12 foils 650 r33 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) 1x12 foils 651 r38 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) 1x12 foils 652 r50 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm 1x12 foils 653 r40 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm 1x12 foils 654 r37 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm 1x12 foils 655 r51 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm 1x12 foils 656 r44 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) 1x12 foils 657 r36 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) 1x12 foils 658 r48 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) 1x12 foils 659 r29 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm 1x12 foils 660 r35 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) 1x12 foils 661 r32 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) 1x12 foils 662 r42 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm 1x12 foils 663 r75 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 1x12 foils 664 r23 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) 1x12 foils 665 r28 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 666 r27 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 667 r24 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) 1x12 foils 668 r25 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) 1x12 foils 669 r53 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 1x12 foils 670 r52 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) each pcs. 671 r54 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) 1x12 foils 672 r30 non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 1x12 foils 673 r39 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm 1x12 foils 674 r43 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) 1x12 foils 675 r49 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm 1x12 foils 676 r41 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) 1x12 foils 677 r31 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) 1x12 foils 678 r47 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) 1x12 foils 679 r26 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) 1x12 foils 680 554 noradrenaline injection ip 2 mg / ml each pcs. 681 296 norethisterone tab ip 5 mg each pcs. 682 124 norfloxacin tab ip 400mg film coated 10x10 tab blister 683 633 normal human intravenous immunoglobulin 5g / 100ml 100 ml vial 684 608 octreotide injection 50 mcg / ml 1 ml. ampoule 685 520 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 10x10 tab blister 686 521 ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) each pcs. 687 711 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size 30 ml. bottle 688 428 ofloxacin oral suspension ip 50mg / 5ml 30 ml. bottle 689 125 ofloxacin tab ip 200 mg 10x10 tab blister 690 219 ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o each pcs. 691 762 oitment mupirocin ip 2% 5 gm tube 692 360 olanzapine tab ip 5 mg each pcs. 693 761 olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size 5ml bottle 694 272 omeprazole cap ip 20 mg each pcs. 695 273 ondansetron inj ip 2mg / ml 2 ml amp 10 ampoules 696 595 ondansetron orally disintegrating tablets ip 4mg 10x10 tab strip 697 274 ors powder ip each pcs. 698 641 oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) each pcs. 699 640 oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) strip / blister of 10 capsule 700 639 oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) strip / blister of 10 capsule 701 642 oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) 75 ml bottle with measuring cap 702 642a oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) each pcs. 703 538 oxaliplatin injection usp 50 mg 25 ml vial 704 703 oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) 10x10 tablets 705 s100 oxygen mask ( adult ) 706 s101 oxygen mask ( pediatric ) unit 707 338 oxytocin inj ip 5 iu / ml each pcs. 708 156 paclitaxel inj ip 100 mg 16.7 ml vial 709 155 paclitaxel inj ip 260 mg each pcs. 710 596 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets each pcs. 711 s18 paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 712 s19 paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 713 s20 paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 714 26 paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 715 696 paracetamol infusion ip 1% w / v 100ml size 100 ml bottle 716 29 paracetamol inj. 150 mg / ml 2 ml amp 50 ampoules 717 27 paracetamol syrup ip 125 mg / 5ml ( detail in rc ) 60 ml bottle ( with measuring cap ) 718 28 paracetamol tab ip 500 mg 10x10 tab blister 719 30 pentazocine inj ip 30mg / ml ( im / iv use ) 1ml amp 25 ampoules 720 275 pentoprazole inj 40 mg each pcs. 721 s12 perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) unit 722 s11 perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) unit 723 401 peritonial dialysis solution ip 1000 ml ffs / bfs pack 724 569 permethrin cream 5% 30gm tube in a unit carton 725 568 permethrin lotion 5% 30 ml 726 786 phenazopyridine tablet 5 mg each pcs. 727 45 pheniramine inj ip 22.75mg / ml 2 ml amp 25 ampoules 728 420 phenobarbitone inj ip 200mg / ml each pcs. 729 56 phenobarbitone tab ip 30 mg 10x10 tab strip 730 614 phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% each pcs. 731 57 phenytoin injection bp 50mg / ml 2 ml amp ( amber colour ) ( 25 ampoules ) 732 58 phenytoin oral suspension ip 25mg / ml 100 ml glass bottle with measuring cap 733 59 phenytoin tab ip 100 mg ( film coated ) each pcs. 734 297 pioglitazone tab ip 15 mg 10x10 tab blister 735 468 piperacillin + tazobactum for injection ip 4gm+500mg vial 736 707 piperacillin injection 2 gm + tazobactom 250mg ip vial 737 s22 plaster of paris bandage 10cm x 2.7mts unit 738 s21 plaster of paris bandage 15cm x 2.7 mts / roll unit 739 405 polygeline 3.5% solution with electrolytes for i.v. infusion each pcs. 740 716 polymixin sulphate b injection usp 5 lac i.u. vial 741 s74 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm piece 742 s73 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm piece 743 383 potassium chloride inj. 0.15 gm / ml 10 ml amp 10 ampoules 744 384 potassium chloride oral solution u.s.p 500mg / 5ml 200ml bottle ( amber color ) 745 221 povidone iodine ointment 5% 15 gm each pcs. 746 571 povidone iodine ointment usp 250 gm 250 gm pack 747 250 povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 500 ml bottle 748 572 povidone iodine solution ip 10 % 100 ml bottle 749 222 povidone iodine solution ip 5 % 500 ml 500 ml bottle 750 450 povidone iodine solution ip 5% 100ml bottle each pcs. 751 759 powder clotrimazole 1% w / w 30 gm 30 gm bottle 752 52 pralidoxime chloride injection ip 25 mg / ml / 500 mg vial 753 555 prazosin tablets ( extended release ) 2.5 mg 10x15 tablet strip / blister 754 470 prednisolone tab ip 20 mg 10x10 tab strip / blister 755 47 prednisolone tab ip 5 mg 10x10 tab strip / blister 756 469 prednisolone tablet ip 10 mg 10x10 tab strip / blister 757 634 pregabalin cap ip 75 mg 10 x 10 capsule 758 s91 pressure monitoring line / high pressure extension line ( details in rc ) each piece in blister pack 759 128 primaquine tab ip 2.5 mg 10x10 tab strip / blister 760 129 primaquine tab ip 7.5 mg 10x10 tab strip / blister 761 765 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) 1 gm each sachet 762 725 procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) each pcs. 763 764 prochlorperazine mesylate injection 12.5mg / ml 5ml size each pcs. 764 298 progesterone inj 200 mg / 2ml 2 ml amp 10 ampoules 765 49 promethazine inj ip 25mg / ml 2 ml amp ( amber color ) ( 10 ampoules ) 766 48 promethazine syrup ip 5 mg / 5ml 60 ml bottle ( with measuring cap ) 767 50 promethazine tab ip 25 mg 10x10 tab strip 768 14 propofol inj ip 10 mg / ml each pcs. 769 207 propranolol tab ip 40 mg each pcs. 770 792 pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) 10x10 tablets 771 626 pyridoxine tablet ip 10 mg each pcs. 772 627 pyridoxine tablet ip 40mg 10x10 tab strip 773 675 quetiapine tablet ip 25mg 10x10 tab blister 774 674 quetiapine tablet ip 50mg 10x10 tab blister 775 131 quinine dihydrochloride inj ip 300 mg / ml each pcs. 776 132 quinine sulphate tablets ip 300 mg ( film coated ) 10x10 tab blister 777 408 rabies antiserum ip ( equine ) 300 units per ml contains equine antirabies immunoglobulin fragments ( i.m. / sc use ) 5 ml vial 778 306 rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu 1 ml vial with 1.0 ml diluent 779 307 rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose single dose vial with diluent and syringe with needle 780 636 ramipril tablets ip 2.5 mg 10x10 tablets 781 276 ranitidine hcl injection ip 50mg / 2ml each pcs. 782 277 ranitidine tab ip 150mg film coated each pcs. 783 433 ranitidine tab ip 300mg film coated each pcs. 784 690 recombinant coagulation factor viia 1mg vial 785 691 recombinant coagulation factor viia 2mg each pcs. 786 748 recombinant f ix 500 iu with diluent vial with diluent 787 179 rh erythropoetin inj 4000 iu vial / pfs 788 176 rh erythropoetin inj ip 10000 iu vial / pfs 789 177 rh erythropoetin inj ip 2000iu vial / pfs 790 781 ringer acetate infusion 500 ml 500 ml bottle 791 362 risperidone tab 1 mg 10x10 tab strip / blister 792 361 risperidone tab 2mg each pcs. 793 757 rosuvastatin tablet 10 mg 10x10 tablets 794 756 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 10x10 tablets 795 s90.d rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) dispenser box of100 gloves 796 s90.a rubber examination gloves, non sterile, extra small ( details in rc ) dispenser box of100 gloves 797 s90.c rubber examination gloves, size medium ( details in rc ) dispenser box of100 gloves 798 s90.b rubber examination gloves, size small ( details in rc ) dispenser box of100 gloves 799 s23.a ryles tube / nasogastric tube size: 10 ( details in rc ) each piece 800 s23.b ryles tube / nasogastric tube size: 12 ( details in rc ) each piece 801 s24.b ryles tube / nasogastric tube size: 16 ( details in rc ) each piece 802 s24.c ryles tube / nasogastric tube size: 18 ( details in rc ) each piece 803 s24.a ryles tube / nasogastric tube size:14 ( details in rc ) each piece 804 758 sacubitril 24 mg and valsartan 26 mg tablet 14x2 tablets 805 371 salbutamol inhalation 100 mcg / dose 200metered dose container 806 372 salbutamol nebuliser solution bp 5 mg / ml 10 ml vial 807 432 salbutamol syrup ip 2mg / 5ml 100 ml bottle ( with measuring cap ) 808 373 salbutamol tab ip 2 mg 10x10 tab strip / blister 809 370 salbutamol tablet ip 4 mg each pcs. 810 442 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) each pcs. 811 s99.p sanitary napkin beltless with wings ( details in rc ) each pcs. 812 s99.a sanitary napkin beltless ( details in rc ) 6 napkin / pack 813 s99.b sanitary pads belt type ( details in rc ) 6 napkin / pack 814 783 savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) 10x10 tablets 815 s25.a scalp vein set ( disposable ) size 18g ( details in rc ) each piece 816 s25.b scalp vein set ( disposable ) size 20g ( details in rc ) each piece 817 s25.c scalp vein set ( disposable ) size 22g ( details in rc ) each piece 818 s25.d scalp vein set ( disposable ) size 24 g ( details in rc ) each piece 819 363 sertraline tab ip 50 mg each pcs. 820 491 sevoflurane each pcs. 821 573 silver sulphadiazine cream ip 1% 500 gm jar 500 gm jar 822 224 silver sulphadiazine cream ip 1% 50gm tube each pcs. 823 s82 skin graft knife blade ( sterile ) ( details in rc ) one pack each 824 308 snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) vial 825 402 sodium bicarbonate inj ip 7.5% w / v 10 ml amp 25 ampoules 826 784 sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) 10x10 tablets 827 782 sodium chloride 0.45% w / v polypack 500 ml 500 ml bottle 828 385 sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 500 ml ffs / bfs bottle 829 386 sodium chloride inj ip 500 ml 500 ml ffs / bfs bottle 830 621 sodium chloride injection ip 100 ml each pcs. 831 754 sodium nitroprusside injection 25mg / ml 2ml size 2ml vial / ampoule 832 278 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o 100 ml polypropylene pack 833 61 sodium valproate gastro resistant tablets ip 200 mg 10x10 tab strip 834 60 sodium valproate inj 100 mg / ml each pcs. 835 479 sodium valproate oral solution ip 200 mg / 5 ml 100 ml bottle ( with measuring cap ) 836 661 sodium valproate tablet ( gastro resistant ) ip 500mg 10x10 tab strip 837 752 sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) 10x10 tablets 838 258 spironolactone tab ip 25mg each pcs. 839 574 spironolactone tablets ip 50 mg each pcs. 840 s88.a standard pama intra ocular lenses ( details in rc ) 11 to 17.5 each piece 841 s88.b standard pama intra ocular lenses ( details in rc ) 18 to 24 each piece 842 s88.c standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 each piece 843 s128 sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) each pcs. 844 s15.e sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) each piece 845 s15.a sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) each piece 846 s15.c sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) each piece 847 s15.d sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) each piece 848 s15.b sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) each piece 849 s39.a sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) each piece 850 s39.b sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) each piece 851 s106 sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) each piece 852 s79 sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) each piece 853 209 streptokinase injection 15 lac units ip vial 854 317 succinylcholine inj. ip 50 mg / ml ( iv use ) 10 ml vial 855 s8.d suction catheter, sterile. size: f g 10 ( details in rc ) each piece 856 s8.e suction catheter, sterile. size: f g 12 ( details in rc ) each piece 857 s8.f suction catheter, sterile. size: f g 14 ( details in rc ) each piece 858 s8.g suction catheter, sterile. size: f g 16 ( details in rc ) each piece 859 s8.h suction catheter, sterile. size: f g 18 ( details in rc ) each piece 860 s8.i suction catheter, sterile. size: f g 20 ( details in rc ) each piece 861 s8.j suction catheter, sterile. size: f g 22 ( details in rc ) each piece 862 s8.b suction catheter, sterile. size: f g 6 ( details in rc ) each piece 863 s8.c suction catheter, sterile. size: f g 8 ( details in rc ) each piece 864 s8.a suction catheter, sterile.size: fg 5 ( details in rc ) each piece 865 602 sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg 10x10 tablets 866 635 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 4ml vial 867 s30.a surgical blade sterile, size 11 ( details in rc ) 100 blades / packet 868 s30.b surgical blade sterile, size 15 ( details in rc ) 100 blades / packet 869 s30.c surgical blade sterile, size 22 ( details in rc ) 100 blades / packet 870 s105 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) each piece 871 s86.a surgical cap disposable ( for surgeons ) ( details in rc ) piece 872 s86.b surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) piece 873 449 surgical spirit ip ( 100 ml ) 100ml opaque white bottle with inner cap 874 252 surgical spirit ip ( 500 ml ) 500 ml opaque white bottle with inner cap 875 s31 suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) each pcs. 876 s32 suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) each pcs. 877 s33 suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) each pcs. 878 s34 suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) each pcs. 879 s35 suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) each pcs. 880 s36 suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) each pcs. 881 s37 suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) each pcs. 882 s38 suture needles curved and cutting size 1 5 ( details in rc ) each pcs. 883 s28 syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 884 s26 syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 885 s29 syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 886 s27 syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 887 739 tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) 10 x 10 capsule 888 157 tamoxifen tab ip 10 mg each pcs. 889 576 tamsulosin hcl tablets / capsule 0.4 mg each pcs. 890 556 telmisartan tablets ip 40 mg 10x10 tablets 891 729 temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) strip of 5 cap / bottele of 5 cap 892 s81 temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm each pcs. 893 682 tenaligliptin tablet ip 20mg 10x10 tablet blister / alu alu pack 894 760 terbinafine cream 1%w / w ( 10 gm tube ) 10 gm tube 895 721 terbinafine hydrochloride tablet 250 mg 10x10 tablets 896 619 terbutaline tablets ip 2.5 mg 10x10 tablets 897 309 tetanus immunoglobulin ip 250 iu / vial vial / ampoules 898 310 tetanus vaccine ( adsorbed ) ip 5 ml vial each pcs. 899 733 thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) each pcs. 900 374 theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 2 ml amp 25 ampoules 901 375 theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) 902 376 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 10x10 tab blister 903 629 thiamine tablets ip 100 mg 10x10 tab strip 904 15 thiopentone inj ip 0.5 g each pcs. 905 301 thyroxine sodium tablets ip 100mcg 100 tablet in a bottle 906 607 thyroxine tablets ip 50 mcg 100 tablet in a bottle or 10x10 tablet 907 484 timolol eye drops ip 0.5 o / o w / v 5 ml squeeze vial 908 430 tinidazole tab ip 300 mg ( film coated ) 10x10 tab blister 909 431 tinidazole tab ip 500 mg ( film coated ) 10x10 tab blister 910 699 tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) 10x10 tablets 911 330 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o each pcs. 912 331 tobramycin eye drops 0.3% [ 331 ] 5 ml. vial with sterilized dropper, or squeeze vial 913 332 tobramycin ophthalmic ointment usp 0.3% each pcs. 914 582 tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) 50 gm tube in unit carton 915 705 topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) each pcs. 916 471 torsemide inj 10 mg / ml each pcs. 917 259 torsemide tab 10 ip mg 10x10 tab strip / blister 918 s46 tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) each piece 919 s45 tracheostomy tube, plain all sizes ( details in rc ) each piece 920 32 tramadol cap ip 50 mg each pcs. 921 33 tramadol inj 50 mg / ml each pcs. 922 747 tranexamic acid injection ip 100mg / ml 5ml size 5ml vial / amp 923 545 tranexamic acid tablets ip 500 mg 10x6 tablet blister 924 486 travoprost eye drops ip 0.004 o / o 3 ml squeeze vial 925 570 tretenoin cream usp 0.025% 20 gm tube in unit carton 926 364 trifluperazine tab ip 5 mg coated 10x10 tab strip / blister 927 162 trihexyphenidyl hcl tab ip 2 mg 10x10 tab blister 928 241 tropicamide eye drop ip 1o / o 5 ml. vial with sterilized dropper, or squeeze vial 929 s97 t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) each pcs. 930 s93 umbilical catheter for new born, all sizes ( details in rc ) each piece 931 s94 umbilical cord clamp ( details in rc ) each piece 932 s107 urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) each piece 933 s108 urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) each piece 934 s92 urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) each piece 935 s40 urine collecting bag, disposable 2000 ml ( details in rc ) unit 936 557 urokinase injection 5 lac unit ( lyophilized ) vial 937 597 ursodeoxycholic acid tablets ip 300 mg each pcs. 938 s109 vaccum suction set, 2.5 meter length ( detail in rc ) each piece 939 318 valethamate bromide inj 8mg / ml each pcs. 940 722 valganciclovir tablet 450 mg 10x10 tablets 941 524 vancomycin for intravenous infusion ip 1 gm vial 942 523 vancomycin for intravenous infusion ip 500 mg each pcs. 943 s115 vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 944 s111 vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) each pcs. 945 s112 vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 946 s116 vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 947 s113 vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 948 s117 vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 949 s114 vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 950 s118 vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 951 242 vdrl antigen ( with + ve and ve control ) / rpr slide kit 100 test kits 952 419 vecuronium bromide for injection 4mg ( freeze dried ) each pcs. 953 211 verapamil tab ip 40 mg film coated 10x10 tab strip 954 158 vinblastine inj ip 10mg / 10ml vial 955 159 vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) vial / ampoules 956 409 vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu 100 ml bottle and spoon with marking 1 ml / 2ml in unit carton 957 395 vitamin b complex inj nfi 10 ml vial 958 397 vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) 10x10 tab strip / blister 959 676 vitamin d3 oral solution 60000 iu 5ml glass bottle in unit carton 960 795 vitamin e capsule 400 mg 10x10 tablets 961 180 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 1ml amp ( ambercolor ) 25 amp 962 644 vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) each pcs. 963 720 voriconazole injection 200mg / vial vial 964 546 warfarin sodium. tab ip 5mg 10x10 tablets 965 404 water for inj ip 10 ml ampoule 50 ampoules 966 620 xylometazoline nasal drops ip 0.1% each pcs. 967 472 zinc sulphate dispersible tablets ip elemental zinc 10 mg 10x10 tab strip / blister 968 743 zoledronic acid injection ip 4mg vial each pcs. 969 779 zolpidem tablet 5 mg 10x10 tablets 970 amino acid drop each piece 971 amino acid inj. ( astamin ) each piece 972 aminorich drop / astymen c / amenovik each piece 973 amoxycillin and potassium clavulanate drop each piece 974 ampilox 250 ml inj. each piece 975 aquasop inj. 1000 ml 976 arichitol inj. one 977 arodesin solution one 978 augpen 150 mg ( amoxycilline + pot. clavulanate ) inj. 979 augpen 300 mg ( amoxycilline + pot. clavulanate ) inj. 1 piece 980 auto clave tape ( stera tape ) 1 piece 981 b.p. instument with mercuary 1 piece 982 b.p. instument with mercuary standing 983 b.p. instument without mercuary 984 bains circuit adult each 985 bains circuit pediatric each piece 986 betnisol inj. 02 tab strip / blister 987 biotax 125 mg ( ceftoxyn ) inj. each piece 988 cabergolin 0.25 mg tab. 5 ltr. 989 candid lotion each piece 990 citric acid 1 piece 991 dettol 100 ml each piece 992 disposable baby kit each piece 993 disposable needle no 16 11 / 2 inch each piece 994 disposable razor each piece 995 dressing drum all sizes each piece 996 drop sodabicarb each piece 997 erofer l drops 15 ml each piece 998 evion drop 999 ezithromycin 15ml sy 1000 formalin 1 ltr each piece 1001 formalin 5 ltr each piece 1002 glucometer strip each piece 1003 gluco one strip ( dr. morepen ) 1004 hand sanitizer 1005 inj. citicholin 1006 inj. hepamerz 1007 inj. nootrophil each piece 1008 inj. strocit each piece 1009 intralipid inj. 1 tin ( 400 gm ) 1010 k 90 catheter dispenser box of 100 gloves 1011 lactodex lbw with micronutrients dispenser box of 100 gloves 1012 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small dispenser box of 100 gloves 1013 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large dispenser box of 100 gloves 1014 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium 1015 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small 1016 lilan thread 40 3 x 4.5 feet 1017 lilan thread 60 each piece 1018 mackintosh each piece 1019 mucus sucker set each piece 1020 multivitamin with zinc syp. each piece 1021 multizec trop 15 ml each piece 1022 neasphine oint. 1023 needle no. 211 / 2 1024 needle order each piece 1025 neosprin eye oint. each piece 1026 netromycine 10 mg. inj. ( netromax 10 mg inj. ) 1027 nuclovate cream 15 gm 1028 oxygen double stage ragulator each 1029 pedia set 100 ml piece 1030 pepericilline + tezobactum 1.125 mg inj. each piece 1031 pressure monitoring line / high pressure extension line ( pmo line ) length 150 cm, prime volume 1.40 ml 1032 prochlorpertine tab. 1033 re breathing bag adult 1034 re breathing bag pediatric 1035 rubber face mask 0 5 1 tin ( 400 gm ) 1036 sevlon lotion 100 ml. 1037 simyl mct powder each piece 1038 star plast ( adhesive plaster ) 100 ml bottle 1039 caffeine citrate 20 mg / ml injection 2 ml vial 1040 vit. a syp. 1041 vit. c drop 1042 vit. c syp. 1 bottle 1043 vit. c tab. 1044 zinc 200 ml syp each piece 1045 zinc 60 ml / 100 ml sy. 1 bottle 1046 zincovit syp. 1047 zincula drop 1 bottle 1048 mouth airway ( all size ) 1 bottle 1049 inj. n.s.500 m.l. ( in glass bottle ) 01 tin 1050 inj. n.s.100 m.l. ( in glass bottle ) 01 bottle 1051 cidex 5 ltr 01 pcs. 1052 blanisol plus 01 pcs. 1053 alcohal based hand rub 01 pcs. 1054 surgical hand & skin disinfactent 01 pcs. 1055 antiseptic surgical hand rub 01 pcs. 1056 povidine iodine 5% & 10% 01 pcs. 1057 high level instrument disinfactent 01 pcs. 1058 multi eyzymetic instrument cleaner 01 pcs. 1059 surgical instrument rust, spot & stain remover 01 pcs. 1060 rejuventate dialysis reprocessing 01 pcs. 1061 disinfectent & decalcification of haemodialysis machine 01 pcs. 1062 d 125 disinfectent 1 ltr. 01 pcs. 1063 5 fu 500 mg 01 pcs. 1064 capcetabin 500 mg 01 pcs. 1065 carboplatin 150 mg 01 pcs. 1066 carboplatin 450 mg 01 pcs. 1067 cisplatin 10 mg 01 pcs. 1068 codon iv set 01 pcs. 1069 cyclophosphamide 500mg 01 pcs. 1070 danazole 50 mg cap. 01 pcs. 1071 docetaxel 120 mg 01 pcs. 1072 docetaxel 80 mg 01 pcs. 1073 doxorubicine 10 mg 01 pcs. 1074 doxorubicine 50 mg 01 pcs. 1075 epirubicine 50 mg 01 pcs. 1076 filgrastin 300 mg 01 pcs. 1077 inj. gemcitabin 1 gm 01 pcs. 1078 inj. gemcitabin 2 mg 01 pcs. 1079 ieucovorin 50 mg 01 pcs. 1080 tab. imatinib 400 mg 01 pcs. 1081 inj. mesna 100 mg 01 nos. 1082 inj. botrezumib 01 pcs. 1083 inj. bleomycin 01 pcs. 1084 oxaliplatin 50 mg 01 pcs. 1085 pacletaxel 260 mg 01 pcs. 1086 tamoxifen 10 mg 01 nos. 1087 zolidronic acid 4 mg 01 nos. 1088 inj. vetneuren 2 ml 01 nos. 1089 inj. vanomycin 01 nos. 1090 inj. surfactant 01 nos. 1091 human hepatitis b immunoglobulin 100 i.u. injection ( 100 i.u. / 0.5 ml ) 01 nos. 1092 three way adopter 01 nos. 1093 inj. milriuon 01 nos. 1094 inj. decarbazine ( dtic ) etc...

North Western Railway - Rajasthan

33738993 supply of tretinoin 0.025 % + clindamycin 1% gel min.tretinoin 0.025 % + clindamycin 1% gel min., tretinoin 0.025 % + clindamycin 1% gel min. central hospital jaipur rajasthan 2000.00 numbers => limited...

Indian Army - Rajasthan

33729820 rate enquiry of consumable/drugs and allied for dglp tacrolimus oint (0.03%) 20 gm tube , cream ivermactin 1% , coal tar 6% v/w + salicylic acid 3% ointment 50 gm tube , azelaic acid 20% cream, tube of 15 gm , yellow soft paraffin , methotraxate 5 mg tab , ammonium chloride 0.5 % w/w+ calcium lactate 0.5 % w/w+ glycerin 3 % w/w+ lactic acid 6 % w/w + magnesium chloride 0.3 % w/w+ potassium chloride 0.5 % w/w + sodium chloride 0.5 % w/w + urea 12 % w/w, tube of 75 gm , oxybutynin 2.5 mg tab , tab apremilast 30 mg , tab bilastin 20 mg , cap acitretin 10 mg , white soft paraffin + light liquid paraffin 200mg , clobetasole + salicylic acid oint , lotion fibroblast growth factor derived decapeptide + melbild bottle of 2ml , ointment tacrolimus 0.1% 30gm , lotion aquaxyl+shea butter150g (mixrich(glenmark dermax , cream hydroquine + qctinoxate + brite , cream tyro stat 09+3 0 ethyl ascorbic acid +3% gca kojigold 20gm , lot fluocinolone 0.01% sebowash 100 ml , cream pimecrolimus + elidel , cream salicylic acid 2% +5% nicotinamide 30 gm , lot sodium sulphacetamide + sulphur+ ecnil , octinoxate 7.5%+ kojic acid 2% gel , aloe barbadensis + zinc oxide dermadew diaper 60gm tube , clobetasol propionate 0.05% with white soft paraffin, light liquid paraffin, isopropyl myristate & dimethicone in a water washable gel base preservatives : methylparaben ip 0.18% w/v , propylparaben ip 0.02% w/v. , clobetasol propionate bp 0.05% w/w, salicylic acid ip 3.5% w/w , in an emollient lotion base containing hexylene glycol. preservatives : methylparaben ip 0.20% w/w, propylparaben ip 0.02% w/w 30ml tube , gel clindamycin 1% + adapalene 0.1% 15 gm , cap minocycline 65mg extended release capsules , methoxsalen topical solution 1% , lotion precipitated sulphur 10% + zinc oxide 5 % + acnid 100ml , lotion hydrolysed collagen 60 ml , purified water, aloe vera gel,light liquid paraffin, calamine, propylene glycol,dimethicone ,camphor,pramoxine hydrochloride 100ml , ciclopirox olamine nail laquer 8% 5 ml , squalene,aloe vera and vitamin e acetate cream 150 gm , glycolic acid,urea, cetylated fatty ester complex 50 gm , allium cepa extract, heparin sodium, allantion gel tube 10 gm , minoxidil topical solution 10% , urea 10% + lactic acid 5% + cyclomethicone 1% + sorbitol 5% + allantoin 0.5% + menthol 0.5% + white petroleum jelly 5% 50gm , cream kojic acid +arbutin+niacinamide kojiglo , clobetasol propionate bp 0.05% w/w, salicylic acid ip 3.5% w/w ,white soft paraffin, light liquid paraffin, isopropyl myristate & in an emollient ointment base containing propylene glycol. preservatives : methylparaben ip 0.20% w/w, propylparaben ip 0.02% w/w , lot pramoxine + thc + camphor + menthol calosoft plus 100 ml , cream pentavitin3% + cerasoft tube of 60 gm , permethrin 5%, glycerine, jojoba oil, caprylic triglyceride , clobetasole 0.5 % + salicylic acid 6.5%, tube of 20 gms , aloe vera 10%, light liquid paraffin 7%, white soft paraffin 3%, dimethicone, purified lanolin , dermadew caloe lotion , cream propygenta tube of 20gm , ointment salicylic acid 12% tube of 50 gm , ointment mometasone furoate 0.1%+ salicylic acid 6.5%, propylene glycol 10gm tube , tab terbinafine micronized 500 mg , terbinafine hcl tab of 250 gm , tab desloratidine 5mg=> limited...

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Medical Health And Family Welfare - Rajasthan

33724693 supply of s mndy_durgandmedicen mndy_durgandmedicen pmosuj , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , atropine sulphate injection 0.6mg / ml , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , fentanyl citrate injection ip 2 ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , cefixime tab ip 100 mg / cefixime dispersible tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , itraconazole cap 100 mg , meropenem inj ip 500 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , piperacillin + tazobactum for injection ip 4gm+500mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , meropenem inj. ip 1gm , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , linezolid tablets ip 600 mg , linezolid inj 200mg / 100ml , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , trihexyphenidyl hcl tab ip 2 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , human albumin solution ip 20% , rh erythropoetin inj ip 2000iu , rh erythropoetin inj 4000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , tranexamic acid injection ip 100mg / ml 5ml size , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , losartan tab ip 25 mg , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , telmisartan tablets ip 40 mg , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , fusidic acid cream ip 2% , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , silver sulphadiazine cream ip 1% 50gm tube , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , multistix test strip , povidone iodine solution ip 5 % 500 ml , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , spironolactone tablets ip 50 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , hydroxyprogesterone inj ip 250mg / ml , metformin tab ip 500 mg , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , human anti d immunoglobulin injection 300mcg ( im use ) , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , tropicamide eye drop ip 1o / o , atropine sulphate ophthalmic solution usp 1% , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , carboxymethylcellulose eye drops ip 0.5% , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , imipramine tab ip 25 mg ( coated tab ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , clonazepam tablet 0.5 mg , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , aminophylline inj ip 25 mg / ml , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , cough syrup / expectorant ( 50 ) ml , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , black disinfectant fluid ( phenyl ) as per schedule o grade iii , pregabalin cap ip 75 mg , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , flurbiprofen & hydroxypropylmethyl cellulose eye drops , pilocarpine 0.5 % inj , hyaluronidase inj , tab prednisolone 40 mg , moxifloxacin+prednisolone eye drop ( bak free ) , tropicamide and phenylephrine eye drop , sodium chloride ophthalmic solutionl 5% eye drop , pilocarpine 2 % eye drop , inj.compound sodium lactate 500 ml in glass bottle , lignocaine 4% drop vial , bupivacaine hcl and epinephrine inj. 0.5 % , inj. mannitol 350 ml , balance salt solution bottle , sanatiser , ammonia bottle , disposable sterile niddle 26 g , disposable sterile niddle 23 g , keratone operation use 2.8 mm angeled bewel up , crecents operation use 2.5 mm angeled bewel up , dark black goggles , spectacles ( after ref. / with numbers ) , ofloxacin eye ointment 0.3 % , monofilament vicryl suture 5 0 [ nylon non abs ] , monofilament vicryl suture 6 0 [ nylon non abs ] , monofilament vicryl suture 8 0 [ nylon non abs ] , monofilament vicryl suture 10 0 [ nylon non abs ] , liquid hand wash ( dettol / savlon ) , low voltage halogen lamp ( for eye operating microscope ) projection lamp type 24 / 250 v , side port 15 degree operation use knife , proparacaine hydrochloride opthalmic solution 0.5 % , ear buds , trypan blue dye ophthalmic solution for cataract surgery , urine sugar test strips , standard pmma intra ocular lenses ( size + 11 d to +17.5 d ) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 11 d to +17.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 18 d to + 24 d ) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 18 d to + 24 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 24.5 d to + 28.5 d ) 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, bioconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 24.5 d to + 28.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , foldable intra ocular lense with injector ( size + 11 d to +17.5 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics ( 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 11 d to +17.5 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , foldable intra ocular lense with injector ( size + 18 d to + 24 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 18 d to + 24 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 24.5 d to + 28.5 d ) 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, bioconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 24.5 d to + 28.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , disposable sterilesurgicalo tgown ( noonwoven ) , sterile noonwoven disposable eye drape , eye shield ( plastic ) , 3 piece rigid ( pamma ) iol +17 to +25 d , rapid multi enzyme cleaner 500ml , sf6 gas 30 ml for eye surgery , bacillocid extra surface and equipment disinfectant 500 ml , tropicamide 0.2 mg / ml and phenylephrine hcl 3.1 mg / ml and lidocaine hcl 10 mg / mlinjection ( 1 ml ampule intracameral injection ) , d 125 microgen fogging disinfectant 01 ltr , blood administration set blood transfusion set ( details in rc ) , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powdered, , without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 7½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 7 ½ inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) , infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , plaster of paris bandage 15cm x 2.7 mts / roll , plaster of paris bandage 10cm x 2.7mts , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , face mask, disposable ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , foldable intra ocular lense with injector ( details in rc ) 18 to 24 , foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 , standard pama intra ocular lenses ( details in rc ) 18 to 24 , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) , umbilical cord clamp ( details in rc ) , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 ( detail in rc ) , biodegradable biomedical plastic bags with tie string 25 ltr. capacity ( colour black / blue / green / red / yellow ) , sharp container 6 ltr. ( blue / white ) , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm...

Medical Health And Family Welfare - Rajasthan

33724548 supply of medician and drugs supply of medician and drugs , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg |2 ] , bupivacaine lnj ip 0.5% [ 4 ] , drotaverine hydrochloride inj 40 mg / 2 ml [ 5 ) , halothane bp ( 6 ) , lsoflurane usp [ 7 ] , ketamine inj ip so mg / ml [ 8 ] , lignocaineointment5 o / o [ 9j , lignocaine and adrenaline lnj ipeach ml. contains lignocaine hydrochlorideip 20 mg adrenaline ip 0.01 mg [ 10 ] , lignocaine and adrenaline lnj ipeach ml. contains lignocaine 50 mg dextrose ( monohydrate ) 75 mg [ 11 ] , lignocaine gel ip 2% [ 12 ] , lignocaine inj ip 2 o / o [ 13 ) , propofol inj ip 10 mg / ml [ 14 ] , thiopentone lnj ip 0.5 g [ 15 ] , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) [ 19 ] , diclofenac gastro resistanttablet ip 50 mg ( enteric coated ) [ 20 ] , fentanyl citrate injecion ip 2 ml ( 21 ) , ibuprofen and paracetamoltablets ip ibuprofen 400 mg+paracetamol 325 mg { 22 ] , ibuprofen tab ip 200 mg ( coated ) [ 23 ] , ibuprofen tab ip 400 mg ( coated ) [ 24 ] , morphine sulphate inj ip 10mg / ml ( 25 ) , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) [ 26 ] , paracetamol syrup ip 125 mg / 5mi ( detail in rc ) [ 27 ] , paracetamoltab ip 500 mg [ 28 ] , paracetamol inj. 150 mg / ml [ 29 ] , pentazocine inj ip 30mg / ml ( im / iv use ) [ 30 ] , tramadol cap ip 50 mg ( 32 ] , tramadol inj50 mg / ml [ 33 ] , adrenaline injection ip 1mg / ml im / iv use ( 34j , betamethasonetabip 0.smg [ 35 ] , chlorpheniramine maleate tab ip 4mg [ 37j , dexamethasonelnj ip 8mg / 2ml [ 39 ] , dexamethasonetab ip 0.5 mg [ 40 ) , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) [ 42 ] , hydroxyzine tab ip 25 mg [ 43 ] , methyl prednisolone sodium succinate for injection usp 500 mg [ 44 ] , pheniramine lnj ip 22.7smg / ml |45 ] , prednisolone tab ip 5 mg ( 47 ] , promethazine syrup ips mg / 5ml [ 48 ] , promethazine inj ip 25mg / ml ( 49 ] , promethazine tabip 2s mg [ 50 ) , naloxone inj ip 0.4mg / ml [ 51 ] , pralidoximechloride injection ip 25 mg / ml / 500 mg [ 52 ] , carbamazepine tab ip 200 mg ( 53 ) , carbamazepine tab ip 100 mg [ 54 ] , phenobarbitone tab ip 30 mg [ 56 ) , phenytoin injection bp s0mg / ml [ 57 ) , phenytoin oral suspensionip 25mg / ml ( 58 ) , phenytoin tab ip 100 mg ( film coated ) [ 59 ] , sodium valproateinj100 mg / ml [ 60 ) , sodium valproate gastro resistant tablets ip 200 mg [ 61 ] , acyclovir oral suspension ip 400mg / 5mi |62 ] , acyclovir tabip 200 mg [ 63 ] , acyclovir tab ip 800 mg [ 64 ) , albendazole oral suspension ip 400 mg / 10ml [ 65 ] , amikacininj ip 100 mg [ 67 ] , amikacininj ip 500 mg [ 68 ] , amoxycillinand cloxacillin cap 250 + 250 mg ( 69 ] , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg [ 70 ] , amoxycillin cap ip 250mg ( 71j , amoxycillin cap ip 500mg [ 72 ] , amoxycillindispersible tablets ip 125 mg [ 73 ] , ampicillin injection ip 500 mg |75 ] , benzathine benzylpenicillin inj ip 12 lac units ( 81 ] , benzathine benzylpenicillin lnj ip 6 lac units [ 82 ] , cefixime tab ip 100 mg [ 84 ] , cefixime tab ip 200 mg [ 85 ] , cefoperazone and sulbactum for lnj ( cefoperazonesodium eq.to cefopera, zone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) [ 86 ] , cefotaxime injection ip 1 g [ 87 ] , cefotaximelnj ip 250 mg ( 88 ] , ceftazidime lnj ip 1g [ 89 ] , ceftazidime inj ip250 mg [ 90j , ceftazidime inj ip500 mg ( 91 ] , ceftriaxone inj ip1g / viai [ 93 ] , ceftriaxoneinj ip250 mg / vial [ 94 ] , ceftriaxone lnj ip500mg / vial [ 95 ] , cephalexincap ip 250 mg [ 96 ] , cephalexin cap ip 500 mg [ 97 ) , chloroquine phosphate inj ip 40 mg / ml |98 ] , chloroquine phosphatetab. ip 250mg eq to 155 mg of chloroquine base film coated [ 99 ) , ciprofloxacin injection ip200mg / 100mi [ 101j , ciprofloxacintablets ip250 mgfilm coated ( 102 ] , ciprofloxacintablet ip 500 mg film coated |103 ] , clotrimazole credmip2% w / w [ 104 ] , clotrimazole vaginal tab ip500mg [ 105 ] , compound benzoic acid ointment ip benzoic acid s o / o + salicylic acid 3 o / o [ 106 ] , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg |107j , co trimoxazole tablets ip trimethoprim40 mg and sulphamethoxazole 200 mg [ 108 ] , diethylcarbamazine tab ip 100 mg [ 110 ] , doxycycline cap ip 100 mg [ 111 ] , gentamycin injection ip80mg / 2ml ( im / iv use ) [ 116 ] , griseofulvintabip 125 mg [ 117 ] , itraconazole cap 100 mg [ 118 ] , metronidazole injip 500 mg [ 119 ] , metronidazole injip 500 mg / 100mi [ 120 ] “ , metronidazolebenzoate oral suspension ip100 mg of base / 5ml [ 121 ] , metronidazole tablets ip 200 mg ( film coated ) [ 122 ] , metronidazole tablets ip 400 mg ( film coated ) [ 123 ] , norfloxacin tab ip 400rñg film coated [ 124 ] , ofloxacin tab ip 200 mg [ 125 ] , primaquine tab ip 2.s mg [ 128 ] , primaquine tab ip 7.5 mg [ 129 ] , quinine dihydrochloride inj ip 300 mg / ml [ 131 ] , quinine sulphate tablets ip 300 mg ( film coated ) [ 132 ] , azathioprine tab ip 50 mg ( 133 ] , bleomycin injection ip 15mg ( bleomycin s sulphate injection 15 units ) [ 134 ] , chlorambucil tab ip 5mg [ 136 ] , cisplatin inj ip 50mg / 50ml [ 137 ] , cyclophosphamide inj ip 200mg [ 138 ] , cyclophosphamide inj ip 500 mg [ 139 ] , cytarabine injection bp 500 mg [ 141 ] , danazol cap ip 50 mg [ 142 ] , daunorubicin inj ip 20 mg [ 143 ] , doxorubicin inj ip 50 mg / 25 ml [ 144 ] , etoposide inj ip 100 [ 146 ] , flunarizine tabs mg [ 147 ] , fluorouracil inj ip 250 mg / 5ml [ 148 ] , l asparaginase inj 10000 iu [ 149 ] , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml [ 150 ] , melphalan tab ip 5 mg [ 151 ] , mercaptopurine tab ip 50 mg [ 152 ] , methotrexate lnj ip 50 mg / 2 ml [ 153 ] , methotrexate tab ip2.5 mg [ 154 ) , paclitaxel inj ip 260 mg [ 155 ] , paclitaxel inj ip 100 mg [ 156 ] , tamoxifen tab ip 10 mg [ 157 ] , vinblastine inj ip 10mg / 10ml [ 158 ] , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) [ 159 ] , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg [ 160 ] , levodopa and carbidopa tab 2s0 mg+ 25 mg ( 161 ] , trihexyphenidyl hci tab ip 2 mg [ 162 ] , acenocoumarol tab ip / nicoumalone tab ip 2 mg [ 163 ] , deferasirox tab 100 mg [ 165 ] , deferasirox tab 500 mg [ 166 ] , deferiprone cap 250 mg [ 167 ] , deferiprone cap 500 mg [ 168 ] , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion [ 169 ] , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) [ 171 ] , enoxaparin sodium inj ip60 mg [ 172 ] , ethamsylate lnj 2s0 mg / 2ml ( im / iv ) [ 173 ] , heparin sodium lnj ip s000 iu / ml ( im / iv use ) [ 174 ] , humal albumin solution ip 20% [ 175 ] , rh erythropoetion inj ip 10000 iu [ 176 ] , rh erythropoetin inj ip 2000iu [ 177 ] , rh erythropoetin inj ip4000iu [ 179 ] , vitamin k injection each ml contains menadione sodium bisulphite10mg equivalentto 5.2 mg of menadione. ( aqueous solution ) [ 180 ] , amiodaronetab ip 100 mg [ 181 ] , amiodarone tab ip 200 mg [ 182 ] , amiodarone hydrochloride inj 50 mg / ml [ 183 ] , amlodipine tabip 2.5 mg [ 184 ] , amlodipine tabletsip 5 mg [ 185 ] , atenolol tab ip 50 mg [ 186 ] , atorvastatin tab ip10mg [ 187 ] , clopidogrel tab ip 75 mg [ 188 ] , digoxin injip 0.25 mg / ml [ 189 ) , digoxin tab ip 0.25 mg. [ 190 ] , diltiazem tabs ip 30 mg film coated ( 191 ] , dobutaminelnj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) [ 192 ] , dopamine hydrochlorideinjip 40 mg / ml { 193 ] , enalapril maleate tabip smg [ 194 ] , enalapril maleate tab ip 2.5mg [ 195 ] , lsosorbide dinitrate tab ip 5 mg [ 197 ] , sosorbide mononitrate tabs ip 20 mg [ 198 ] , lisinopril tab ip 5 mg [ 199 ] , losartan tab ip 50 mg [ 200 ] , magnesiumsulphate inj. ip 500mg / ml ( 50p•w / v ) [ 201 ) , methyldopatab ip 250mgfilm coated [ 202 ] , nifedipine cap ip smg { 203 ] , nifedipine tablets ip 10 mg ( sustained release ) [ 204 ] , nitrogiycerininj5 mg / ml [ 20s ] , propranolol tabip 40 mg [ 207 ] , streptokinase injection 15 lac units ip [ 209 ] , verapdmii tab ip 40 mgfilm coated [ 211 ] , acyclovir cream s% [ 213 ] , glycerin ip 400 gm [ 217 ] , liquid paraffin ip 400 ml [ 218 ] , ointmentcontaining lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o [ 219 ] , miconazole nitrate cream ip 2% [ 220 ) , povidone iodine ointment 5% 15 gm [ 221 ] , povidone iodine solutionip 5 % 500 ml|222 ) , neomycin bacitracin and sulphacetamide powder ( neomycin s mg, bacitracin 250 units, sulphacetamide 60 mg ) ( 223 ) , silver sulphadiazinecream ip 1% 50gm tube [ 224 ) , anti a blood grouping serum ip ( anti a monoclonal serum ) [ 225 ] , anti b blood grouping serum ip ( anti b mono clonal serum ) [ 226j , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip [ 227 ] , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.=292mg / ml ) [ 232 ] , diatrizoate meglumine and diat sod inj usp 76& w / v ( iodine=370mg / ml ) [ 233 ] , tropicamideeye drop ip 1o / o [ 241 ) , vdrl antigen ( with + ve and ve control ) / rpr slide kit [ 242 ] , compound benzoin tincture ip [ 244 ] , formaldehyde solution ( 34.5 per. 38 per. ) |245 ) , gentian violet topical solution usp 1o / o [ 246 ] , giuteraidehyde solution 2% [ 247 ] , hydrogen peroxide solution ip 6 o / o ( 20 vol ) [ 248 ] , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) ( 249 ] , povidone iodine scrub solution / cleansing solution7.s o / o w / v povidoneiodine ( suitable for hand wash ) [ 250 ] , surgical spirit ip ( 500 ml ) [ 252 ] , acetazolamide tab ip 250mg [ 253 ) , frusemide tab ip 40 mg [ 2s4 ] , furosemide injectionip10mg / ml ( im and iv use ) ( 255 ] , hydrochlorthiazide tab ip 12.5 mg [ 256 ] , spironolactone tabip 25mg [ 258 ] , torsemide tab 10 ip mg [ 259 ] , bisacodyltab ip 5 mg [ 262 ] , dicyclominetab ip 10 mg [ 263 ] , dicyclomine lnj ip 10 mg / mi [ 264 ] , dicyclomine hydrochloride oral solution ip 10mg / 5ml [ 265 ) , domperidone suspension ip 5mg / 5ml { 266 ] , domperidone tab ip 10 mg [ 267 ] , hyoscine butylbromideinjip 20 mg / ml [ 268 ] , loperamide tab ip 2 mg [ 269 ] , metoclopramide inj ip 10mg / 2ml [ 270 ] , metoclopramide tab ip 10 mg [ 271 ] , omeprazole cap ip 20 mg [ 272 ] , ondansetron inj ip 2mg / ml [ 273 ] , ors powder ip [ 274 ] , pentoprazole lnj 40 mg [ 27s ] , ranitidine hcl injection ip s0mg / 2mi [ 276 ] , ranitidine tabip 1s0mgfilm coated [ 277 ] , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o ( 278 ] , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dnaorigin ) [ 279 ] , carbimazole tabs ip5 mg ( film coated ) { 280 ] , carboprosttromethamine injection ip each ml contains carboprost 0.25 mg / ml [ 281 ] , clomifene tab ip 25 mg [ 282 ] , clomiphene tab ip 50 mg [ 283 ] , conjugated estrogen tabs usp0.62s mg. [ 284 ] , dinoprostone cream / gel 0.5 mg dinoprostonein syringe [ 285 ] , ethinyloestradiol tabs ip 50 mcg [ 286 ] , glibenclamide tab ip s mg ( 287 ] , gliclazide tab ip 40 mg [ 288 ] , glimepiride tabip 2 mg ( 289 ] , glimepiridetab ip1mg |290 ] , glipizide tab ip smg ( 291 ] , hydroxyprogesterone inj ip 250mg / ml [ 293 ] , isophane insulin injip 40 iu / ml [ 294j , metformin tab ip s00 mg ( film coated ) [ 295 ] , norethisterone tab ip 5 mg [ 296 ] , pioglitazone tab ip 15 mg |297 ] , progesteroneinj 200 mg / 2ml [ 298 ] , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) [ 300 ] , thyroxine sodium tablets ip 100mcg [ 301 ) , human anti d immunoglobulin injection 300mcg ( im use ) [ 303 ] , human anti d immunoglobulin150 mcg [ 304 ] , humanrabieslmmunog|obulinlnj150lu / mll305 ) , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu [ 306 ] , rabies vaccinehuman ( cell cuiture ) ip ( intramuscular ) 2.5iu / dose [ 307 ] , snake venum anti serum ip ( lyophiiized ) poiyvaient anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) |308 ) , tetanus immunoglobulin ip 250 iu / vial [ 309 ] , tetanus vaccine ( adsorbed ) ip 5 ml vial [ 310 ) , atracuriuminj 10 mg / ml [ 311 ] , |giycopyrrolate inj ip 0.2 mg / ml ( 312 ] , |midazolam lnj ip 1 mg / ml [ 313 ) , jneostigmine lnj ip 0.5 mg / ml [ 314 ] , t neostigmine tab ip 15 mg [ 316 ] , tsuccinylcholineinj. ip 50 mg / ml ( iv use ) [ 317 ] , t valethamate bromide inj 8mg / ml [ 318 ] , atropine eye ointment ip 1% { 319 ) , atropine sulphate ophthalmic solution us.^ 1% |320 ] , |chioramphenicoi eye drops ip 0.5 0 / 0 |321 ] , |ciprofioxacin eye dropsip 0.3 o / o w / v [ 322 ] , tciprofloxacin ophthalmic ointment usp 0.3% [ 323j , hydroxypropylmethyl cellulose solution 20 mg / ml [ 324 ] , tobramycin and dexamethasoneophthalmic suspension usp 0.3 o / o +0.1 o / o |330 ] , tobramycin eye drops 0.3% ( 331 ] [ 331j , ttobramycin ophthalmic ointment usp 0.3% [ 332 ) , tlsoxsuprinelnj ip 5 mg / ml ( 333 ] , lsoxsuprine tab ip 20 mg [ 334 ) , methylergometrine injip 0.2 mg / ml |335 ) , jmethylergometrine tab ip 0.125 mg [ 336 ] , misoprostol tab ip 200 mcg [ 337 ] , oxytocin lnjip 5 iu / ml [ 338 ) , alprazolam tab ip 0.25 mg [ 339 ] , alprazolam tab ip 0.5mg l340 ] , amitriptyline tabip 25mgfilm coated [ 341 ] , chiordiazepoxide tablets ip 10mg [ 342 ] , tchlorpromazine tablets ip 100 mg ( coated tablet ) |343 ] , chiorpromazine tablets ip 25 mg ( sugar coated ) [ 344 ] , tchlorpromazine tablets ip 50 mg ( coated tablets ) |345 ] , chlorpromazine inj. ip 25mg / ml [ 346 ] , diazepam inj ip 10mg / 2mi ( 1m / iv use ) [ 349| , diazepamtab ip5 mg [ 350 ] , escitaiopram tab ip 10 mg [ 351 ] , tfluoxetine cap ip 20 mg { 352 ) , haloperidol lnj ip 5 mg / ml [ 353 ] , haioperidol tabip 1.5 mg [ 354 ] , haloperidoi tab ip 5 mg [ 355 ] , lmipramine tab ip 25 mg ( coated tab ) ( 356 ] , jlmipramine tab ip 75 mg ( coated ) [ 357 ) , lithium carbonate tabip 300 mg |358 ] , lorazepam inj ip 2 mg / ml [ 359 ] , olanzapinetabip 5 mg [ 360 ] , |risperidone tabzmg [ 361 ] , risperidone tab 1 mg [ 362 ) , sertraline tab ip 50 mg [ 363 ] , trifluperazine tab ip 5 mg coated [ 364 ) , aminophylline inj ip 25 mg / ml [ 365 ] , beclomethasone inhalation ip 200 mcg / dose [ 366 ] , budesonide nebulizer suspension 0.25mg / ml [ 367 ] , cough syrup each 5 ml contains chloropheniramine maleate ip 3mg, ammoniumchloride 130 mg, sodium citrate 6s mg, menthol0.5 mg, syrup q.s. [ 368 ] , ipratropiumbromide nebulizer solution 250 mcg / ml |369 ] , salbutamol tablet ip 4 mg [ 370 ) , salbutamol inhàlation 100 mcg / dose ( 371 ] , salbutamol nebuliser solution bp 5 mg / ml [ 372 ] , salbutamol tabip 2 mg [ 373 ] , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) [ 374 ] , theophyllineand etofylline tablets ( theophyllineip 23mg + etofylline 77 mg ) ( 375 ] , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) [ 376 ] , compound sodium lactate lnj. ip [ 377 ] , dextrose injip 25% w / v [ 378 ] , dextrose inj ip 10% [ 379 ] , dextrose inj ip 5% ( 380 ] , multiple electrolytes and dextrose injection type iip ( electrolyte p injection ) [ 381 ] , multiple electrolytes and dextrose injection type iiiip electroylte m injection ( i.v. ) [ 382 ] , potassium chloride inj. 0.15 gm / ml [ 383 ) , potassium chloride oral solution u.s.p 500mg / 5mi { 384 ] , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o ( 385 ] , sodium chloride inj ip 500 ml |386 ] , ascorbic acid tab ip 500 mg [ 387 ] , calcium gluconate lnjip 10% ( iv use ) [ 388 ] , ferrous sulphate with folic acid tab jp each film coated tab. containing dried ferrous sulphate ip equiv100 mg elemental iron and folic acid ip 0.5 mg [ 390 ] , ferrous sulphate with folic acid tab ( paediatric ) ip each film coatedtab. containing dried ferrous sulphate ip eqivaientto 20mg elemental iron and folic acid ip 100 mcg [ 391 ] , folic acidtab ip 5 mg [ 392 ] , multivitamin drops each mlcontains vit a3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenoi 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin1mcg, lysine hcl10mg [ 393 ] , multivitamintabletsnfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mgniacinamide 25mgfolic acid 0.2 mg ( 394 ] , vitamin b complex injnfi [ 395 ] , vitaminb complex tablet nfi ( prophylactic ) b1 2mg b2 2mgb6 0.5mg niacinamide25mg calcium pantothenate1mg ( with appropriate overages ) ( 397 ] , black disinfectant fluid ( phenyl ) as per schedule o grade iii [ 398 ] , conc haemodialysis fluid b.p acetate concentrate 10 litre can [ 399 ] , peritonial dialysis solution ip [ 401 ] , sodium bicarbonate injip 7.5°a w / v ( 402 ) , |water for lnj ip ( 404 ] , ( polygeline 3.5% solution with electrolytes for i.v. infusion |405 ] , factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) [ 406 ] , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) ( 408 ) , vitamin a paediatric oral solutionip ( vitamin a concentrate oil lp ) each ml contains vitamin a 100000 iu ( 409 ] , tlabetalol tab ip 100mg { 410 ] , |labetaiol hci lnj ip 20mg / 4ml [ 411 ] , ( ampicillin cap ip500mg { 412 ] , nitrofurantoin tab ip 100mg [ 413 ) , hyoscine butyl bromide tablets ip 10mg [ 414| , tdrotaverinetab ip 40 mg [ 415 ] , hydroxyethylstarch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesiumchloride intravenousinfusion [ 416 ] , ( cloxacillin sodium lnj ip 500mg [ 417 ] , ) betamethasone sod phos 1nj ip 4mg / ml |418 ) , vecuronium bromide for injection 4mg ( freeze dried ) 419 ) , phenobarbitone inj ip 200mg / ml [ 420 ] , flurbiprofen sodium ophthalmic solution ip0.03 olow / v [ 421j , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i’u. [ 423 ] , t lidocaine hci topical s?lution usp 4% [ 424 ] , fluconazole eye drops0.3% [ 425 ] , cephalexinoral suspension ip ( cephalexin dry syrup ip ) 125mg / s ml [ 427 ] , j oiioxacin oral suspension ip 50mg / xml [ 428 ] , ttinidazole tab ip 300 mg ( film coated ) [ 430 } , ttinidazole tab ip 500 mg ( film coated ) |431 ) , |salbutamoi syrup ip 2mg / sml [ 432 ] , tranitidine tabip 300mg film coated ( 433 ] , indomethacincap ip 25 mg [ 436 ] , diclofence prolonged release tablet ip 100 mg [ 437 ] , dicyclomine hydrochloride and activated dimethicone suspensioneachml contains dicyclomine hydrochloride 10mgactivated dimethicone 40mg [ 438 ] , dextromethorphan hbr syrup ip 13.5mg / smt [ 440 ] , calcium and vitamin d3 suspension ( each s ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) [ 441 ) , saline nasal solution ( drops ) ( sodium ch!or.de 0.o5 o / oj [ 442 ] , clotdmazole mouth pant ( clotrimazole1 o / ow / v ) { 443 ) , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 7s mg ) [ 444j , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) [ 445 ] , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) ( 446 ] , chlorhexidine gluconate solution 5% 250 ml [ 447 ] , iron and folic acid suspension. each 5mi contains ferrousfumerate equivalent to elemental iron 100mg, folic acid 500 mcg ( 448 ] , surgical spirit ip ( 100 ml ) [ 449 ] , povidone iodine solution ip 5% 100mi bottle [ 450 ] , metforminhydrochloride ( sustained release tablets ip 1000 mg ( 4s1 ] , glipizide and metformin hydrochloridetablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) [ 4s2 ] , glibenclamideand metformin hydrochloride ( sr ) tablets glibenclamide s mg, metformin hydrochloride s00 mg ( sustained release ) |4s3 ] , metformin hcl ( sustained release ) and glimepiridetab metformin hcl ( sustained release ) 500mg , glimepiride 1mg [ 4s4 ] , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) [ 45s ] , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg [ 456 ] , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine s mg, enalapril maleate s mg ) [ 457 ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine smg ) [ 458 ] , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium50 mg, hydochlorothiazide 12.5 mg ) [ 459 ) , amlodipine and lisinopril tablets amlodipine besilate equivalentto amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) s mg [ 460j , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenoiol 50mg ) [ 461 ) , atenolol tab ip 25 mg [ 462 ] , enalapril maleate tablets ip 10 rrig [ 463 ) , hydrochlorthiazide tab ip 25mg [ 464 ] , lisinopril tablets ip 10 mg ( 465 ] , lisinopril tab ip 2.5 mg [ 466 ] , losartan tabip 25 mg [ 467 ] , piperacillin+tazobactum for injection ip 4gm+500mg [ 468 ] , prednisolone tablet ip 10 mg [ 469 ] , prednisolone tab ip 20 mg [ 470 ) , torsemide lnj10 mg / ml |471j , zinc sulphate dispersible tablets ip elemental zinc 10 mg [ 472j , amoxyciilin oral suspension ip ( dry syrup ) 125 mg / 5ml [ 473 ] , carbamazepine oral suspensionusp 100 mg / 5ml [ 474 ] , cefpodoxime dispersible tab 50 mg [ 475 ] , cephalexin tablets 125 mg ( dispersible tablets ) [ 476 ) , ibuprofen oral suspension bp / usp 100 mg / s ml [ 477 ] , metoclopramide hydrochloride syrup ip 5 mg / 5m| [ 478 ) , tsodium valproate oral solution ip 200 mg / 5 ml [ 479 ] , diphtheria antitoxin 10000 iu [ 480 ] , meropenem inj. ip 1gm [ 481 ] , lohexol usp ( solution for injection ) non lonic contrast medium in sterile aquous solution 300 mg lodine / ml [ 482 ] , diclofenac sod + paracetamoltablets ip diclofenac sod50 mg + paracetamol 325 mg [ 483 ] , timolol eye drops ip 0.s o / o w / v ( 484 ] , homatropine eye drops ip 2% ( 485 ) , travoprosteye drops ip0.004 o / o [ 486 ] , brimonidinetartrate& timolol maleate eye drops 0.15% + 0.5% ( 487 ] , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg [ 488 ] , sevoflurane [ 491 ] , aceclofenac and paracetamoltablets aceclofenac 100 mg and paracetamol 325 mg [ 492 ] , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% [ 493 ) , etoricoxib tab ip l20mg |495 ] , mefenamicacid tablets bp 500 mg ( 496 ] , anticold syrup each s ml contains phenylephrine hydrochloride2 smg chlorpheniramine maleate 1 mg, and paracetamol125 mg [ 497 ] , cetirizine, phenyiephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab [ 498 ] , cetirizine syrup ip 5mg / 5 ml [ 499 ] , acetyicystine solution usp ( injection ) 200 mg / ml [ 500 ] , acyclovir intravenous infusion ip 250mg [ 502 ] , acyclovir intravenous infusion ip 500mg [ 503 ] , amikacin lnj ip 250 mg [ 504 ) , amoxicillinand potassium clavulanic ip lnj g00mg [ 505 ] , amoxicillinand potassium clavulanate inj ip 1.2gm ( 506 ] , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) [ 507 ] , cefixime injection ip 500 mg [ 510 ] , cefixime oral suspension ip 25mg / ml ( paediatric drops ) [ 511 ] , cefuroxime axetil tab ip 250 mg [ 512 ] , clindamycin capsule ip 1s0mg [ 513 ] , ciindamycincapsule ip 300 mg [ 514j , levofloxacintablets ip 250 mg [ 515 ] , levofloxacin tablets ip 600 mg [ 516 ] , linezolid inj 200mg / 100ml [ 517 ] , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg ( 520 ] , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) [ 521 ] , vancomycin for intravenous infusion !p 500 mg 523j , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit [ 525 ] , carboplatin injection ip 150 mg [ 526 ] , carboplatin injection ip 450 mg [ 527 ] , cisplatin inj ip 10 mg / 10ml [ 528 ] , dacarbazine injection 500mg usp / bp [ 529 ] , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg [ 530 ] , gemcitabine for injection 200 mg [ 531 ] , gemcitabine for injection 1gm [ 532 ] , ifosfamide injection ip / bp / usp 1gm [ 533 ] , imatinib tab ip 400mg [ 534 ] , methotrexate tablets ip 10 mg { 536 ] , mitomycine injection ip 10mg / mitomycine for injection usp 10 mg [ 537 ] , oxaliplatin injection usp 50 mg [ 538 ] , betahistine tab ip 8 mg [ 541 ] , betahistine tab ip 16 mg [ 542 ] , cinnarizine tablets ip 25 mg [ 543 ] , cinnarizine tablet ip 75 mg [ s44 ] , tranexamicacid tablets ip 500 mg [ 545 ] , warfarin sodium. tab ip smg [ 546 ] , adenosine injection ip 6 mg / 2mi [ 547 ] , atorvastatin tablets ip40 mg [ 548 ] , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg [ 549 ] , fenofibrate capsules / tab ip 200 mg [ 550j , lsoprenaline injection ip 2mg / ml [ 551 ] , metoprolol tablets ip 25 mg [ s52 ] , metoprolol succinate extended release tablets ip 50 mg [ 553 ] , noradrenalineinjection ip 2 mg / ml [ 554 ] , prazosin tablets ( extended release ) 2.5 mg [ 555 ] , telmisartan tablets ip 40 mg [ 556j , urokinase injection s lac unit ( lyophilized ) [ 557 ] , betamethasonedipropionate cream ip 0.05% { 558 ) , betamethasonelotion ip0.05 o / o [ ss9 ] , clindamycin phosphate gel usp 1 o / o [ 560 ] , clobetasol propionate cream ip 0.05 o / o [ 561 ] , glycerin ip 100 ml [ 564 ] , ketoconazolecream 2% |565 ] , permethrinlotion5% ( 568 ] , permethrin cream 5% [ 569j , tretenoin c”ream usp 0.025% [ 570 ] , povidone iodine ointment usp250 gm |571 ] , povidone iodine solution ip 10 % [ 572 ] , silver sulphadiazinecream ip 1% s00 gm jar [ 573 ] , spironolactone tabletsip50 mg [ 574j , finasteride tablets ip 5 mg [ 575j , tamsulosin hci tablets / capsule 0.4 mg [ 576 ] , flavoxate tablets ip 200 mg ( coated tablet ) ( 579 ] , chlorhexidinemouthwash ip 0.2 o / o [ 580 ] , dental gel choline salicylate 8.7 o / o, benzalkoniumchloride 0.01 lignocaine hci 2 o / o ( flavoured gel base ) [ 581 ) , tooth gel sodium monofluorophosphate 0.7 o / o andpotassium nitrate o / o ( in flavoured base ) [ 582 ] , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1°” [ 583 ) , metronidazole1% and chlorhexidine gluconade 0.25% gel [ 584 ] , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasoneotic suspension usp ( 585 ] , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops [ 586 ] , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp [ 588 ] , ceruminolyticdrops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o |589 ] , domperidone oral drops 10mg / ml ( 10mi ) [ 590 ] , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg ( 591 ] , lactic acid bacillus tab60 million spores [ 592 ] , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml [ 593 { , liquid paraffin ip 100 ml [ s94 ] , ondansetron orally disintegrating tablets ip 4mg [ 595 ] , pantoprazole 40mg and oomperidone 30mg sr cap ip pantoprazole ‘* enteric coated pellets and domperidoneas sr pellets [ 596 ) , ursodeoxycholic acid tablets ip 300 mg ( 597 ] , allopurinol tabletsip100 mg ( 598 ] , hydroxychloroquine sulphate tablets 200mg [ 599 ] , leflunomide tablets ip 10mg ( film coated ) [ 600 ] , leflunomide tablets ip / usp 20mg ( film coated ) [ 601 ) , sulfasalazine gastroresistant tablets ip 500 mg ip [ 602 ] , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) ( 603 ] , medroxyprogesterone acetate tablets ip10 mg [ 605 ) , thyroxine tablets ip 50 mcg [ 607 ] , chlorzoxazone., diclofenac sodium & paracetamoltablets ( chlorzoxazone 250mg , diclofenacsodium 50mg paracetamol 325 mg ) [ 610a , betaxolol eye drops 0.5 o / o [ 612 ) , carboxymethylcellulose eye dropsip 0.5% ( 613 ] , phenylephrine hydrochlorideopthalmic solution usp / phenylephrine eye drops bp 5% [ 614 ] , mifepristonetab ip 200mg [ 615 ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg [ 616 ) , budesonide powder for inhalation200 mcg |617 ] , ipratropium powder for inhalation ip 40 mcg [ 618j , terbutaline tabletsip 2.5 mg |619 ] , xylometazolinenasal dropsip 0.1% [ 620 ] , sodium chloride injection ip 100 ml [ 621 ] , calcium with vitamin d tabletsusp / caicium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elementalcalcium 500 mg, vitamin d3 250 iu ) ( non chewable ) [ 622 ] , cholecalciferol granules 60, 000 iu / gm [ 623j , mecobalamininj 500 mcg / ml |624 ) , pyridoxine tablet ip 10 mg [ 626j , pyridoxine tablet ip 40mg { 627 ] , thiamine tabletsip100 mg |629 ) , calcitriol capsules ip 0.25 mcg [ 630 ] , normal human intravenous immunoglobulin 5g / 100 ml [ 633 ] , pregabalin cap ip 75 mg [ 634 ] , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) [ 635 ] , ramipril tablets ip 2.s mg ( 636 ] , neostigmine injection ip 2.5mg / 5ml [ 638 ] , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) [ 639 ] , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent ’to oseltamivir 45 mg ) ( 640 ] , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) [ 641 ] , oseltamivir phosphatefor oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) [ 642 ] , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) [ 644 ] , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxineand pyrimethamine ( 250mg+12.smg ) ( 645 ] , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxineand pyrimethamine ( 500mg+25mg ) |646 ] , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxineand pyrimethamine ( 750mg+37.smg ) ( 647 ] , act kit containing 3 tablets of artesunate ( 1s0 mg each ) and 2 tablet of sulphadoxineand pyrimethamine ( 500mg+25mg ) [ 648 ] , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 7s0mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+2s ) mg [ 649 ) , glyceryl trinitrate tablets 2.6 mg controlled release tablets [ 650 ] , artemether and leumefantrinetablet ( 80 mg and 480 mg ) [ 651j , methyl cobalmine tablet 500mcg [ 652 ] , methyl cobalmine tablet 1500mcg [ 653 ] , atropine sulphate injection 0.6mg / ml [ 654 ] , fentanyl citrate injection 50mcg / ml [ 65sj , naproxen tablet ip 500mg [ 656j , naproxen tablet ip 250mg [ 657 ] , etoricoxib tablet ip 90 mg [ 658 ] , levoceitrizine tablet smg [ 659 ) , monteiucast ( 10mg ) + levocetrizinetablet ( smg ) [ 660 ] , sodium valproate tablet ( gastro resistant ) ip 500mg [ 661 ] , clobazam tablet / capsule 5 mg [ 662 ] , clobazam tablet / capsule 10 mg [ 663 ) , levetiracetamtablet ip 500 mg [ 664 ] , levetiracetamoral solution / suspension 100mg / ml [ 665 ] , levetiracetam injection 500mg / 5ml [ 666 ] , gabapentine tablet / capsule 100mg [ 667 ] , gabapentinetablet / capsule 300mg |668j , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) ( 669 ] , coal tdr 6% & salicylic acid 3% ointment [ 670 ] , calamine lotion ip 100mi [ 671j , lohexol usp ( solution for injection ) non lonic contrast medium in sterile aqueous solution 350 mg lodine / ml. [ 672 ] , vitamin d3 oral solution 60000 iu [ 676 ] , cyclosporin capsule usp / ip 50 mg [ 677 ] , clonazepamtablet 0.5 mg [ 678 ] , aspirin tablet ip ( gastro resistant ) 150 mg [ 679 ] , insulin glargine 3ml ( 100iu / ml ) with 1s insulin’ syringes and needles / cartridge 3mi ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges [ 680 ] , tenaligliptin tablet ip 20mg ( 682j , framycetin sulphate cream 1 o / o 30gm pack [ 684 ] , framycetin sulphate cream 1 o / o 100 gm pack ( 685 ] , artemetherand leumefantrinetablet ( 40 mg and 240 mg ) t686 ] , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans [ 687 ] , dried factor viii fraction ip ( iv use ) 500 iu / vial [ 688 ] , dried factor viii fraction ip ( iv use ) 1000 iu / vial [ 689 ] , cough syrup / expectorant ( 50 ) ml [ 692 ] , insulin glargine .10 ml vial ( 100 iu / ml ) with 30 lnsuline syringes with needle [ 693 ) , butorphanol tartrate injection usp 1mg / ml 1ml size [ 694 ] , diclofenac sodium aqueous injection75mg / mi1mi size, iv& im use [ 695 ] , paracetamolinfusion ip 1% w / v 100mi size [ 696 ] , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine10 mg ) [ 697 ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) [ 698 ] , tizanidine hydrochloridetablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) |699 ] , dexamethasonetablet ip 4 mg ( each uncoated tablet contains dexamethasoneip 4 mg ) |700 ] , lamotrigine tablet ip 50 mg ( each sustained release tablet contains lamotrigine ip 50mg ) [ 701 ] , divalproexextended release tablet ip 250 mg ( each extended release film coated tablet contains divalproexsodium ip equivalentto .valproic acid 250 mg ) [ 702 ] , oxcarbazepinetablet ip150 mg ( each film coated tablet contains oxcarbazepine ip150 mg ) [ 703 ] , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) ( 705 ] , ( amoxycillin tablet 250 mg+caivulanic acid 125 mg ip each f:•im coated tab conatin amoxycillin trihydrate ip 250 mg & potassiumclavulanate ip 125 mg [ 706 ] , ceftriaxone 1 m+tazobactum 125 mg injection [ 708 ] , cefadroxil dispersible tablet 250 mg ( each uncoated dispersibletablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) [ 709 ] , cefadroxil tablet s00 mg [ 710j , ofloxacin oral suspension ip ( each 5mi contains ofloxacin ip 100 mg ) 30 ml size [ 711 ] , levofloxacintablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) [ 712 ] , clindamycin phosphate injection ip 300 mg [ 714 ] , terbinafine hydrochloride tablet 250 mg [ 721 ] , capecitabine tablet ip 500mg ( each film coated tablet contains capecitabine ip 500 mg ) [ 727 ] , letrozole tablet ip 2.5mg ( each film coated tablet contains letrozole ip 2.5mg ) [ 728 ] , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) [ 729 ] , thalidomide capsule usp 100mg ( each hard gelatin capsule contains thalidomide usp 100mg ) [ 733 ] , biscalutamide tablet ip 50mg ( each film tablet contains bicalutamide ip 50mg ) [ 741 ] , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) [ 742 ] , zoledronic acid injection ip 4mg [ 743 ] , n butyl alcohol injection 0.25mg / 5ml and sod. chioride solution 5 ml size [ 744 ] , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) [ 745 ] , ferrrylum sterile solution 100 mi [ 746 ] , tranexarriic acid injection ip 10gmg / ml sml size [ 747 ] , recombinant f ix 500 iu with diluent [ 748 ] , 3rd generation recombinant f viii 250 iu with diluent [ 749 ] , 3rd generation recombinant f viii 1000 iu with diluent [ 750 ] , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochlorideip 0.1 mg ) [ 751 ] , sotalol hydrochioride tablet usp / bp 40 mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) [ 752 ] , esmolol hydrochioride injection 10 mg / ml 10ml size [ 753 ] , carvedilol tablet 3.12s mg [ 755 ) , rosuvastatin tablet ip 20mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20mg ) [ 756 ] , rosuvastatin tablet 10 mg [ 757 ] , sacubitril 24 mg and valsartan 26 mg tablett758 ] , powder clotrimazole 1% w / w 30 gm [ 759 ] , terbinafine cream 1%w / w ( 10 gm tube ) [ 760 ] , oitment mupirocin ip 2% [ 762 ) , doxylamine succinate 20 mg & pyridoxine hydrochloride20 mg tablet ( each enteric coated tablet contains doxylamine succinateusp 20 mg & pyridoxine hydrochloride ip 20 mg ) [ 763 ] , prochlorperazine mesylate injection 12.5 mg / ml 5ml size [ 764 ] , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) [ 76s ] , mesalamine tablet usp 1.2gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) [ 766 ] , hepatitis b immunologiobin injection ip 200 l.u. [ 767 ] , acyclovir eye ointment ip 3% w / w 5gm size [ 769 ] , eye drop moxifloxacin0.5% w / v ophthalmic solutionip 5mi size [ 770 ] , chloramphenicol 1% w / w eye ointment ip, 3gm size [ 771 ] , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) [ 772 ] , cabergoline tabletip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) [ 773 ] , human chorionic gonadotropin injection ip 5000 l.u. [ 774 ] , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) [ 777 ] , lorazepam tablet ip 2 mg ” ( each uncoatedtablet contains lorazepam ip 2 mg ) ( 778 ] , zolpidem tablet s mg [ 779 ] , acebrophylline tablet / capsule 100 mg ( 780 ) , ringer acetate infusion 500 ml |781 ] , sodium chloride 0.45% w / v polypack 500 ml { 782 ] , sodium bicarbonatetablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) [ 784 ) , phenazopyridine tdblet 5 mg [ 786 ] , dutasteride tablet 0.5 mg [ 787 ] , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) [ 788 ) , ferric carboxymaltose injection 50 mg / ml 10 ml size [ 789 ] , multi vitamin syrup [ 790 ] , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) [ 792 ] , caffeine citrate usp injection 20mg / ml ( equlent to 10 mg caffeine base / ml ) 3ml size [ 793 ] , vitamin e capsule 400 mg [ 795 ) , inj poractant alpha 80mg / ml in pack of 1.5 ml ( detail in rc ) [ 796 ] , liquid medical oxygen ( lmo ) [ 799 ] , multistix test strip [ 801 { , chloroquine phosphate suspension ip 50 mg / 5mi [ 100a ] , fluconazole tablets ip 150mg [ 114a ] , cetrimide cream ip 1s gm [ 215a ] , fusidic acid cream ip 2% [ 216aj , mannitol inj ip 20% w / v [ 257a ] , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 2s0 mg, dried aluminium hydroxide gel 120 mg, peppermint oil [ 260a ] , antacidliquid, eachsml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide250mg, activatedpolydimethyl siloxane 50mg [ 261a ] , dicyclomine and paracetamol tablets dicyclomine hydrochloride20 mg ” paracetamol 325 mgtablets [ 439a ] , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1mi ampouie ) , sodium chloride injection ip 0.9o / o w / v ( 5mi ampoule ) ( 508a ) , oseltamivir phosphate for oral suspensionip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) [ 642a| , albendazole tablets ip 400 mg ( detail in rc ) ( 66a ) , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) |78a ) , azithromycintablets ip 250mg [ 79a ] , azithromycintab ip 500 mg [ 80a ] , dorzolamide 2% eye drop [ nrd. 101 ] , gatifloxacin and prednisolone eye drop [ nrd. 103 ] , moxifloxacin and prednisolone eye drop [ nrd. 109 ] , anti oxidants capsule ( beta carotene 10 mg. vit e 25mg, vit c 100mg, copper 1.5mg, managanese 1.5mg, z [ nrd. 11 ] , sodium chloride 5& eye drop [ nrd. 115 ] , tropicamide and phenylepherine eye drop [ nrd. 118 ] , aprepitant capsule 125 mg [ nrd. 12 ] , chloramphenicol and polymycin eye ointment [ nrd. 122 ] , chloramphenicol and polymycin and dexamethasone eye ointment [ nrd. 123 ] , alpha beta arteether 2 ml injection [ nrd. 150 ] , azithromycin 10 ml vial equaivelent to 500 mg injection [ nrd. 161 ] , compound sodium lactate ( ringer lactate ) in glass bottle 500ml injection [ nrd. 197 ] , dexmedetomidine 100 mcg / mi [ nrd. 215 ] , doxycycline for injection 100 mg injection [ nrd. 221 ] , etomidate 20 mg injection [ nrd.231 ] , fluconazole 200 mg injection [ nrd.236 ] , gdw 5% glass bottle / 500 ml injection [ nrd.247 ] , levofloxacine 500 mg / 100 ml injection [ nrd.273 ] , l orinithine l aspartate 10 ml injection [ nrd. 283 ] , mephentermine 50 mg / ml injection [ nrd. 285 ] , methylprednisolon acetate 40 mg injection [ nrd. 291 ] , alpha and lipoic acid and leycopen and multivitamin and miltiminerals capsule [ nrd. 3 ] , moxifloxin 400mg / 100ml injection [ nrd.301 ] , multivitamin 10 ml injection [ nrd. 302 ] , nandrolone decanoate 50mg injection [ nrd.305 ] , nicorandil 48 mg injection [ nrd.310 ] , normal saline 500 ml glass bottle injection [ nrd.315 ] , pilocarpine 0.5% w / v injection [ nrd.334 ] , piracetam 200mg injection [ nrd.336 ] , silodosin capsule 4mg [ nrd.35 ] , reteplase 18 mg injection [ nrd.352 ] , silodosin capsule 8mg [ nrd.36 ] , glucosamine and hydrochloride and methylsulfonylmethane capsule [ nrd.4 ] , vitamin d ( 600000 lu ) injection [ nrd.402 ] , lignocaine 1% mouth paint [ nrd.427 ] , cyproheptadine 200ml syrup [ nrd.491 ] , drotavarine syrup [ nrd.494 ] , racecadotril capsule 100mg [ nrd.5 ] , levofloxacin oral solution syrup [ nrd.503 ] , mefenamice acid 100mg / 5ml syrup [ nrd.505 ] , montelucast and levocetrizine syrup [ nrd.508 ] , ondansetron oral suspension syrup [ nrd.510 ] , phenobarbitone 20mg / 5ml in 100ml syrup [ nrd.512 ] , zinc oral suspension 20 mg / 100 ml syrup [ nrd.524 ] , azithromycin oral suspension 100mg / 5ml syrup [ nrd.525 ] , azithromycin oral suspension 200mg / 5ml syrup [ nrd.526 ] , luliconazole 1% cream [ nrd.55 ] , cefpodoxime proxetil tablet 100mg [ nrd.571 ] , clarithromycin tablet 500mg [ nrd.581 ] , dapagliflozin tablet 10mg [ nrd.599 ] , rabeprazole and levosulpiride capsule [ nrd.6 ] , deflazacort tablet 6mg [ nrd.602 ] , duloxetine gastro resistant tablet 20mg [ nrd.614 ] , duloxitine gastro resistant tablet 30mg [ nrd.615 ] , esomeprazole tablet 40mg [ nrd.624 ] , febuxostat tablet 40mg [ nrd.632 ] , febuxostat tablet 80mg [ nrd.633 ] , formaline tablet [ nrd.642 ] , glucosamine hydrocloride tablet and diacerin 50 tablet mg [ nrd.644 ] , lvermectin tablet 6mg [ nrd.650 ] , lvermectin tablet 12mg [ nrd.650 ] , levothyroxine sodium tablet 25 mcg [ nrd.665 ] , methylprednisolone tablet 16mg [ nrd.683 ] , methylprednisolone tablet 8mg [ nrd.684 ] , moxifloxacin tablet 400mg [ nrd.697 ] , nicoumalone tablet 1mg [ nrd.705 ] , nicoumalone tablet 4mg [ nrd.707 ] , diastase pepsin with simethicone 15 ml drop [ nrd.71 ] , nitrazepam tablet 5mg [ nrd.714 ] , paracetomol tablet 650mg [ nrd.726 ] , ondansetron oral suolution 30 ml drop [ nrd.73 ] , prednisolone acetate opthalmic suspension 10 ml eye drop [ nrd.74 ] , terbutalin drop [ nrd.75 ] , propylthiouracil tablet 100mg [ nrd.753 ] , hydroxyzine oral solution 15 ml drop [ nrd.76 ] , rosuvastatin tablet 10 mg and fenofibrate tablet 160mg [ nrd.771 ] , serratiopeptidase tablet 10mg [ nrd.777 ] , anticold drop [ nrd.78 ] , enzyme drop [ nrd.80 ] , trypsin chymotripsin tablet [ nrd.807 ] , vildagliptin tablet 50mg [ nrd.812 ] , voglibose tablet 0.2mg [ nrd.813 ] , voglibose tablet 0.3mg [ nrd.814 ] , zinc tablet 50mg [ nrd.818 ] , tetanus vaccine ( adsorbed ) injection ip in 0.5 mi. ( nrd.824j , vitamin d3 400lu / ml drop [ nrd.84 ] , vitamin d3 800lu / ml drop [ nrd.85 ] , carboxymethylcellulose and glygerin eye drop [ nrd.92 ] , moxifloxacin and difluoprednate eye drop [ nrd.93 ] , natamycin opthalmic suspension 5% eye drop [ nrd.94 ] , olaptadine & ketorolac eye drop [ nrd.95 ] , polymyxin b 10000lu / gm and neomycin 3400lu / gm eye drop [ nrd.96 ] ...

Rajasthan University Of Health Science - Rajasthan

33718300 suppy medicine and surgical items supply medicine and surgical items , oral and topical , 2% glutarldehyde lotion , abiphyline sr 200mg , acebrofline 100 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , aceclover+ thiocolside , acetazolamide tab ip 250mg , acetylcestine600mg tab , activated charcol , acyclovir 200mg , acyclovir cream 5.5% , acyclovir eye ointment , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole suspension 10 ml , albendazole tablets ip 400 mg , alkaliser syp , allopurinol tablets ip 100 mg , alovera+vit.e cream , alpha methyl dopa250mg , alprazolam 0.25mg , alprazolam 0.50mg , aluminium chlorohydrate solution , ambroxol 75 / 90 mg , amiodarane 100mg , amiodarane 200mg , amisulphiride 50mg , amitriptyline tab ip 25mg film coated , amitryptyline 10mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , amlodipine tab ip 2.5 mg , amlodipine tab ip 5 mg , amoxy+clave 375 tab , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg + 28.5 ml / 5 ml ( 30ml bottle ) , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mgg , amphotericin b tab , ampicillin cap ip 500mg , anastrozole 1mg , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint , anticolddrop , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , antioxidant , apixapan tab 2.5 mg , aripiprazole 10mg , artemether+lumefantrine 20mgdt, 40mgdt 60mgdt , artesal seath 6f, 5f , aspirin delayed release tablet / aspirin gastroresistant tab ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , atenolol tab ip 25 mg , atenolol tab ip 50 mg , atorvastatin tablets ip 40 mg , azathioprine tab ip 50 mg , azithromycin syp , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tab ip 500 mg , beclomethasone inhalation ip 200mg / dose , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , benzocaine20%+chlorhexidine gel ( for oral ulcer ) , benzyl peroxide 2.5%gel , betahistine tab ip 16 mg , betahistine tab ip 8 mg , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , betamethasone tab ip 0.5mg , betaxolol eye drops 0.5 o / o , biotin+minerals , biotin+pantothenic acid , bisacodyl tab ip 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , blu dye , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , bromofenac .09%eye drop , buprenorphine patch 10, 20 , bupropion 250mg tab , cabergolin 50 mg , calamine lotion ip ( 50 ml ) , calcitriol capsules ip 0.25 mcg , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , calcium calictrol + zinc , calcium carbonate and vitamin d3 tablets elemental calcium 500 mg, vitamin d3 250 iu calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp , capecitabin 500mg , capecitabine 500 mg tab , carbamazapine 200mg , carboxymethylcellulose sodium lubricant eye drops 0.5.5% , carvidilol 3.125mg , cefadroxil 125mg dt , cefadroxil 250mg dt , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefpodoxime dispersible tab 50 mg , cefpodoxime+clav acid 250 tab , cefpodoxime+clav acid 500 tab , cefuroxime 500 mg tab , cefuroxime axetil tab ip 250 mg , cefuroxime+clav acid tab , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , cephalexin tablets 125 mg ( dispersible tablets ) , cepodoxime +clavunic acid , cepodoxime 100mg , cepodoxime 200mg , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , cetirizine syrup ip 5mg / 5 ml , cetirizine tab ip 10mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cevverix ( cervical canccs ) , chiken pox ( varilix / biovac v ) , chloramphenicol+dexamethasoinbe eye ointment , chlordiazepoxide tablets ip 10mg , chlorhexidine gluconate solution 5% , chlorhexidine mouthwash ip / bp 0.2 o / o , chloroquine phosphate suspension ip 50 mg / 5ml , chloroquine phosphate tab. ip 250mg ( eq to 155 mg of chloroquine base ) ( film coated ) , chlorpheniramine maleate tab ip 4mg , chlorprocaine 50mg , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , cholecalciferol granules 60, 000 iu / gm , cinnarizine tablet ip 75 mg , cinnarizine tablets ip 25 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , ciprofloxacin eye drops 0.3 o / o w / v , ciprofloxacin opthalimic ointment 0.3% , ciprofloxacin tablet ip 500 mg film coated , ciprofloxacin tablets ip 250 mg film coated , clindamycin capsule ip 300 mg , clindamycin phosphate gel usp 1 o / o , clindamycin+adaplane cream , clinidine 10 mg , clobazam 5mg , clobetasol propionate cream 0.05 o / o , clomifene citrate 50 mg , clonazepam 0.5mg , clonazepam tab ip 1 mg , clonazepam tab ip 1 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , clopidogrel tab ip 75 mg , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab 500mg , coaltar 45+ketaconazole 2% shampoo , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , coug syp dextrometharphen , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cream eberconazole , cream itraconazole 1% , cream vit e+sea butter oil , critanitone+hydrocortisone 1% cream , crotamitone lotion , cyclopentolate eye drop , danzol 50mg , deflazacort 6mg , dental gel choline salicylate+benzalkonium+lignocaine , desmide gel , desvenlafaxin 50mg , dexamethasone tab ip 0.5 mg , dha drops , diclo+para+serra , diclo+serra , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5.5% , diclofenac sod + paracetamol tablets diclofenac sod 50 mg + paracetamol 325 mg , diclofenac sodium tab ip 50 mg ( enteric coated ) , diclofenc supposter , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , dicyclomine hydrochloride and activatd dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activatd dimethicone 40mg , dicyclomine oral solution , dicyclomine tab ip 10 mg , diethylcarbamazapine tab , digoxin tab ip 0.25 mg. , diltiazem gel , diltiazem tabs ip 30 mg film coated , dinoprostone vaginal pessasary 10mg , domperidone oral drops 10mg / ml ( 10ml ) , domperidone suspension 5mg / 5ml , domperidone tab ip 10 mg , dorazolamide eye drop , doxycycline cap ip 100 mg , doxylamine plus tab , drop anticold , drop iron folic 2mg / ml , drop mefenemic acid , drop vit d , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , drotaverine tab 40 mg , dulcolex suppository , dulexitine 20 mg , duolin respules , ear drop oflox+clotrimazole+beclomethasone , enalapril maleate tab 10 mg , enalapril maleate tab ip 2.5mg , enalapril maleate tab ip 5mg , erlotinib 150mg , escitalopram tab ip 10 mg , esmoprazole tab , etizolam 0.5mg , etoricoxib 90 mg tab , etoricoxib tab ip 120mg , etoricoxib tab ip 60mg , etoricoxib+thiocolchicoside 4mg , famotidine tab ip 20 mg , famotidine tab ip 40 mg , febustate 80mg , femitral plus budesonide 200 / 400 rotacap / inhaler , femitral plus fluticasone250 / 500 rotacap / inhaler , fenofibrate capsules ip 200 mg , fentanyl patch 25, 50mg , fenticonazole cream , ferrous sulphate with folic acid tab ( paediatric ) each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , ferrous sulphate with folic acid tab.each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , flavoxate tablets 200 mg , fluconazole 200mg , fluconazole 50mg dt , fluconazole eye drops 0.3% , fluconazole tablets / capsules ip 150mg , fluoxetine cap ip 20 mg , flupenthixol 1 mg , flurbiprofen sodium ophthalmic solution usp 0.03 o / o w / v , fluromethasone+neomycin eye drop , fluticalone furoate nasal spray , fluvoxamine 50mg , folic acid tab ip 5 mg , foracort 12 mg fort respules , foracort 400 respules , formaldehyde solution ( 34.5 per. 38 per. ) , formalin tab , framycetin 1%cream , frusemide 40 +ameloride 10mg , frusemide tab ip 40 mg. , fusidic acid cream ip 2% , gabapantin 100mg , gabapantin 300mg , gabapantin 300mg+mecobalamin , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , geftinib250mg , gemcitabine for injection 200 mg , gingikobiloba , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg , glibenclamide tab ip 5 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , gliclazide tab ip 40 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) , glipizide tab ip 5mg , glucosamine+diacerin , glycerin ip , glycerin supplostery , glycopyronium 50mg rotacops , griseofulvin 250mg , gum paint ( tannic acid+cetrimide+zinc chloride ) , hmf sachet ( human milk fortifier ) , homatropine eye drop , hpmc eye ointment , hydrochlorthiazide tab ip 12.5 mg , hydrocortisone 1% cream , hydroquinone 2% cream , hydroquinone2%+tretinoin+fluticasonre oint. , hydroxychloroquine sulphate tablets 200mg , hydroxyurea 500mg cap , hydroxyzine tab ip 25 mg , hyoscine butylbromide tab 10mg , ibu+para suspension , ibuprofen and paracetamol tablets ibuprofen 400 mg+paracetamol 325 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , imatinib 400mg , imipramine 75 mg tab , indomethacine cap 25mg , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , ismn 30, 60mg , isoflurane usp , isosorbide mononitrate tabs ip 20 mg , isotretinoin 10mg , isotretinoin 20 mg , isoxsuprine tab ip 20 mg , itraconazole 200mg cap , itraconazole 400mg , itraconazole cap 100 mg , itraconazole+terbinafine , iver mectin 12 mg , ivermectin 4% cream , ivermectin 6 mg , ivermectin shampoo , ivermectin soap , ketaconazole 200mg , ketoconazole cream 2% , ketoconazole soap , kojic acid+vit.c cream , l arginine sachet , labetalol tab ip 100mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , lancets , laxative supppository , leflunomide tablets 10mg ( film coated ) , leflunomide tablets 20mg ( film coated ) , letrozole 2.5 mg , levetiracetam 500 , levodopa and carbidopa tab 100 mg and 10 mg , levofloxacin 500mg tab , levofloxacin tablets ip 250 mg , levosalbutamol+ipratropium bromide respirator solution , lignocaine gel ip 2% , lignocaine+zinc oxide+steroid gel , linezolid tablets ip 600 mg , liquid parrafin ip , lisinopril tab 2.5 mg , lisinopril tab ip 5 mg , livamisole 150mg , loperamide tab ip 2 mg , lorazepam tab , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , loteprednolol eye drop , lotion permethrin , loxicard spray , lsolyte p 10% , lulicaonazole cream 10 gm , luliconazole cream , luliconazole lotion , lycopene plus cap , medroxyprogesterone acetate tablets ip 10 mg , mefloquine tablets ip 250 mg , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin tab ip 500 mg ( film coated ) , methotrexate tab ip 2.5 mg , methyl prednisolone 8 mg , methylcobalamine 1500mg tab , methylcobalamine 500mg tab , methyldopa tab ip 250mg film coated , methylergometrine tab ip 0.125 mg , metoclopramide tab ip 10 mg , metoprolol succinate extended release tablets usp 50 mg , metoprolol tablets ip 25 mg , metronidazole and norfloxacin suspension 100 mg + 100 mg per 5ml , metronidazole tablets ip 400 mg , miconazole nitrate cream 2% , micronized progestrone orall / veginal / rectul 200mg , minoxidil 10% , misoprost 600mg , misoprostol tab 200 mcg , moisturising soap , momentasone cream , momentasone nasal spray , montelukast +fexofenadine , montelukast+levocetrizine tab , moxifloxacin eye drop , multivitamin cap , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , mupirocaine 2% cream , nabivilol , naproxen 500mg , nasal drop botroclot , neomycine ointment , neomycine powder , neomycine+bacitracin ointment , neosporin powder , neosporin+sulphacetamide oint. , nephazoline+hpmc+cpm eye drop , netamycine eye drop , nicotex patch 7 / 14 / 21 mg , nifedipine gel , nikorandil 5mg , nitrofurantoin tab ip 100mg , norethisterone tab ip 5 mg , norfloxacin tab ip 400mg film coated , ntg 2.6 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin suspension , ofloxacin tab ip 200 mg , ofloxacin+betamethasone eye drop , oint. soframycine , oint.clobetasol+salicylic acid , oint.traimciclolone , olanzapine tab ip 5 mg , olanzipine 5mg , olapatadine +ketorolac eye drop , olmesartan 25mg , olmesartan 50mg , omega 3 fatty acid , omeprazole cap ip 20 mg , omocroptine 1mg , ondansetron orally disintegrating tablets ip 4mg , opipramol 50mg , ormeloxifene 60mg , ors powder ip , pantoprazole 40mg and domperidone 30mg sr cap pantoprazole as enteric coated pellets and domperidone as sr pellets , paracetamol 625 tab , paracetamol drops ( paracetamol syrup ip ) ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracine eye drop , pazopanib 400mg , pcm suppostery , penicilin g , perindoprine , permethrin cream 1% , permethrin cream 5% , permethrin lotion 1% , permethrin soap , phenytoin 100mg , pilocarpine eye drop , pioglitazone tab ip 15 mg , podophylin 20% resin solution , povidine iodine 5% 100 ml , povidone iodine 10% / 100ml sol , povidone iodine gargle , povidone iodine ointment 5% , powder clotrimazole , powder fluconazole , powder ketaconazole , powder terbinafine , ppd 5 tu , prednisolone 20 / 40 / 60mg , prednisolone acetate eye drop , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , pregabalin cap ip 75 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , progestron 100 mg , progestron 300 mg , promethazine tab ip 25 mg , propracaine eye drop , propranolol 10mg , propranolol tab ip 40 mg , protion powder 200gm , pyridoxime , ramipril 5+metoprolol 50 mg xl , ramipril tablets ip 2.5 mg , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , ranolazine 500mg , resperidone 2mg , revaroxabain 10 mg , roflimulast 500mg , rosuvastatin 10mg , rosuvastatin 20mg , rosuvastatin 40mg , salbutamol inhaler , salbutamol nebulizer sol. 5mg / .ml , salbutamol syrup ip 2mg / 5ml , salbutamol tablet ip 4 mg , salicylic acid 12% cream , salicylic acid 17.3%+lactic acid 17.3% cream , salicylic acid 3% cream , salicylic acid 6% cream , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , seerrratiopeptidase 20mg tab , serratiopeptidase 10mg tab , sertaconazole cream 1% , sertraline tab 50 mg , shampoo ketaconazole+zpto , sildinafil 20 mg tab , silversulphadiazine cream , sitagliptin , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , sodium valporate 500mg , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet 200 mg ( enteric coated ) , solution minoxidil 2% , solution minoxidil 5% , sorafenib200mg , spironolactone 50 mg tab , sunscreen lotion , surgical spirit 100ml , syp ambroxol+terbutaline+levosalbutamol , syp artemether+lumefantrine , syp azithromycin 100mg , syp cefixime 50mg , syp cepodoxime 100mg , syp cepodoxime 50mg / ml , syp cpm+dextro+phenylephrine , syp diclomine + pcm , syp digoxin , syp erythromycin 125mg / 5ml , syp levosalbutamol 1mg / sml , syp mct oil ( mediw chain triglycenide ) , syp mefenamic acid 100mg / 5ml , syp mefenamic acid+pcm , syp mom plus , syp nevirapin , syp ofloxacin , syp ofloxacin oz , syp phenobarbitone 20mg / 500ml , syp promethazine+pcm , syp sucralfate , tacrolimus 0.03%cream , tacrolimus 0.1% cream , tacrolimus lotion 0.1% , tamoxifen 10mg , tamsulosin hcl tablets 0.4 mg , telmisartan tablets ip 40 mg , temozolovide 100mg , teneligliptin 20mg , tenozolomide 200mg , terbinafine 250mg , terbinafine 500mg , terbinafine cream 1 % , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline ip 77 mg ) , thiamine 100mg , thiocolchicodide 4mg , thiocolciside 8 mg , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , timolol eye drop 0.5% , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , tiotropium 9 / 18 mg rotacaps , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycine eye ointment 0.3% , tofisopam 50mg , tooth gel sodium monoflurophosphate+pottasium nitrate , torsemide tab 10 mg , tramadol cap 50 mg , tramadol+pcm , tranexamic acid tablets 500 mg , travoprost eye drop , tretinoin .025%% cream , triamcinololone acetomide oral paste , triamcinololone acetonide 10mg tab , triamcinololone acetonide 40mg tab , trichloroacetic acid 30% , trihexiphenidyl 2mg , tropica plus eye drop ( tropicamide+phenerimine ) , trypan blue soluation .06% , trypsin + cymo trypsin tab , trypsin + rutotoside , urea lactic acid cream , ursodeoxycholic acid tablets 300 mg , vallsartan 100mg , valsartan 50mg , velcyclorver 1 gm , vericonazol , vilazodone 40mg , vit c , vit e 400 mg , vit.a 25000 iu , vit.d+e , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , white soft parrafin liquid parrafin , xylometazoline nasal drops ip 0.1% , zinc sulphate 50mg , zoledronic acid 4 mg inj. , syp caffeine citrate , glycerine suppositiry , fluconazole 200mg tab , syp sildenafil , savlon 100ml , paracain eye drop , cyclopentolate eye drop , prazoxamide eye drop , syp hydroxyzine , syp prednisolone , syp montas l , syp phenobarbitone 20mg / 500ml , syp azee 200ml , diazepam rectal , diazepam oral syp , pretermmilk formula , erythromycine drop , dha syp , fexofenadine syp , fexofenadine tablet , griseofulvin 125mg tab , syp sodium picosulphate , tab telma +amlo , tab telma h , tab atorva+fenofibrate , tab apixaben2.5mg , tab apixaben5mg , tab rivaroxaben10mg , tab febusrate 40mg , tab voglibose 0.3mg , tab voglibose 0.2mg , tab carbimazole 10mg , tab sitagliptin 50mg , tab sitagliptin+metformn , tab vidagliptin+metformin , tab escitalopram+propranolol , tab propranolol+alprazolam , tab nilazoxamide200mg , pulvis isapgol husk , tab triflurazine 1mg , tab rifaximine 400mg , tab n acetylcestine 600mg , tab acebrophyline + nac600 , tab methylprednisolone 8mg , tab methylprednisolone 16mg , tab clinidium+chlordiazepoxide , tab triflurazine+chlordiazepoxide , syp pcm , syp diclo , diclo suppository , valcyclovir tab 1gm , tab aripiprazole 5mg , tab vilazodone 20mg , tab propranolol+etizolam0.5mg , tab posaconazole 100mg , fluticasone +azilastin nasal spray , cap lycopene+mv , syp sodium picosulphate+liq.parrafin+mom , glycerine nitrate ointment , alkaline nasal wash solution , inj sodium valporate 500mg , tab thiocolchicoside 8mg , tab calcium+l carnitine , drop dicyclomine , drop mv , surgical item and others , adhesive tapee 1 / 2 ( durapore ) , 26 g cannula , abdominal belt alll sizes , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdomonal belt , absorable hemostates ( surgicel ) , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size3 / 0 1 / 2 rb 20mm, suture lenth 70mm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid / glycolid co lactide ) size2 / 0 1 / 2rb 20mm, suture lenth 70mm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbent cotton wool ip 500 gm , accepto syringe , adhesive tape 1 ( durapore ) , adhesive tape 2 ( durapore ) , adult diaper , ankle binder , arm pouch sling , b p cuff , baby diaper s, m, l , bain circuuit , bandage 10cm , bandage 15cm , bandaid , barbur thred , bed pan , biopsy container 1 kg , biopsy container 1 / 2 kg, 1 kg , bipap mask , bipap tubing / hose pipe , black google , blood administration set blood transfusion set ( details in rc ) , blood sugar glucometer withstrip ( sd code free ) , blood sugar strip ( 64765 ) free style optium h , blue dye , bone wax sterilised , bongic , bougie singal use , breast pump , buprenophine patch 10mg , buprenophine patch 5mg , c arm cover , cannula fixer , catheter for urinary drainage size 8 to 16 , cautry plate , cental line double lumen , central linetriple lumen , central line single lumen , chest tube with trachor , ciling drape , clavical brace s, m, l , clear sole inj ( rl glass bottle ) , clostomy bag / ileostomy bag , combined spinal epidural kit , comet spinal needle no. 18 / 16 , condom catheter , corrugated drainage sheet all sizes ( details in rc ) , corrugated rubber drain ( crd ) , cp geel , crepe bandage 2 , crepe bandage 4 , crepe bandage 6 , cresant eye blade , cutting burr , cvp manometer , delivery safety aprin , derma film , diagnostic sticks for urine sugar , diamond burr 0 , diamond burr 2 , diamond burr 4 , diamond burr 6 , diamond burr 8 , digital thermameter , dispo needle 16 , dispo needle 18 , dispo needle 22 , dispo needle no. 24 , dispo needle no. 26 1 / 2 , dispo razor blade , disposable o drape , disposable u drape , disposable aprin , disposable cautry plates , disposable cpap circuits , disposable drepping , disposable gown , disposable sheet , disposable sterile surgical rubber gloves size 6.5 inches ( details in rc ) , disposable sterile surgical rubber gloves size 7 inches ( details in rc ) , disposable sterile surgical rubber gloves size 7.5 inches ( details in rc ) , disposable sterile surgical rubber gloves size 8 inches ( details in rc ) , disposable syringes 1 ml , disposable syringes 10 ml , disposable syringes 2 ml , disposable syringes 20 ml , disposable syringes 5 ml , dispovan 50ml romsons , dj stent with guide wire , double lumen octopus with 2 binectons&clamps , durapore 1 , dyanoplast 4 ( inch ) , ecg electrode new born baby , ecg electrods , eliostomy beg , endo gi stappler with cartridge , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, plain size 2.5 ( details in rc ) , endotracheal tube, plain size 3 ( details in rc ) , endotracheal tube, plain size 3.5 ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 7 ( details in rc ) , endotracheal tube, plain size 7.5 ( details in rc ) , endotracheal tube, plain size 8 ( details in rc ) , endotracheal tube, plain size 8.5 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , enlarger blade 5.1 mm eye blade , epicath picc line 28fr , epidural kit , eusol solution , eye drape sheet , eye hand blade , eye incison blade , face mask, disposable ( details in rc ) , face shild , feeding tube no.6 , fibrin ( ear ) glue ( torseal ) , finger cot split , flatus tube , flexometalic et tube , flow regulator , fogarty catheter , foldable intra ocular lense with injector , foley catheter 12, 14, 16 , follops ring , g dress20 , g dress 10 , g dress 15 , g dress 20 , g dress 25 , g dress 30 , g dress 5 , gauze than 400gm , gel foam , gigli saw , glucometer optium h , green theraband , grommets of all sizes , guedel airways , halothane bp , hand sanitizer 500ml , hfnc catheters , hi flow mask , high concentration mask , high flow nasal canula all colours , hip u drape , hiv / hbsag safe delivery kit , hme filter , hot water bottle , i gel all sizes , i v canula 26 no. , i v set. , identification tag of neonatal size , incise drape iodine impregated different size , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infant feeding tube size: 1ofg, 8fg, 5fg ( details in rc ) , infrared thermometer , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , ioben 6640 , ioben betadine , iv cannula 26 g , j r circuit pedia , jelonet , johnson buds 30s , k 90 cathetor , ketone strip , knee brace , knee brase , knee cap , knee cap xl , koratome 2.1 mm eye blade , koratome 2.8 mm eye blade , lab pad , laproscopic hernia tracker , leader flex ( lorg dive ) 22g 2fr 4cm , liga clip 200 , liga clip 300 , liga clip 400 , lma all sizes , long taper diamond barr , longline axillony 45cm , longline femoral 75cm , loprescope mesh 15 x15 , makintosh rubber sheet , malecote catheter 28, 30, 32 , maro cel , mayo vein strippe , medicath 18 / 20 / 22 , metallic tracheostomy tube 30, 32, 34 , micropore , miph gun , moxi flozenie ( vigamox ) , mucus extractor sterile , nasal cannula adult , nasal dressing pack , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , nasal packing 4.5cms 400409 , nasal packing 8 cms 400402 , nasal packing 8cms airway 400405 , nasal prong , nebulization kit , nebulization mask , nebulizer machine , neck line , neonatal urine collectting bag , neonataldisposable ventilator circuits with dispos.humidifier chamber , neotamic enema , niv mask , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , ns 2 ltr glass bottle , orthoroll 50gm , oxygen hood , oxygen mask ( adult ) , oxygen mask ( pdeatric ) , oxygen recovery kit , oxygen regulator , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , pencil cautry , perfusion set ( infusion set ) with airway and needle ( paediatric use ) ( details in rc ) , perifencal catheter ( pediatrics ) l 20cm, 12fr , picc line 24, 26, 28 fr , plain sheet large , plain sheet small , plaster of paris bandage 10cm x 2.7mts , plaster of paris bandage 15cm x 2.7 mts / roll , plastic transparent sheet , plater of paris powder 50 kg , pmo line , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , pouch arm sling , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , ppe kit , premicath picc line 28fr , premicath picc line no.26 and 28 , pressure monitoring line / high pressure extension line ( details in rc ) , provox , puls oxymeter , red rubber catheter size 8.10, 12 , reservoir bag adult 1 lt. , reservoir bag adult 1.5 lt. , reservoir bag adult 2 lt. , respirpometer , romovac set 14 / 16 n0. , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves, size small ( details in rc ) , rubber shoes cover , ryles tube / nasogastric tube size: 10 ( details in rc ) , ryles tube / nasogastric tube size: 12 ( details in rc ) , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , ryles tube / nasogastric tube size:14 ( details in rc ) , s.s.g knife ( dawn blade ) , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , sanitizer 100 ml , savlon 100 ml , scalp vein set ( disposable ) size 18g ( details in rc ) , scalp vein set ( disposable ) size 20g ( details in rc ) , scalp vein set ( disposable ) size 22g ( details in rc ) , scalp vein set ( disposable ) size 24 g ( details in rc ) , shoulder immobilizer , side port eye blade , silk suture 40&30 with cutter , silling dress , skin graft knife blade ( sterile ) & handle ( details in rc ) , skin stapler , skin traction set , slow diclofenac tablets bp / diclofenac sodium extended release tablets usp 100 mg ( sustained release ) / diclofenac prolonged release tablet ip 100mg , sono jelly , spinal needle all sizes , stapes piston size 0.6mm ( teflon ) , stayfree pad , sterile catheter for urinary drainage ( foley balloon catheter ) , 2 way, size 10 ( details in rc ) , sterile catheter for urinary drainage ( foley balloon catheter ) , 2 way, size 18 ( details in rc ) , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size16 ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable infusion set with microdrip ( i.v. ) ( details in rc ) , sterile disposable perfusion set with airway and needle ( adult use ) ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , sterile gauze , sterile hypodermic syringe with needle attached, 22g, single use 10 ml ( details in rc ) , sterile hypodermic syringe with needle attached, 22g, single use 20 ml ( details in rc ) , sterile hypodermic syringe with needle attached, 24g, single use 2 ml ( details in rc ) , sterile hypodermic syringe with needle attached, 24g, single use 5 ml ( details in rc ) , sterile swab , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , sterllium 500 ml , stokinet 1.5m*8 , stokinet 1m*6cm , streptokinase injection 15 lac units , stylet , succinylcholine inj. ip 50 mg / ml ( iv use ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , suction catheter, sterile. size: f g 24 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , suction connector , suction tip , sugar strip caresons , surfactant for ( pre term babies ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , surgical mask , suti pan , suture 10 0 ( ethylene ) , suture 8 0 ( ethylene ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , swine flu mask n 95 , t piece , t tube 10 no. , t tube 12 no. , t tube 14 no. , tegaderm , three way adaptor , thumb spica , thumb support , torp porpseptoplast ( splints ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , tracheostomy tube ( portex with cuff 7, 7.5, 8 ) , tracheostomy tube, plain all sizes ( details in rc ) , trop t kit , tungeston burrr 0 to 8 , turp set , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , umblical catheter all size , underwater seal drain , universal sholder immulizer , upt kit , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , urine container sterile , urine ketone test strip , urine pot , uroflow meter , vaccume sucction tube , vaporizer machine , vein o line 10 cm , vein 0 line 150 cm , ventilator circuit , zommed grommet , octopus three way , octopus two way , dettol 200ml soap liquid handwash , leaderflex long line , bionectar , ventilator circuit pedia with heat wire , c pap bubble circuit , humedified high flow nasal cannula circuit , hhfnc optiflow red , hhfnc optiflow yellow , hhfnc optiflow blue , ecg electrode infant pedia , suction connection tube , iol foldable all powers 3000 , iol pmma , ac iol all powers , foley catheter 10 no. , cannula ptef 26no. , picc line 4fr , picc line5fr , cvc 4 fr , cvc 4.5 fr , cvc 5 fr , nasal prong pedia , nasal prong adult , nrbm pedia ( non rebreathing mask ) , oropharyngeal airway , hme filter bacterial , hme filter viral , kangaro care sling bag , soflene adhesive tape , intercostal drainage tube 24no. , intercostal drainage tube 28no. , intercostal drainage bag , cannula fixator , flexometalic et tube 6 to 7.5 cuffed , mls et tube 5, 5.5 cuffed , maggile forcap , neb t kit , close suction set , north pole et tube 6 to8.5 cuffed , south pole et tube 6 to 8.5 cuffed , proceal lma 3.0 , proceal lma4.0 , proceal lma5.0 , classic lma 1 to 5 no , pop bandage 6inch , pop bandage 4 inch , synthetic cast bandage 4 inch , synthetic cast bandage 5 inch , synthetic cast bandage 3 inch , softroll 4 inch , sofftroll 6 inch , compressed cotton rolll for plaster 4 inch , compressed cotton rolll for plaster 6 inch , iodine impregnated incise drape small around 15*10 , iodine impregnated incise drape medium around 20*20 , iodine imppregnatedincise drape large 20*30 , iodine impregnate incise drapearound 30*40 , skin traction set adults , skin traction kit kid , skin traction kit dunlop , skeletal traction kit , ssg knife blade , u drape , o drape , ls belt all size , silicon cusgioned heel , tennis elbow all size , long knee brace all size , cervical collar , linarand circular stapler with cartridge , glucometer dr morepen , glucometer dr morepen strip , glucometer caresens , glucometer caresens strip , glucometer accu sure , glucometer accu sure strip , bp instrument , laproscope warsher 10mm, 5mm ports , miph stapler , ipom mesh , nitrpous regulator , eto gas regulatorr , eto packing roll 10cm , eto packing roll 20cm , eto packing roll 30cm , amino acid bagfor parentral nutrition ( parentral nutrition ) , vein striper for varicose vein , urobag with flowmeter , forgaty catheter , enseal probe laproscopic compatable for eticon device , 24 hormonic probe ( compatable foreticon device 5mm laproscopic , debridder blades ( straight / rad 40 / rad 60 ) , coblator wands ( pro max ) , ear suction cannula , nasal suction , injectable , 5 fluorouracil inj 250mg / 5ml , acetylcystine solution usp ( injection ) 200 mg / ml , actrpid , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , adenosine 6mg / 2ml inj. , adrenaline injection ip 1mg / ml im / iv use , alamine inj , albumi 20% , albumin 10% , alpha beta artether inj , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , aminophylline inj ip 25 mg / ml , aminovain 100ml , aminovein 250 ml , amiodarone hydrochloride inj 50 mg / ml , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amphoteriricin b 50mg , ampicillin injection ip 500 mg , aq.diclofenac sodium inj ( dynapar aq ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , artracil 2.5 ml inj , arv , atropine sulphate injection ip 0.6 mg / ml ( sc / im / iv use ) , betamethasone sod phos inj ip 4mg / ml , bhcg 10000 iu inj. , bhcg 2000 iu inj. , b hcg 5000 iu inj. , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bleomycin 15 unit inj. , botroclot inj , botrophase inj. , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , butadol 1 ml inj. , caffeine citrate inj , calcium gluconate inj ip 10% ( iv use ) , carbolic acid 500ml bottle , carboplatin 150mg , carboplatin 450mg , carboplatin injection 150 mg , carboplatin injection 450 mg , carboprost tromethamine injection each ml contains carboprost 0.25 mg / ml , carpinol inj , cefipime 250mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , ceftrixone + sulbactam 1.5 gm inj. , chiken px ( varilix / biovac v ) , chlor procaine , chloroquine phosphate inj ip 40 mg / ml , ciprofloxacin injection ip 200mg / 100ml , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clonidine inj. , colistin , collin sulphate 10 miuinj vit d 3l / 6l , compound sodium lactate inj. ip , corbolic acid 500 ml bottle , crystalline penicilline , cyclophosphomide 200mg , cyclophosphomide 500mg , cytarabine inj ip 100mg / ml , dd 50 inj ( nandrololone ) ) , decarbazine 500mg , depomedrol 1ml , dexamethasone inj ip 8mg / 2ml , dexmedetomidine 100 mcg inj , dexmedetomidine 200 mcg inj , dextomid 1 ml inj , dextrose 5% 500ml ( d 5 ) , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% isotonic , diclofenac aq. , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , dicyclomine inj ip 10 mg / ml , digoxin inj ip 0.25 mg / ml , diltiazem , dobutamine inj 50mg / ml , dopamine hydrochloride inj 40 mg / ml , doxorubicin 50 mg inj. , drotaverine hydrochloride inj 40 mg / 2 ml , elderviit , enoxaparin sodium inj ip 60 mg ( lmwh ) , epirubicin 10mg , esmolol , et co2 samle lime , ethamsylate inj 250 mg / 2ml ( im / iv ) , etomidate 10 ml inj , etomidate inj 10mg , etoposide 100mg inj , fentanyl , fentanyl patch , fluconazole 100ml bottle , furosemide injection ip 10mg / ml ( im and iv use ) , gcsf 300 ug , gemcitabine 1gm , gemcitabine 200mg , gemcitabine for injection 1gm , gentamycin injection ip 80mg / 2ml ( im / iv use ) , glargin , gluteraldehyde solution 2% , glycopyrrolate + neostrogemin inj usp 0.2 mg / ml , glycopyrrolate inj usp 0.2 mg / ml , haloperidol , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis a ( havarix / biovac a ) , hepatitis b 1ml , hepatitis b immunoglotonlis 100 iu , hepatitis b ( hbig ) , heplock , human albumin inj 100ml , human anti d immunoglobulin injection 300mcg ( im use ) , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyprogesterone inj ip 250mg / ml , hyoscine inj ( buscopan ) , ifosfamide injection usp / bp 1gm , imunoglobulin 10gm , imunoglobulin 5gm , indomethacin , inj bevacizumab 100mg , insulin inj ip 40 iu / ml , ipv ( imovax / polio vac / polproket ) , iron ferric carboxymaltose 100mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , irrigation solution 500ml , iso p forte 10% , isolyte p 10% , isolyte p 500 glass bottle , isoprenaline injection ip 2mg / ml , kcl , ketamine inj ip 50 mg / ml , labetalol hcl inj ip 20mg / 4ml , lantus insulin , l asparaginase inj 10000 iu , leucovarin 15mg , levitiracetams , levo bupivacaine , levofloxacin 100ml , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% inj. , linazolid 300ml , linezolid inj 200mg / 100ml , lorazepalm , lorazepam inj 2mg , lox +adr inj , lox 4 % topical , lox spray , loxicard 2 % inj , loxicard 2% 50 ml , lsolyte p 10% , magnesium sulphate inj 50mg / ml ( 50% w / v ) , mannitol inj ip 20% w / v 100 ml , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml , mecobalamin inj 1000 mcg / ml , meropenem inj ip 500 mg , meropenem inj. ip 1gm , methotrexate 50mg , methotrexate inj ip 50 mg / 2 ml , methyl prednisolone sodium succinate for injection usp 500 mg , methyl prednisolone sodium succinate inj 80 mg , methylergometrine inj ip 0.2 mg / ml , metoclopramide inj ip 10mg / 2ml , metronidazole inj ip 500 mg / 100ml , milrinol , mitomycin 10mg , mixtard , mizolam 10 ml inj. , mmr ( tersivac ) , morphine , mucus extractor sterile ( details in rc ) , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , mvi inj , myoril ( thiocolchicoside ) , n.s 0.45% 500ml , naloxone , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , ns 100ml , ns 3 ltr , code free gluco strips , ns 3% 100ml , octreotide injection 50 mcg / ml , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin suspension 50mg / 5ml , omnidase inj , omnipaque , omniscan , ondansetron inj ip 2mg / ml , oxaliplatin 50 mg inj. , oxytocin inj ip 5 iu / ml , paclitaxel 260mg , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , palanosetron inj , pantazocin inj 30mg / ml , paracetamil inj 100ml , pemetrexed 100mg , pemetrexed 500mg , penidura la , pentoprazole inj 40 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone , phenytoin injection 50mg / ml , pilocarpine inj. , piperacillin + tazobactum for injection usp 4gm+500mg , pneumococcal ( synflorix / prevnav ) , polidoconol , potassium chloride inj. 0.15 gm / ml , pralidoxime chloride injection ip 25 mg / ml , prochlorperazone 5mg , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , propofol inj ip 10 mg / ml , quinine dihydrochloride inj 300 mg / ml , r l 500 ml glass , rabies vaccine human ip 2.5 iu , ranitidine hcl injection ip 50mg / 2ml , ringer acetate inj. 500 ml ( glass bottle ) , ringer lactate 500ml ( rl ) , rituximab 100mg inj , rituximab 500mg , ropivacaine 0.75 % 20 ml , rotavirus ( rotarix / rotateg ) , sensocaine inj , sevflurane / isoflurane , sevoflurane , sildinafil inj , soda lime medical grade , sodium bicarbonate inj ip 7.5% w / v , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium valproate inj 100 mg / ml , streptokinase 15 lac unit inj , succinylcholine 50mg / ml inj , taxim 500 inj , termin 10 ml inj. , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetrahes / voluven ( starch ) , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , thiocolchicoside 4mg , torsemide , trace elements ( celecil ) , tramadol inj 50 mg / ml , trastuzumab 440mg , trenaximic acid inj. , triamcinololone acetonide 10mg inj , triamcinololone acetonide 40mg inj , typhoid ( pcv typh bar / typhim vi ) , vancomycin 250mg , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , varicella zoster ( vzig ) , vassopressin , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil2.5 mg inj , vinblastine 10mg / 10ml inj , vincristine inj1mg / ml , vitamin a 40000 / ml , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) 1mg / 0.5ml injection ( detail in rc ) , vitcofol , vitcofol c , water for inj ip , zoledronic acid 4mg inj , distill water 5 ltr , inj terlipressin , mannitol 350ml , anti snake venom , anti scorpion venom , inj penidura la 6lac u , inj hbig 200iu , aminovain inj 10% , indamethasone inj , inj nac 600 , inj lorthinine +l asparginase , inj benzathine penicilin g 2.4lac , inj rocuronium , inj ropin 0.2% , inj nalbuphine10mg , pcm inj 150mg , pcm inj30mg , inj.polidoconal , inj d 125 , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , suction catheter, sterile. size: f g 24 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , suction connector , suction tip , sugar strip caresons , surfactant for ( pre term babies ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , surgical mask , suti pan , suture 10 0 ( ethylene ) , suture 8 0 ( ethylene ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , swine flu mask n 95 , t piece , t tube 10 no. , t tube 12 no. , t tube 14 no. , tegaderm , three way adaptor , thumb spica , thumb support , torp porpseptoplast ( splints ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , tracheostomy tube ( portex with cuff 7, 7.5, 8 ) , tracheostomy tube, plain all sizes ( details in rc ) , trop t kit , tungeston burrr 0 to 8 , turp set , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , umblical catheter all size , underwater seal drain , universal sholder immulizer , upt kit , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , urine container sterile , urine ketone test strip , urine pot , uroflow meter , vaccume sucction tube , vaporizer machine , vein o line 10 cm , vein 0 line 150 cm , ventilator circuit , zommed grommet , octopus three way , octopus two way , dettol 200ml soap liquid handwash , leaderflex long line , bionectar , ventilator circuit pedia with heat wire , c pap bubble circuit , humedified high flow nasal cannula circuit , hhfnc optiflow red , hhfnc optiflow yellow , hhfnc optiflow blue , ecg electrode infant pedia , suction connection tube , iol foldable all powers 3000 , iol pmma , ac iol all powers , foley catheter 10 no. , cannula ptef 26no. , picc line 4fr , picc line5fr , cvc 4 fr , cvc 4.5 fr , cvc 5 fr , nasal prong pedia , nasal prong adult , nrbm pedia ( non rebreathing mask ) , oropharyngeal airway , hme filter bacterial , hme filter viral , kangaro care sling bag , soflene adhesive tape , intercostal drainage tube 24no. , intercostal drainage tube 28no. , intercostal drainage bag , cannula fixator , flexometalic et tube 6 to 7.5 cuffed , mls et tube 5, 5.5 cuffed , maggile forcap , neb t kit , close suction set , north pole et tube 6 to8.5 cuffed , south pole et tube 6 to 8.5 cuffed , proceal lma 3.0 , proceal lma4.0 , proceal lma5.0 , classic lma 1 to 5 no , pop bandage 6inch , pop bandage 4 inch , synthetic cast bandage 4 inch , synthetic cast bandage 5 inch , synthetic cast bandage 3 inch , softroll 4 inch , sofftroll 6 inch , compressed cotton rolll for plaster 4 inch , compressed cotton rolll for plaster 6 inch , iodine impregnated incise drape small around 15*10 , iodine impregnated incise drape medium around 20*20 , iodine imppregnatedincise drape large 20*30 , iodine impregnate incise drapearound 30*40 , skin traction set adults , skin traction kit kid , skin traction kit dunlop , skeletal traction kit , ssg knife blade , u drape , o drape , ls belt all size , silicon cusgioned heel , tennis elbow all size , long knee brace all size , cervical collar , linarand circular stapler with cartridge , glucometer dr morepen , glucometer dr morepen strip , glucometer caresens , glucometer caresens strip , glucometer accu sure , glucometer accu sure strip , bp instrument , laproscope warsher 10mm, 5mm ports , miph stapler , ipom mesh , nitrpous regulator , eto gas regulatorr , eto packing roll 10cm , eto packing roll 20cm , eto packing roll 30cm , amino acid bagfor parentral nutrition ( parentral nutrition ) , vein striper for varicose vein , urobag with flowmeter , forgaty catheter , enseal probe laproscopic compatable for eticon device , 24 hormonic probe ( compatable foreticon device 5mm laproscopic , debridder blades ( straight / rad 40 / rad 60 ) , coblator wands ( pro max ) , ear suction cannula , nasal suction , injectable , 5 fluorouracil inj 250mg / 5ml , acetylcystine solution usp ( injection ) 200 mg / ml , actrpid , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , adenosine 6mg / 2ml inj. , adrenaline injection ip 1mg / ml im / iv use , alamine inj , albumi 20% , albumin 10% , alpha beta artether inj , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , aminophylline inj ip 25 mg / ml , aminovain 100ml , aminovein 250 ml , amiodarone hydrochloride inj 50 mg / ml , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amphoteriricin b 50mg , ampicillin injection ip 500 mg , aq.diclofenac sodium inj ( dynapar aq ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , artracil 2.5 ml inj , arv , atropine sulphate injection ip 0.6 mg / ml ( sc / im / iv use ) , betamethasone sod phos inj ip 4mg / ml , bhcg 10000 iu inj. , bhcg 2000 iu inj. , b hcg 5000 iu inj. , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bleomycin 15 unit inj. , botroclot inj , botrophase inj. , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , butadol 1 ml inj. , caffeine citrate inj , calcium gluconate inj ip 10% ( iv use ) , carbolic acid 500ml bottle , carboplatin 150mg , carboplatin 450mg , carboplatin injection 150 mg , carboplatin injection 450 mg , carboprost tromethamine injection each ml contains carboprost 0.25 mg / ml , carpinol inj , cefipime 250mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , ceftrixone + sulbactam 1.5 gm inj. , chiken px ( varilix / biovac v ) , chlor procaine , chloroquine phosphate inj ip 40 mg / ml , ciprofloxacin injection ip 200mg / 100ml , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clonidine inj. , colistin , collin sulphate 10 miuinj vit d 3l / 6l , compound sodium lactate inj. ip , corbolic acid 500 ml bottle , crystalline penicilline , cyclophosphomide 200mg , cyclophosphomide 500mg , cytarabine inj ip 100mg / ml , dd 50 inj ( nandrololone ) ) , decarbazine 500mg , depomedrol 1ml , dexamethasone inj ip 8mg / 2ml , dexmedetomidine 100 mcg inj , dexmedetomidine 200 mcg inj , dextomid 1 ml inj , dextrose 5% 500ml ( d 5 ) , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% isotonic , diclofenac aq. , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , dicyclomine inj ip 10 mg / ml , digoxin inj ip 0.25 mg / ml , diltiazem , dobutamine inj 50mg / ml , dopamine hydrochloride inj 40 mg / ml , doxorubicin 50 mg inj. , drotaverine hydrochloride inj 40 mg / 2 ml , elderviit , enoxaparin sodium inj ip 60 mg ( lmwh ) , epirubicin 10mg , esmolol , et co2 samle lime , ethamsylate inj 250 mg / 2ml ( im / iv ) , etomidate 10 ml inj , etomidate inj 10mg , etoposide 100mg inj , fentanyl , fentanyl patch , fluconazole 100ml bottle , furosemide injection ip 10mg / ml ( im and iv use ) , gcsf 300 ug , gemcitabine 1gm , gemcitabine 200mg , gemcitabine for injection 1gm , gentamycin injection ip 80mg / 2ml ( im / iv use ) , glargin , gluteraldehyde solution 2% , glycopyrrolate + neostrogemin inj usp 0.2 mg / ml , glycopyrrolate inj usp 0.2 mg / ml , haloperidol , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis a ( havarix / biovac a ) , hepatitis b 1ml , hepatitis b immunoglotonlis 100 iu , hepatitis b ( hbig ) , heplock , human albumin inj 100ml , human anti d immunoglobulin injection 300mcg ( im use ) , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyprogesterone inj ip 250mg / ml , hyoscine inj ( buscopan ) , ifosfamide injection usp / bp 1gm , imunoglobulin 10gm , imunoglobulin 5gm , indomethacin , inj bevacizumab 100mg , insulin inj ip 40 iu / ml , ipv ( imovax / polio vac / polproket ) , iron ferric carboxymaltose 100mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , irrigation solution 500ml , iso p forte 10% , isolyte p 10% , isolyte p 500 glass bottle , isoprenaline injection ip 2mg / ml , kcl , ketamine inj ip 50 mg / ml , labetalol hcl inj ip 20mg / 4ml , lantus insulin , l asparaginase inj 10000 iu , leucovarin 15mg , levitiracetams , levo bupivacaine , levofloxacin 100ml , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% inj. , linazolid 300ml , linezolid inj 200mg / 100ml , lorazepalm , lorazepam inj 2mg , lox +adr inj , lox 4 % topical , lox spray , loxicard 2 % inj , loxicard 2% 50 ml , lsolyte p 10% , magnesium sulphate inj 50mg / ml ( 50% w / v ) , mannitol inj ip 20% w / v 100 ml , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml , mecobalamin inj 1000 mcg / ml , meropenem inj ip 500 mg , meropenem inj. ip 1gm , methotrexate 50mg , methotrexate inj ip 50 mg / 2 ml , methyl prednisolone sodium succinate for injection usp 500 mg , methyl prednisolone sodium succinate inj 80 mg , methylergometrine inj ip 0.2 mg / ml , metoclopramide inj ip 10mg / 2ml , metronidazole inj ip 500 mg / 100ml , milrinol , mitomycin 10mg , mixtard , mizolam 10 ml inj. , mmr ( tersivac ) , morphine , mucus extractor sterile ( details in rc ) , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , mvi inj , myoril ( thiocolchicoside ) , n.s 0.45% 500ml , naloxone , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , ns 100ml , ns 3 ltr , ns 3% 100ml , octreotide injection 50 mcg / ml , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin suspension 50mg / 5ml , omnidase inj , omnipaque , omniscan , ondansetron inj ip 2mg / ml , oxaliplatin 50 mg inj. , oxytocin inj ip 5 iu / ml , paclitaxel 260mg , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , palanosetron inj , pantazocin inj 30mg / ml , paracetamil inj 100ml , pemetrexed 100mg , pemetrexed 500mg , penidura la , pentoprazole inj 40 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone , phenytoin injection 50mg / ml , pilocarpine inj. , piperacillin + tazobactum for injection usp 4gm+500mg , pneumococcal ( synflorix / prevnav ) , polidoconol , potassium chloride inj. 0.15 gm / ml , pralidoxime chloride injection ip 25 mg / ml , prochlorperazone 5mg , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , propofol inj ip 10 mg / ml , quinine dihydrochloride inj 300 mg / ml , r l 500 ml glass , rabies vaccine human ip 2.5 iu , ranitidine hcl injection ip 50mg / 2ml , ringer acetate inj. 500 ml ( glass bottle ) , ringer lactate 500ml ( rl ) , rituximab 100mg inj , rituximab 500mg , ropivacaine 0.75 % 20 ml , rotavirus ( rotarix / rotateg ) , sensocaine inj , sevflurane / isoflurane , sevoflurane , sildinafil inj , soda lime medical grade , sodium bicarbonate inj ip 7.5% w / v , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium valproate inj 100 mg / ml , streptokinase 15 lac unit inj , succinylcholine 50mg / ml inj , taxim 500 inj , termin 10 ml inj. , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetrahes / voluven ( starch ) , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , thiocolchicoside 4mg , torsemide , trace elements ( celecil ) , tramadol inj 50 mg / ml , trastuzumab 440mg , trenaximic acid inj. , triamcinololone acetonide 10mg inj , triamcinololone acetonide 40mg inj , typhoid ( pcv typh bar / typhim vi ) , vancomycin 250mg , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , varicella zoster ( vzig ) , vassopressin , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil2.5 mg inj , vinblastine 10mg / 10ml inj , vincristine inj1mg / ml , vitamin a 40000 / ml , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) 1mg / 0.5ml injection ( detail in rc ) , vitcofol , vitcofol c , water for inj ip , zoledronic acid 4mg inj , distill water 5 ltr , inj terlipressin , mannitol 350ml , anti snake venom , anti scorpion venom , inj penidura la 6lac u , inj hbig 200iu , aminovain inj 10% , indamethasone inj , inj nac 600 , inj lorthinine +l asparginase , inj benzathine penicilin g 2.4lac , inj rocuronium , inj ropin 0.2% , inj nalbuphine10mg , pcm inj 150mg , pcm inj30mg , inj.polidoconal , inj d 125 , diltiazen ointment , kehr t tube no.14 , amino acid ( for parentiral nutrition ) 10% , lipid ( for parentral nutrition ) 20% , albumin 20% , colostomy bag , gigli saw urire , liga clip lt 200 , lt 300 , lt 400 , suprapubic catheter with tocar kit , hemoclip , c arm cover , crape bandage 4” , stainless steel burr 1 mm , 2 mm , 3 mm , 4 mm , 5 mm , 6 mm , tungston carbide burr1 mm , 2 mm , 3 mm , 4 mm , 5 mm , 6 mm , debrider blade40, 60 , merocele nasal blade , lignocaine 10% spray , h2o2 solution , lignocaine aderniline vial , surgical shaw , surgical fibrillar , crescent knife ( eye ) , keratone knife ( eye ) , side port knife ( eye ) , ethibond no.5 , elastic adhesive bandage 6 inches , crepe bandage 2, 4, 6 inches , skin traction adhesive , skin traction dunlop’s , shoulder immobilizer , knee cap splint , thumb spice splint , stockinette 3, 6, 9 cm*15m roll , skin stapler , 1938cotton roll 4 inch. pressed cotton for plaster 50 gm , cotton roll 6 inch. pressed cotton for plaster 50 gm , sterile adhesive dressing size. pad size 5x5cm , ( primapore / g dress type ) , sterile adhesive dressing size. pad size 5x10cm , ( primapore / g dress type ) , sterile adhesive dressing size. pad size 5x15cm , ( primapore / g dress type ) , sterile adhesive dressing size. pad size 5x25cm , ( primapore / g dress type ) , iodine impregnated incised drape ( ioban type ) approx. size 15x15cm , iodine impregnated incised drape ( ioban type ) approx. size 25x25cm , iodine impregnated incised drape ( ioban type ) approx. size 30x40cm , arm pouch sling , clavicle brace , long knee brace , finger cot different sizes , tennis elbow belt , silicon heel pad , ankle brace , lumbosacral belt , hip u drape , knee o drape , circular stapler for endto end amastomois , ( various sizes ) – 28 6 , 31 6 , polypropylene mask 6*11cm , 7.5*15cm , hernia tacper ( 5mm ) with 30 tacps ( nonabsorbable ) , hernia tacper ( 5mm ) with 30 tacps ( absorbable ) , composit mask12cm circular , 15cm circular , 20cm circular , 15*10cm , 20*15cm , thoracis trocarcatheter 12f, 20f, 28f , underwater seal beg , multifire luiner cutter without blade dual firing knob, push realize button , 60cm, , 80cm , luiner cutter reload 75mm cartridage , catridage for luiner cutter knif 60mm , inj. etomidate 2mg / ml 10ml , inj. rocurinium 10mg / ml 5ml , inj dexamedetomidine 1% 1ml , inj. xylocard 2% vial 50ml ( inj ligocaine iv ) , inj ropivicane 0.75% 20ml , inj ropivicaine 0.2% 20 ml , inj ropivicaine heavy 0.75% 4ml , inj. chlorprocaine 1% spinal use 5ml , inj. nalbuphine 10mg / ml 1ml , lignocaine spray 10% 50ml , paracetamol suppositories 100mg , diclofenac suppositories50mg , inj. lignocaine heavy 5% spinal use 2ml , i.v. cannula fixator , flexometallic et tube no.6 , flexometallic et tube no.6.5 , flexometallic et tube no 7 , flexometallic et tube no 7.5 , microlaryngel surgery ( mls ) et tube no. 5 , microlaryngel surgery ( mls ) et tube no. 5.5 , flexible bougie , magill forcep , ventilator –t nebulisation kit ( neb t kit ) , north pole et tube no.6 , north pole et tube no.6.5 , north pole et tube no.7 , north pole et tube no.7.5 , south pole et tube no. 6 , south pole et tube no. 6.5 , south pole et tube no. 7 , south pole et tube no. 7.5 , laryngoscope mac intosh ( adult ) , laryngoscope magill ( pediatri ) , laryngoscope mac coy ( adult ) , arterial bp cannula ( jelco ) , etco2 sampli line , inj. palanossetron 0.25mg 5ml , spinocaine 27g ( lumber puncture needle ) , glucometer caresens , glucometer caresensstripes , inj. levobupivicaine heavy .5% , inj. phenylephrine 50mcg / ml 10ml , inj metoprolol 1mg / ml 5ml , inj mephentermine 10ml vial , plasticcountenar , code free strips , disinfectant for surface & environment chemical , requirements active ingredients : , n alkyl ( 60% c14%, 30% c16, 5% c12, 5% c18 ) , dimethyl benzyl ammonium chloride 2.37% , n alkyl ( 68% c12, 32% c14 ) , dimethyl ethylbenzyl ammonium chloride 2.37% , inert ingredients 95.26% , it should be effective against hiv, hcv, h1n1, h5n1 and certificate should be enclosed supporting the claim with contact time not more than 10min. and with proven claim efficacy either from epa or niv or nicd. , macro porus partiall absorbable mesh made up of approximately equal part ofpolypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with poresize 2.7mm &weight of 39g / m2 and containing blue orientation strips of polypropylene. 10*15cm / european ce approved , 2point fixation deviced for open hernia repairs with a curved cannula &strap positioning tip having a forward – tited handle & metric ruler. inserted length of straps should be 6 7 mm total no of straps 20 usfda / europen ce approved , triple layer ( polydioxanone / polypropylene / polydioxanone ) tissued separation mesh with orc layer ofr ventral hernia repair. 15*15cm, squar usfda / europen ce approved , 5mm absorbable mesh fixarion device for hernia repair, with 2 point secure fixation, withmultiangle firing inserted length of straps should be 6.7 mmno of straps 12 usfda / europen ce approved , softpolypropylene mesh construced of knitted filaments of extrudedpolypropylene identical in composition to that ised in polypropylene suture, the mesh should affords excellent strength, durability and surgical adaptability, with sufficient porosssity for necessaty tissued ingrowth, blue polypropylene monofilaments incorporated to produce contrast striping in the mesh. size 15*15cmusfda / europen ce approved...

Medical And Health Services - Rajasthan

33713916 supply of mndy generic medicine, surgical, sutures, eye camp medicine iol bupivacaine hydochloride in dextrose lnjection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 4mlamp 2 4 bupivacaine lnj lp 0.5% 20 mlvial 3 b ketamine lnj lp 50 mg/ml l0 mlvial 4 9 lignocaine ointment 5 o/o 10 gm tube in unit carton lignocaine and adrenaline lnj lp each ml. contains lignocaine hydrochloride lp 20 mg adrenaline ip 0.01 mg 5 10 30 mlvial 6 12 lignocaine gel lp 2% 30gm tube in a unit carton 7 1_3 lignocaine lnj lp 2 o/o 30 mlvial 8 1,4 propofol lnj lp 10 mg/ml 20 ml vial / ampoule 9 15 thiopentone lnj lp 0.5 g vial 10 654 atropine sulphate lnjection 0.6mg/ml lmlamp 25 ampoules 11 19 diclofenac sodium lnj lp 25 mg/ ml (lm/lv use) 3 ml amp 12 20 diclofenac gastro resistant tablet lp 50 mg(enteric coated) 10x10 ta b strip/blister 13 2l fentanyl citrate lnjection lp 2 ml 2 mlamp 1,4 22 10x10 tab blister lbuprofen and paracetamol tablets lp lbupiofen 400 mg+paracetamol 325 mg 15 23 ibuprofen tab lp 200 rng (coated) 10x10 tab blister i6 24 ibuprofen tab lp 400 mg (coated) 10x10 tab blister .il fy ;? ffiuyry, fifuersrdr 6r qrsl i ffi/d 15 ml bottle (with dropper which should be able to screw and cap the bottle) in t7 26 paracetamol drops paediatric paracetamol oral suspension lp(each ml contains paracetamol 150mg) * /.*j ./ (ctr; 60 ml bottle (with measuring cap) paracetamolsyrup lp 125 mg/sml (detail in rc) 18 27 10x10 tab blister 19 28 paracetamoltab lp 500 mg 29 paracetamol lnj. 150 mg/ml 2 ml amp 20 21 30 pentazocine lnj lp 3omg/ml (lm/lv use) lmlamp 10x10 cap strip/blister 22 32 tramadol cap lp 50 mg 23 33 tramadol lnj 50 mg/ml 2 mlamp 10x10 tab strip 24 437 diclofence prolonged release tablet lp 100 mg 60 ml bottle (with measuring cap) lbuprofen oral suspension bp /usp 100 mg/ 5 ml 25 477 10x10 tab blister 26 483 i diclofenac sod + paracetamol tablets lp diclofenac sod 50 mg + paracetamol 325 mg 10x10 tab blister aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 21 492 20 gm tube in unit carton diclofenac gel: diclofenac diethylamine l.liyo, methyl salicylate 10%, linseed oil 3%, menthol5% 28 493 etoricoxib tab 10x10 tab blister 29 495 lp 120mg fentanyl citrate lnjection 50mcg/ml l0mlvial/amp 30 6s5 10x10 tab blister 31 656 naproxen tablet lp 500mg naproxen tablet 10x10 tab blister 32 657 lp 250mg etoricoxib tablet lp 90 mg 10x10 tablets 33 658 14x10 tablet aspirin tablet lp (gastro resistant) 150 mg 34 679 1ml. ampoule diclofenac sodium aqueous lnjection 75mg/ml 1ml size, lv & lm use 35 695 100 ml bottle paracetamol infusion lp 1o/owlv 100m1 size 36 696 37 34 adrenaline lnjection lp 1mg/ml lm/lv use 1ml amp(ambercolor) 35 betamethasone tab lp 0.5mg 10x10 tab blister 38 chlorpheniramine maleate tab lp 4mg 10x10 ta b strip/blister 39 37 2 ml vial (usp type i vial) 40 39 dexamethasone lnj lp 8mg/2ml dexamethasone tab lp 0.5 mg 10x10 tab strip 41, 40 vial hydrocortisone sodium succinate lnjection lp 100 mg base / vial (lm/lv use) 42 42 43 hydroxyzine tab lp 25 mg methyl prednisolone sodium succinate for lnjection usp 500 mg vial 45 45 pheniramine lnj lp 22.75mg /ml 2 mlampxrr%wr/x 10x10 rab strip/blnekfr */a ) 46 47 prednisolone tab lp 5 mg , ..a)t // tlrav.,4 47 49 promethazine lnj lp 25mg/ml 2 ml amp (amber colo$ 48 50 promethazine tab lp 25 mg 10x10 tab strip 49 418 betamethasone sod phos lnj lp 4mg/ml 1 mlampoule/vial 50 469 prednisolone tablet lp 10 mg 10x10 ta b strip/blister 51 470 prednisolone tab lp 20 mg 10x10 tab strip/blister 52 497 30 ml bottle anticold syrup each 5 mlcontains phenylephrine hydrochloride 2.5mg, chlorpheniramine maleate 1 mg, and paracetamol 125 mg 53 498 10x10 tablets cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg,phenylephrine 10 mg & paracetamol 325 mg tab 54 499 cetirizine syrup lp 5mg/5 ml 30 ml bottle with measuring 55 659 levoceitrizine tablet 5mg 10x10 tablets montelucast( 10mg) + levocetrizine tablet (5mg) 10x10 tablet bl ister/strip/al u al u pack 56 660 57 700 10x10 tablets dexamethasone tablet lp 4 mg (each u ncoated tablet contains dexamethasone lp 4 mg) 58 53 carbamazepine tab lp 200 mg 10x10 tab strip/blister 59 54 carbamazepine tab lp 100 mg 10x10 tab strip/blister 60 56 phenobarbitone tab lp 30 mg 10x10 tab strip 61 57 phenytoin lnjection bp 50mg/ml 2 ml amp(amber colour) 100 ml bottle(with measuring cap) 62 58 phenytoin oral suspension lp 2lmglml 59 phenytoin tab lp 100 mg (film coated) 10x10 tab strip 61 10x10 tab strip sodium valproate gastro resistant tablets lp 200 mg 64 65 420 phenobarbitone lnj lp 200mg/ml 1 mlampoule/vial 100 ml bottle(with measuring cap) 66 474 carbamazepine oral suspension usp 100 mg/5ml 100 ml bottle(with measuring cap) 67 479 sodium valproate oralsolution lp 200 mg/5ml 661 10x10 tab strip sodium valproate tablet(gastro resistant) lp 500mg 68 10x10 tablet/ca psule blister 69 662 clobazam tablet/capsule 5 mg 663 clobazam tablet/capsule 10 mg 10x10 tablet/capsule blister 70 10x10 tab blister 71. 664 levetiracetam tablet lp 500 mg g*p , :* 7 /lxl s d 63 t 72 66s levetiracetam oral solution/suspension 100mg/ml 100m1 lt ffip iil , /b,rl fri t,, , . . t7/ wl / .} / 73 667 gabapentine tablet/capsule 100mg 10x10 tablet/capsule blister/strip 74 668 gabapentine tablet/capsule 300mg 10x10 tablet/capsule blister/strip 75 63 acyclovir tab lp 200 mg 10x10 tab blister 76 64 acyclovir tab lp 800 mg 10x10 tab strip 77 65 10 ml bottle albendazole oral suspension lp 400 mg/10m1 78 66a albendazole tablets lp 400 mg(detail in rc) 10* 10* 1 ta blet strip/blister 79 67 amikacin lnj lp l00 mg 2 mlvial 80 68 amikacin lnj lp 500 mg 2 mlvial amoxycillin and potassium clavulanate tabs lp 500 mg + 125 mg 81 70 10x10 82 71. amoxycillin cap lp 250mg 10x10 cap strip/blister 83 72 amoxycillin cap lp 500mg 10x10 84 73 amoxycillin dispersible tablets lp 125 mg 1 0x10 tab strip azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 10x3x3 tab strip/blister(strip/blister of 3 tab) 85 78a 86 794 azithromycin tablets lp 250mg 10x3x3 tab strip/blister(strip/blister of 3 tab) 87 80a azithromycin tab lp 500 mg 1x3 tab 88 84 10x10 tab strip cefixime tab lp l00 mg/cefixime dispersible tab lp 100 mg 89 85 cefixime tab lp 200 mg 10x10 tab strip 90 86 vial cefoperazone and sulbactum for lnj (cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gmxlm/lv use) 91 87 cefotaxime lnjection lp 1 g vial 92 88 cefotaxime lnj lp 250 mg vial 93 93 ceftriaxone lnj lp 1g /vial vial 94 94 ceftriaxone lnj lp 250 mg/vial vial 95 95 ceftriaxone lnj lp 500mg/vial vial 96 96 cephalexin cap lp 250 mg 10x10 cap blister 97 97 cephalexin cap lp 500 mg 1x10 98 98 chloroquine phosphate lnj lp 40 mg/ ml 5 ml amp 99 10x10 tab strip/blister chloroquine phosphate tab. lp 250mg eq to 155 mg of chloroquine base film coated 99 100 101 ciprofloxacin lnjection lp 200m9/100m1 100 ml ffs / bfs bottle 101 702 10x10 tab blister ciprofloxacin tablets lp 250 mg film coated h r71 u)/ >z r <=r 1,61 187 atorvastatin tab lp 10mg 10x10 tab strip/blister 1,62 188 clopidogrel tab lp 75 mg 10x10 tab strip 163 189 digoxin lnj lp 0.25 mg/ml 10x10 1.64 190 digoxin tab lp 0.25 mg 10x10 tab strip 165 191, diltiazem tabs lp 30 mg film coated 10x10 tab blister 166 192 dobutamine lnj lp 50mg/ml/250mg (vial/)dobutamine lnj lp 250 me/sml(amp) 5 ml vial/amp 1,67 193 dopamine hydrochloride lnj lp 40 mg/ml 5 mlamp(amber colour) 168 194 enalapril maleate tab lp 5mg 10x10 tab strip 169 195 enalapril maleate tab lp 2.5mg 10x10 tab strip 170 197 lsosorbide dinitrate tab lp 5 mg 10x10 tab blister 177 198 lsosorbide mononitrate tabs lp 20 mg 10x10 tab strip 172 199 lisinopril tab lp 5 mg 10x10 tab strip 173 200 losartan tab lp 50 mg 10x10 tab strip 174 201 magnesium sulphate lnj. lp 500mg/ml (so%w/v) 2 ml amp 175 202 methyldopa tab lp 250mg film coated 10x10 176 203 nifedipine cap lp 5mg 10x10 cap strip 177 204 nifedipine tablets lp 10 mg (sustained release) 10x10 tab blister 178 20s nitroglycerin lnj 5 mg/ ml 5 ml amp 179 207 propranololtab lp 40 mg 10x10 ta b strip/blister 180 209 streptokinase lnjection 15 lac units lp vial 181 410 labetaloltab lp 100mg 10x10 tab blister 182 4tt labetalol hci lnj lp 20mg/4ml 4 mlampules 183 444 aspirin delayed release tablet / aspirin gastroresistant tab lp (each enteric coated tablet contains acetyl salicylic acid 75 mg) 10x14 tab strips 184 458 losartan potassium and amlodipine tablets lp (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5me) 10x10 tab strip/blister 185 459 losartan potassium and hydrochlorothiazide tablets lp(losartan potassium 50 mg, hydochlorothiazide 12.5 mg) 10x10 tab blister 186 461 amlodipine and atenolol tablet (amlodipine besilate equivalent to amlodipine 5mg,atenolol 50mg) 10x10 tab blister 187 462 atenololtab lp 25 mg 10x14 tab blister 4*9 r * s: li ,y lili r l>li i, i 188 467 losartan tab lp 25 mg 10x10 tab blister i ft 189 548 atorvastatin tablets ip 40 mg 10x10 tablets tr l,bn lfw i 190 549 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 10x10 tab strip ll , /*/ 191 550 fenofibrate capsules/ tab lp 200 mg 10 x 10 capsule 3+rr,ffip1 192 552 metoprolol tablets lp 25 mg 10x10 tablets *n# 193 553 metoprolol succinate extended release tablets lp 50 mg 10x10 tablets 194 554 noradrenaline lnjection lp 2 mg/ml 2ml vial/ ampoule 195 556 telmisartan tablets lp 40 mg 10x10 tablets 196 636 ramipriltablets lp 2.5 mg 10x10 tablets 197 650 glyceryl trinitrate tablets 2.6 mg control led release tablets 30 tab bottles 198 580 chlorhexidine mouthwash lp 0.2 o/o 50 ml bottle 199 581 dental gel choline salicylate 8.7 of o, benzalkonium chloride 0.01, o/o, lignocaine hcl2 olo (flavoured gel base) 10 gm tube 200 582 tooth gel sodium monofluorophosphate a.7 o/o and potassium nitrate 5 o/o (in flavoured base) 50 gm tube in unit carton 201, 583 gum paint containing tannic acid 2%, cetrimide 0.7yo,zinc chloride l% 15 ml squeeze vial 202 276a fusidic acid cream lp 2% 10gm tube in mono carton 203 218 liquid paraffin lp 400 ml 400 ml bottle 204 220 miconazole nitrate cream lp 2% 15gm tube in a unit carton 205 221, povidone lodine ointment 5% 15 gm 15gm tube in a unit carton 206 224 silver sulphadiazine cream lp 1% 50gm tube 50 gm tube 207 445 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1%) 10 gm tube in unit carton 208 446 gamma benzene hexachloride lotion 1%(lindane lotion usp) 100 ml bottle 209 558 betamethasone dipropionate cream lp o.05% 15gm tube in a unit carton 210 559 betamethasone lotion lp 0.05 o/o 50ml 2il s60 clindamycin phosphate gel usp 1o/o 20gm tube in mono carton 212 561 clobetasol propionate cream lp 0.05 o/o 20 gm tube 213 564 glycerin lp 100 ml 100 ml bottle 21.4 565 ketoconazole cream 2%o 15gm tube in mono carton qr* 42+ t *sz v] ffi t./ n 215 568 permethrin lotion 5% 30 ml 216 s69 permethrin cream 5% 30gm tube in a unit carton 217 570 tretenoin cream usp 0.025% 20 gm tube in unit carton 218 670 coal tar 6% & salicylic acid 3% ointment 20gm 219 671 calamine lotion lp 100m1 100 ml bottle 220 801 multistix test strip 100 strip pkt 221, 222 povidone lodine solution lp 5 % 500 ml 500 ml bottle 222 245 formaldehyde solution (34.5 per. 38 per.) 500 ml bottle 223 247 gluteraldehyde solution 2% 5 ltrs can 224 248 hydrogen peroxide solution lp 6 o/o (20 vol) 400 ml bottle 225 249 lysol (cresol with soap solution) lp (cresol 50 o/o + soap 50 o/o) 5 ltrs can 226 250 povidone lodine scrub solution / cleansing solution 7.5 o/o w/v povidone lodine (suitable for hand wash) 500 ml bottle 227 252 surgical spirit lp (500 ml) 500 ml opaque white bottle with lnner cap 228 2s3 acetazolamide tab lp 250mg 10x10 tab blister 229 254 frusemide tab lp 40 mg 10x10 tab strip 230 255 furosemide lnjection lp 10mg/ml (lm and lv use) 2 mlampoule 231, 256 hydrochlorthiazide tab lp 12.5 mg 10x10 tab strip 232 257a mannitol lnjlp 20%w/v 100 ml ffs / bfs bottle 233 258 spironolactone tab lp 25mg 10x10 tab blister 234 259 torsemide tab l0 lp mg 10x10 ta b strip/bl ister 23s 464 hydrochlorthiazide tab lp 25mg 10x10 tab strip 236 574 spironolactone tablets lp 50 mg 10x10 tablets 237 585 ciprofloxacin 0.3 o/o and dexamethasone 0.l o/o ear drops ciprofloxacin and dexamethasone otic suspension usp 5 ml. vialwith sterilized dropper,or squeeze via i 238 589 ceruminolytic drops (wax dissolving ear drops) paradichlorobenzene 2 of o, benzocaine 2.7 o/o, chlorbutol 5 olo, turpentine oil l5 o/o 10ml bottle/vial(with a seperate dropper which should be able to screw&cap the bottle)in unit carton 239 5 drotaverine hydrochloride lnj 40 mg/2 ml 2 ml amp 240 219 ointment containing lidocaine lp 3 o/o zinc oxide ip 5 o/o , hydrocortisone lp offin lpo5o/o 15gm tube in a unit carton .* y i ! 241 260a 10x10 tab blister antacitl ta blets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 242 261,4 antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 60 ml bottle (with measuring cap) 243 262 bisacodyltab lp 5 mg 10x10 tab strip 244 263 dicyclomine tab lp 10 mg 10x10 tab strip/blister 245 264 dicyclomine lnj lp 10 mg/ml 2 ml amp 246 265 dicyclomine hydrochloride oral solution lp 10mg /5ml 30 ml bottle with measuring cap 247 266 domperidone suspension lp 5mg/5ml 30 ml bottle with measuring cap 248 267 domperidone tab lp 10 mg 10x10 tab blister 249 , 268 hyoscine butylbromide lnj lp 20 mg/ ml lmlamp 250 270 metoclopramide lnj lp 10me/2ml 2 ml amp 251. 271. metoclopramide tab lp 10 mg 10x10 tab blister 252 272 omeprazole cap lp 20 mg 10x10 cap strip/blister 253 273 ondansetron lnj lp 2mg/ml 2 ml amp 254 274 ors powder lp pouches 20.5 gms 255 275 pentoprazole lnj 40 mg vial 256 276 ranitidine hcl lnjection lp 50mg/2ml 2 ml amp 257 277 ranitidine tab lp 150mg film coated 10x10 258 278 sodium phosphates enema bp each 100m1 contains sodium dihydrogen phosphate dihydrate lo o/o disodium hydrogen phosphate dodecahydrate 8 o/o 100 ml polypropylene pack 259 41.4 hyoscine butyl bromide tablets lp 10mg 10x10 tab blister 260 415 drotaverine tab lp 40 mg 10x10 tab blister 261. 439a dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 10x10 tab blister 262 478 metoclopramide hydrochloride syrup lp 5 mg/ 5ml 30 ml bottle (with a seperate dropper which should be able to screw & cap the bottle) in unit carton ffi 263 i oral drops 10mg/ ml (10m1) .domperidone l0 ml bottle (with dropper which should be able to screw and cap the bottle) in a unit carton 4t. ru s< u,, c .ya 264 591 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 10x10 tablets llxt i {lc& rr,.r:+ l f t rcj.{,rt, ./ il.tj*el tj f*,i! r.*{d i * w,:#v ! { ,,w if* t/ , . /.*. 265 592 lactic acid bacillus tab 60 million spores 10x10 tablets 65ro jfiq 266 593 lactulose solution usp/bp 10gm/15m1 or 3.35 sm/5ml 100 ml bottle(with measuring cap) q y:/ 267 595 ondansetron orally disintegrating tablets lp 4mg 10x10 tab strip 268 596 pantoprazole 40mg and domperidone 30mg sr cap lp pantoprazole as enteric coated pellets and domperidone as sr pellets 10x10 cap strip 269 597 ursodeoxycholic acid tablets lp 300 mg 10x10 tab strip/blister 270 763 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride lp 20 mg ) 10x10 tablets 271 76s probiotic sachets 1gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 1 gm each sachet 272 598 allopurinoltablets lp 100 mg 10x10 tablets 273 599 hydroxychloroquine sulphate tablets 200mg 10x10 tablets 274 279 biphasic lsophane lnsulin lnj lp (30 % soluble insulin and 70 % isophane insulin) inj. 40 lu/ml(r dna origin) 10 mlvial 275 280 carbimazole tabs lp 5 mg (film coated) 10x10 tab blister 276 281, carboprost tromethamine lnjection lp each ml contains carboprost 0.25 mg/ml l mlamp/vials 277 285 dinoprostone cream/ gel 0.5 mg dinoprostone in syringe single syringe 278 289 glimepiride tab lp 2 mg 10x10 ta b strip/blister 279 290 glimepiride tab lp lmg 10x10 tab strip/blister 280 293 hydroxyprogesterone lnj lp 250mg /ml lmlamp 281 295 metformin tab lp 500 mg 10x10 tab blister 282 296 norethisterone tab lp 5 mg 10x10 tab strip 283 297 pioglitazone tab lp 15 mg 10x10 tab blister 284 298 progesterone lnj 200 mg/2ml 2 ml amp . w^) y4va7: r j _/r * t1! ,, 285 300 lnsulin lnjection lp (soluble i nsulin/neutral lnsulin lnjection)40 lu/ml(r.dna origin) 10 mlvial ffi0wffi 286 301 thyroxine sodium tablets lp 100mcg 100 tablet in a bottle trj 1w/ 287 451, metformi n hydrochloride(sustained release tablets lp 1000 mg 10x10 tab blister x 97 288 454 metformin hcl (sustained release) and glimepiride tab metformin hcl (sustained release) 500mg,glimepiride 1mg 10x10 tab blister 289 455 metformin hydrochloride (sustained release) and glimepiride tablets lp (metformin hydrochloride(sustained release) 500 mg, glimipiride 2mg) 10x10 tab blister 290 456 glimepiride, pioglitazone and metformin hydrochloride (sustained release) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride (sustained release) 500 mg 10x10 tab blister 291. 603 gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 500 mg) 10x10 tablets 292 605 medroxyprogesterone acetate tablets lp 10 mg 10x10 tablets 293 607 thyroxine tablets lp 50 mcg 100 tablet in a bottle or 10x10 tablet 294 680 lnsulin glargine 3ml (1001u/ml) with 15 lnsulin syringes and needles/cartridge 3ml (1001u/ml)with 15 needles and 1 pen per 20 cartridges 3mlvial 295 682 tenaligliptin tablet lp 20mg 10x10 ta blet blister/alu alu pack 296 693 lnsulin glargine 10 mlvial (100 lu/ml) with 30 lnsuline syringes with needle l0 mlvial 297 303 human anti d lmmunoglobulin lnjection 300mcg (lm use) pre filled syringe/via i 298 305 human rabies lmmunoglobulin lnj 150 lu/ ml single dose vial 299 306 rabies vaccine human (cell culture) lp (lntradermal)2.5 lu 1 mlvial with 1.0 ml diluent 300 307 rabies vaccine human (cell culture) lp (lntramuscular) 2.5 lu/ dose single dose vial n*, f* * s 1, i: 301 308 snake venum anti serum lp ( lyophilized) polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.l ml of serum neutralizes 0.6 mg of cobra venum,0.45 mg of common kraite( bungaras)venum(details in rc) vial 302 309 tetanus lmmunoglobulin lp 250 lu/ vial vial/ampoules 303 310 tetanus vaccine (adsorbed) lp 5 mlvial 5 mlvial 304 408 rabies antiserum lp (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (1.m./sc use) 5 mlvial 305 311 atracurium lnj 10 mg/ml 2.5 mlamp 306 312 glycopyrrolate lnj lp 0.2 mg/ml l ml amp 307 313 midazolam lnj lp 1mg/ml 5 mlvial 308 317 succinylcholine lnj. lp 50 mg/ml (lv use) 10 mlvial 309 318 valethamate bromide lnj smg / ml l mlamp 310 610 chlorzoxazone, diclofenac sodium & paracetamol tablets (chlorzoxazone 250mg, diclofenac sodium 50mg paracetamol325 mg) 10x10 tablets 311 638 neostigmine injection i p 2.5mg/5ml 5 ml amp 3t2 241, tropicamide eye drop lp to/o 5 ml. vialwith sterilized dropper,or squeeze via i 313 320 atropine sulphate ophthalmic solution usp 1% 5 ml. vialwith sterilized dropper,or squeeze vial 314 322 ciprofloxacin eye drops lp 0.3 o/o w/v 5 ml squeeze vial 315 323 ciprofloxacin ophthalmic ointment usp o.3o/o 5 gm tube in unit carton 316 324 hydroxypropylmethyl cellulose solution 20 mg/ ml 2 ml pfs 317 330 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o/o +0.! olo 5ml vial with sterilized dropper packed in seperate polythene pack 318 331 tobramycin eye drops 0.3% [331] 5 ml. vialwith sterilized dropper,or squeeze vial 319 421, flurbiprofen sodium ophthalmic solution lp 0.03 olowlv 5 ml squeeze vial 320 423 hyaluronidase lnjection lp each vial contains hyaluronidase lp 1500 l.u. vial 32r 425 fluconazole eye drops 0.3% 5 ml. vialwith sterilized dropper,or squeeze vial 322 484 timolol eye drops lp 0.5 o/o w/v 5 ml squeeze vial 323 485 homatropine eye drops lp 2% 5 ml squeeze vial b4 r *:? t. fi, p 324 486 travoprost eye drops lp 0.004 o/o 3ml ueeze vial f ,if # [*l # flfi ,, 325 487 5 ml squeeze vial brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% rffi 10 ml squeeze vial carboxymethylcellulose eye drops i p o.s% 326 613 ;v .h 5 ml. vial with sterilized dropper,or squeeze vial eye drop moxifloxacin 0.5%wlv ophthalmic solution lp 5ml size 327 770 328 33s methylergometrine lnj lp 0.2 mg/ml lmlamp 329 336 methylergometrine tab lp 0.125 mg 10x10 tab strip 330 337 misoprostoltab lp 200 mcg 10x10 tablets l mlampoule (single unit in blister pack) 331 338 oxytocin lnj lp 5 lu/ml 332 615 mifepristone tab lp 200mg single tablet 10x10 tablet/capsule blister/strip natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron lp 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron lp 200 mg) 333 772 334 339 alprazolam tab lp 0.25 mg 10x10 ta b strip/blister 33s 340 alprazolam tab lp 0.5mg 10x10 tab strip/blister 336 341, amitriptyline tab lp 25mg film coated 10x10 tab strip 337 342 chlordiazepoxide tablets lp 10mg 10x10 tab strip 338 344 10x10 tab strip chlorpromazine tablets lp 25 mg (sugar coated) chlorpromazine tablets lp 50 mg (coated tablets) 339 345 10x10 tab strip 340 349 diazepam lnj lp 10mg/2ml (lm/lv use) 2 ml amp 341, 350 diazepam tab lp 5 mg 10x10 ta b strip/bl ister 342 351 escitalopram tab lp 10 mg 10x10 tab strip/blister 343 3s2 fluoxetine cap lp 20 mg 10x10 cap strip/blister 344 3s6 lmipramine tab lp 25 mg (coated tab) 10x10 tab blister 345 358 lithium carbonate tab lp 300 mg 10x10 tab strip 346 359 lorazepam lnj lp 2 mg/ml 2 ml amp 347 360 olanzapine tab lp 5 mg 10x10 tab strip 348 361 risperidone tab 2mg 10x10 ta b stri p/blister 34s 362 risperidone tab 1 mg 10x10 tab strip/blister 3s0 363 sertraline tab lp 50 mg 10x10 ta b stri p/blister 351 678 clonazepam tablet 0.5 mg 352 778 10x10 tablets lorazepam tablet lp 2 mg (each uncoated tablet contains lorazepam lp 2 ms) 353 365 aminophylline lnj lp 25 mg/ml 10 mlamp 354 367 2 ml amp budesonide nebulizer suspension 0.25mglml 1)* / , {rrr ..*:,..€gtltr 356 370 salbutamoltablet lp 4 mg 10x10 tab strip/blister g* 357 371 salbutamol lnhalation 100 mcg /dose 200metered dose container 358 372 salbutamol nebuliser solution bp 5 ms/ml l0 mlvial 359 374 theophylline and etofylline lnjection (anhydrous theophylline 50.6mg + etofylline 169.4 mg) 2 ml amp 360 375 theophylline a nd etofylline ta blets (theophylline lp 23mg + etofylline 77 mg) 10x10 361 432 salbutamol syrup lp 2mel 5ml 100 ml bottle(with measuring cap) 362 440 dextromethorphan hbr syrup lp 13.5mg / 5ml 30 ml. bottle 363 616 formoterol fumerate & budesonide powder for lnhalation lp 6 mcg + 200 mcg 30 capsules 364 617 budesonide powder for lnhalation 200 mcg 30 capsule (rota caps) 36s 692 cough syrup/expectorant(50) ml 50 ml bottle (with measuring cap) 366 377 compound sodium lactate lnj. lp 500 ml ffs/bfs bottle 367 3tb dextrose lnjlp 25%w/v 100 ml ffs / bfs bottle 368 379 dextrose lnj lp 10% 500 ml ffs/bfs bottle 369 380 dextrose lnj lp 5% 500 ml ffs/bfs bottle 370 381 multiple electrolytes and dextrose lnjection type i lp (electrolyte p lnjection ) 500 ml ffs/bfs bottle 37l 382 multiple electrolytes and dextrose injection type lll lp electroylte m lnjection ( l.v. ) 500 ml ffs/bfs bottle 372 383 potassium chloride lnj. 0.15 gm/ml 10 mlamp 373 384 potassium chloride oral solution u.s.p 500mg/ 5ml 200m1 bottle(amber color) 374 38s sodium chloride and dextrose lnjection lp 0.9 o/o + 5 o/o 500 ml ffs/bfs bottle 375 386 sodium chloride lnj lp 500 ml 500 ml ffs/bfs bottle 376 62l sodium chloride lnjection lp 100 ml 100 ml bottle 377 576 tamsulosin hci tablets/capsule 0.4 mg 10x10 tablet/cap strip 378 579 flavoxate tablets lp 200 mg (coated tablet) 10x10 tablets 379 788 alkylizer syrup 1.4 em/5 ml( 100 ml )(disodium hydrogen citrate) 100 ml syp 380 541. betahistine tab lp 8 mg 10x10 tablets ./4 .<44 381 542 betahistine tab lp 16 mg 10x10 rablets iti fi tvffif if 382 543 cinnarizine tablets lp 25 mg 10x10 tab blister h,b ffid$, i fp)if*, 383 544 cinnarizine tablet lp 75 mg 10x10 tab blister b ediqffil 384 387 ascorbic acid tab lp 500 mg 10x10 tab strip &k 38s 388 calcium gluconate lnj lp 10% (lv use) 10 mlamp w 386 390 ferrous sulphate with folic acid tab lp each film coated tab. containing dried ferrous sulphate lp equiv 100 mg elemental lron and folic acid lp 0.5 mg 10x10 ta b stri p/blister 387 392 folic acid tab lp 5 mg 10x10 tab blister 388 393 multivitamin drops each ml contains vit a 3000 tu, vit d3 300 tu, vit 8l 1mg, riboflavine phosphate sodium 2mg, dpanthenol 2.5mg, niacinamide l0mg, pyridoxine hcl 1mg, cyanocobalamin lmcg, lysine hcl 10mg 15 ml bottle (with dropper which should be able to screw and cap the bottle) in a unit carton 389 394 multivitamin tablets nfi formula sugar coated vit a 2500 lu vit b1 2mg vit b6 0.5mg vit c somg calcium pantothenate1mg vit d3 2001u vit b2 2 mg niacinamide 25mg folic acid o.2 mg 10x10 tab strip/blister 390 395 vitamin b complex lnj nfi 10 mlvial 391 397 vitamin b complex tablet nfi (prophylactic) 812mg b2 2mg b5 0.5mg niacinamide 25mg calcium pantothenate 1mg (with appropriate overages) 10x10 ta b strip/blister 392 441 calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 lu ) 100 ml bottle(with measuring cap) 393 448 lron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 394 472 zinc sulphate dispersible tablets tp elemental zinc l0 10x10 tab strip/blister 395 488 lron sucrose lnjection usp/bp 2ome/ml (for lv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental lron 20 mg 5 mlampoule (amber colour) 396 622 calcium with vitamin d tablets usp /ca lcium and colecalciferol tablets bp/calcium and vitamin d3 tablets lp(elemental calcium 500 mg, vitamin d3. 250 lu) (non chewable) 10x10 tablets 397 652 methyl cobalmine tablet 500mcg 10x10 tab strip/blister i fl2.^ . | / /i:t 4,z, 401 634 pregabalin cap lp 75 mg l0 x 10 capsule n. :iy;z 402 639 oseltamivir capsule lp 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) strip/blister of 10 capsule 403 640 oseltamivir capsule lp 45 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg) strip/blister of l0 capsule 404 641, oseltamivir capsule lp 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) strip/blister of 10 capsule 405 642 oseltamivir phosphate for oral suspension lp 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 75 ml bottle with measuring cap list of eye camp medicine406 fl urbiprofen & hydroxypropylmethyl cellulose eye drops 5 mlvial 407 pilocarpine 0.5 % inj 1ml 408 hyaluronidase inj 1500 iu 409 tab prednisolone 40 mg 10 tab 410 moxifloxacin+prednisolone eye drop (bak free) 5 mlvial 411. tropicamide and phenylephrine eye drop 5ml 412 sodium chloride ophthalmic solutionl 5% eye drop 5ml 413 pilocarpine 2% eye drop 5ml 414 lnj.compound sodium lactate 500 ml in glass bottle 500 ml glass bottle 4ts lignocaine 4% drop vial 30 mlvial 41.6 bupivacaine hcl and epinephrine inj.0.5 % 30 mlvial 417 lnj. mannitol 350 ml 350 ml 41.8 balance salt solution bottle 500 ml 419 sa natiser 500 ml 420 ammonia bottle 500 ml 421, disposable sterile niddle 26 g piece 422 disposable sterile niddle 23 g piece 423 keratone operation use 2.8 mm angeled bewel up piece 424 crecents operation use 2.5 mm angeled bewel up piece 425 dark black goggles piece 4t tzf , vt. , 450 sf6 gas 30 ml for eye surgery each piece ll h: 451, bacillocid extra surface and equipment disinfectant 500 ml each piece ((;r( ffi l.: r 1. ,?}{ (gr each piece yy*,,, f:)/ 452 tropicamide 0.2 mg/ml and phenylephrine hcl 3.1 mg/ml and lidocaine hcl 10 mglml injection (1 n{l ampule intracameral injection) 453 d 125 microgen fogging disinfectant 01 ltr each piece list of surgicals454 s4 u nit blood administration set blood transfusion set (details in rc) 455 s s (a) disposable sterile surgical rubber gloves size 6 % lnches o made of natural rubber latex, powdered, without tear, properly folded in a paper 456 s s (b) disposable sterile surgical rubber gloves size 5 % lnches . made of natural rubber latex, powder free (polymer /silicon coated), without tear, properly folded in a paper pair 457 s 6(a) disposable sterile surgical rubber gloves size 7 lnches . made of natural rubber latex, powdered,,without tear, properly folded in a paper pair 4s8 s 6 (b) disposable sterile surgical rubber gloves size 7 lnches r made of natural rubber latex, powder free (polymer /silicon coated), without tear, properly folded in a paper pair 459 s 7 (a) disposable sterile surgical rubber gloves sizet% lnches . made of natural rubber latex, powdered, without tear, properly folded in a paper pair 460 s 7 (b) disposable sterile surgical rubber gloves sizet % lnches . made of natural rubber latex, powder free (polymer /silicon coated), without tear, properly folded in a paper pair 461, 58.c suction catheter, sterile. size: f g 8 (details in rc) each piece 462 s8.d suction catheter, sterile. size: f g 10 (details in rc) each piece tj **f /^ )u yl 6i$tr pair t, 463 s8.e suction catheter, sterile. size: f g 12 (details in rc) each piece j illt ilffi rtl . e a+t #,, v 464 s8.f suction catheter, sterile. size: f g 14 (details in rc) each piece t#fu,.#.ll 465 s8.g suction catheter, sterile. size: f g 16 (details in rc) each piece t,lr*: ffir1a ,6^/ 466 s8.h suction catheter, sterile. size: f g 18 (details in rc) each piece 467 s8.i suction catheter, sterile. size: f g 20 (details in rc) each piece 468 59.c catheter,size 16(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 469 s9.d catheter,size 18(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 470 s10.a lnfant feeding tube size 10fg(details in rc) each piece 471. s10.b lnfant feeding tube size 8fg(details in rc) each piece 472 s10.c lnfant feeding tube size 5fg(details in rc) each piece 473 s11 perfusion set with airway and needle,(adult use) sterile disposable(details in rc) unit 474 s12 perfusion set (lnfusion set)with airway and needle (paediatric use)sterile disposable(details in rc) unit 475 s13 lnfusion set with microdrip,(1.v.)sterile disposable(details in rc) unit 476 s14 lnsulin syringe (40 units)with (fixed) 30 g needle shall conforn to ls 12227 unit 477 s15.c sterile disposable (single use) teflon/ptfe l.v. cannula with integrated 3 way stop cock.size 20 g (details in rc) each piece 478. s15.d sterile disposable (single use) teflon/ptfe l.v. cannula with integrated 3 way stop cock.size 22g (details in rc) each piece 479 sl5.e sterile disposable (single use) teflon/ ptfe l.v. cannula without port size 24g (details in rc) each piece 480 s17.a nasal oxygen set, twin bore all sizes adult (details in rc) each piece 481 s17.b nasal oxygen set, twin bore all sizes paediatrics (details in rc) each piece e* t. ri 482 s18 paper adhesive plaster 1 inch x 9.0 mts (with cutter) non woven adhesive tape u nit f( ffi ffih,)#) 483 s19 paper adhesive plaster 2 inch x 9.0 mts (with cutter) non woven adhesive tape unit 484 s20 paper adhesive plaster 3 inch x 9.0 mts (with cutter) non woven adhesive tape unit 485 s21 plaster of paris bandage t5cmx2.7 mts/roll unit 486 s22 plaster of paris bandage locm x 2.7mts unit 487 s24.b ryles tube / nasogastric tube size: 16 (details in rc) each piece 488 s24.c ryles tube / nasogastric tube size: 18 (details in rc) each piece 489 s26 syringe 2 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) unit 490 s27 syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) unit 491 s28 syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) unit 492 s30.a surgical blade sterile, size 11(details in rc) 100 blades/packet 493 s30.c surgical blade sterile, size 22(details in rc) 100 blades/packet 494 s39.b sterile disposable spinal needle for single use. 25g x31,/2 inch (details in rc) each piece 495 s40 urine collecting bag, disposable 2000 ml(details in rc) unit 496 s43.d endotracheal tube, plain size 4 (details in rc) each piece 497 s43.e endotracheal tube, plain size 4.5 (details in rc) each piece 498 s43.f endotracheal tube, plain size 5 (details in rc) each piece 499 s43.g endotracheal tube, plain size 5.5 (details in rc) each piece 500 s43.h endotracheal tube, plain size 6 (details in rc) each piece 501 s43.i endotracheal tube, plain size 5.5 (details in rc) each piece 502 s44.f endotracheal tube, cuff size 7 (details in rc) each piece s03 s44.g endotracheal tube, cuff size 7.5 (details in rc) each piece s* 4, ^5 h & sllol .15// r azls (tu: oot qfual )_4/ ** s? alpaan gu rll 7/1)crurorq3 / arnlns palpaan asn/ae (rn8tel a1ua15) ajntns ;ecrt:ng alqeqrosqv zu ezs slroj zixi o/i azts (uc az qfual urrug, alpaan bu r!f, 7/1)rruuorq3 alnlns palpaan dsn/de (rn8re:r alr:a15) arntns ;ecr8rn5 alqeqrosqv su zzs slrol zixi o/t azls (ruc gt qfual urx o, alpaan gu rll g/e)oruorq3 arntns palpaan dsn/dg (ln8rel a1ria15) arnlns leorbrn5 alqeqrosqv iu iz9 stunrns jo rsi i acard :ad (a1rqm/anlq) rtt g raureluoc dreqg ozs e4 rad (mo1 gaa/par/uaar3/an 1ql1:e;q r no;o:) futcede3 t11 97 3utt1s alt ql!/irr s8eq rrlse;d le)rpauorg a;qeper8aporg 6ts alard qles (39 ur ;re1a6) ut otrt ralaqlej saa;o1 zois 8rs 1!un (rrrlerpa6) 1sey1 uaeax6 tois lts 1!un (ttnpv)1se4 ua8axg oois 9is alard qlel (39 ur s;re1a6) duel: prol lelrlrqujn ,6s sie sano;3 00tlo xoq rasuadsr6 (39 ur s;re1a6) able 1 azr5a1ua15 uo11xa1e; jaqqnr lejnleu jo apeu sano;e uorleuruexf jaqqnu p06s vt9 sano;3 ooijo xoq rasuadsr6 (39 ur sgrela6) urnrpala azrssano;3 uorleuruexl jaqqnu r06s tts alard qlel ,z or gi (39 ur s;re1a6) sasual jelnlo ejlulvl^lvd pjepuels q88s zts alard lllel s82 o1srz (lu ur s;re1a6) lolrafu; q]!m asual jelnro er]ul alqeplol ].285 iis alard q3el ,z ol8i (39 ur slrelaq) rolcalul qtr!/v asual relnlo erlul alqeploj q18s 0rs alard (39 ur s;rela6xlu ul s;re1a6) (sasrnry io3) alqesodsr6 de3 ;ecr8rn5 q985 60s 1!un (39 ur s1re1a6)(suoa8rn5 :o1) a;qesodsrq de3 ;eor8rn5 e98s b0s alard (3y ur s;re1a6)alqesodsr6 isenl ale1 s8s l0s alard q3el [uus 90s (cu ut s;re1a6) 6 azrs jjnj aqnf leaqlerlopul !tts s0s (lu ut sl!erag) s8 azts jjnf aqnl leaqlellopul a3ard q3el qrts ,os (cu ut s1re1a6) 8 azrs gn3aqn1 leaqlejlopul alard qlel * 524 r13 1x12 foils absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1 u2 cn rb needle4omm length 90 cm r21 non absorbable surgical suture, sterilised needled black braided silk size 3/0(3/8cir reverse cutting needle 26mm, length 76 cm) 1x12 foils s26 r22 non absorbable surgical suture, sterilised needled black braided siik size 210(3/8cir reverse cutting needle 45mm, length 76 cm) 1x12 foils 527 r27 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 2/0 (3/8 cir r cutting needle 45mm length 70 cm.) 1x12 foils 528 r68 absorbable surgical sutu re(synthetic)antibacterial coated sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1 l/2circle ct round bodied 4omm,gs needle,suture length 90 cm 1x12 foils 529 r69 absorbable surgical suture(synthetic)antibacterial with sterilised needled( braided coated polyglactin/polyglycolic acid violet)size ua uz circle ct round bodied 40mm,gs needle,suture length 90 cm lx12 foils 530 r71 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1,1/2 circle reverse cutting,os 40mm, suture length 90 cm 1x12 foils 531 r74 absorbable surgical suture (synthetic)antibacteria i with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 3/o3/8 circle r cutting, ps 1, suture length 70 cm etc ...

Medical And Health Services - Rajasthan

33711883 supply medicines surgical items for jaipuria hospital jaipur 1 oral and topical 2 2% glutarldehyde lotion 3 abiphyline sr 200mg 4 acebrofltne 100 mg 5 aceclotenac and paracetamol tablets aceclotenac 100 mg and paracetarnot 325 mg 8 aceclover+ thiocolside 7 acetazolamide tab ip 250mg 8 acetylcestine 600mg tab 9 activated charcol 10 acyclovir 200mg 11 acyciovir cream 5.5% 12 acyclovir eye ointment 13 acyclovir tab ip 200 mg 14 acyclow tab ip 800 mg 15 albendazole suspension 10 ml 18 albendazole tablets ip 400 mg 17 alkaliser syp 18 allopunncl tablets ip 100 mg 19 alovera+vit e cream 20 alpha methyl dopa250mg 21 alprazolam 0 25mg 22 alprazolam 0 somg solution 24 ambroxol 75, 190 mg, 25 26 amiodarane 100mg amiodarane 200mg 27 amisulphiride 50mg 28 amitriptyline tab ip 25mg film coated 29 amitryptyline 10mg ig arnlodipme and atenolol tablet ( arntoddine bestlate equivalent to amloctipine 5rng, atenolol 50mg ) 31 amlooipine tab ip 2.5 mg 32 amlodipine tab ip 5 mg 33 amoxyclave 375 tab 34 amoxycillin and cloxacillin cap 250 + 250 mg 35 arroxycillin and potassium clavutanate tabs ip 500 mg + 125 mg 36 amoxycillin and potassium clavunate oral suspension 1p 200 mg + 28_5 ml 15 ml { 30m1 bottle ) 37 amoxycillin cap ip 250mg 38 amoxycillin cap ip 500mg 39 arnoxycillin dispersible tablets ip 125 mgg 40 amphotericin b tab 41 ampicillin cap ip 500mg 42 anastrozole 1mg 43 antacid liquid.each sail contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, act / vated polydimelnyl siloxane 50mg 44 antacid tablets formula, esch chewable tablet contains magnesium trisiltate 250 mg dried aluminium hydroxide gel 120 mg peppermint 45 anticold drop 46 anticold syrup each 5 ml contains phenylephrine hydrochloride 2 5mg chlorpheniramine maleate 1 mg and paracetamol 125 mg 47 antioxidant 48 apixapan tab 2 5 mg 49 aripiprazole 10mg , 50 artemether•lumefantr1ne 20mgdt.40mgdt 6qmgdt 51 artesal seath 6f, 5f 52 aspirin delayed release tablet r aspinn gastroresistant tab ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 53 atenotol tab ip 25 mg 54 atenolol tab ip 50 mg 55 atorvastatin tablets ip 40 mg 56 azathioprine tab ip 50 mg 57 azithromycin sw 58 azithromyon tab 100 mg dispersible tabs ( 3 tab strip 10x3x3i 59 azilhrornycin tab ip 500 mg 2 beclomethasone inhalation ip 200mg / dose 61 beclomethasone neomycin and clotnmazole cream ( beclomethasone dipropionate 0 025 %, neomycin sulphate 0 5 % and clotrimazole 1 % 62 benzocaine20%+chlorhexidine gel ( for oral ulcer ) 63 benzyl peroxide 2 5%gel 64 betahletine tab ip 16 mg 65 betahistine tab ip 8 mg r_ betamethasone dipropionale cream ip 0 05% 67 betamethasone lotion ip 0 05 cvo 68 betamethasone tab ip 0.5mg 69 betaxolol eye drops 0 5 oio 70 biot1n+minerals 71 biotin+pantothenic acid 72 brsacodyl tab ip 5 mg 73 black disinfectant fluid ( phenyl ) as per schedule 0 grade ill 74 blu dye 75 brimonidine tartrate & timolol maleate eye drops 0 15% + 0.5% 76 bromofenac 09%eye drop 77 buprenorphine patch 10.20 78 bupropion 250mg tab 79 cabergolin 50 mg 80 calamine lotion ip ( 50 ml ) 81 calcitriol capsules ip 0.25 mcg 82 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 83 calcium calictrol • zinc 84 calcium carbonate and vitamin 03 tablets elemental calcium 500 rig vitamin 03 250 iu calcium with vitamin d tablets usp / calcium and colecalciferol tabtets bp 85 capecitabin 500mg 85 capecitabine 500 mg tab 87 carbamazapine 200mg 88 carboxymethylcellulose sodium lubricant eye drops 0.5 5% 89 carvidilol 3 125mg 2 cefadroxil 125mg dt 91 cefadroxil 250mg dt 92 fixime oral suspension ip 25rngiml ( paediatric drops ) 93 cehxime tab ip 100 mg 94 cetixime tab ip 200 mg etpoaoxime uisperslole i ab 50 mg 96 cefpodoxime+ciav acrd 250 tab 97 cefpodoxime+clav acid 500 tab 98 cefuroxime 500 mg tab 99 cefuroxime axetil tab ip 250 mg 100 ceturoxime•clav acid tab 101 cephalexin cap ip 250 mg 102 cephalexin cap ip 500 mg 103 cephalexin oral suspension ip ep a exin ury syrup , 104 i o cephatexin tablets 125 mg idispersibte tablets ) 105 cepodoxime +clavunic acid l cepodoxime 100mg 107 cepodoxime 200mg 108 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 wo benzocaine 2 7 wo . chiorbutol 5 wt. turpentine an 15 wo 109 cebrizine syrup ip 5rn915 ml 11 ( ) cetirizine tab ip 10mg 111 cratirizine phenytephrine & paracetamol tablets cetirizine 5 mg phenytephnne 10 mg & paracetamol 325 mg tab 112 cewenx ( cervical canoes ) 113 chrkert pox ( vanlixtboovac v ) 114 chloramphenicol+dexamethas oinbe eye ointment 115 chlorthazepoxide tablets ip 10mg 118 chiorhexidine gtuconate solution 5% 117 chlorhexidine mouthwash ip / bcco11;k7— 118 chloroquine phosphate suspension ip 50 mg / 5m1 119 chloroquine phosphate tab ip 250mg ( eq to 155 mg of chloroquine base ) ( film rei2tarl i 120 chlorpheniramine maleate tab ip 4mg 121 chlorprocaine 50mg 122 chk ) orzoxazone diclofenac sodium & paracetamol tablets ( chlwzoxazone 250mg diclotenac sodium 50mg paracetamol 325 mg ) 123 cholecalcrferol granules 60.000 iu / gm 124 cinnanzine tablet ip 75 mg 125 cinnarizine tablets ip 25 mg 4 126 ciproiloxacin 0 3 wo ano dexamethasone 0.1 wo ear drops ciprofloxacin and dexamethasone otic suspension usp 127 cipronoxecin eye drops 0 3 wo womv 128 ciprofloxacin opthalimic ointment 0 3% 129 ciprofloxacin tablet ip 500 mg film coated 130 ciprofloxacin tablets ip 250 mg film coated 131 clindamycin capsule ip 300 mg 132 clindamycin phosphate gel usp i oi 133 clindamycin+adaplane cream 134 clinidine 10 mg 135 clobazam 5mg 136 clobetasol propionate cream 0 05 o / c 137 _ clomifene citrate 50 mg 138 clonazepam 0 5mg 139 clonazepam tab ip 1 mg 140 cionazepam tab ip 1 mg 141 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 142 clopidogrel tab ip 75 mg 143 clotrirnazote cream ip 2% why 144 clolrimazole vaginal tab 500mg 145 coaltar 45+ketaconazole 2% shampoo 146 co tnmoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and suiphamethoxazole 200 mg 147 coug syp dextrometharphen 148 cough syrup each 5 ml contains chlorophenirarnme maleate ip 3 mg, amrnonium chlo•cte 130 mg. sodiur citrate 65 rnsmenthol 0.5 mg, syrup os 149 cream eberconazole 1411 r. fifam itrarcina7c11 f 1% 151 cream vit e+sea butter oil 152 critanitone hydrocortisone 1% cream 153 crotamitone lotion 154 cyclopentolate eye drop 155 danzol 50mg 156 deflazacort 6mg 157 dental gel choline salicylate+benzaikoniurn+lignocaine 158 desmide gel 159 desvenlafaxin 50mg 160 dexamethasone tab ip 0.5 mg 161 i dha drops 162 diclo+para*serra 163 diclo+serra 164 diclofenac gel: diclofenac chetnylamint 1 16%, methyl salicylate 10% linseed 3% menthol 5 5% 165 diclofenac sod + paracetamol tablets diclofenac sod 50 mg + paracetamol 325 mg 166 diciofenac sodium tab ip 50 mgienter v .6101.v ) 168 diclofenc supposter 169 dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg • paracetamol 325 mg tablets 170 choreic:cline hydrochloride and activat dimethicone suspension each ml contains dicyclomine hydrochloride lama activatd dimethicone 40mg 171 dicyclomine oral solution 172 dicyclomine tab ip 10 mg 173 diethylcarbamazapine tab 174 digoxin tab ip 0 25 mg 175 diltiazem gel 176 diltiazem tabs ip 30 mg film coated 177 dinoprostone vaginal pessasary 10mg 178 dompendone ora drops davi ml 4 179 dompendone suspension 5m9, 5m1 180 dompendone tab ip 10 mg 181 dorazolamide eye drop 182 doxycycline cap ip 100 mg 183 doxylamine plus tab 184 drop anticold 185 drop iron folic 2mgjml 166 drop mefenemic acid 187 drop vii 188 drotavenne and mefenamic acid tablets drotavenne 80 mg and mefenamic acid 250 mg 189 drotavenne tab 40 mg 190 dulcolex suppository 191 dulexitine 20 mg 192 duolin respules 193 ear drop oflox+clotrimazole+beclomet ha sone 194 enalapril maleate tab 10 mg 195 enalapnl maleate tab ip 2 5rng 196 enalaprit maleate tab ip 5mg 197 erlotinib 150mg 198 escitalopram tab ip 10 mg 199 esmoprazole tab 200 2o1 etizolam 0 5mg etoricoxib 90 mg tab 202 etoncoxib tab ip 120rng 203 etoncoxib tab ip 60rng 204 etoricoxib+thiocolchicoside 4mg 205 famotdine tab ip 20 mg 206 famobdine tab ip 40 mg 207 febustate 80mg 208 femitral plus budesonide 200 / 400 rotacap / inhaler 209 ii femitral plus fluticasone250 / 500 rotacap / inhaler 210 fenofibrate capsules ip 200 mg 211 fentanyl patch 25.50mg 212 fenticonazole cream 213 ferrous sulphate with folic acid tab ( paediatric ) each film coaled tab containing dried ferrous sulphate ip eqrvalent to 20mg elemental iron and folic acid ip•100 mcg 214 ferrous sulphate with folic acd tab each film coated tab containing dned ferrous sulphate ip•equiv 100 mg elemental iron and folic acid ip 0 5 mg 215 flavoxate tablets 200 mg 216 fluconazole 200mg 217 fluconazole 50mg dt 218 fluconazole eye drops 0 3% 219 fluconazole tablets / capsules ip 150mg 230 fluoxetine cap ip 20 mg 231 flupenth / xol 1 mg...

Medical Health And Family Welfare - Rajasthan

33688505 rate contract for supply of drug injection tablet syrup capsule bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 2 bupivacaine inj ip 0.5% 3 halothane bp 4 isoflurane usp 5 ketamine inj ip 50 mg/ml 6 lignocaine ointment 5 o/o 7 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 8 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg 9 lignocaine gel ip 2% 10 lignocaine inj ip 2 o/o 11 propofol inj ip 10 mg/ml 12 thiopentone inj ip 0.5 g 13 sevoflurane 14 atropine sulphate injection 0.6mg/ml 15 liquid medical oxygen (lmo) 16 diclofenac sodium inj ip 25 mg/ ml (im/iv use) 17 diclofenac gastro resistant tablet ip 50 mg(enteric coated) 18 fentanyl citrate injection ip 2 ml 19 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 20 ibuprofen tab ip 200 mg (coated) 21 ibuprofen tab ip 400 mg (coated) 22 morphine sulphate inj ip 10mg/ml 23 paracetamol drops paediatric paracetamol oral suspension ip(each ml contains paracetamol 150mg) 24 paracetamol syrup ip 125 mg/5ml (detail in rc) 25 paracetamol tab ip 500 mg 26 paracetamol inj. 150 mg/ml 27 pentazocine inj ip 30mg/ml (im/iv use) 28 tramadol cap ip 50 mg 29 tramadol inj 50 mg/ml 30 indomethacin cap ip 25 mg 31 diclofence prolonged release tablet ip 100 mg 32 ibuprofen oral suspension bp /usp 100 mg/ 5 ml 33 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 34 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 35 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 36 etoricoxib tab ip 120mg 37 mefenamic acid tablets bp 500 mg 38 fentanyl citrate injection 50mcg/ml 39 naproxen tablet ip 500mg 40 naproxen tablet ip 250mg 41 etoricoxib tablet ip 90 mg 42 aspirin tablet ip (gastro resistant) 150 mg 43 butorphanol tartrate injection usp 1mg/ml 1ml size 44 diclofenac sodium aqueous injection 75mg/ml 1ml size, iv & im use 45 paracetamol infusion ip 1% w/v 100ml size 46 ketorolac tromethamine dispersible tablet 10 mg(each uncoated dispersible tablet contains ketorolac tromethamine 10 mg) 47 baclofen tablet ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) 48 tizanidine hydrochloride tablet ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg) 49 adrenaline injection ip 1mg/ml im/iv use 50 betamethasone tab ip 0.5mg 51 chlorpheniramine maleate tab ip 4mg 52 dexamethasone inj ip 8mg/2ml 53 dexamethasone tab ip 0.5 mg 54 hydrocortisone sodium succinate injection ip 100 mg base / vial (im/iv use) 55 hydroxyzine tab ip 25 mg 56 methyl prednisolone sodium succinate for injection usp 500 mg 57 pheniramine inj ip 22.75mg /ml 58 prednisolone tab ip 5 mg 59 promethazine syrup ip 5 mg/5ml 60 promethazine inj ip 25mg/ml 61 promethazine tab ip 25 mg 62 betamethasone sod phos inj ip 4mg/ml 63 prednisolone tablet ip 10 mg 64 prednisolone tab ip 20 mg 65 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg 66 cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg,phenylephrine 10 mg & paracetamol 325 mg tab 67 cetirizine syrup ip 5mg/5 ml 68 levoceitrizine tablet 5mg 69 montelucast(10mg) + levocetrizine tablet (5mg) 70 dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) 71 naloxone inj ip 0.4mg/ ml 72 pralidoxime chloride injection ip 25 mg/ml / 500 mg 73 acetylcystine solution usp (injection) 200 mg/ml 74 carbamazepine tab ip 200 mg 75 carbamazepine tab ip 100 mg 76 phenobarbitone tab ip 30 mg 77 phenytoin injection bp 50mg/ml 78 phenytoin oral suspension ip 25mg/ml 79 phenytoin tab ip 100 mg (film coated) 80 sodium valproate inj 100 mg/ ml 81 sodium valproate gastro resistant tablets ip 200 mg 82 phenobarbitone inj ip 200mg/ml 83 carbamazepine oral suspension usp 100 mg/5ml 84 sodium valproate oral solution ip 200 mg / 5 ml 85 sodium valproate tablet(gastro resistant) ip 500mg 86 clobazam tablet/capsule 5 mg 87 clobazam tablet/capsule 10 mg 88 levetiracetam tablet ip 500 mg 89 levetiracetam oral solution/suspension 100mg/ml 90 levetiracetam injection 500mg/5ml 91 gabapentine tablet/capsule 100mg 92 gabapentine tablet/capsule 300mg 93 lamotrigine tablet ip 50 mg (each sustained releasetablet contains lamotrigine ip 50 mg) 94 divalproex extended release tablet ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) 95 oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) 96 lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100 mg) 97 topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) 98 acyclovir oral suspension ip 400mg/5ml 99 acyclovir tab ip 200 mg 100 acyclovir tab ip 800 mg 101 albendazole oral suspension ip 400 mg/10ml 102 albendazole tablets ip 400 mg(detail in rc) 103 amikacin inj ip 100 mg 104 amikacin inj ip 500 mg 105 amoxycillin and cloxacillin cap 250 + 250 mg 106 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg 107 amoxycillin cap ip 250mg 108 amoxycillin cap ip 500mg 109 amoxycillin dispersible tablets ip 125 mg 110 amphotericin b inj ip 50 mg 111 ampicillin injection ip 500 mg 112 azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 113 azithromycin tablets ip 250mg 114 azithromycin tab ip 500 mg 115 benzathine benzylpenicillin inj ip 12 lac units 116 benzathine benzylpenicillin inj ip 6 lac units 117 cefixime tab ip 100 mg 118 cefixime tab ip 200 mg 119 cefoperazone and sulbactum for inj (cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm)(im/iv use) 120 cefotaxime injection ip 1 g 121 cefotaxime inj ip 250 mg 122 ceftazidime inj ip 1g 123 ceftazidime inj ip 250 mg 124 ceftazidime inj ip 500 mg 125 ceftriaxone inj ip 1g /vial 126 ceftriaxone inj ip 250 mg/vial 127 ceftriaxone inj ip 500mg/vial 128 cephalexin cap ip 250 mg 129 cephalexin cap ip 500 mg 130 chloroquine phosphate inj ip 40 mg/ ml 131 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 132 chloroquine phosphate suspension ip 50 mg/5ml 133 ciprofloxacin injection ip 200mg/100ml 134 ciprofloxacin tablets ip 250 mg film coated 135 ciprofloxacin tablet ip 500 mg film coated 136 clotrimazole cream ip 2% w/w 137 clotrimazole vaginal tab ip 500mg 138 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 139 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 140 diethylcarbamazine tab ip 100 mg 141 doxycycline cap ip 100 mg 142 fluconazole tablets ip 150mg 143 gentamycin injection ip 80mg/2ml (im/ iv use) 144 griseofulvin tab ip 125 mg 145 itraconazole cap 100 mg 146 meropenem inj ip 500 mg 147 metronidazole inj ip 500 mg/100ml 148 metronidazole benzoate oral suspension ip 100 mg of base/5ml 149 metronidazole tablets ip 200 mg (film coated) 150 metronidazole tablets ip 400 mg (film coated) 151 norfloxacin tab ip 400mg film coated 152 ofloxacin tab ip 200 mg 153 primaquine tab ip 2.5 mg 154 primaquine tab ip 7.5 mg 155 quinine dihydrochloride inj ip 300 mg/ml 156 quinine sulphate tablets ip 300 mg (film coated) 157 ampicillin cap ip 500mg 158 nitrofurantoin tab ip 100mg 159 cloxacillin sodium inj ip 500mg 160 cephalexin oral suspension ip (cephalexin dry syrup ip) 125mg/ 5 ml 161 ofloxacin oral suspension ip 50mg/ 5ml 162 tinidazole tab ip 300 mg (film coated) 163 tinidazole tab ip 500 mg (film coated) 164 piperacillin + tazobactum for injection ip 4gm+500mg 165 amoxycillin oral suspension ip (dry syrup) 125 mg/5ml 166 cefpodoxime dispersible tab 50 mg 167 cephalexin tablets 125 mg (dispersible tablets) 168 meropenem inj. ip 1gm 169 acyclovir intravenous infusion ip 250mg 170 acyclovir intravenous infusion ip 500mg 171 amikacin inj ip 250 mg 172 amoxicillin and potassium clavulanic ip inj 600mg 173 amoxicillin and potassium clavulanate inj ip 1.2gm 174 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg/5 ml (30ml bottle) 175 artesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o/o w/v (1ml ampoule),sodium chloride injection ip 0.9o/o w/v (5ml ampoule) 176 aztreonam injection usp 500 mg 177 cefepime injection ip 500 mg 178 cefixime oral suspension ip 25mg/ml (paediatric drops) 179 cefuroxime axetil tab ip 250 mg 180 clindamycin capsule ip 150mg 181 clindamycin capsule ip 300 mg 182 levofloxacin tablets ip 250 mg 183 linezolid tablets ip 600 mg 184 linezolid inj 200mg/100ml 185 mefloquine tablets ip 250 mg 186 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 187 ofloxacin infusion ip 200mg / 100 ml(in nacl inj) 188 vancomycin for intravenous infusion ip 500 mg 189 vancomycin for intravenous infusion ip 1 gm 190 artemether and leumefantrine tablet (80 mg and 480 mg) 191 co trimoxazole tablet ip (trimethoprim 160mg+sulphamethoxazole 800mg) 192 aztreonam injection 1gm 193 framycetin sulphate cream 1 o/o 30gm pack 194 framycetin sulphate cream 1 o/o 100 gm pack 195 artemether and leumefantrine tablet (40 mg and 240 mg) 196 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 197 piperacillin injection 2 gm + tazobactom 250mg ip 198 ceftriaxone 1 gm + tazobactum 125 mg injection 199 cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) 200 cefadroxil tablet 500 mg 201 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size 202 levofloxacin tablet ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) 203 faropenem tablet sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) 204 clindamycin phosphate injection ip 300 mg 205 imipenem + cilastatin injection 500mg/500mg ip powder for solution 206 polymixin sulphate b injection usp 5 lac i.u. 207 meropenem injection ip 250 mg 208 colistimethate injection ip 1m iu powder for solution 209 voriconazole injection 200mg/vial 210 terbinafine hydrochloride tablet 250 mg 211 valganciclovir tablet 450 mg 212 entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) 213 ganciclovir sodium injection 500mg (lyophilized powder for reconstitution) 214 azathioprine tab ip 50 mg 215 bleomycin injection ip 15mg (bleomycin sulphate injection 15 units) 216 chlorambucil tab ip 5 mg 217 cisplatin inj ip 50 mg/ 50 ml 218 cyclophosphamide inj ip 200 mg 219 cyclophosphamide inj ip 500 mg 220 cytarabine injection bp 500mg 221 danazol cap ip 50 mg 222 daunorubicin inj ip 20 mg 223 doxorubicin inj ip 50 mg/ 25 ml 224 etoposide inj ip 100 mg 225 fluorouracil inj ip 250 mg/ 5ml 226 l asparaginase inj 10000 iu 227 leucovorin calcium inj ip / calcium folinate inj ip 10 mg /ml 228 melphalan tab ip 5 mg 229 mercaptopurine tab ip 50 mg 230 methotrexate inj ip 50 mg/2 ml 231 methotrexate tab ip 2.5 mg 232 paclitaxel inj ip 260 mg 233 paclitaxel inj ip 100 mg 234 tamoxifen tab ip 10 mg 235 vinblastine inj ip 10mg/ 10ml 236 vincristine inj ip 1mg(vial)/vincristin injection usp 1mg/ml (amp) 237 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit 238 carboplatin injection ip 150 mg 239 carboplatin injection ip 450 mg 240 cisplatin inj ip 10 mg/10 ml 241 dacarbazine injection 500 mg usp/ bp 242 filgrastim injection ip (granulocyte colony stimulating factor) (sc/iv use) 300 mcg 243 gemcitabine for injection 200 mg 244 gemcitabine for injection ip 1gm 245 ifosfamide injection ip/bp/usp 1gm 246 imatinib tab ip 400mg 247 methotrexate tablets ip 10 mg 248 mitomycine injection ip 10 mg/mitomycine for injection usp 10 mg 249 oxaliplatin injection usp 50 mg 250 cyclosporin capsule usp/ip 50 mg 251 procarbazine hydrochloride capsule usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) 252 bendamustine injection 100 mg 253 capecitabine tablet ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) 254 letrozole tablet ip 2.5 mg (each film coated tablet contains letrozole ip 2.5 mg) 255 temozolomide capsule ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) 256 bortezomib injection 2mg 257 abiraterone acetate tablet ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) 258 lomustine capsule ip 40 mg (each capsule contains lomustine ip 40 mg) 259 thalidomide capsule usp 100 mg (each hard gelatin capsule contains thalidomide usp 100 mg) 260 bevacizumab injection 400 mg 261 bevacizumab injection 100 mg 262 cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) 263 gefitinib tablet ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) 264 mycophenolate mofetil capsule/tablets ip 250 mg (each capsule/tablets conatin mycophenolate mofetil ip 250 mg) 265 tacrolimus capsule ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) 266 mycophenolate sodium tablet 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) 267 bicalutamide tablet ip 50 mg (each film tablet contains bicalutamide ip 50 mg) 268 6 thioguanine tablet usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) 269 zoledronic acid injection ip 4mg vial 270 dasatinib tab 100 mg 271 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg 272 levodopa and carbidopa tab 250 mg+ 25 mg 273 trihexyphenidyl hcl tab ip 2 mg 274 bromocriptine tablets ip 2.5 mg 275 acenocoumarol tab ip/ nicoumalone tab ip 2 mg 276 deferasirox tab 100 mg 277 deferasirox tab 500 mg 278 deferiprone cap 250 mg 279 deferiprone cap 500 mg 280 desferrioxamine injection ip 500 mg / vial (for i.m. inj and i.v s.c. infusion) 281 dried human anti haemophlic fraction ip (dried factor viii fraction ip) 250 iu/ vial (iv use) 282 enoxaparin sodium inj ip 60 mg 283 ethamsylate inj 250 mg/ 2ml (im/iv) 284 heparin sodium inj ip 5000 iu/ml (im/iv use) 285 human albumin solution ip 20% 286 rh erythropoetin inj ip 10000 iu 287 rh erythropoetin inj ip 2000iu 288 rh erythropoetin inj 4000 iu 289 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. (aqueous solution) 290 polygeline 3.5% solution with electrolytes for i.v. infusion 291 factor ix concentrate (purified) ip 500 600 i.u.(human coagulation factor ix) 292 anti inhibitor coagulation complex (human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial) 293 hydroxyethyl starch (130/0.4) 6 o/o w/v with sodium chloride 0.9 o/o w/v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 294 tranexamic acid tablets ip 500 mg 295 warfarin sodium. tab ip 5mg 296 vitamin k 1 (phytomenadione) ip 1mg/0.5ml injection (detail in rc) 297 dried factor viii fraction ip (iv use) 500 iu/vial 298 dried factor viii fraction ip (iv use) 1000 iu/vial 299 recombinant coagulation factor viia 1mg 300 recombinant coagulation factor viia 2mg 301 n butyl alcohol injection 0.26mg/5ml, citric acid 2.5mg/5ml and sod. chloride solution 5 ml size 302 ethamsylate tablet 500 mg (each uncoated coated tablet contains ethamsylate 500 mg) 303 feracrylum 1% w/v sterile solution 100 ml 304 tranexamic acid injection ip 100mg/ml 5ml size 305 recombinant f ix 500 iu with diluent 306 3rd generation recombinant f viii 250 iu with diluent 307 3rd generation recombinant f viii 1000 iu with diluent 308 amiodarone tab ip 100 mg 309 amiodarone tab ip 200 mg 310 amiodarone hydrochloride inj 50 mg/ml 311 amlodipine tab ip 2.5 mg 312 amlodipine tablets ip 5 mg 313 atenolol tab ip 50 mg 314 atorvastatin tab ip 10mg 315 clopidogrel tab ip 75 mg 316 digoxin inj ip 0.25 mg/ml 317 digoxin tab ip 0.25 mg. 318 diltiazem tabs ip 30 mg film coated 319 dobutamine inj ip 50mg/ml/250mg (vial/)dobutamine inj ip 250 mg/5ml(amp) 320 dopamine hydrochloride inj ip 40 mg/ml 321 enalapril maleate tab ip 5mg 322 enalapril maleate tab ip 2.5mg 323 isosorbide dinitrate tab ip 5 mg 324 isosorbide mononitrate tabs ip 20 mg 325 lisinopril tab ip 5 mg 326 losartan tab ip 50 mg 327 magnesium sulphate inj. ip 500mg/ml (50%w/v) 328 methyldopa tab ip 250mg film coated 329 nifedipine cap ip 5mg 330 nifedipine tablets ip 10 mg (sustained release) 331 nitroglycerin inj 5 mg/ ml 332 propranolol tab ip 40 mg 333 streptokinase injection 15 lac units ip 334 verapamil tab ip 40 mg film coated 335 labetalol tab ip 100mg 336 labetalol hcl inj ip 20mg/4ml 337 aspirin delayed release tablet / aspirin gastroresistant tab ip (each enteric coated tablet contains acetyl salicylic acid 75 mg) 338 amlodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) 339 losartan potassium and amlodipine tablets ip (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) 340 losartan potassium and hydrochlorothiazide tablets ip(losartan potassium 50 mg, hydochlorothiazide 12.5 mg) 341 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg 342 amlodipine and atenolol tablet (amlodipine besilate equivalent to amlodipine 5mg,atenolol 50mg) 343 atenolol tab ip 25 mg 344 enalapril maleate tablets ip 10 mg 345 lisinopril tablets ip 10 mg 346 lisinopril tab ip 2.5 mg 347 losartan tab ip 25 mg 348 adenosine injection ip 6 mg/2ml 349 atorvastatin tablets ip 40 mg 350 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 351 fenofibrate capsules/ tab ip 200 mg 352 isoprenaline injection ip 2mg / ml 353 metoprolol tablets ip 25 mg 354 metoprolol succinate extended release tablets ip 50 mg 355 noradrenaline injection ip 2 mg/ml 356 prazosin tablets (extended release) 2.5 mg 357 telmisartan tablets ip 40 mg 358 urokinase injection 5 lac unit (lyophilized) 359 ramipril tablets ip 2.5 mg 360 glyceryl trinitrate tablets 2.6 mg controlled release tablets 361 clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) 362 sotalol hydrochloride tablet usp/bp 40mg (each film coated tablet contains sotalol hydrochloride usp/bp 40mg) 363 esmolol hydrochloride injection 10mg/ml 10ml size 364 sodium nitroprusside injection 25mg/ml 2ml size 365 carvedilol tablet 3.125 mg 366 rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) 367 rosuvastatin tablet 10 mg 368 sacubitril 24 mg and valsartan 26 mg tablet 369 chlorhexidine mouthwash ip 0.2 o/o 370 dental gel choline salicylate 8.7 o/o, benzalkonium chloride 0.01 o/o, lignocaine hcl 2 o/o (flavoured gel base) 371 tooth gel sodium monofluorophosphate 0.7 o/o and potassium nitrate 5 o/o (in flavoured base) 372 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 373 metronidazole 1% and chlorhexidine gluconade 0.25% gel 374 compound benzoic acid ointment ip benzoic acid 6 o/o + salicylic acid 3 o/o 375 acyclovir cream 5% 376 cetrimide cream ip 15 gm 377 fusidic acid cream ip 2% 378 glycerin ip 400 gm 379 liquid paraffin ip 400 ml 380 miconazole nitrate cream ip 2% 381 povidone iodine ointment 5% 15 gm 382 neomycin bacitracin and sulphacetamide powder (neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg) 383 silver sulphadiazine cream ip 1% 50gm tube 384 gentian violet topical solution usp 1o/o 385 clotrimazole mouth paint (clotrimazole 1 o/o w/v) 386 beclomethasone, neomycin and clotrimazole cream (beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 %) 387 gamma benzene hexachloride lotion 1%(lindane lotion usp) 388 betamethasone dipropionate cream ip 0.05% 389 betamethasone lotion ip 0.05 o/o 390 clindamycin phosphate gel usp 1 o/o 391 clobetasol propionate cream ip 0.05 o/o 392 glycerin ip 100 ml 393 ketoconazole cream 2% 394 permethrin lotion 5% 395 permethrin cream 5% 396 tretenoin cream usp 0.025% 397 coal tar 6% & salicylic acid 3% ointment 398 calamine lotion ip 100ml 399 powder clotrimazole 1% w/w 30 gm 400 terbinafine cream 1%w/w (10 gm tube) 401 olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size 402 oitment mupirocin ip 2% 403 anti a blood grouping serum ip(anti a monoclonal serum) 404 anti b blood grouping serum ip(anti b mono clonal serum) 405 anti d(rh) blood grouping serum ip/anti d blood grouping serum ip 406 diatrizoate meglumine & diatrizoate sodium inj usp 60% (iodine conc.= 292 mg/ml) 407 diatrizoate meglumine and diat sod inj usp 76%w/v (iodine = 370 mg/ml) 408 gadodiamide inj. 0.5mml/ml vial 409 vdrl antigen (with + ve and ve control) / rpr slide kit 410 iohexol usp (solution for injection) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml 411 iohexol usp(solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. 412 multistix test strip 413 povidone iodine solution ip 5 % 500 ml 414 compound benzoin tincture ip 415 formaldehyde solution (34.5 per. 38 per.) 416 gluteraldehyde solution 2% 417 hydrogen peroxide solution ip 6 o/o (20 vol) 418 lysol (cresol with soap solution) ip (cresol 50 o/o + soap 50 o/o) 419 povidone iodine scrub solution / cleansing solution 7.5 o/o w/v povidone iodine (suitable for hand wash) 420 surgical spirit ip (500 ml) 421 chlorhexidine gluconate solution 5% 250 ml 422 surgical spirit ip (100 ml) 423 povidone iodine solution ip 5% 100ml bottle 424 povidone iodine ointment usp 250 gm 425 povidone iodine solution ip 10 % 426 silver sulphadiazine cream ip 1% 500 gm jar 427 acetazolamide tab ip 250mg 428 frusemide tab ip 40 mg 429 furosemide injection ip 10mg/ml (im and iv use) 430 hydrochlorthiazide tab ip 12.5 mg 431 mannitol inj ip 20% w/v 432 spironolactone tab ip 25mg 433 torsemide tab 10 ip mg 434 hydrochlorthiazide tab ip 25mg 435 torsemide inj 10 mg/ml 436 spironolactone tablets ip 50 mg 437 ciprofloxacin 0.3 o/o and dexamethasone 0.1 o/o ear drops ciprofloxacin and dexamethasone otic suspension usp 438 clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops 439 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 440 ceruminolytic drops (wax dissolving ear drops) paradichlorobenzene 2 o/o , benzocaine 2.7 o/o , chlorbutol 5 o/o, turpentine oil 15 o/o 441 drotaverine hydrochloride inj 40 mg/2 ml 442 ointment containing lidocaine ip 3 o/o zinc oxide ip 5 o/o , hydrocortisone ip 0.25 o/o, allantoin ip 0.5 o/o 443 antacid tablets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 444 antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 445 bisacodyl tab ip 5 mg 446 dicyclomine tab ip 10 mg 447 dicyclomine inj ip 10 mg /ml 448 dicyclomine hydrochloride oral solution ip 10mg /5ml 449 domperidone suspension ip 5mg/5ml 450 domperidone tab ip 10 mg 451 hyoscine butylbromide inj ip 20 mg/ ml 452 loperamide tab ip 2 mg 453 metoclopramide inj ip 10mg/2ml 454 metoclopramide tab ip 10 mg 455 omeprazole cap ip 20 mg 456 ondansetron inj ip 2mg/ml 457 ors powder ip 458 pentoprazole inj 40 mg 459 ranitidine hcl injection ip 50mg/2ml 460 ranitidine tab ip 150mg film coated 461 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o/o disodium hydrogen phosphate dodecahydrate 8 o/o 462 hyoscine butyl bromide tablets ip 10mg 463 drotaverine tab ip 40 mg 464 ranitidine tab ip 300mg film coated 465 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 466 dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 467 metoclopramide hydrochloride syrup ip 5 mg/ 5ml 468 domperidone oral drops 10mg/ ml (10ml) 469 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 470 lactic acid bacillus tab 60 million spores 471 lactulose solution usp/bp 10gm/15ml or 3.35 gm/5ml 472 liquid paraffin ip 100 ml 473 ondansetron orally disintegrating tablets ip 4mg 474 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 475 ursodeoxycholic acid tablets ip 300 mg 476 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 477 prochlorperazine mesylate injection 12.5mg/ml 5ml size 478 probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 479 mesalamine tablet usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) 480 allopurinol tablets ip 100 mg 481 hydroxychloroquine sulphate tablets 200mg 482 leflunomide tablets ip 10mg(film coated) 483 leflunomide tablets ip/usp 20mg (film coated) 484 sulfasalazine gastroresistant tablets ip 500 mg ip 485 biphasic isophane insulin inj ip (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) 486 carbimazole tabs ip 5 mg (film coated) 487 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg/ml 488 clomifene tab ip 25 mg 489 clomiphene tab ip 50 mg 490 conjugated estrogen tabs usp 0.625 mg. 491 dinoprostone cream/ gel 0.5 mg dinoprostone in syringe 492 ethinyloestradiol tabs ip 50 mcg 493 glibenclamide tab ip 5 mg 494 gliclazide tab ip 40 mg 495 glimepiride tab ip 2 mg 496 glimepiride tab ip 1mg 497 glipizide tab ip 5mg 498 hydroxyprogesterone inj ip 250mg /ml 499 isophane insulin inj ip 40 iu /ml 500 metformin tab ip 500 mg(film coated) 501 norethisterone tab ip 5 mg 502 pioglitazone tab ip 15 mg 503 progesterone inj 200 mg/ 2ml 504 insulin injection ip (soluble insulin/neutral insulin injection)40 iu/ml(r.dna origin) 505 thyroxine sodium tablets ip 100mcg 506 metformin hydrochloride(sustained release tablets ip 1000 mg 507 glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) 508 glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg (sustained release) 509 metformin hcl (sustained release) and glimepiride tab metformin hcl (sustained release) 500mg ,glimepiride 1mg 510 metformin hydrochloride (sustained release) and glimepiride tablets ip (metformin hydrochloride(sustained release) 500 mg, glimipiride 2mg) 511 glimepiride, pioglitazone and metformin hydrochloride (sustained release) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride (sustained release) 500 mg 512 gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 500 mg) 513 glucagon for injection usp 1 mg/ml 514 medroxyprogesterone acetate tablets ip 10 mg 515 thyroxine tablets ip 50 mcg 516 octreotide injection 50 mcg/ml 517 insulin glargine 3ml (100iu/ml) with 15 insulin syringes and needles/cartridge 3ml (100iu/ml) with 15 needles and 1 pen per 20 cartridges 518 tenaligliptin tablet ip 20mg 519 insulin glargine 10 ml vial (100 iu/ml) with 30 insuline syringes with needle 520 human anti d immunoglobulin injection 300mcg (im use) 521 human anti d immunoglobulin 150 mcg 522 human rabies immunoglobulin inj 150 iu/ ml 523 rabies vaccine human (cell culture) ip (intradermal) 2.5 iu 524 rabies vaccine human (cell culture) ip (intramuscular) 2.5 iu/ dose 525 snake venum anti serum ip (lyophilized)polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum,0.45 mg of common kraite(bungaras)venum(details in rc) 526 tetanus immunoglobulin ip 250 iu/ vial 527 tetanus vaccine (adsorbed) ip 5 ml vial 528 rabies antiserum ip (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (i.m./sc use) 529 diphtheria antitoxin 10000 iu 530 hepatitis b immunologlobin injection ip 200 i.u 531 human immunoglobulin inj with 12%igm,12%iga,76%igg in pack of 10ml(0.5gm) 532 atracurium inj 10 mg/ml 533 glycopyrrolate inj ip 0.2 mg/ml 534 midazolam inj ip 1 mg/ml 535 neostigmine inj ip 0.5 mg/ml 536 neostigmine tab ip 15 mg 537 succinylcholine inj. ip 50 mg/ml (iv use) 538 valethamate bromide inj 8mg / ml 539 vecuronium bromide for injection 4mg (freeze dried) 540 chlorzoxazone , diclofenac sodium & paracetamol tablets (chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg) 541 neostigmine injection ip 2.5mg/5ml 542 cis atracurium besylate injection 2 mg/ml in 5 ml vial 543 tropicamide eye drop ip 1o/o 544 atropine eye ointment ip 1% 545 atropine sulphate ophthalmic solution usp 1% 546 chloramphenicol eye drops ip 0.5 0/0 547 ciprofloxacin eye drops ip 0.3 o/o w/v 548 ciprofloxacin ophthalmic ointment usp 0.3% 549 hydroxypropylmethyl cellulose solution 20 mg/ ml 550 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o/o +0.1 o/o 551 tobramycin eye drops 0.3% [331] 552 tobramycin ophthalmic ointment usp 0.3% 553 flurbiprofen sodium ophthalmic solution ip 0.03 o/o w/v 554 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. 555 lidocaine hcl topical solution usp 4% 556 fluconazole eye drops 0.3% 557 timolol eye drops ip 0.5 o/o w/v 558 homatropine eye drops ip 2% 559 travoprost eye drops ip 0.004 o/o 560 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 561 betaxolol eye drops 0.5 o/o 562 carboxymethylcellulose eye drops ip 0.5% 563 phenylephrine hydrochloride opthalmic solution usp/phenylephrine eye drops bp 5% 564 acyclovir eye ointment ip 3% w/w 5gm size 565 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size 566 chloramphenicol 1% w/w eye ointment ip, 3gm size 567 isoxsuprine inj ip 5 mg/ml 568 isoxsuprine tab ip 20 mg 569 methylergometrine inj ip 0.2 mg/ml 570 methylergometrine tab ip 0.125 mg 571 misoprostol tab ip 200 mcg 572 oxytocin inj ip 5 iu/ml 573 mifepristone tab ip 200mg 574 natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron ip 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron ip 200 mg) 575 cabergoline tablet ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) 576 human chorionic gonadotropin injection ip 5000 i.u. 577 leurprolide acetate depot 3.75 mg 578 leurprolide acetate depot 11.25 mg 579 alprazolam tab ip 0.25 mg 580 alprazolam tab ip 0.5mg 581 amitriptyline tab ip 25mg film coated 582 chlordiazepoxide tablets ip 10mg 583 chlorpromazine tablets ip 100 mg (coated tablet) 584 chlorpromazine tablets ip 25 mg (sugar coated) 585 chlorpromazine tablets ip 50 mg (coated tablets) 586 chlorpromazine inj. ip 25mg/ml 587 diazepam inj ip 10mg/2ml (1m/iv use) 588 diazepam tab ip 5 mg 589 escitalopram tab ip 10 mg 590 fluoxetine cap ip 20 mg 591 haloperidol inj ip 5 mg/ml 592 haloperidol tab ip 1.5 mg 593 haloperidol tab ip 5 mg 594 imipramine tab ip 25 mg (coated tab) 595 imipramine tab ip 75 mg (coated) 596 lithium carbonate tab ip 300 mg 597 lorazepam inj ip 2 mg/ml 598 olanzapine tab ip 5 mg 599 risperidone tab 2mg 600 risperidone tab 1 mg 601 sertraline tab ip 50 mg 602 trifluperazine tab ip 5 mg coated 603 quetiapine tablet ip 50mg 604 quetiapine tablet ip 25mg 605 clonazepam tablet 0.5 mg 606 levosulpiride tablet 25 mg (each uncoated tablet contains levosulpiride 25 mg) 607 lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) 608 zolpidem tablet 5 mg 609 aminophylline inj ip 25 mg/ml 610 beclomethasone inhalation ip 200 mcg/dose 611 budesonide nebulizer suspension 0.25mg/ml 612 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg,ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup q.s. 613 ipratropium bromide nebulizer solution 250 mcg/ ml 614 salbutamol tablet ip 4 mg 615 salbutamol inhalation 100 mcg /dose 616 salbutamol nebuliser solution bp 5 mg/ml 617 salbutamol tab ip 2 mg 618 theophylline and etofylline injection (anhydrous theophylline 50.6mg + etofylline 169.4 mg) 619 theophylline and etofylline tablets (theophylline ip 23mg + etofylline 77 mg) 620 theophylline tablet 400mg sustained release/ controlled release (theophylline prolonged released tablet ip) 621 salbutamol syrup ip 2mg/ 5ml 622 dextromethorphan hbr syrup ip 13.5mg / 5ml 623 saline nasal solution (drops) (sodium chloride 0.65 o/o) 624 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 625 budesonide powder for inhalation 200 mcg 626 ipratropium powder for inhalation ip 40 mcg 627 terbutaline tablets ip 2.5 mg 628 xylometazoline nasal drops ip 0.1% 629 cough syrup/expectorant(50) ml 630 acebrophylline tablet/capsule 100 mg 631 compound sodium lactate inj. ip 632 dextrose inj ip 25% w/v 633 dextrose inj ip 10% 634 dextrose inj ip 5% 635 multiple electrolytes and dextrose injection type i ip (electrolyte p injection ) 636 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 637 potassium chloride inj. 0.15 gm/ml 638 potassium chloride oral solution u.s.p 500mg/ 5ml 639 sodium chloride and dextrose injection ip 0.9 o/o + 5 o/o 640 sodium chloride inj ip 500 ml 641 sodium chloride injection ip 100 ml 642 ringer acetate infusion 500 ml 643 sodium chloride 0.45% w/v polypack 500 ml 644 finasteride tablets ip 5 mg 645 tamsulosin hcl tablets/capsule 0.4 mg 646 flavoxate tablets ip 200 mg (coated tablet) 647 savelamer carbonate tablet 400 mg (each film coated tablet contains savelamer carbonate 400 mg) 648 sodium bicarbonate tablet usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) 649 levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatin levamisol hydrochloride ip 50 mg) 650 phenazopyridine tablet 5 mg 651 dutasteride tablet 0.5 mg 652 alkylizer syrup 1.4 gm/5 ml( 100 ml )(disodium hydrogen citrate) 653 betahistine tab ip 8 mg 654 betahistine tab ip 16 mg 655 cinnarizine tablets ip 25 mg 656 cinnarizine tablet ip 75 mg 657 ascorbic acid tab ip 500 mg 658 calcium gluconate inj ip 10% (iv use) 659 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 660 ferrous sulphate with folic acid tab (paediatric) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 661 folic acid tab ip 5 mg 662 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 663 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 664 vitamin b complex inj nfi 665 vitamin b complex tablet nfi (prophylactic) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg (with appropriate overages) 666 vitamin a paediatric oral solution ip(vitamin a concentrate oil ip)each ml contains vitamin a 100000 iu 667 calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 668 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 669 zinc sulphate dispersible tablets ip elemental zinc 10 mg 670 iron sucrose injection usp/bp 20mg/ml (for iv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 671 calcium with vitamin d tablets usp /calcium and colecalciferol tablets bp/calcium and vitamin d3 tablets ip(elemental calcium 500 mg, vitamin d3 250 iu) (non chewable) 672 cholecalciferol granules 60,000 iu /gm 673 mecobalamin inj 500 mcg/ml 674 pyridoxine tablet ip 10 mg 675 pyridoxine tablet ip 40mg 676 thiamine tablets ip 100 mg 677 calcitriol capsules ip 0.25 mcg 678 methyl cobalmine tablet 500mcg 679 methyl cobalmine tablet 1500mcg 680 vitamin d3 oral solution 60000 iu 681 ferric carboxymaltose injection 50 mg/ml 10 ml size 682 multi vitamin syrup 683 flunarizine tab 5 mg 684 black disinfectant fluid (phenyl) as per schedule o grade iii 685 conc haemodialysis fluid b.p acetate concentrate 10 litre can 686 peritonial dialysis solution ip 687 sodium bicarbonate inj ip 7.5% w/v 688 water for inj ip 689 alendronate sodium tablets usp / bp 35 mg 690 mannitol with glycerin injection 10 o/o + 10 o/o w/v (for intravenous infusion) 691 normal human intravenous immunoglobulin 5g/100ml 692 pregabalin cap ip 75 mg 693 surfactant for intratrecheal instillation (natural bovine lung surfactant) 694 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans 695 intravenous fat emulsion 20% w/v 250ml 696 pyridostigmine tablet ip 60 mg (each tablet contains pyridostigmine ip 60 mg ) 697 caffeine citrate usp injection 20mg/ml (equivalent to 10 mg caffeine base/ml) 3ml size 698 amino acid 10% injection 100ml size 699 vitamin e capsule 400 mg 700 inj poractant alpha 80 mg/ml in pack of 1.5 ml (detail in rc) 701 oseltamivir capsule ip 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) 702 oseltamivir capsule ip 45 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg) 703 oseltamivir capsule ip 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) 704 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 705 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 706 act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and pyrimethamine(250mg+12.5mg) 707 act kit containing 3 tablets of artesunate(50 mg each) and 1 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 708 act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of sulphadoxine and pyrimethamine(750mg+37.5mg) 709 act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 710 each combi bliste pack: containing 3 tablets of artesunate(200 mg each) and 2 tablet of sulphadoxine pyrimethamine(750mg+37.5mg)each or 3 tablets of sulphadoxine pyrimethamine(500+25)mg 711 liposomol amphotericine injection b 50mg 712 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 40 mm length 76 cm) size 1/0 713 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 20 mm length 76 cm) size 3/0 714 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 2/0 715 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 1/0 716 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 40mm length 76 cm) size 1/0 717 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 30 mm length 76 cm) size 2/0 718 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 45 mm length 100 cm) size 1 719 absorbable surgical suture (sterile catgut), needled suture chromic size 3/0 (3/8 cir rcutting needle 26mm, length 76 cm) 720 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 3/0 1/2cir rb needle 20mm length 70 cm 721 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 30mm length 90 cm 722 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)1/2 cir rb needle size 1/0 30mm length 90 cm 723 absorbable surgical suture (synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 1 1/2 cir tapercut needle (heavy) 40mm length 90 cm 724 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1 1/2 cir rb needle40mm length 90 cm 725 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0(1/2 cir conventional 25mm length 90 cm)undyed 726 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 4/0 (1/2 cir rb needle 20mm length 70 cm) 727 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 40mm l 90cm 728 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1/0(1/2 cir rb needle 40mm length 90 cm) 729 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0 3/8 circle cutting needle 22mm length 45 cm 730 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 4/0 3/8 circle cutting 16mm needle,suture length 70cm 731 chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm) size 5/0 (details in rc) 732 chromic catgut suture(3/8 cir cutting needle 8 mm, suture length 35 cm) size 6/0 (details in rc) 733 chromic catgut suture(3/8 cir r cutting needle 19 mm needle, suture length 76 cm) size 4/0 (details in rc) 734 non absorbable surgical suture, sterilised needled black braided silk size 3/0(1/2 cir rb needle 20mm, length 76 cm) 735 non absorbable surgical suture, sterilised needled black braided silk size 3/0(3/8cir reverse cutting needle 26mm, length 76 cm) 736 non absorbable surgical suture, sterilised needled black braided silk size 2/0(3/8cir reverse cutting needle 45mm, length 76 cm) 737 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 8/0 (3/8 cir micropoint round body ,6mm length 38 cm) 738 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 3/0 (3/8 conventional cutting needle 16mm length 70 cm) 739 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 4/0 (3/8 conventional cutting needle 19mm length 60 cm.) 740 non absorbable surgical suture,sterilised needled polyamide monofilament black (nylon)size 5/0(3/8 cir slim blade cutting needle 15mm length 70 cm) 741 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 2/0 (3/8 cir r cutting needle 45mm length 70 cm.) 742 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 1/0 (3/8 cir r cutting needle 45mm length 70 cm.) 743 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb 13 mm needle,length 75cm) double arm 744 non absorbable surgical suture,sterilised needled monofilament polypropylene blue (3/8cir rb 16 mm needle,length 90 cm)size 6/0 745 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 7/0 (3/8cir rb double 8mm needle, length 60 cm) 746 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(3/8cir rb 16 mm needle, length 70 cm) 747 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1/0(1/2 cir rb needle 30mm length 90 cm) 748 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1(1/2 cir rb heavy needle 45mm length 90 cm) 749 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb double needle 17mm length 90 cm)(detail in rc) 750 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 cir tapercut double needle 17mm length 70 cm)(detail in rc) 751 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, length 90 cm) double arm 752 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 cir rb needle 30mm, length 90 cm) 753 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir tapercut needle 17mm length 75 cm) double arm 754 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0(1/2 cir tapercut needle,25 mm length 90 cm) double arm 755 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 6/0(3/8 cir conventional cutting pc 3needle 15mm length 60cm) 756 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6/0(3/8 cir rb 13mm needle, length 90 cm double arm 757 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 4/0(1/2 cir rb needle 16 mm length 70 cm) 758 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0(3/8 cir cutting needle 25mm length 45 cm) 759 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir rb heavy 40mm, length 90 cm) 760 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir reverse cutting, 45 mm needle length 100 cm) 761 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 8/0 (3/8 cir rb , 8mm double needle, suture length of 70cm) 762 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 circle tapercut 13mm double needle 70cm) 763 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 5/0 (1/2 circle cc 13mm needle, suture length of 70cm) double arm 764 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 circle tapercut needle 17mm suture length of 90cm) double arm 765 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, suture length of 75cm) double arm 766 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/ blue size 4/0(1/2 cir tapercut ,17 mm double needle, length 75 cm) 767 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2/0 (1/2 cir tapercut ,17 mm double needle, length 90 cm) 768 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/blue size 2/0(1/2 cir tapercut ,17 mm double needle, length 90 cm)(detail in rc) 769 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2/0 1/2 circle taper cut,17mm double armed needle,suture length of 90cm with pledgets size 6 x 3 x 1.5mm 770 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2 0 1/2 circle taper cut,25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 771 non absorbable surgical suture, sterilised needled coated polyster braided, green/white or blue/white coated polyster braided (green / blue) with size 3/0 1/2 circle tapercut double needle 25mm,suture length 90 cm 772 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 10/0 (3/8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 773 b.b silk suture (3/8 cir rb needle 20mm, length 76 cm size 4/0 (details in rc) 774 b.b silk suture (3/8 cir rb needle 16mm, length 76 cm size 5/0 (details in rc) 775 absorbable surgical sutures,sterilised needled polyglecaprone/polyglyconate,monofilament sutures size 2/0 (1/2 circle oval rb needle 26mm needle,suture length of 70cm) 776 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate,size 3/0 (1/2 circle ovalrb contrast needle 26mm, suture length 70cm) 777 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 4/0 (1/2 circle cutting 16mm needle,suture length 70cm) 778 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 3/0 (3/8 circle cutting 25mm needle, suture length of 70cm) 779 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1 (1/2 circle reverse cutting 50 mm length 90cm) 780 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 2/0 (1/2 circle rb 31mm needle, length 70cm) 781 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1/0(1/2 circle rb 30mm needle,length 70cm) 782 absorbable surgical suture(synthetic)antibacterial coated sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 783 absorbable surgical suture(synthetic)antibacterial with sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1/0 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 784 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 2/0 1/2 circle round bodied 30mm, suture length 90 cm 785 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1 1/2 circle reverse cutting,os 40mm, suture length 90 cm 786 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 1/0 1/2 circle reverse cutting 36mm, os needle, suture length 90 cm 787 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture(braided coated polyglactin/polyglycolic acid violet)size 3/0 1/2 circle round bodied 20mm, suture length 70 cm 788 absorbable surgical suture (synthetic)antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 3/0 3/8 circle r cutting, ps 1,24mm, suture length 70 cm 789 absorbable gelatin sponge 80 x 50x 10mm(details in rc) 790 no item 791 asepto syringe with transparent bulb sterile, 60 ml 792 blood administration set blood transfusion set (details in rc) 793 gloves size 6.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 794 gloves size 6.5 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) 795 gloves size 7 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 796 gloves size 7 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) 797 gloves size 7.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 798 gloves size 7 .5inches,powder free (disposablesterile surgical rubber gloves)(details in rc) 799 suction catheter, sterile.size: fg 5 (details in rc) 800 suction catheter, sterile. size: f g 6 (details in rc) 801 suction catheter, sterile. size: f g 8 (details in rc) 802 suction catheter, sterile. size: f g 10 (details in rc) 803 suction catheter, sterile. size: f g 12 (details in rc) 804 suction catheter, sterile. size: f g 14 (details in rc) 805 suction catheter, sterile. size: f g 16 (details in rc) 806 suction catheter, sterile. size: f g 18 (details in rc) 807 suction catheter, sterile. size: f g 20 (details in rc) 808 suction catheter, sterile. size: f g 22 (details in rc) 809 catheter,size 8(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 810 catheter,size 10(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 811 catheter,size 16(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 812 catheter,size 18(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 813 catheter,size 20(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 814 catheter,size 22(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 815 catheter,size 24(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 816 infant feeding tube size 10fg(details in rc) 817 infant feeding tube size 8fg(details in rc) 818 infant feeding tube size 5fg(details in rc) 819 perfusion set with airway and needle,(adult use) sterile disposable(details in rc) 820 perfusion set (infusion set) with airway and needle (paediatric use)sterile disposable(details in rc) 821 infusion set with microdrip,(i.v.)sterile disposable(details in rc) 822 insulin syringe ( 40 units) with (fixed) 30 g needle shall conforn to is 12227 823 sterile disposable (single use) teflon/ptfe i.v cannula with integrated 3 way stop cock size 16g (details in rc) 824 sterile disposable (single useteflon / ptfe i.v. cannula with integrated 3 way stop cock.) size 18g (details in rc) 825 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 20 g (details in rc) 826 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 22g (details in rc) 827 sterile disposable (single use) teflon/ ptfe i.v. cannula without port size 24g (details in rc) 828 mucus extractor sterile(details in rc) 829 nasal oxygen set, twin bore all sizes adult (details in rc) 830 nasal oxygen set, twin bore all sizes paediatrics (details in rc) 831 paper adhesive plaster 1 inch x 9.0 mts (with cutter) non woven adhesive tape 832 paper adhesive plaster 2 inch x 9.0 mts (with cutter) non woven adhesive tape 833 paper adhesive plaster 3 inch x 9.0 mts (with cutter) non woven adhesive tape 834 plaster of paris bandage 15cm x 2.7 mts/roll 835 plaster of paris bandage 10cm x 2.7mts 836 ryles tube / nasogastric tube size: 10(details in rc) 837 ryles tube / nasogastric tube size: 12(details in rc) 838 ryles tube / nasogastric tube size:14 (details in rc) 839 ryles tube / nasogastric tube size: 16 (details in rc) 840 ryles tube / nasogastric tube size: 18 (details in rc) 841 scalp vein set (disposable) size 18g (details in rc) 842 scalp vein set (disposable) size 20g (details in rc) 843 scalp vein set (disposable) size 22g (details in rc) 844 scalp vein set (disposable) size 24 g (details in rc) 845 syringe 2 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 846 syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 847 syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 848 syringe 20 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 849 surgical blade sterile, size 11(details in rc) 850 surgical blade sterile, size 15(details in rc) 851 surgical blade sterile, size 22(details in rc) 852 suture needles curved 1/2 circle round body assorted size 11 15(details in rc) 853 suture needles curved 1/2 circle round body assorted size 1 5(details in rc) 854 suture needles curved 1/2 circle round body assorted size 16 20(details in rc) 855 suture needles curved 1/2 circle round body assorted size 6 10(details in rc) 856 suture needles curved and cutting 1/2 circle cutting size 6 10(details in rc) 857 suture needles curved and cutting 1/2 circle size 11 15(details in rc) 858 suture needles curved and cutting 1/2 circle size 16 20(details in rc) 859 suture needles curved and cutting size 1 5(details in rc) 860 sterile disposable spinal needle for single use. 22g x 3 1/2 inch (details in rc) 861 sterile disposable spinal needle for single use. 25g x 3 1/2 inch (details in rc) 862 urine collecting bag, disposable 2000 ml(details in rc) 863 double j stent, sterile, both ends open size 4f, length 16 cm 864 double j stent, sterile, both ends open, size 5f, length 20 cm 865 double j stent, sterile, one end closed size 4f, length 16 cm 866 double j stent, sterile, one end closed, size 5f, length 20 cm 867 endotracheal tube, plain size 2.5 (details in rc) 868 endotracheal tube, plain size 3 (details in rc) 869 endotracheal tube, plain size 3.5 (details in rc) 870 endotracheal tube, plain size 4 (details in rc) 871 endotracheal tube, plain size 4.5 (details in rc) 872 endotracheal tube, plain size 5 (details in rc) 873 endotracheal tube, plain size 5.5 (details in rc) 874 endotracheal tube, plain size 6 (details in rc) 875 endotracheal tube, plain size 6.5 (details in rc) 876 endotracheal tube, plain size 7 (details in rc) 877 endotracheal tube, plain size 7.5 (details in rc) 878 endotracheal tube, plain size 8 (details in rc) 879 endotracheal tube, plain size 8.5 (details in rc) 880 endotracheal tube, cuffed size 4 (details in rc) 881 endotracheal tube, cuff size 4.5 (details in rc) 882 endotracheal tube, cuff size 5 details in rc 883 endotracheal tube, cuff size 6 (details in rc) 884 endotracheal tube, cuff size 6.5 (details in rc) 885 endotracheal tube, cuff size 7 (details in rc) 886 endotracheal tube, cuff size 7.5 (details in rc) 887 endotracheal tube, cuff size 8 (details in rc) 888 endotracheal tube, cuff size 8.5 (details in rc) 889 endotracheal tube, cuff size 9 (details in rc) 890 tracheostomy tube, plain all sizes(details in rc) 891 tracheostomy tube (pvc), cuffed all sizes(details in rc) 892 abdominal drain kit (with collection bag 2000 ml size 24 (details in rc) 893 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) size 28 (details in rc) 894 abdominal drain kit,sterile,having drainage cather and collection bag(2000) ml size 32 (details in rc) 895 corrugated drainage sheet all sizes(details in rc) 896 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm 897 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm 898 sterilized umbilical cotton tape width 3 mm, length 75 cm(details in rc) 899 bone wax sterilised 900 temporary cardiac pacing wire (electrode) sterile â½ cir, tapercut, 26 mm; reverse cutting 60 mm 901 skin graft knife blade (sterile)(details in rc) 902 k wire, length 375 mm; 1mm(details in rc) 903 k wire, length 375 mm; 1.6mm(details in rc) 904 k wire, length 375 mm; 1.8mm(details in rc) 905 face mask, disposable(details in rc) 906 surgical cap disposable (for surgeons)(details in rc) 907 surgical cap, disposable (for nurses) (details in rc)(details in rc) 908 foldable intra ocular lense with injector (details in rc) 11 to 17.5 909 foldable intra ocular lense with injector (details in rc) 18 to 24 910 foldable intra ocular lense with injector (details in rc) 24.5 to 28.5 911 standard pama intra ocular lenses (details in rc) 11 to 17.5 912 standard pama intra ocular lenses (details in rc) 18 to 24 913 standard pama intra ocular lenses (details in rc) 24.5 to 28.5 914 disposable sterile surgical rubber gloves size 8 inches,powdered 915 disposable sterile surgical rubber gloves size 8 inches,powder free 916 rubber examination gloves, non sterile, extra small(details in rc) 917 rubber examination gloves,size small (details in rc) 918 rubber examination gloves,size medium (details in rc) 919 rubber examination gloves made of natural rubber latex, non sterile, size large (details in rc) 920 pressure monitoring line / high pressure extension line (details in rc) 921 urine collecting bag for new born /paediatric urine collection bag, capacity 100ml (details in rc) 922 umbilical catheter for new born, all sizes (details in rc) 923 umbilical cord clamp (details in rc) 924 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property(details in rc) 925 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 16 (details in rc) 926 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 18 (details in rc) 927 t tube for common bile duct drainage, length 20x60 cm, size (details in rc) 928 bone cement 929 sanitary napkin beltless(details in rc) 930 sanitary pads belt type(details in rc) 931 sanitary napkin beltless with wings (details in rc) 932 oxygen mask (adult) 933 oxygen mask (pediatric) 934 foleys catheter no. 14 (detail in rc) 935 nelaton catheter size 14 fg(detail in rc) 936 ecg electrode (detail in rc) 937 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 (detail in rc) 938 sterile hypodermic syringe with needle attached, 22g, single use 50 ml (detail in rc) 939 urethral catheter 90 (fg 14) made up of medical grade pvc (detail in rc) 940 urethral catheter 91 (fg 10), made up of medical grade pvc (detail in rc) 941 vaccum suction set, 2.5 meter length (detail in rc) 942 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile (detail in rc) 943 vascular catheter with metal guide no. 16, double lumen size 30 cm (longline iv) (detail in rc) 944 vascular catheter with metal guide no. 18 double lumen size 30 cm (longline iv) (detail in rc) 945 vascular catheter with metal guide no. 20 double lumen size 30 cm (longline iv) (detail in rc) 946 vascular catheter with metal guide no. 22 double lumen size 30 cm (longline iv) (detail in rc) 947 vascular catheter with metal guide no. 16 double lumen size 45 cm (longline iv) (detail in rc) 948 vascular catheter with metal guide no. 18 double lumen size 45 cm (longline iv) (detail in rc) 949 vascular catheter with metal guide no. 20 double lumen size 45 cm (longline iv) (detail in rc) 950 vascular catheter with metal guide no. 22 double lumen size 45 cm (longline iv) (detail in rc) 951 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements (detail in rc) 952 3 way stop cock with extension tube (vein o extension line) size 10cm (non pyrogenic & single use) (detail in rc) 953 3 way stop cock with extension tube (vein o extension line) size 50cm (non pyrogenic & single use) (detail in rc) 954 3 way stop cock with extension tube (vein o extension line) size 100cm (non pyrogenic & single use) (detail in rc) 955 3 way stop cock with extension tube (vein o extension line) size 150cm (non pyrogenic & single use) (detail in rc) 956 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 16) (detail in rc) 957 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) (detail in rc) 958 nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube (detail in rc) 959 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property (detail in rc) 960 sterile disposable (single use teflon/ptfe i.v cannula with integrated 3 way stop cock size 26g (detail in rc) 961 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for ventilator without vent (detail in rc) 962 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for ventilator without vent (detail in rc) 963 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for bipap with vent (detail in rc) 964 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for bipap with vent (detail in rc) 965 niv mask (noninvasive ventilation mask) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support (detail in rc) 966 nebulization mask adult (detail in rc) 967 nebulization mask paediatric (detail in rc) 968 chemotherapy port and non coring needles(adult) (detail in rc) 969 chemotherapy port & non coring needles(pediatric) (detail in rc) ...

Indian Army - Rajasthan

33662472 supply of consumables and expendable medical stores , acarbose 25 mg tab , accucheck active glucostrips bott of 50 , aceclofenac 100mg + paracetamol 100 mg+ serratiopeptidase 15 mg tab , actime (6x5 ml) , activated charcol 200 mg cap , adrenaline tartrate (1:1000) ampoule of 1ml inj , alendronate sodium (oesteofos) 35 mg tab (pkt of 7 tablets) , amisulpride 50mg tab , amlodipine besylate 10 mg tab , amlodipine besylate 2.5 mg tab , amytriptilline 10 mg tab , antacid gel containing oxetacaine 10 mg,aluminium hydroxide 0.291 g,magnesium hydroxide 98 mg (mucaine gel) bott of 200 ml , antacid gel each 5ml containing dried aluminium hyroxide gel ip 250mg, magnesium hydroxide nf 250mg and methyl polysiloxane 50mg bott of 200 ml syp , antioxidant capsules containing tocotrienols 40% 12.5mg, resveratrol 5mg, lutein 5mg, astaxanthin 5% 4mg, zeaxanthin 1mg, zinc 12mg, copper 2mg capsules. , antispasmodic cap containing dicyclomine hcl 10mg, dextroprop oxyphen hcl 65mg acetaminophen ip 400mg , antispasmodic drop bott of 15ml , apixaban 2.5 mg tab , aquasoft cream 100 gm , armodafinil 150 mg tab , artemether 80mg/ml, 1ml inj , atenolol 50mg + amlodipine 5 mg tab , atomoxetin 10 mg , azithromycin syp bott of 15 ml , b 12, 500 mcg/ml inj , baclofen 10 mg tab , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcg inhaler , beclomethasonedipropionate nasal apray50 mcgperdose metereddose150 units , benzathiazide 25 mg + triamterene 50mg tab , benzathine penicillin 12,00,00 unit inj , benzocaine 20%,pecatin based ,oral ointment tube of 5 gm , benzoyl peroxide 5% tube of 20 gm. , bisacodyl tab 5 mg(perpn:tab) , bisoprolol 2.5 mg tab , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bottle of 120ml , bupivacaine hcl 0.5% vial of 20 ml inj , calcium chloride (10x10) , calcium gluconate 10% in 10 ml amp inj , carboxy methyl cellulose 1% eye drop bott of 5 ml eye drop , carvedilol 6.25 mg tab , chloramphenicol5% w/vclotrimazole 1% w/vbetamethasone 0.25 % w/vlignocaine hcl 2%w/vin bott of 5 ml ear drop , chlordiazepoxide 10 mg tab , chlorhexidine gluconate solution equivalent to 4% w/v surgical scurb , chloroquine phosphate (containing 50 gm base per 5 ml) bottle syrup , chloroxylenol solution potassium hydroxide 13.6 gm, chlaroxylenon sol , chlorzoxazone 500mg+ diclofen sodium 50 mg+ paracetamol 325 mg tab , cilinidipine 10 mg tab , cissus quadrangularis extract, acacia catechu extract & mangifera indiaca bark extract capsules. , clindamycin 100mg+clotrimazole 100mg vaginal pessary , clobetasol propionate cream + gentaycin +miconazole tube of 20 gm oint , clomipramine hcl 25 mg tab , clonazepam 1 mg tab , clonazepam 2 mg tab , coenzyme q10 (100 mg) + dehydroepiandrosterone (micronized 75mg) + melatonin (3mg) cap , common cold tab (antihistiminics + paracetamol 500 mg without pseudoephedrine) , conjugated estrogen 0.625 mg(premarin) tab , control ddimer n+p 5x1 ml ,5x1ml , corn cap pkt of 4 , curcumin capsule , cyclopentolate 1% eye drop , cyclophosphamide 50 mg tab , dapagliflozin 10 mg tab , darbepoietin alfa 60 inj , deflazacort 6mg, tab , desvenalafaxine 50 mg tab , dexmedetomidine 100mcg/ml inj , dextrose 50% inj in amp of 25ml , dichlorobenzyl 2 4,alcohol and amylmetacresol cough lozenges , diclofenac 25 mg/ml ip inj amp of 3 ml inj , diclofenac diethylamine ip1.16% w/v containing virgin linseed oil bp 3%, methyl salicylate ip 10% w/w, menthol ip 5% propellant spray 100 gm bott. , diclofenac gel 1%, linseed oil, methyl salicylate, menthol tube of 30gm , digoxin 0.25 mg tab , digoxin 0.5 mg, 2 ml inj , digoxin syp/ elixir 0.05mg /ml in 30 ml syp , dilator trachea with spring 12.5 cm long ss , diltiazem 5mg/ml inj , dinoprostone gel 0.5 mgpfs , dinoprostone vaginal insert , disposable port 7mm for laparoscopic surgery , divalproate sodium 500mg tab , dopamine hcl40 mg/ml, 5ml inj , doxepin 25 mg cap , doxophyllin sr 650 mg tab , doxophylline 400 mg tab , drotaverine hcl 80 mg tab , duloxetine 20 mg tab , dura protector , dydrogesterone tab , e/d fluromethalone 0.1% , e/d olaptadine 0.2% , ear buds bott of 100 , ecg roll (large one) 210 mm x 20 mtr , entrogermina 5 ml amp , ether solvent , ethinyl estradiol 0.035 mg,cyproterone acetate 2 mg (pack of 21 or 28 tablets without or with placebo). , etophyllin bp 84.7mg and theophyllin inj ip 25.3mg per 2ml amp , etoricoxib 120 mg tab , etrocoxib 60 mg tab , eye drop hydroxypropylmethylcellulose 0.3% , sodium perborate(preservative free) 10ml , eye drop nepafenac suspension 0.1% , febuxostat 40 mg tab , fenofibrate 145mg tab , fexofenadine hydrochloride tab 120 mg , flunarzine 10 mg tab , fluoxetine hcl 20 mg cap , flurbiprofen eye drop , folic acid 5 mg tab , formeterol fumerate 6 mcg and budesonide 200 mcg inhaler , formetrol 6 mcg+budesonide rotacaps 200 mcg bott of 30 , frusemide 20 mg + spironolactone 50 mg tab , fsh 75 iu inj , gaba benzene hexa chloride lotion 100ml bott , gabapentin 300 mg + methylcobalamin 500 mcg capsule , glucosamine 250mg+ chondroitin sulphate 200 mg cap , glucosamine sulphate, acetyl 11, keto beta boswellic acid, berberis vulgaris root extract, resveratrol tablets , glucose powder(dextrose monohydrate for oral use in pack of 100 gm) , glutaraldehyde2% (cidex) jar of 5 ltr , glycerin bott of 200 ml , haematinic tab/cap containing ferrous fumarate, vit b 12 , folic acidan(autrin) , haemorrhoidal rings (pkt of 25) , haloperidol 5 mg tab , heparin 5000 iu/ml inj , homatropine 2% eye drop , human chorionic gonadotrophin 2000 iu inj , human chorionic gonadotrophin 5000 iu inj , human rabies immunoglobulin 2 ml (300 iu) , hydrochlorothiazide 12.5 mg tab , hydroxyprogesterone caproate ip 500 mg inj , hydroxyprophyl methylcellulose usp 2% w/v (max visc)for intra ocular use , hydroxyprophyl methylcellulose(hypermellous) solution usp (gental) eye drop , ibuprofen + paracetamol bott of 60 ml syp , imipramine 25 mg tab , indicator soda lime , indomethacin 75mg cap , inj isoxsuprine hydrochloride 10mg amp of 2ml , inj ketamine hcl 50 mg/ml vial of 2 ml , inj morphine 15 mgin 1 ml amp , insulin lispro 100 iu/ml 3 ml inj , insulin pen needle , ipratropium bromide respiratory solution 250 mcg/ml vial of 15 ml , iron sucrose 20 mg/5 ml inj , isabgol/isphagula husk 3.5gm sachet , isonized300 mg tab , isotretinion 20 mg tab , isoxsuperine hcl 5 mg/ml amp of 2 ml inj , isoxsuprine hydrochloride10 mg tab , ketoconazole shampoo bott of 75 ml , labetalol hcl 4 ml amp inj , lacosamide 100 mg tab , lactocalamine lotion bott of 120 ml , lamotrigine 25 mg tab , lamotrigine 50 mg tab , laryngoscope cell 1.5 vdia13 mm and length 51 mm for , leflunomide 10 mg tab , leflunomide 20mg tab , levetericetam 500 mg tab , levocartinine 500 mg tab , levonorgestrel iu system , levosulpride 50 mg tab , lignocaine 10% spray , lignocaine hcl solution 2% for iv use, vial of 50 ml , lina retractor , linctus cough syrup paediatric,bottle of 100 ml , linezolid infusion 200 mg to 300mg/100 ml inj , lopinavir 200mg + ritonavir 50mg tab , lorazepam 1 mg tab , lorazepam 2mg/ml, 2 ml inj , lotepredenoletabonate 0.5 eye drop bott of 5 ml , lulliconazole tube of 20 gm oint , magnesium sulphate 50% inj , mefenemic acid 500mg cap , mefnamic acid syp 50 mg bott of 60 ml syp , melatonin tablets , memantine 10mg tab , mephenteramine 30 mg/ml,10 ml inj , mesalamine suppository , mesalmine 1.2 gm tab , metformin 1000 mg + glimipride 2 mg tab , methimazole 10 mg tab , methotraxtate 5 mg tab , methotrexate sodium 50mg, 2 ml inj , methyldopa 500 mg tab , methylergometrine 0.2 mg/ml, 1 ml amp inj , metoclopramide hcl 5mg/ml, 2ml inj , metoprolol1mg/ml amp of 5 ml inj , metronidazole + norfloxacin syp bott of 30 ml , miconazole nitrate 2% creamskin tube of 15 gm , microlyte cal a (280 ml) , microlyte cal b (280 ml) , microlyte deproteinizer , micronized purified flavonoid fraction 500 mg tab , midazolam 1 mg / ml 10 ml vial inj , misoprost 200 mg tab , montelukast 10mg + levocetrizine 5mgtab , montelukast 4mg + levocetrezine 2.5mg/ml syp , mouth ulcer gel tube of 15 gm , moxifloxacin + prednisolone eye drop , moxifloxacin 0.5 % eye drop , moxifloxacin 0.5 % eye oint , moxifloxacin 0.5 % w/v ear drop , multivitamin bott of 200 ml syp , multivitamin infusion 10 ml inj , n acetylcystene 200 mg/ml amp of 2 ml inj , nasal drop oxymetazoline 0.025% nasal drops , nasal spray buffered hypertonic saline spray 100ml , nasal spray buffered isotonic solution 135ml , nasal spray solspry saline 100 ml/100gm per 100 metered dose , natamycin 5% eye drop , nifedipine retard 20mgcap , nitrocontin 6.4 mg tab , nitrocontine 2.6 mg tab , nitrofurantion 100 mg , nitroglycerine 2.5mg tab , nitroglycerine 5 mg/ml, 5 ml inj , nitroglycerine 5mg patches , nor ethisterone 5 mgtab , normal saline 100 ml pouch collapsable , oxcarbamazepine 150 mg tab , oxytocin 5 units per 1.0ml amp inj , palmitoylethanolamide (pea), scutelleria tablets , pancreatin microspheres 150 mg cap , pantoprazole 40mg+ domeperidone 20mg tab , paracetamol 500mg + dicyclomide hydrochloride 500 mg tab , paracetamol infusion 1000 mg/100 ml bott , paradichlorobenzene,benzocaine,chlorbutol&terpentine oil ear drops 10ml , paraformaldehyde tab , perindopril 4 mg tab , phenytoin sodium vial of 100 mg(sodium dilentin) inj , phytomenadione (vit k) 01 mg/0.5ml inj , phytomenadione (vit k) 10 mg/0.5ml inj , piroxicam tab 20mg , ployethelene glycol 3350 (pegmove) powder for oral solution , pointed needle , poly ethelyne glycole 400 nf 0.4% propyline glucol 0.3%,sorbitol,hp guar,borate polyquad 0.001% 10 ml (systane ultra) eye drop , potassium chloride 50%(intravenous) ampoule of 10ml (1.5g) inj , povidone iodine 2% gargles bottle 100ml , prednisolone20 mg , pregablin 75 mg+ methylcobalamine 1500 mcg tab , primaquine (7.5 mg base) tab , prochlorperazine 5 mg tab , progestrone sustained release 200 mg tab , promethazine hcl 2.5%, 25mgm/ml, 2 ml inj , promethazine+pholcodine bott of 60 ml , proparcaiane 0.5% eye drop , protinex powder bott of 200 gm , prucalpride 2 mg tab , pyrantel pamoate 250 mg / 5 ml suspension , pyrazinamide 0.5 gm tab. , pyrazinamide 1500 mg tab (perpn:tab) , pyridoxine 40 mg tab , quinine dihydrochloride 300mg/ml,2 ml inj , rabies vaccine human ip( purified vero cell rabies vaccine) for intra muscular/intradermal use , rasagaline 0.5 mg tab , rashfree tube of 20 gm oint , rifampicin 150mg cap , rifaximin 550 mg tab , rosuvastatin 20 mg tab , salbutamol inhalation ip 100 mcg/dose inhaler , salbutamol sulphate respirotory solution 5 mg/ml vial of 10 ml , salmeterol25 mcg and fluticasone propionate 250 mcgfor inhaler , septran ds tab , sertaline 25 mg tab , sevelamer 400 mg tab , silodocin 8 mg , silver sulphadazine 1% tube of 25 gm oint , sitagliptin 50 mg tab , sodium bicarbonate 7.5% solution ampoule of 10ml inj , sodium chloride eye drops 5% 5ml bottle , sodium cromoglycate eye drops 2% bottle of 5 ml. , sodium nitroprusside inj , sodium phosphate6% sod acidphosphate 16% enema , sodium valpurate 200 mg bott of 200 ml syp , sodium valpurate 500 mg tab , solifenacin 10mg tab , streptokinase inj. 15 lacs iu/vial. , succinylchloline chloride 50 mg/ml, 2 ml inj , sumatriptan 50 mg tab , suspention of calcium with vita d3 and b12 bott of 200 ml , sylimerin 135 mg tab , syndopa cr 110 mg tab , syndopa cr 125 mg tab , syp iron paed 100 ml , tacrolimus 0.03% to 0.1% (w/w cream 10g), cream , tamoxifen citrate 20 mg tab , telmisartan 20 mg tab , teneligliptin 20 mg tab , terbinafine 1% cream tube of 10 gm , terbinafine hcl tab of 250gm , tetanus toxoid, purified absorbed rubber capped, vial of 5 ml (10 doses) , thiopentone ampoule of 0.5g without water for injection inj , thyroxin sodium 75 mcg , ticagrelor 90 mg tab , tiotropium bromide 18 mcg & formoterol 12 mcg dry powder cap (bott of 15 ) , tobramycin 0.3 %+ fluromethalone acetate eye drop , tofacitinib 5 mg tab , torsemide 20 mg tab , tranexamic acid 500 mg tab , triclofos bott of 30 ml syp , trihexyphenidyl hcl 2 mg , tropicamide 0.8% + phenylpherine 5% eye drop , trypsin chymotrypsin tab , ursodeoxycholic acid 300 mg tab , vasopressin 20 units/ml inj , vecuronium bromide4mg/ml, 1 ml inj , venlafaxine 37.5 mg tab , verapamil 5mg, 2ml inj , vildagliptin 50 mg , vit b12, folic acid inj , vitamin d3 oral drops 800 iu bott of 30 ml , voglibose 0.3 mg tab , zidovudine tab 300 mg , zinc 20 mg / 5ml, bottle of 100 ml syp , zincovit(zinc+vitamin) 200 ml syp , zolpidem 10 mg tab...

Medical College - Rajasthan

33634321 rate contract for antisera and antibiotic discs at microbiology department rate contract for antisera and antibiotic discs at microbiology department , electrical items : , shigella dysenteriae , shigella flexneri , shigella boydii , shigella soneii , salmonella polyvalent h antisera , salmonella polyvalent o antisera , salmonella typhi o 9 antisera , salmonella typhi h a antisera , salmonella typhi h b antisera , salmonella typhi h d antisera , vibrio cholerapolyvalentantisera , vibrio cholera inabaantisera , vibrio cholera ogawaantisera , salmonella sero quick id kit , amphotericin b , clotrimazole , fluconzole ( fluconazoleflc25 mcg ) , griesofulvin , itraconazole , ketoconazole , miconazole , nystatin , terbinafine , voriconazole , amikacin 30 ug , amoxycillin 30 ug , amoxyclav 20 / 10 ug , ampicillin 10 ug , azithromycin 15 ug , cefepime 30 ug , cefixime 5 ug , cefoperazone 75 ug , cefotaxime 30 ug , cefpodoxime 10 ug , ceftazidime 30 ug , ceftriaxone 30 ug , cefuroxime 30 ug , cephalexin 30 ug , chloramphenicol 30 ug , ciprofloxacin 5 ug , clindamycin 2 ug , doxycycline 30 ug , erythromycin 10 ug , furazolidone 50ug , gentamycin ( 10mcg ) , linezolid 30 ug , meropenem 10 ug , netilmycin 30 ug , nitrofurantoin 300 ug , doripenem 10ug , optochin , piperacillin 100 ug , piperacillin + tazobactum ( 100 / 10 ) , tetracycline 30 ug , tiecoplanin 30 ug , tobramycin 10ug , vancomycin 30ug , ofloxacin 5 ug , imipenem 10ug , cefoxitin 30 ug , ceftazidime + clavulanic acid 30+10 , aztreonam 30 ug , penicillin g 10ug , ticarcillin + clavulanic acid ( 75 / 10 mcg ) , cefaclor 30 ug , nitrate reagent disc , dalfopristin 15 ug , carbenicillin100ug , cefdinir 5 ug , clarithromycin 15ug , co trimoxazole 25 ug , fosfomycin 200 ug , fusidic acid 10 ug , levofloxacin 5ug , lincomycin , hi gentamicin 120 ug , moxalactam030 ug , pristinomycin 15 ug , hi streptomycin 180ug , ticarcillin 75ug , spectinomycin 100ug , tigecycline 15 ug , cefotatan 30ug , colistin 10ug , minocycline 30ug , cefoperazone + sulbactum 75 ug / 10ug , novobiocin disc 30 ug , moxifloxacin 5 ug , ertapenem 10ug , polymyxin b ( 300 units ) , rifampicin 5ug , rifampicin 5ug , esbl identification kot ( a ) cefotaxime 30ug & cefotaxime + clavulanic acid 30 + 10mcq ( b ) ceftazidime & ceftazidme + clavulanic ancid 30+10 mcq , e test for cefotaxime , e test for vancomycin , e test for penicillin , e test for tiecoplanin , e test for colistin , mc farland equivalence turbidity standard 0.5 , x factor disc , v factor disc , x+v factor disc , bacitracin ( 0.04 unit ) , bile esculin disc , fluconzole ( 0.016 to 256 mcg / ml ) e strip mic , griesofulvin ( 0.002 to 32 mcg / ml ) e strip mic , itraconazole ( 0.002 to 32 mcg / ml ) e strip mic , terbinafine ( 0.002 to 32 mcg / ml ) e strip mic...

North Western Railway - Rajasthan

33627668 supply of clindamycin 300mg. inj. with solvent.clindamycin 300mg. inj. with solvent., clindamycin 300mg. inj. with solvent. => limited...

Rajasthan University Of Health Science - Rajasthan

33627667 annual rate contract for supply of drug and medicines and surgical items under mndy at ruhs hospital of medical sciences, jaipur hospital of medical sciences, jaipur , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg [2] , bupivacaine inj ip 0.5% [4] , halothane bp [6] , isoflurane usp [7] , ketamine inj ip 50 mg/ ml [8] , lignocaineointment 5o/o [9] , lignocaine and adrenaline inj ipeach ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg [10] , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg [11] , lignocaine gel ip 2% [ 12] , lignocaine inj ip 2 o/o [ 13] , sevoflurane [491] , atropine sulphate injection 0.6mg/ml [654] , diclofenac sodium inj ip 25 mg/ ml (im/iv use) [19] , diclofenac gastro resistant tablet ip 50 mg(enteric coated) [20] , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+ paracetamol25 mg [22] , ibuprofen tab ip 200 mg (coated) [23] , ibuprofen tab ip 400 mg (coated) [24] , morphine sulphate inj ip10mg/ml [25] , paracetamol drops paediatric paracetamol oral suspension ip (each ml contains paracetamol 150mg) [26] , paracetamol syrup ip 125 mg/5ml (detail in rc) [27] , paracetamoltab ip 500 mg [28] , paracetamol inj. 150 mg/ml [29] , tramadol cap ip 50 mg [32] , tramadol inj50 mg/ml [33] , indomethacin cap ip 25 mg [436] , diclofence prolonged release tablet ip 100 mg [437] , ibuprofen oral suspension bp /usp 100 mg/ 5 ml [477] , diclofenac sod + paracetamol tablets ip diclofenac sod50 mg + paracetamol 325 mg [483] , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg [ 492] , diclofenac gel: diclofenac diethylamine 1.16%, methylsalicylate 10%, linseed oil 3%, menthol 5% [493] , etoricoxib tab ip 120mg [495] , mefenamic acid tablets bp 500 mg [496] , fentanyl citrate injection 50mcg/ml [655] , naproxen tablet ip 500mg [656] , naproxen tablet ip 250mg [657] , etoricoxib tablet 90 mg [658] , aspirin tablet ip ( gastro resistant) 150 mg [679] , butorphanol tartrate injection usp 1mg/ml 1ml size[694] , diclofenac sodium aqueous injection 75mg/ ml1ml size, iv & im use [695] , paracetamol infusion ip 1% w/v 100ml size [696] , baclofen tablet ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) [698] , chlorpheniramine maleate tab ip 4mg [37] , dexamethasone tab ip 0.5 mg [40] , hydroxyzine tab ip 25 mg [43] , methyl prednisolone sodium succinate for injection usp 500 mg [ 44] , pheniramine inj ip 22.75mg /ml [45] , prednisolone tab ip 5 mg [47] , promethazine tabip 25 mg [50] , betamethasone sod phos inj ip 4mg/ml [418] , prednisolone tablet ip 10 mg [469] , prednisolone tab ip 20 mg [470] , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg [ 497] , cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab [498] , cetirizine syrup ip 5mg/ 5 ml [499] , levoceitrizine tablet 5mg [659] , montelucast(10mg) + levocetrizine tablet ( 5mg) [660] , dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) [700] , naloxone inj ip 0.4mg/ ml [51] , pralidoxime chloride injection ip 25 mg/ml / 500 mg[52] , carbamazepine tab ip 200 mg (film coated) [ 53] , phenobarbitone tab ip 30 mg [56] , phenytoin injection bp 50mg/ml [57] , phenytoin tab ip 100 , sodium valproateinj 100 mg/ ml [60] , carbamazepine oral suspensionusp 100 mg/5ml [474] , sodium valproate tablet(gastro resistant) ip 500mg [661] , clobazam tablet/ capsule 5 mg [662] , clobazam tablet/ capsule 10 mg [663] , levetiracetam tablet ip 500 mg [664] , levetiracetam oral solution/suspension 100mg/ml [665] , levetiracetam injection 500mg/5ml [666] , gabapentine tablet/ capsule 100mg [667] , gabapentine tablet/ capsule 300mg [668] , divalproex extended release tablet ip 250mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) [702] , oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip150 mg) [703] , lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100 mg) [ 704] , topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) [ 705] , acyclovir oral suspension ip 400mg/ 5ml [62] , acyclovir tabip 200 mg [63] , acyclovir tab ip 800 mg [64] , albendazole oral suspension ip 400 mg/ 10ml [65] , albendazole tablets ip 400 mg(detail in rc) [ 66a] , amikacininj ip 500 mg [68] , amoxycillin and cloxacillin cap 250 +250 mg [69] , amoxycillin and potassium clavulanate tabs ip 500 mg + 125mg [70] , amoxycillin cap ip 250mg [71] , amoxycillin cap ip 500mg [72] , azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) [78a] , azithromycin tablets ip 250mg [79a] , azithromycin tab ip 500 mg [80a] , benzathine benzylpenicillin inj ip 12 lac units [81] , benzathine benzylpenicillin inj ip 6 lac units [82] , cefixime tab ip 100 mg [84] , cefixime tab ip 200 mg [85] , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm) (im/iv use) [86] , ceftazidime inj ip 1g [ 89] , ceftazidime inj ip250 mg [90] , ceftazidime inj ip500 mg [91] , ceftriaxone inj ip1g / vial [93] , ceftriaxone inj ip250 mg/vial [94] , cephalexin cap ip 250 mg [96] , cephalexin cap ip 500 mg [97] , chloroquine phosphate inj ip 40 mg/ ml [98] , ciprofloxacin injection ip200mg/100ml [101] , ciprofloxacin tablets ip 250 mgfilm coated [ 102] , ciprofloxacin tablet ip 500 mg film coated [ 103] , clotrimazole creamip2% w/w [104] , clotrimazole vaginal tab ip500mg [105] , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200mg [107] , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg[108] , diethylcarbamazine tab ip 100 mg [110] , doxycycline cap ip 100 mg [111] , fluconazole tablets ip 150mg [114a] , griseofulvin tabip 125 mg [117] , itraconazole cap 100 mg [118] , meropenem inj ip 500 mg [119] , metronidazoleinjip 500 mg/100ml [120] , metronidazole tablets ip 400 mg (film coated) [123] , norfloxacin tab ip 400mg film coated [ 124] , ofloxacin tab ip 200 mg [125] , primaquine tab ip 2.5 mg [128] , primaquine tab ip 7.5 mg [129] , quinine sulphate tablets ip 300 mg (film coated) [132] , nitrofurantoin tab ip 100mg [413] , cloxacillin sodium inj ip 500mg [417] , cephalexin oral suspension ip ( cephalexin dry syrup ip) 125mg/ 5 ml [427] , ofloxacin oral suspension ip 50mg/ 5ml [428] , tinidazole tab ip 500 mg (film coated) [431] , piperacillin + tazobactum for injection ip 4gm+500mg [468] , amoxycillin oral suspension ip (dry syrup) 125 mg/5ml[473] , cefpodoxime dispersible tab 50 mg [ 475] , meropenem inj. ip 1gm [481] , acyclovir intravenous infusion ip 250mg [502] , amikacin inj ip 250 mg [504] , amoxicillinand potassium clavulanic ip inj 600mg [505] , amoxicillinand potassium clavulanate inj ip 1.2gm [506] , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg/5 ml ( 30ml bottle) [507] , artesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mg vial, sodium bicarbonate injection ip 5 o/o w/v (1ml ampoule),sodium chloride injection ip 0.9o/o w/v (5ml ampoule) [508a] , aztreonam injection usp500 mg [509] , cefixime oral suspension ip 25mg/ml (paediatric drops) [511] , cefuroxime axetil tab ip 250 mg [512] , clindamycin capsule ip 150mg [513] , clindamycin capsule ip 300 mg [514] , levofloxacin tablets ip 250 mg [515] , linezolid tablets ip 600 mg [516] , linezolid inj200mg/ 100ml [517] , mefloquine tablets ip 250 mg [518] , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg [520] , ofloxacin infusion ip 200mg / 100 ml(in nacl inj) [521] , vancomycin for intravenous infusion ip 500 mg [523] , vancomycin for intravenous infusion ip 1 gm [524] , artemether and leumefantrine tablet ( 80 mg and 480 mg) [651] , co trimoxazole tablet ip (trimethoprim 160mg+ sulphamethoxazole800mg) [669] , framycetin sulphate cream 1 o/o 30gm pack [684] , framycetin sulphate cream 1 o/o 100 gm pack [685] , artemether and leumefantrine tablet ( 40 mg and 240 mg) [686] , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg& potassium clavulanate ip 125 mg [706] , piperacillin injection 2 gm + tazobactom 250mg ip [707] , ceftriaxone 1 gm + tazobactum 125 mg injection [708] , cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) [709] , cefadroxil tablet 500mg [710] , ofloxacin oral suspension ip(each 5ml contains ofloxacin ip 100 mg) 30 ml size [711] , levofloxacin tablet ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) [712] , faropenem tablet sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) [713] , clindamycin phosphate injection ip 300 mg [714] , imipenem + cilastatin injection 500mg/500mg ip powder for solution [715] , meropenem injection ip 250 mg [717] , voriconazoleinjection 200mg/vial [720] , terbinafine hydrochloride tablet 250 mg [721] , valganciclovir tablet 450 mg [722] , entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) [ 723] , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution) [724] , azathioprine tab ip 50 mg [133] , cyclophosphamide inj ip 200 mg [138] , danazol cap ip50 mg [ 142] , methotrexate tab ip2.5 mg [154] , imatinib tab ip 400mg [ 534] , methotrexate tablets ip 10 mg [536] , cyclosporin capsule usp/ip 50 mg [677] , cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50mg) [736] , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg [160] , levodopa and carbidopa tab 250 mg+ 25 mg [161] , trihexyphenidyl hcl tab ip 2 mg [162] , bromocriptine tablets ip2.5 mg [540] , acenocoumarol tab ip/ nicoumalone tab ip 2 mg [163] , ethamsylate inj 250 mg/ 2ml (im/iv) [173] , heparin sodium inj ip 5000 iu/ml (im/iv use) [174] , humanalbumin solution ip 20% [175] , rh erythropoetininj ip 10000 iu [176] , rh erythropoetininj ip 2000iu [177] , rh erythropoetininj 4000 iu [179] , vitamin k injection each ml contains menadione sodium bisulphite10mg equivalent to 5.2 mg of menadione. (aqueous solution) [180] , tranexamic acid tablets ip 500 mg [545] , warfarin sodium. tab ip 5mg [546] , ethamsylate tablet 500 mg (each uncoated coated tablet contains ethamsylate 500 mg) [ 745] , tranexamic acid injection ip 100mg/ml 5ml size [747] , amiodaronetab ip 100 mg [181] , amiodarone tab ip 200 mg [182] , amlodipine tabip 2.5 mg [184] , amlodipine tabletsip 5 mg [185] , atenolol tab ip 50 mg [ 186] , atorvastatin tab ip 10mg [187] , clopidogrel tab ip 75 mg [188] , digoxin tab ip 0.25 mg. [190] , diltiazem tabs ip 30 mg film coated [191] , dobutamine inj ip 50mg/ml/250mg (vial/) dobutamine inj ip 250 mg/5ml(amp) [192] , dopamine hydrochloride injip 40 mg/ml [193] , enalapril maleate tab ip 5mg [194] , enalapril maleate tab ip 2.5mg [195] , isosorbide dinitrate tab ip 5 mg [197] , isosorbide mononitrate tabs ip 20 mg [198] , lisinopril tab ip 5 mg [ 199] , losartan tab ip 50 mg [ 200] , magnesium sulphate inj. ip 500mg/ml (50%w/v) [201] , methyldopa tab ip 250mgfilm coated [ 202] , nifedipine cap ip 5mg [ 203] , nifedipine tablets ip 10 mg (sustained release) [204] , nitroglycerininj5 mg/ ml [205] , propranolol tabip 40 mg [207] , streptokinase injection 15 lac units ip [209] , verapamil tab ip 40 mg film coated [211] , labetalol tab ip 100mg [410] , labetalol hcl inj ip 20mg/4ml [411] , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg) [ 444] , amlodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) [457] , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) [458] , losartan potassium and hydrochlorothiazide tablets ip(losartanpotassium 50 mg, hydochlorothiazide 12.5 mg) [459] , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg [460] , atenolol tab ip 25 mg [ 462] , enalapril maleate tablets ip 10 mg [463] , lisinopril tablets ip 10 mg [465] , lisinopril tab ip 2.5 mg [466] , losartan tab ip 25 mg [ 467] , atorvastatin tablets ip 40 mg [548] , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg [549] , fenofibrate capsules/ tab ip 200 mg [550] , metoprolol tablets ip 25 mg [552] , metoprolol succinate extended release tablets ip 50 mg[553] , prazosin tablets ( extended release) 2.5 mg [555] , telmisartan tablets ip 40 mg [556] , urokinase injection 5 lac unit (lyophilized) [ 557] , ramipril tablets ip 2.5 mg [636] , glyceryl trinitrate tablets 2.6 mg controlled release tablets [650] , clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) [751] , esmolol hydrochloride injection 10mg/ml 10ml size [753] , carvedilol tablet 3.125mg [755] , rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) [ 756] , rosuvastatin tablet 10 mg [757] , chlorhexidine mouthwash ip 0.2 o/o [ 580] , dental gel choline salicylate 8.7 o/o, benzalkonium chloride 0.01 o/o, lignocaine hcl 2 o/o (flavoured gel base) [581] , tooth gel sodium monofluorophosphate 0.7 o/o andpotassium nitrate 5 o/o (in flavoured base) [582] , metronidazole 1% and chlorhexidine gluconade 0.25% gel [ 584] , compound benzoic acid ointment ip benzoic acid 6 o/o + salicylic acid 3 o/o [106] , acyclovir cream 5% [ 213] , cetrimide cream ip 15 gm [215a] , fusidic acid cream ip 2 % [216a] , liquid paraffin ip 400 ml [218] , silver sulphadiazine cream ip 1% 50gm tube [224] , gentian violet topical solution usp 1o/o [246] , clotrimazole mouth paint (clotrimazole 1 o/o w/v) [443] , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5% and clotrimazole 1 %) [445] , gamma benzene hexachloride lotion 1%(lindane lotion usp) [ 446] , betamethasone dipropionate cream ip 0.05% [558] , betamethasone lotion ip0.05 o/o [559] , clindamycin phosphate gel usp 1 o/o [560] , clobetasol propionate cream ip 0.05 o/o [561] , glycerin ip 100 ml [564] , ketoconazole cream 2% [565] , permethrinlotion5% [ 568] , permethrin cream 5% [ 569] , tretenoin cream usp 0.025% [570] , coal tar 6% & salicylic acid 3% ointment [670] , calamine lotion ip 100ml [671] , powder clotrimazole 1% w/w 30 gm [759] , terbinafine cream 1%w/ w (10 gm tube) [760] , olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size [761] , oitment mupirocin ip 2% [762] , anti a blood grouping serum ip(anti amonoclonal serum) [ 225] , anti b blood grouping serum ip(anti b mono clonal serum) [226] , anti d(rh) blood grouping serum ip/anti d blood grouping serum ip [227] , vdrl antigen (with + ve and ve control) / rpr slide kit [242] , iohexol usp (solution for injection) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml [482] , iohexol usp(solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. [672] , compound benzoin tincture ip [244] , formaldehyde solution ( 34.5 per. 38 per.) [245] , gluteraldehyde solution 2% [247] , chlorhexidine gluconate solution 5% 250 ml [447] , povidone iodine solution ip 5% 100ml bottle [ 450] , povidone iodine ointment usp250 gm [ 571] , povidone iodine solution ip 10 % [572] , acetazolamide tab ip 250mg [253] , frusemide tab ip 40 mg [254] , furosemide injectionip 10mg/ml (im and iv use) [255] , hydrochlorthiazide tab ip 12.5 mg [256] , mannitol inj ip 20% w/v [257a] , spironolactone tabip 25mg [258] , torsemide tab 10 ip mg [259] , hydrochlorthiazide tab ip 25mg[464] , spironolactone tablets ip50 mg [574] , ciprofloxacin 0.3 o/o and dexamethasone 0.1 o/o ear drops ciprofloxacin and dexamethasone otic suspension usp [585] , clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops [586] , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp [588] , ceruminolytic drops ( wax dissolving ear drops) paradichlorobenzene 2 o/o , benzocaine 2.7 o/o , chlorbutol 5 o/o, turpentine oil 15 o/o [ 589] , drotaverine hydrochloride inj 40 mg/2 ml [5] , ointment containing lidocaine ip 3 o/o zinc oxide ip 5 o/o , hydrocortisone ip 0.25 o/o,allantoin ip 0.5 o/o [219] , antacid tablets. formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil [260a] , antacidliquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide250mg, activatedpolydimethyl siloxane 50mg [261a] , bisacodyl tab ip 5 mg [ 262] , dicyclominetab ip 10 mg [263] , dicyclomineinj ip 10 mg /ml [264] , dicyclomine hydrochloride oral solution ip 10mg /5ml [ 265] , domperidone suspension ip 5mg/5ml[266] , domperidone tab ip10 mg [267] , loperamide tabip 2 mg [269] , metoclopramide injip 10mg/2ml [270] , metoclopramide tabip 10 mg [271] , omeprazole cap ip 20 mg [272] , ondansetron inj ip 2mg/ ml [273] , ors powder ip [274] , pentoprazole inj40 mg [275] , ranitidine hcl injectionip 50mg/2ml [ 276] , ranitidine tabip 150mgfilm coated [ 277] , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate10 o/o disodium hydrogen phosphate dodecahydrate8 o/o[ 278] , hyoscine butyl bromide tablets ip 10mg [414] , drotaverine tab ip 40 mg [415] , ranitidine tabip 300mg film coated [433] , dicyclomine hydrochloride and activated dimethicone suspensioneach ml contains dicyclomine hydrochloride 10mg activated dimethicone40mg[438] , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets [439a] , metoclopramide hydrochloride syrup ip 5 mg/ 5ml [478] , domperidone oral drops 10mg/ ml(10ml) [590] , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg [591] , lactic acid bacillus tab 60 million spores [592] , lactulose solution usp/ bp 10gm/15ml or 3.35 gm/5ml [593] , liquid paraffin ip 100 ml [594] , ondansetron orally disintegrating tablets ip 4mg [595] , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets [596] , ursodeoxycholic acid tablets ip 300 mg [597] , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg) [763] , prochlorperazine mesylate injection 12.5mg/ml 5ml size [ 764] , probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) [765] , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2gm) [766] , allopurinol tabletsip 100 mg [598] , hydroxychloroquine sulphate tablets 200mg [599] , leflunomide tablets ip 10mg(film coated) [600] , leflunomide tablets ip/usp 20mg (film coated) [601] , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg [602] , biphasic isophane insulin inj ip (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) [ 279] , carbimazole tabs ip5 mg (film coated) [280] , clomifene tab ip 25 mg [282] , clomiphene tab ip 50 mg [283] , dinoprostone cream/ gel 0.5 mg dinoprostone in syringe [285] , glibenclamide tab ip 5 mg [287] , gliclazide tab ip 40 mg [288] , glimepiride tabip 2 mg [289] , glimepiride tab ip1mg [290] , glipizide tab ip 5mg [ 291] , hydroxyprogesterone inj ip 250mg /ml [293] , metformin tab ip 500 mg(film coated) [295] , norethisterone tab ip 5 mg [296] , pioglitazone tab ip 15 mg [297] , progesteroneinj 200mg/ 2ml [298] , insulin injection ip ( soluble insulin/neutral insulin injection)40 iu/ ml(r.dna origin) [300] , thyroxine sodium tablets ip 100mcg [301] , metformin hydrochloride(sustained release tablets ip 1000 mg [451] , glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) [ 452] , glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release) [453] , metformin hcl ( sustained release) and glimepiride tab metformin hcl ( sustained release) 500mg ,glimepiride 1mg [454] , metformin hydrochloride ( sustained release) and glimepiride tablets ip ( metformin hydrochloride (sustained release) 500 mg, glimipiride 2mg) [455] , glimepiride, pioglitazone and metformin hydrochloride ( sustainedrelease) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release) 500 mg [456] , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg) [603] , glucagon for injection usp 1 mg/ml [604] , thyroxine tablets ip 50 mcg [607] , insulin glargine 3ml ( 100iu/ml) with 15 insulin syringes and needles/cartridge 3ml ( 100iu/ml) with 15 needles and 1 pen per 20 cartridges [680] , tenaligliptin tablet ip 20mg [682] , human rabies immunoglobulin inj 150 iu/ ml [305] , rabies vaccine human ( cell culture) ip(intradermal)2.5 iu[ 306] , rabies vaccine human ( cell culture) ip (intramuscular) 2.5 iu/dose [307] , snake venum anti serum ip (lyophilized) polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6mg of cobra venum,0.45 mg of common kraite (bungaras)venum(details in rc) [308] , tetanus vaccine( adsorbed) ip 5 ml vial [ 310] , rabies antiserum ip ( equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (i.m./sc use) [408] , hepatitis b immunologlobin injection ip 200 i.u [767] , glycopyrrolate inj ip 0.2 mg/ml [312] , neostigmine inj ip 0.5 mg/ml [314] , neostigmine tab ip 15 mg [316] , chlorzoxazone , diclofenac sodium & paracetamol tablets (chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg) [610] , tropicamide eye drop ip 1o/o [241] , atropine eye ointment ip 1% [319] , atropine sulphate ophthalmic solution usp 1% [320] , chloramphenicol eye drops ip 0.5 0/0 [321] , ciprofloxacin eye drops ip 0.3 o/o w/v [322] , hydroxypropylmethyl cellulose solution 20 mg/ ml [324] , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o/o +0.1 o/o [330] , tobramycin eye drops 0.3% [331] [331] , flurbiprofen sodium ophthalmic solution ip 0.03 o/o w/v [421] , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. [423] , lidocaine hcl topical solution usp 4% [424] , timolol eye drops ip 0.5 o/o w/v [484] , homatropine eye drops ip 2% [485] , travoprost eye drops ip 0.004 o/o [486] , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% [487] , betaxolol eye drops 0.5 o/o [612] , carboxymethylcellulose eye dropsip 0.5% [613] , phenylephrine hydrochloride opthalmic solution usp/ phenylephrine eye drops bp 5% [614] , acyclovir eye ointment ip 3% w/w 5gm size [ 769] , eye drop moxifloxacin 0.5% w/v ophthalmic solutionip 5ml size [ 770] , chloramphenicol 1% w/ w eye ointment ip, 3gm size [771] , isoxsuprine tab ip 20 mg [334] , methylergometrine inj ip 0.2 mg/ml [335] , methylergometrine tab ip 0.125 mg [336] , misoprostol tab ip 200 mcg [337] , oxytocin injip 5 iu/ml [338] , mifepristone tab ip 200mg [615] , natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule containsprogesteron ip 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron ip 200 mg) [772] , cabergoline tabletip 0.5mg(each uncoated coated tablet contains cabergoline ip 0.5mg) [ 773] , human chorionic gonadotropin injection ip 5000 i.u. [774] , alprazolam tab ip 0.25 mg [339] , alprazolam tab ip 0.5mg [340] , amitriptyline tabip 25mgfilm coated [341] , chlordiazepoxide tablets ip 10mg [342] , chlorpromazine tablets ip 100 mg (coated tablet) [343] , chlorpromazine tablets ip 25 mg (sugar coated) [344] , chlorpromazine tablets ip 50 mg(coated tablets) [345] , escitalopram tab ip 10 mg [351] , fluoxetine cap ip 20 mg [352] , haloperidol inj ip 5 mg/ ml [353] , haloperidol tab ip 5 mg [355] , imipramine tab ip 25 mg (coated tab) [356] , imipramine tab ip 75 mg (coated) [357] , lithium carbonate tab ip 300 mg [358] , lorazepam inj ip 2 mg/ ml [359] , olanzapine tabip 5 mg [360] , risperidone tab2mg [ 361] , risperidone tab 1 mg [ 362] , sertraline tab ip 50 mg [363] , trifluperazine tabip 5 mgcoated [364] , quetiapine tablet ip 50mg [674] , quetiapine tablet ip 25mg [675] , clonazepam tablet 0.5mg [678] , levosulpiride tablet 25 mg (each uncoated tablet contains levosulpiride 25 mg) [ 777] , lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) [ 778] , aminophylline inj ip 25 mg/ml [365] , beclomethasone inhalation ip 200 mcg/ dose [366] , budesonide nebulizer suspension 0.25mg/ml [ 367] , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup q.s. [368] , ipratropium bromide nebulizer solution 250 mcg/ ml [369] , salbutamol tablet ip 4 mg [370] , salbutamol inhalation 100 mcg /dose [371] , salbutamol nebuliser solution bp 5 mg/ml [ 372] , salbutamol tabip 2 mg [373] , theophylline and etofylline injection( anhydrous theophylline 50.6mg + etofylline 169.4 mg) [374] , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg) [375] , theophylline tablet 400mg sustained release/ controlled release (theophylline prolonged released tablet ip) [376] , salbutamol syrup ip 2mg/ 5ml [432] , dextromethorphan hbr syrup ip 13.5mg / 5ml [ 440] , saline nasal solution ( drops) (sodium chloride 0.65 o/o) [442] , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg [616] , budesonide powder for inhalation200 mcg [ 617] , ipratropium powder for inhalation ip 40 mcg [ 618] , xylometazolinenasal dropsip 0.1% [620] , cough syrup/ expectorant(50) ml [692] , acebrophylline tablet/ capsule 100 mg [780] , compound sodium lactate inj. ip [377] , dextrose inj ip 10% [ 379] , dextrose inj ip 5% [380] , potassium chloride inj. 0.15 gm/ml [383] , potassium chloride oral solution u.s.p 500mg/ 5ml [384] , sodium chloride and dextrose injection ip 0.9 o/o + 5 o/o [385] , sodium chloride inj ip 500 ml [386] , sodium chloride injection ip 100 ml [621] , tamsulosin hcl tablets/ capsule 0.4 mg [576] , flavoxate tablets ip 200 mg (coated tablet) [ 579] , levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatinlevamisol hydrochloride ip 50 mg) [785] , dutasteride tablet 0.5 mg [787] , alkylizer syrup 1.4 gm/ 5 ml( 100 ml ) (disodium hydrogen citrate) [788] , betahistine tab ip 8 mg [541] , betahistine tab ip 16 mg [542] , cinnarizine tablets ip 25 mg [543] , cinnarizine tablet ip 75 mg [544] , ascorbic acid tab ip 500 mg [387] , calcium gluconate inj ip 10%(iv use) [388] , ferrous sulphate with folic acid tab ip each film coated tab.containing dried ferrous sulphate ip equiv100 mg elemental iron and folic acid ip 0.5 mg [390] , ferrous sulphate with folic acid tab ( paediatric) ip each film coatedtab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg [391] , folic acidtab ip 5 mg [392] , multivitamin drops each mlcontains vit a 3000 iu,vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin1mcg, lysine hcl10mg [393] , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mgniacinamide 25mgfolic acid 0.2 mg [394] , vitamin b complex inj nfi [395] , vitamin b complex tablet nfi (prophylactic) b1 2mg b2 2mgb6 0.5mgniacinamide 25mg calcium pantothenate 1mg (with appropriateoverages) [ 397] , vitamin a paediatric oral solution ip( vitamin a concentrate oil ip) each ml contains vitamin a 100000 iu [ 409] , calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu) [441] , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg [448] , iron sucrose injection usp/bp 20mg/ml (for iv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg [ 488] , calcium with vitamin d tabletsusp /calcium and colecalciferol tablets bp/calcium and vitamin d3 tablets ip( elemental calcium 500 mg, vitamin d3 250 iu) (non chewable) [622] , cholecalciferol granules 60,000 iu /gm [623] , mecobalamin inj 500 mcg/ml [624] , pyridoxine tablet ip 10 mg [626] , pyridoxine tablet ip 40mg [627] , thiamine tabletsip 100 mg [629] , calcitriol capsules ip 0.25 mcg [630] , methyl cobalmine tablet 500mcg [652] , methyl cobalmine tablet 1500mcg [653] , vitamin d3 oral solution 60000 iu [676] , ferric carboxymaltose injection 50 mg/ml 10ml size [789] , multi vitamin syrup [ 790] , flunarizine tab5 mg [ 147] , alendronate sodium tablets usp / bp 35 mg [631] , normal human intravenous immunoglobulin 5g/ 100ml [633] , pregabalin cap ip 75 mg [634] , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans [687] , intravenous fat emulsion 20% w/v 250ml [791] , pyridostigmine tablet ip 60 mg (each tablet contains pyridostigmine ip 60 mg ) [792] , vitamin e capsule 400 mg [795] , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 40 mm length 76 cm) size 1/0 [r1] , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 20 mm length 76 cm) size 3/0 [r2] , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 2/0 [r3] , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 1/0 [r4] , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 40mm length 76 cm) size 1/0 [r5] , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 30 mm length 76 cm) size 2/0 [r6] , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 45 mm length 100 cm) size 1 [r7] , absorbable surgical suture (sterile catgut), needled suture chromic size 3/0 (3/8 cir rcutting needle 26mm, length 76 cm) [r8] , absorbable surgical suture (synthetic) sterilised needled( braided) coated polyglactin / polyglycolic acid / poly (glycolide co l lactide) size 3/0 1/2cir rb needle 20mm length 70 cm [r9] , absorbable surgical suture (synthetic) sterilised needled ( braided) coated polyglactin / polyglycolic acid / poly (glycolide co l lactide) size 2/0 1/2 cir rb needle 30mm length 90 cm [r10] , absorbable surgical suture (synthetic) sterilised needled ( braided) coated polyglactin / polyglycolic acid / poly (glycolide co l lactide) 1/2 cir rb needle size 1/0 30mm length 90 cm [r11] , absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin/polyglycolic acid/poly(glycolide co l lactide) size 1 1/2 cir tapercut needle (heavy) 40mm length 90 cm [ r12] , absorbable surgical suture (synthetic) sterilised needled( braided) coated polyglactin / polyglycolic acid / poly (glycolide co l lactide) size 1 1/2 cir rb needle40mm length 90 cm [r13] , absorbable surgical suture(synthetic) sterilised needled( braided) coated polyglactin/polyglycolic acid/poly(glycolide co l lactide) size 3/0(1/2 cir conventional 25mm length 90 cm)undyed [ r14] , absorbable surgical suture (synthetic) sterilised needled( braided) coated polyg