North Western Railway - Rajasthan

34222648 supply of gasket bhel drg.no.44394300002v00gasket bhel drg.no.44394300002v00, gasket bhel drg.no.44394300002v00 bcs 3133 / b028 as per drg.no. bhel drg.no. 44394300002v00, markers drg. no. / cat...

Indian Army - Rajasthan

34197828 bids are invited for nas , hard disk , cat 6 , ups 5 kva , battery 42 ah , lan nasandhd extender total quantity : 31...

Department Of Defence - Rajasthan

34184538 bids are invited for 264142300172 rear brake actuator , 2641332002 assy ball joint lh , 2641332003 assy ball joint rh , 253420156310 v belt cogged 925 mm , p69830000044 side cat a spare window glass , p69830000045 side window glass , p69830000048 door glass front driver side , p69830000049door glass front driver side total quantity : 11...

Directorate Of Purchase And Stores - Rajasthan

34168328 supply of combi coulomat frit and n, n dimethyl 1 4 phenylenediammonium dichloride gr supply of combi coulomat frit and n, n dimethyl 1 4 phenylenediammonium dichloride gr , 1 ) combi coulomat frit, ( karl fischer reagent, pyridine free single soln. for the coulometric water determiniation for cells with diaphragm ) make merck, cat. no. 1.09255.0500, packing of 500 ml , 2 ) n, n dimethyl 1 4 phenylenediammonium dichloride gr foranalysis make merck, cat. no. 1.03067.0025, packing of25gm...

Border Security Force - Rajasthan

34154663 bids are invited for ptz camera with ir range 200 mtr nos , bullet camera with ir range 50 mtr nos , nvr 16 port input channel with 4tb hard disk nos , xvr dvr 4 port input channel nos , monitor 55 inch display nos , invertor 1 kva with 12 v 150 ahc bty nos , ups online 3 kva nos , cw sw 4 port switch nos , l 2 fiber switch, 4 or 8 sfp plus nos , 24 core ofc frp armored mtr , liu 16 or 24 port nos , fiber patch cord mtr , pigtail mtr , cat 6 cable mtr , electric cable mtr , cabinet for switch nos , 24 u rack for control nos , spike buster 6 socket multi functional nos , electric cable 3 core 6 sq mm pvc mtr , electrical extension board 03 socket 5 or 15 amp nos , splicing machine nos , otdr machine nos , fiber optic tool kit nos , modify iron safety box water proof 1x1x1 feet nos , 6 core ofc with hard core support wire mtr , fiber media convertor single mode in pairs nos , ofc joint enclosure nos , project on turnkey basis with 5 year camc 1 / 40 outdoor cabinet for inverter battery trolly nos ,earthing for control room and camera group lot ,misc work digging and laying of ofc and electricalcable and civil work masonayr work etc as perrequirement for different patches distances andplaces at indo pak border under shq bsf sgnr lot ,misc items cat 6 p cord,clip wire,rj45 contr ,ofc j sleeve,conduit and hdpe pipe, cabinet i obox,camera shed, cable fixing clip, cable ties,mount fix support wire etc as per requirement lot ,misc items insulation, flexible pipe, mcb equipmentsassys, lt wire 2.5 mm 2 core, electric junction box,top male and female plug 5 to 15 amp etc. as perrequirement lot , ict charges ip cctv surveillancesystem at 50 patches of different distance andplaces at indo pak border in shq bsf sgnr underftr hq bsf rajasthan. , camc for five years aseperate breakup list to be enclosed with the bidsitc of electronic surveillance cameras eqpts total quantity : 285819...

Border Security Force - Rajasthan

34134299 bids are invited for ptz camera 4 mp , static bullet camera 2 mp , nvr 24 port 4 tb , nvr 16 port 4 tb , xvr and dvr 4 port , monitor 55 inch , invertor 1100va with bty 12v150ahc tubller , ups on line 1 kva with bty , copper switch 4 ports , l2 switch 8 sfp plus 4 copper , ofc 24 core armoured , liu 16 and 24 ports , patch cord fiber , pigtails , cat 6 cable , electric cable 2 core 2mm , cabinet for camera , 24 u rack for control , total cost 1 to 5 years camc as per given performa...

Central Public Works Department - Rajasthan

34133496 comprehensive maintenance outsourcing including day to day maintenance ar / mo, special repairs and up gradation works pertaining to civil, electrical and horticulture works for residential and non residential building of cpwd, inspection bunglow, holiday home, iced cag, ag, rti, cghs, salt commissioner, passport office, it / ce, cbi, c&ce, survey of india, nia, nth, cat, marketing and service extension centre and craft museum, mrhru, cisf, nirman bhawan, kendriya sadan nirman vihar i, ii & iii, gpra colony, etc. under jurisdiction of jaipur central division i at different locations of jaipur, kant kalwar, bhanpur kalan, amer during fy 2019 20, 2020 21 & 2020 22...

North Western Railway - Rajasthan

34115581 supply of piston seal to ep contactor m24pc2 as per bhel cat no. 25801130044p1 acs2201 / a013piston seal to ep contactor m24pc2 as per bhel cat no. 25801130044p1 acs2201 / a013, piston seal to ep contactor m24pc2 as per bhel cat no. 25801130044p1 acs2201 / a013...

Indira Gandhi Canal Project Rajasthan - Rajasthan

34104509 supply of spare parts for pump, ht panel, transformer, eot crane, switch yard etc. for ps i to vi of gjlc supply of spare parts for pump, ht panel, transformer, eot crane, switch yard etc. for ps i to vi of gjlc , 360 kvar, 6.6kv or 3.3 kv, 3 phase, 50hz, all pp dielectric design, capacitor bank comprising with 03 nos of 120 kvar, 6.6 kv, 3 phase, 50hz, external fuse design, bare capacitor unit shall confirm to as per is 13925 ( part 1 ) / 2012 standards , spring charging motor , closing coil 30v dc for 6.6 kv / 3.3 kv ht panel , tripping coil 30v dc for 6.6 kv / 3.3 kv ht panels , insulator 6.6 kv / 3.3 kv for ht panel , tnc switch , tripping coil 110vdc make schneider , spring charging coil for incomer , rotary switches , auxiliary contactor 110vdc / 4no, 4nc , ammeter digital 96 x 96 , voltmeter digital 96 x 96 0 to 9kv , power pack input 220 vac / 110 vdc , 6.6kv / 3.15 amp pt fuse , fresh transformer oil of standard quality of standard make. , three pole ac contactor ( cat. no. ce15gn3, size g, 40 amp, 22 kw ) , 6.6 / 7.2kv hrc fuse 80 amp ngtt , 6.6 / 7.2kv hrc fuse 63 amp rgtt , 6.6 / 7.2kv hrc fuse c 1 ( 16 32 ) amp , 6.6 / 7.2 kv , 71 / 80 amp hrc fuse ( type bdghc ) , 6.35 / 11kv ( e ) ht xlpe aluminum conductor power cables, confirming to is:7098 / ii / 2011 and as per description given in offer, brand nameunistar3cx120sq.mm ( ayfy ) , gear oil , lubricant oil servo system 32 , material required for pump 2.00 / 2.15 cumec pump supply of ss propeller casing ( ss 304 ) as per sample...

Indira Gandhi Canal Project Rajasthan - Rajasthan

34100946 supply of spare parts for pump, ht panel, transformer, eot crane, switch yard etc. for ps i to vi of gjlc 1 360 kvar, 6.6kv or 3.3 kv, 3 phase, 50hz, all pp dielectric design, capacitor bank comprising with 03 no‟s of 120 kvar, 6.6 kv, 3 phase, 50hz, external fuse design, bare capacitor unit shall confirm to as per is 13925 ( part 1 ) / 2012 standards 2 spring charging motor ( for existing cgl panel ) 3 closing coil 30v dc for 6.6 kv / 3.3 kv ht panel 4 tripping coil 30v dc for 6.6 kv / 3.3 kv ht panels 5 insulator 6.6 kv / 3.3 kv for ht panel 6 tnc switch 7 tripping coil 110vdc 8 spring charging coil for incomer 9 rotary switches 10 auxiliary contactor 110v dc / 4no, 4nc 11 ammeter digital 96 x 96 12 voltmeter digital 96 x 96 0 to 9kv 13 power pack input 220 vac / 110 vdc 14 6.6kv / 3.15 amp pt fuse 15 fresh transformer oil of standard quality of standard make. 16 three pole ac contactor ( cat. no. ce15gn3, size g, 40 amp, 22 kw ) 17 6.6 / 7.2kv hrc fuse 80 amp ngtt 18 6.6 / 7.2kv hrc fuse 63 amp rgtt 19 6.6 / 7.2kv hrc fuse c 1 ( 16 32 ) amp 20 6.6 / 7.2 kv , 71 / 80 amp hrc fuse ( type bdghc ) 21 6.35 / 11kv ( e ) ht xlpe aluminium conductor power cables, confirming to is:7098 / ii / 2011 and as per description given in offer, i 3cx120sq.mm ( ayfy ) 22 gear oil 23 lubricant oil servo system 32 24 material required for pump 2.00 / 2.15 cumec pump supply of ss propeller casing ( ss 304 ) as per sample ( for existing flow more pump ) ...

Military Engineer Services - Rajasthan

34098552 special repair to bldg no. t 39 and special repair to road furniture item at mil cantt ajmer under ge nasirabad. special repair to bldg no. t 39 and special repair to road furniture item taking down cement or cement lime plaster on stone / brick wall, ceiling including raking out joints, hacking for key, scrubbing down with water etc complete all as specified and directed. 2 m& l for 15 mm thickrendering in cement mortar ( 1:6 ) , on stone masonary surfaces finished even and smooth, complete all as specified and directed 3 m&l for rendering 15mm thick in cm 1:4 on stone masonry, external surfaces finished even and smooth, complete all as specified and directed 4 m & l forpreparation ofnew plastered surfaces of wallsand providing two coat of cement base paint over a coat of primer, complete all as specified and directed. 5 m & l forpreparation old decorated surfaces of wallsand providing one coat of cement base paint complete all as specified and directed. 6 m & l for complete removal of existing treatment andpreparationwall surfaces and applying two coats of oil bounddistemperover a coat of primer over 1 mm thick wall care of putty complete all as specified and directed 7 m&l for preparation of new plastered surfaces and applying two coats of oil bounddistemperover a coat of primer over 1 mm thick wall care of putty complete all as specified and directed. 8 m&l for preparation of old wooden surfaces of any descriptionover 10cm width or girth and applying one coat of synthetic enamel paint complete all as specified and directed. 9 m&l for preparation of old concretesurfaces of any descriptionover 10cm width or girth and applying one coat of synthetic enamel paint complete all as specified and directed. 10 s & f second class hw 35mm thick, factory made, plain framed, paneled shutter ( three panels ) with panels of 9mm thick bwpgrade ply wood bonded with high quality liquid phenol formal dehyde synthetic resin adhesive conforming to is 710. the size of rails & style shall be as per is 1003 ( part i ) kiln seasoned & chemically pressure treated complete all as per specified and directed. 11 s&f 2nd class hw 35 mm thick, gauged and skeleton shutters ( three panels ) , factory made open rebated and prepare to receive glass, gauge etc ( with sash bar ) , edges of framing plain, chamfered or rounded, fitted with cut & mitred beads for securing glass etc. size of members of shutter shall be as specified in ssr 2009 part i, section 8 clausemember shall be kiln seasoned& chemically pressure treated complete all as specified and directed. 12 s&f steel window / ventilator glazed and gauged ( combination ) with side hung / top hung shutters incl box type / projecting type hinges, and steel peg stay, handle & locking arrangement and frame made out of 1.25mm thick pressed steel frame complete incl necessary ac / cooler arrangement in window & guard barscomplete all as as specified and directed. note : wire mesh and sheet glass shall be measured & paid separately under respective items. 13 s & f aluminium handle fabricatedtype, anodised 150mm size conforming to is complete all as specified and directed. 14 s & f 300mm long aluminium alloy, anodised, sliding door bolts with hasps, staple ( bolt type ) and fixing clips of sheet, cast or extruded sections and fixing bolts and sliding bolts of extruded sections or cast aluminium alloy and fixed complete all asspecified anddirected. 15 s&f aluminium, anodised, barrel tower bolt of extruded section, isi marked, 150 mm long complete all as specified and directed. 16 s&f mild steel butt hinges, medium weight, cold rolled, isi marked of size 100 mm, complete all as specified and directed. 17 m & l for rolled mild steel work angle ironas in door frame ( chowkhats ) of frame confirming to fe 290 or fe 330 including complete all as specified and directed. 18 taking down chowkhats or frames with shutters ( without taking off shutters from the frames ) exc 1.50 sqm and n.exc 4.00 sqm each and removing from site complete and making good disturbed surfaces of wall in cm ( 1:3 ) all as specified and directed. 19 taking down unserviceable chowkhats or frame with shutters ( without taking off shuters from the frames ) of any description n exc 1.50sqm and removing from site and making good disturbed surfaces of wall in cm 1:3 complete all as specified & directed. 20 m & l for preparation of new wooden surface over 10cm width or girth and applying two coats of synthetic enamel paint of ist quality over a coat of pink primer complete all as specified and directed. 21 m&l for preparation of new steel surface over 10cm width or grith & applying two coats of synthetic enamel paint of 1st quality over a coat of red oxide primer complete all as spd & directed. 22 s&f stainless steel wire cloth 0.36mm nominal dia of wire & average width ofaperture 1.40mm & fixed with wire staples complete all as spd & directed. 23 s&f 3.00 mm thick sheet glass, ordinary quality & glazing with oil putty not exc0.50 sqm each pane complete all as spd & directed. 24 s&f in repair road stud ( cat eye ) abs bodyconforming to irc 67 1977giving reflection on both sides including fixing with epoxycomplete all as specified and directed. 25 s&f in repair solar road studs made up of highly compressive materials , water resistant alluminium alloy and polycarbonates 122 x 122x 20mm with 6 ledprismatic reflective lens on each side with stemfixed inroadcomplete all as specified and directed by engineer in charge. 26 m&l for 2 3 mm thick and 100 mm wide thermo plastic reflective painting white or golden yellow all as specified as on road surfaces in marking speed breakers, centre line, edge line etc complete all as specified and directed. 27 exavating in post holes ( or similar holes ) each n.exc 0.5 cum getting out in soft / lose soil returning, filling in and ramming earth in layers n.exc 25cm, watering and removing surplus soil to a distance n.exc 50m and making good surfaces complete all as specified and directed. 28 m&l for pcc 1:3:6 type c 2 using 40mm graded aggregate as in foundation filling and mass concrete complete all as specified and directed. 29 m&l for 1.65mm thick & 50 mm bore ( outer dia 60.3mm ) stainless steel pipe of schedule 5 s sign board complete all as specified and directed. 30 s&f informatory sign board in reqd size and each sign board made of two 4mm thick aluminium composite panel ( acp ) , both side face to fully covered with 3m scotchlite brand high intersity prismatic grade retro reflective sheet shall be astm d 4956 type iv in required colour.the retro reflective sheet shall be processed on acp by 3m equipment heat lamp vacum applicaror and letter, signs and symbol shall be cut by computerized plotter or digital printed on retro reflective sheet with high quality eco solvent digital roland and fabricated out of high internsity prismatic grade sheeting with text matter ( as reqd ) and border of same sheeting.signboard shall be supplied along with supported circular hollow stainless steel section frame of size 25mmx25mmx1.29mm thick along with proper clamping with same section of stainless steel and nut bolts / welding, complete all as specified and directed. 31 s&f guide post delinators model no. 952 gp abs round body fitted with 2 nos 100 mm dia highly reflective reflectors made out of pmma and mounted on ms pipe of 50 duly powder coated, anti rust & anti theft steel net make ( dark eye ) complete fixing incl necessary excavation, pcc etc required complete all as specified and as directed by the engineer in charge. 32 taking down carefully copper / aluminium point wiring ( light, fan, socket or power ) complete, including fittings such as switches, ceiling roses, holders, regulators, sockets etc., removing materials from siteand making good disturbed surface of walls, floors etc complete all as specified and as directed by the engineer in charge. 33 disconnecting unserviceable sub main wiring / service connection of any size and including steel conduit and accessories and removing from site and making good the disturbed surfaces complete all as specified and as directed by the engineer in charge. 34 taking downmcb dbs complete with mcbs / isolator etc removing materials from siteand making good disturbed surface of walls, floors etc complete all as specified and as directed by the engineer in charge. 35 m&l for point wiring with 1.5 sqmm, pvc insulated, unsheathed, stranded copper conductor single core frls cable, is 694 marked, drawn through and including non metallic rigid pvc concealed conduit 20mm dia or higher complete with all pvc conduit accessories such as socket, elbow, junction box, bell mouth, reducer, bend and flexible conduit etc. / fittings isi marked and sunk type pressed steel anodised terminal box 1.2 mm thick with bakelite laminated sheet top cover 3 mm thick, brass screws and cup washers including 1.5 sqmm stranded copper conductor pvc insulated green in colour as continous earth conductor connected to common earth and earth dolly with all accessories for: 36 one light point controlled by one, one way switch. 37 one ceiling fan / exhaust fan point controlled by one, one way switch. 38 one three pin 5 amp socket on same board with other switches. 39 one 3 pin 5 amp socket on independent board. 40 all as per item no. 35.00 here in before but with 2.5 sqmm, for one 5 pin 5 / 15 amp socket on independent board including 2.5 sqmmstranded copper conductor ( frls ) pvc insulated green in colour as continous earth conductor connected to common earth complete all as specified and as directed by the engineer in charge. 41 s&f of submain wiring with two runs of single core pvc insulated and unsheathed multistranded ( frls ) copperconductor cable of size 6.00 sqmm lt, 1100 volts grade, drawn through and including 25 mm dia or higher pvc nonmetallic concealed conduit with accessories such as socket, elbow, junction box, bell mouth, reducer, bend and flexible conduit etc. and fittings and one run of 6 sqmm single core multistrandedcopper conductor cable green colour as earth continuity conductor complete all as specified and as directed by the engineer in charge. 42 s&f switch piano flush type 5 amps, single pole one way 240 volts complete all as specified and as directed by the engineer in charge. 43 s&f switch piano flush type 15 amps, single pole one way 240 volts complete all as specified and as directed by the engineer in charge. 44 s&fsocket outlet 3 pin 5 / 6 ampflush type complete all as specified and as directed by the engineer in charge. 45 s&fsocket out let 2 in 1, multipurpose 3 pin 15 / 16 amp flush type isi marked complete all as specified and as directed by the engineer in charge. 46 s&f ceiling fan regulator electronic flush , steped ( four step ) 230 volts ac complete all as specified and as directed by the engineer in charge. 47 s&f ceiling rose surface bakelite 3 terminals 63.5 x 17 mm complete all as specified and as directed by the engineer in charge. 48 s&f of lamp holder pvc / polycarbonate type with back plate complete all as specified and as directed by the engineer in charge. 49 s&f led tube light fitting in acrylic linear tube ( 1x 18 watt ) , 230v for single led tube lightincluding 1 x 18 w ledretrofitbar professional cw 6500 k cover channel, bipin holders, led power driver, connector block, etc complete with all accessories internally prewired and including connecting up with three core flexible copper conductor cable with suitable size for connection of fitting from ceiling rose complete all as specified and directed. make : havells cat part no photonultra2.01212t8sstl20wled 865spc ( for tube ) regalbattent8upto1x22wdsbswh ( for batten ) bajaj cat part no blrb 18w cwc for tube , blrb db 118 for batten , or equivalent model of philips / crompton 50 supply and fixing led light fitting mirror type with high out put diffuser 2 feet, 10 watt 220 v ac decorative type with driver holder and led lamp including connecting up with three core flexible copper conductor cable of suitable size complete all as specified and directed.make : bajaj / havells / cg 51 s & f led light fitting 1x10wbulkhead luminaires including led light driver holder connecting up with three core flexible copper conductor cable of suitable size complete all as specified and directed.make : bajaj / havells / cg 52 supply and fixing testing and commissioning energy saving street light luminaire 35 watt led , pressure die cast housing with epoxy powder coated with colour finish and prismatic poly carbonate coverlic cover complete, ip 66 protection incl connecting with three core copper flexible wire from ceiling rose to connector of light fitting complete all as specified and directed by engr in charge. make havells cat part no enduracityliteplat plussl35wled757sasybopc or equivalent model ofsurya / control& switchgear / bajaj 53 supply and fixingstreet light bracket made of 32 mm gi pipe , 1.2 mtr lenght fixed withtwo nos of clamp , nut and bolts for fixing of street lightcomplete all as specified and directed by engr in charge. 54 s & f of mcb sp, 240 volt, 6 amp to 40 amp capacity, 10 ka, c curve complete all as specified and directed. 55 s & f of mcb spn, 240 volt, 63 amp capacity, 10 ka, c curve complete all as specified and directed. 56 s&f of mcb distribution board single pole & neutral with 200 amps rated bus bar, double door ip 43 dbs , made outof sheet steel enclosure, recessed type, factory made powder coated 8 way, 240 volts suitable for housing mcbs including blanking platecomplete all as specified and as directed by the engineer in charge. 57 s&f exhaust fans ac single phase 230v of size 300mm sweep with louver including connecting with three core flexible copper wire from ceiling rose to connector of fan complete all as specified and directed.make : usha / crompton / bajaj 58 m&l for earthing complete with galvanised steel earth plate electrode 60cmx60cmx6 mm thick buried directly in ground vertically to a depth not less than 2.25m below ground level with top edge of the earth plate at a depth not less than 1.5m below ground level, connected to galvanised earth lead wire 4.00 mm dia by means of bolts, nuts, check nuts and washers of galvanised iron or steel and other end of earth wire connected to main switch board and protected by galvanised iron pipe light grade 15mm bore and water pipe 20 mm bore gi med grade with funnel and wire mesh pcc chamber in cement concrete 1:3:6 type c 2 and rcc cover with handle all as specified and shown in elect plate no 3 of ssr part i of 2009 incl dismantling of old unserviceable existing earthing complete all as specified and as directed by the engineer in charge. 59 s&f of led lamp 9 / 10 watt complete all as specified and as directed. make : havells / crompton / bajaj / usha 60 supply & fixing ceiling fan 1200 mm sweep , 230 volts, ac , 50 hz, copper winded motor, bee 5 star rated white colour complete with motor, blade set of three nos , down rod, canopy, shackle assy complete all as specified and as directed.make: crompton / havells / orient 61 s&f single pole and neutral enclosure with a two pin and earth plug and earth plug and socket complete with one single pole 20 amp mcb sp c series for ac complete all as specified and directed. 62 supply, laying and testing cable xlpe insulated , screened, pvc bedded, galvanized steel strip or wire armoured, electric power cables ( heavy duty ) 1100 volts grade with stranded aluminium conductor of size 16 sq mm 4 core complete all as specified and as directed by the engineer in charge. 63 supply and fixingtubes light grade gi tubing 40 mm dia withall fitting laid in trenches, fixed on pole / on wall for cable protection complete all as specified and as directed by the engineer in charge. 64 excavating in trenches not exceeding 1.5 m wide and not exceeding 1.5 m in depth; for foundation, etc. or for shafts, wells, cesspits, manholes, pier holes, etc. or for cable laying or not exceeding 10 sqm on plan and not exceeding 1.5 m in depth and getting out in soft / loose soil complete all as specified and as directed. 65 returning, filling in, including spreading, levelling, watering and well ramming in layers not exceeding 25 cm in soft / loose / hard / dense soil complete all as specified and as directed. 66 removing excavated material ( soils ) not exceeding 50 m and depositing where directed at a level n exc. 1.5 m above the starting point 67 supply & spreading in trenches dry river sand cushioning to underground cable in trenches including spreading, levelling hand punning down complete all as specified and directed.note: depth of sand cushioning will be measured after punning down and levelling the sand properly. 68 m&l for laying of bricks locally available sub class b bricks, non modular sizes as per is 1077: 1992 for cable protection cover laid flat and dry in trenches over the cable perpendicular to the direction of cable all as directed. 69 total in figures 70 quoted amount in words...

Government Medical College - Rajasthan

34098061 supply of general surgical instruments 1 a. instruments should be made of high grade surgical steel. b. the instruments must have a matt finish. c. needle holders should have tungsten carbide inserts. _ d. a demo of instruments will have to be arranged when asked for it. 1. mayo scissors [ blunt ] straight 2, curved 2 2. metzenbaum scissors: straight 2, curved 2 adsons forceps ( long ) 4 , z1: debakey forceps 4 babcock clamps 10 malleable retractors 4 2, 7. frazier suction tip 4 8. needle holders: long 4, short ( 5 ) 4 9. kocher forceps ( 1 2 teeth ) straight 15, curved 15 10. sponge holding forceps 5 t i. artery forceps ( 8 ) curved 10, straight 10 12. mosquito artery forceps ( 4 ) : straight 20, curved 20 13. mosquito artery forceps ( 6 ) : straight 20, curved 30 14. allis forceps ( 6 ) :30 __ 15. allis forceps ( 8 ) : 4 16. allis forceps ( 4 ) : 6 17. back haus towel clips: ( 3 / 2 10 ) , ( 6 10 ) 18. scalpel handle: no3 5, no4 5 and no7 5 each. 19. gigli wire saw handles: 4 20. right angle artery forceps : long 2 small 2 21. s.s. trays : big 5, small 5 22. dandy forceps ( 6 ) 20 23. langenbeck retractor: small 2 long 2 24. deaver retractor: long 2, short 2 25. double action bone nibbler: 6 1, 10 i l. ) 26. babcock clamps 10 27• kelsey fiy • bone 2 awl — 28. wire cutter : big 2, small 2 29. doyen periosteal elevators — a pair of left and right 30• key periostel elevator : 2 31. bristow periosteal elevator ( sharp edge ) 1 32• bone cutter ( 8 ) 1 33. dissecting forceps ( plain ) : long 10 short 10 34• dissecting forceps ( toothed ) : long 10 , short — 10 35•scissors 4: straight 5 , curved 5 36. weitlaner mastoid retractor : 2 37. frazier suction tip ( 3.5mm ) : 4 38. kilner ( cat paw ) retractor 150mm : 4 39. yankauer suction tip: 4 40. volkmann bone curette : 4 41. mallet 7 , 21b; 1...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

34096949 supply of telecom telecom , combination pliers , screwdrivers and nut drivers , wire strippers , voltmeter , ammeter , labeling machine , power drills and drivers , hammer / drills , circuit testers , knife , electrical tape , duct tape , atool pouch , ladders and step stools , allen wrench set ( hex set ) , non contact voltage detector , otdr , power meter , desktop computer with intel i3 processor, 6 gb ram & cd rom , modems / routers , printer with scanner , oscilloscope , rj 45 modular plug , diagonal cutting pilers , long nose pliers , multi tester , lan teste , fisshing tool , fusing splicer ( small ) , fist aid box , rulers , t square , screw drivers , googles , gloves , protractor , anti static wrist wrap , crimping tools , flash lights , sharp pointed tweezers , mirror ( inspection ) , utp cat. 5 cable , utp cat 6 cables...

Rajasthan State Road Transport Corporation - Rajasthan

34096734 supply of spare parts of leyland vehicles 1 various oil seal pioner,cai,super seal 2 various fan belt fenner hilton 3 brake shoe inner &clutch facing. tvs rana 4 major &minor repair kit webco. 5 prop. shaft component s n d sons, ndb,d.d 6 king pin components srmt 7 u bolts,i bolts , centre bolt with nut gs force 8 chasis malleable components shakle ,all. bracket gs 9 shakle pin & bushes gs force 10 high tensile automile fastner unbreko ,hmr pooja 11 water pump components meko ,kafila 12 automotive rubber parts 13 all spare relavents to repair of power stearing box & pump rane 14 head light assambly head light unit accesaries lumix 15 automotive bulb, break light,roof light head light, meter bulb auto pal phonit comet 16 automotive switch flasher 24v h.l.switch 24v dimmer switch 24v reliance/kkk 17 wipper arm 20” wipper blade 20” 18 auto electricls spare parts relative to repair of self starter & alternator lucas , auto best auto spark. 19 f.i.pump spare parts mico bosch 20 allu.rivit for facing 40 hole p1700114 rpw 21 rivit for slack adjuster m813090 rpw 22 slack adjuster cover plate mei 1676 mei 1676 mei 23 major rep.kit rk002 mei 24 minor rep.kit rk001 mei (engine parts) s.no. nomenclature part no. make rate gst 1 exhaust monifold nut f3586215 hmr 2 exhaust monifold stud f3769315 hmr 3 ac crank shim npn gen 4 sump plug f3101211 5 with drawl plate 4 finger b1301503 ibc 6 release bearing ff cover f1103342 gen 7 release bearing housing ff f1870122 gen 8 cap valve steam x1100615 ll parts 9 cap oil filter (filter cap) f1133960 rpw 10 cy.liner x bs ii x3404322 tiger 11 cy.liner y bs ii x3404422 tiger 12 cy.liner z bs ii x3404522 tiger 13 main brg.set 0.10 p0914851 glyco 14 main brg.set 0.20 p0914951 glyco 15 main brg.set 0.30 p0915051 glyco 16 main brg.set 0.40 p0915151 glyco 17 main brg.std 90414751 glyco 18 con.road.brg.set 0.10 p0914351 glyco 19 con.road.brg.set 0.20 p0914451 glyco 20 con.road.brg.set 0.30 p0914551 glyco 21 con.road.brg.set 0.40 p0914651 glyco 22 con.road.brg.std p0924451 glyco 23 crank thrust washer std p0915251 glyco 24 con.road bush bs iii ley parts 25 oil filter bs ii eti x4001000 naveen 26 oil filter bs iii f7a01500 ley parts 27 came bush kit p0920451 ley parts 28 piston assy.bs ii eti p0959851 goetze 29 piston assy.bs iii p2620551 goetze 30 valve seat exhaust p08100634 ley parts 31 fly wheel shim thick 14 rose 32 valve steam oil seal bs ii ley parts daino 33 cyl.head gaskit mls x1700813 excel talbros 34 ohg kit whg 6 dti mls p260317 excle talbros 35 valve grinding rubber 36 tapper cover packing 37 return spring for pressure plate b1301504 (zf gear spare parts) s.no. nomenclature part no. make rate gst 1 selector plate 3rd f2437514 ley.parts 2 selector plate 1st & 2nd f2737614 ley.parts 3 syncro ring 1st & 2 nd f1612311 ley.parts 4 sliding dog clutch 2nd & 3 rd f1608411 ley.parts 5 sliding dog clutch 4th & 5th f1609611 ley.parts 6 t p cover f7100922 ley.parts 7 filter elbow f1337342 ley.parts 8 syncro cone mk 2nd f1610411 ley.parts 9 sleeve f3421615 ley.parts 10 sleeve for spigot bearing 3424115 ley.parts 11 syncro kit p0944851 ley.parts 12 selecter pad f4944310 ley.parts 13 helical spring f3637510 ley.parts 14 syncro body 5th & 6 th f1609511 ley.parts 15 input shaft f3347011 ley.parts 16 locking ring f4930513 ley.parts 17 syncro ring 2nd & 4th f1600716 ley.parts 18 syncro ring 5th & 6th f1624611 ley.parts 19 syncro body 3rd & 4th f1600811 ley.parts 20 detent plunger f4206315 ley.parts 21 detent plunger spring ley.parts 22 sleeve reverse f3424215 ley.parts 23 rear nut locking ring f4930313 ley.parts 24 pressure piecl (plunger) f3400218 ley.parts 25 ball pin big f0927415 ley.parts 26 ball pin small f0927815 ley.parts 27 syncro cone mk 2 (2nd & 3rd) f1610511 ley.parts 28 selector shaft f3351415 ley.parts 29 selector shaft kit p0944751 ley.parts 30 split ring f0743910 ley.parts 31 syncro cone 1st zf f1650111 ley.parts 32 m.s.4th gear zf f1647311 ley.parts 33 c.s.4th gear zf f1646911 ley.parts 34 input shaft cover bs iii f7116422 ley.parts 35 m.s.5th gear bs iii f8a04711 ley.parts 36 l.s.5th gear bs iii f1610111 ley.parts 37 4th gear ms 24 teeth bs iii f1668911 ley.parts 38 input shaft mk 2 f3318211/611 ley.parts 39 gear box gas kit zf p2603017 ley.parts 40 return spring gear box f3650410 ley.parts 41 split ring 37 mm f741410 ley.parts (prop. shaft leyland spare) s.no. nomenclature part no. make rate gst 1 u.j cross shim npn gne 2 prop. shaft check nut bsii npn gne (front axle leyland spare) s.no. nomenclature part no. make rate gst 1 front jaw & pin with nut f0930115 apare 2 brake cam sleeve spacer rose 3 brake cam washer rose 4 brake cam shim 5 brake cam lock 6 frt. axle cotter pin 3 1/2 7 frt. grease cap packing f1731400 tiscon 8 king pin gaskit npn tiscon 9 king pin bush f0500342 srmt 10 stud axle 11 king pin cotter pin big f0983015 gne 12 king pin cotter pin small f0982715 gne 13 tie rod rep.kit bsiii f3406551 vxl (rear axle leyland spare) s.no. nomenclature part no. make rate gst 1 rear jaw & pin with nut apare 2 brake cam sleeve rear gne 3 rear diaphram m843310 4 o ring rear p1600227 5 diapharam tata m843311 6 brake linear rivits set 80 hole npn 7 gear side diff.(sum gear) p4900616 8 rear axle shaft packing tiscon (chasis spare) s.no. nomenclature part no. make rate gst 1 rediator cap with chain bsii rose 2 clutch socket comp. gne 3 clutch socket screw gne 4 diesel pipe 19x19 star 5 diesel pipe 17x20 star 6 oil flexible pipe star 7 shackle pin lock bolt with nut 1/2 x 2¾ hmr 8 rediator hose metal 9 gear joint assy. ley parts (misc. spare) s.no. nomenclature part no. make rate gst 1 battery teerminal p+n kai 2 battery lug kai 3 battery charging clip kai 4 commutator side fiber washer 37swg rpw 5 commutator side fiber washer 23swg rpw 6 rear view mirror with bracket deer/ vip 7 rear view mirror deer/ vip 8 red reflector (eye cat) 9 allu. washer flat 6 mm 10 allu. washer flat 8 mm 11 allu. washer flat 10 mm 12 allu. washer flat 12 mm 13 allu. washer flat 14 mm 14 allu. washer flat 16 mm 15 allu. washer flat 18 mm 16 allu. washer flat 19 mm 17 allu. washer flat 20 mm 18 allu. washer flat 22 mm 19 allu. washer flat 30 mm 20 allu. washer flat 32 mm 21 allu. washer flat 34 mm 22 injector pressure shim 5 k.g tata/leyland 23 injector pressure shim 10 k.g tata/leyland 24 injector pressure shim 15 k.g tata/leyland 25 element shim 26 tail lamp assy. 4 chamber neko 27 tail lamp cover 4 chamber neko 28 side indicator light commet mesko 29 side indicator light commet glass mesko 30 roof light no.1000 mesko 31 toggle switch simco 32 pull & push switch simco 33 wiper wheel box big mesko 34 head light holder 3 pin 35 self starter switch simco 36 l.e.d light yellow 24 volt mesko 37 l.e.d light red 24 volt mesko 38 l.e.d light white 24 volt 39 fuse box 12 poll 24 volt kka 40 wiper lock big mesko 41 wiper lock small mesko 42 wiper blade 24 wiperman 43 wiper arm 24 wiperman 44 warning lamp assy. domex 45 warning lamp bulb h 4 46 l.t wire 4mm (one role 25meter) kai 47 l.t wire 6 mm kai 48 l.t wire 8 mm kai 49 p.v.c tape steel grip 50 cotton tape roll big 51 wiper gear wheel big 52 aralite tube 36gm 53 wiper gear wheel small...

Local Self Government Department - Rajasthan

34022765 bids are invited for personal computer , printer , laser printer , folding blinds , folding curtains , cctv camera , dvr 8 channel , cat 6 cable , hard disk , led tv , web cam , speaker with mic , table eo, cm , table other room , computer table , side table withdrawer eo, cm , chair wheeled eo, cm , chair wheeled otherroom , chair , fan , led light recessed , led bulb , inverter , battery tubular , air condition total quantity : 378...

Medical And Health Services - Rajasthan

34001745 supply of medical and surgical equipments 213 acycluvir crean bp 5% 2 acyclovir suspension ljsp 400ing15m1 3 lacyclosfir tablets ip 200 mg 4 64 jacyclovir tablets ip 800 mg 6 34 65 dhasivc plaster n.5cr adrenaline injection ip lmg / m1 lbendabole oral suspension 400 ne 10ml 66 lbendazole tablets ip 400 mg 9 339 iprazolam tablets ip 0.25 nap 10 340 11 260 iprazolam tablets ip 0.5mg minium hydroxide tab. nfi formula df chewabletab contains magnesium riesiliage ip 250mg, dried aluminium hydroxide gel ip 120mg, peppermint oil .003m1 12 67 ikacin injection ip 100 mg 13 68 mikacin injection ip 500 mg rininophylline injection ip 25 mg / ml 14 15 16 17 365 341 461 itriptyline tablets ip 25mg film .oated amlodipine and atenolol tablets [ amlodipine besilate equivalent to amlodipine 5 mg atenolol 50 mg ] 184 amlodipine tablets, ip tt‘g 18 19 20 21 l8$ 69 70 22 23 amlodipine tablets ip 5 mg amoxycillin and cloxacillin capsules 1250mg + 250 mg kmoxycillin and potassium ciavulanate cabs ip 500 me+125 mg 73 rnoxycillin capsules ip 250mg mcixycillin capsules ip 500mg moxycillin trihydrate dispersible tablets ip 125mg 24 412 lainpicillin c apsules [ p 26 75 .arnpieillin injection 500 mg 26 27 iampicilline+cloxaeine 250 in_ 261 antacid liquid each sail contains. aluminium hydroxide gel 250 mg, magnesium trisilicate ?50mg, methyl polysiloxane 50mg ; 225 rtuni a blood groving serum ( anti 28 a monoclonal sawn ip ) 29 226 nti b bkoil grouping serum 30 227 nti dri1 blood grouping serum , 31 228 anti 0 blood grouping serum 32 0 anti snake injection 33 0 antibiotic. ear drop cipro 34 0 ancifungel ear drop 35 387 ascorbic acid tablets ip 500 mg 36 16 aspirin tablets ip 300 mg 37 186 latenolol tablets ip 50 mg 38 187 latorvastatin tablets ip lonig 39 1 atropine sulphate injection 06 imglml ( sc / inviv tise ) , • 40 7s aziiktomycin tablets ip 100 mg dispersible tabs 41 79 i thromycin tablets ip 250 mg 42 80 i thrornycin tablets ip 500 mg 43 andage 4 44 0 t: a.ndage 6 46 366 : eclomethasonc inhalation ip•200 lidose ►6 230 : nedicts solution ( qualitative ) 47 81 benzathine beazylpenicillin inj p 12 lac units 48 82 enrathine benzylpenicillin inj ip 6 lac its 49 i ; etamediatone sodium phosphate 418 injestion ip 4nteml 50 s 35 retamethasont tablets ip 0, 5mg 51 279 biiahasic isaphane his din injection ip 30% soluble insulin & 70% lsophane insulin ) inj 40 ilitml ( r•dna origin ) 1 52 262 • isacodyl tablets ip 5 mg 53 398 lack disinfectant fluid ( phenyl ) ( as per schedule 0 grade iii 54 0 black g , nle 55 367 budesonide nebuliber suspension d.25mge ml 56 0 tlyoscine butyl bromide . 57 0 arbopro&t gel 58 214 alamine lotion ip 59 388 alcium glucose injection ip 10% ( iv use ) 60 389 • iciwn lactate tablets ip 300 mg 61 54 rbanutzepine tablets1p 100 mg ( film ed ) • 1 . , cs i w 53 arbamazepine tablets rp 200 mg ( film oated ) i u� 281 carboprost tromethamine injection each ini contains carboprost 025ing / m1 64 card throe 66 cat gut 0 no 66 cat gut i no 67 catheter k 90 68 84 cetixime tablets ip 100 mg 69 85 lcefixime tablets ip 200 mg 70 cefoteraxone and sulbactum for injectior gfopmazone stadium cq. to cetbperazone i g and sulbactu.m sodium 4 to stilbactum 04 g ow iv use ) 71 87 efotaxime injection ip i g 72 8 efotaxirne injection ip 250 mg 73 89 eltatidime inection ip 1 g 74 90 cftazidimc injection ip 250 mg 75 91 ettazidirne injection ip 500 mg 76 ceftrioxone injection ip 125mg 77 93 ceftrioxone injection ip ig / vial 78 ceillioxone injection ip i gm 79 94 ceflrioxone injection ip .250 mg / vial 80 95 ceftrioxone injection ip 500mg / vial 81 96 cepltalexin capsules ip 250 mg 82 97 cephalexin capsules ip 500 mg 83 36 cetirizine tablets ip 10mg 84 215 cetritnide cream ip; 85 243 cetrimide tincture 9.5% *iv ( ceylon& 04% wfv. average absolute alcohol content 65.5 % viv ) 86 321 chioramphertieol eye drops 0, 5% r , , 88 ;41 chloridazepoxidc tablets ip lartig chloroquine phosphate injection ip 40 ingi ml 89 i� chlomquine phosphate tab, ip 250mg ( 74155 mg of chloroquine base ) ( film coated ) 90 100 chloskz siptup [ p 50 ins :51111 91 37 chlorphenirami►e maleate tablets ip :mg 38 92 hlorpheniramine oral solution bp m ) gl5m i 343 93 chlorpmmazine tablets 100 mg sugar coated 94 346 chlorpromazine inj, ip 25mgern1 344 95 chlorpromazine tablets rri 2$ ca.?, sugar coated 95 345 chlorpromazinefrobs ip 50 mg, ( coated tablets ) 97 98 99 322 niprofloxacin eye drops 0, 3% wiv 4, 101 ronoxaciu in onion ip 2002ng / 100m1 323 ciproflosacin ophthalmic ointment usf 1 3% 100 102 ciprofloxacin tablets ep 256 mg film elated 1101 103 ciptolloxacin tablets ip 500 mg film coated 102 283 clomiphene tablets ip 50 mg 103 348 clonazepam tablets ip i mg 104 188 clopidogrel tablets all 75 mg 105 104 lotrimazole cream ip 2% wiw 106 105 lotrimazole vaginal tablets ip 500mg 108 244 mpound benzoin tincture ip 109 106 ompound benzoic add ointment 11 ) it enzoic add 6%+ salicylic acid 3% 110 377 =pound sodium pen latj. ip 111 284 onjugated estrogen tabs usp 0.625 mg 112 o trimoxazole oral suspension ip 107 each s ml contains trimethoprim 40 mg • d sulphamethoxazole 200 mg 113 109 o trimoxazole tablets ip trimethoptim 0 m = and sul liainethoxazote 400 m • 114 108 co trimoxazole tablets [ p trimethoprim , 0 mg and sulphamethoxazole 200 mg 115 0 tam thread 40 no. 116 0 onion thread w no. 117 0 onott roll `18 368 ough syrup ead► sail contains hloropheniramine maleate ip 3ing inmoniurn chloride 13.0misodium citrate 65 mg menthol 0.5 mg syrup q.s. • 119 ed sthring niddle 120 39 dexarnethasone injection ip gt2rni 121 40 exarnetbasone tablets ip 0.s.ing 122 xtrose 5% injection 123 379 dextrose injection 10% 124 380 dextrose injection 5% isotonic 125 378 dextrose injection ip 25 % w / v 126 231 diagnostic sticks for urine sugar 127 diamond brush 126 diamox tablets 129 349 diazepam injection ip 10mg2ml ( imi1v sise ) 130 350 diazepam tablets ik 5.mg • 131 diazpam injection 132 17 diclofenac gel bp 1% 133 18 diclofenac sodium and paracetamol ablets dklorenac sodium 50 mg paracetamol 500 mg 134 483 iclofenac sodium and paracetamol ablets iclofenac saari% 50 tag + paracetamol 325 mg, etc....

Indian Army - Rajasthan

33981846 bids are invited for multimeter digital cat iii 600v , temp controlled soldering station , laptop screwdriver set , star allon key , impect wrench , longdeep 12 point socket 10mm , longdeep 12 point socket 14mm , socket 16mm , stanly combination spanner set with tool box , screw driver flat head 12 , screwdriver star head 12 , taparia socket set , chain wrench ,creeper , injector tester , taparia screw driver set , icextractor total quantity : 35...

Central Railway - Rajasthan

33967576 supply of ht hrc fuse link, singleht hrc fuse link, single, high voltage hrc fuse with tricker, 3.6 kv ac, current capacity 20 a, breaking capacity 40 50ka as per cat no. 3.6wdoh20 of eaton bussmann of 9 kva transformer of lhb gs & cn coaches as per rdso spec. no. rdso / pe / spec / tl / 0158 2010 ( rev. 1 ) , make siba, wohner, ferraz, eaton bussmann only. the material is to be procured from oem or their authorized dealers only with manufacturer test certificate...

Airports Authority Of India - Rajasthan

33957370 bids are invited for fixed outdoor ip camera , fixed indoor ip camera , ptz outdoor ip camera , 24 port poe switch , 16 ch nvr , 3 kva online ups , workstation pc , 32 inch led monitor , only laying of cat 6 lan cable , power cable for ptz cameras 3 core 1.5 sq. mm, supply and laying , only laying of pvc conduit , as per site requirement , flexible conduit, supply and laying , network accessories , access control system , biometric card cum rfid card , exit button cum rex button , em lock single leaf , supply, installation, testing and commissioning , camc of cctv and access control system for 1st year , camc of cctv and access control system for 2nd year , camc of cctv and access control system for 3rd year...

Indian Army - Rajasthan

33957042 bids are invited for cd r hp , dvd r hp , u clip 6 mm , screw 2 inch , drill bitt 6 mm , drill bitt 8 mm , 4 port lmb , socket with shutter rj 11 , mcb 6 amps , utp cable roll cat 6 , rosset box , line cord , wireless keyboard and mouse dell , usb to hdmiconverter , data receiver hd box , change over switch ,dura cell aa ultra , dura cell rechargeable aa , charger forrechargeable cel , rechargeable cordless cell panasonic total quantity : 844...

Military Engineer Services - Rajasthan

33929060 maintenance and repairs to various external electric supply items at base camp under ge partapur taking out un serviceable / faulty cable / service connection cable of any grade / type / class of any sizefor repair / replacement from pole / wall / cable duct under ground trench etc for re use or removal from site of work all as specified and as directed by the engineer in charge ( note excavation and earth work shall be measured and paid separately ) 2 supply, laying, fixing, passing through pipe or laid in trenches and testing underground xlpe insulated armoured heavy duty electric cable with aluminium conductor 1100 volts grade cross section area 2 core 10 sqmmall as specified and directed. 3 supply, laying, fixing, passing through pipe or laid in trenches and testing underground xlpe insulated armoured heavy duty electric cable with aluminium conductor 1100 volts grade cross section area 2 core 16 sqmmall as specified and directed. 4 supply, laying, fixing, passing through pipe or laid in trenches and testing underground xlpe insulated armoured heavy duty electric cable with aluminium conductor 1100 volts grade cross section area 4 core 16 sqmmall as specified and directed. 5 supply, laying, fixing, passing through pipe or laid in trenches and testing underground xlpe insulated armoured heavy duty electric cable with aluminium conductor 1100 volts grade cross section area 4 core 25 sqmmall as specified and directed. 6 supply, laying, fixing, passing through pipe or laid in trenches and testing underground xlpe insulated armoured heavy duty electric cable with aluminium conductor 1100 volts grade cross section area 3.5 core 35 sqmmall as specified and directed. 7 supply, laying, fixing, passing through pipe or laid in trenches and testing underground xlpe insulated armoured heavy duty electric cable with aluminium conductor 1100 volts grade cross section area 3.5 core 50 sqmmall as specified and directed. 8 supply, laying, fixing, passing through pipe or laid in trenches and testing underground xlpe insulated armoured heavy duty electric cable with aluminium conductor 1100 volts grade cross section area 3.5 core 70 sqmmall as specified and directed. 9 supply, laying, fixing, passing through pipe or laid in trenches and testing underground xlpe insulated armoured heavy duty electric cable with aluminium conductor 1100 volts grade cross section area 3.5 core 185 sqmmall as specified and directed. 10 supply, laying, fixing, passing through pipe or laid in trenches and testing underground xlpe insulated armoured heavy duty electric cable with aluminium conductor 1100 volts grade cross section area 3.5 core 300 sqmmall as specified and directed. 11 m&l for line separators of lt oh lines with nut, bolts & washers straight type fixed at a point as directed and suitable for 4 wire complete all as specified and directed by engr in charge. 12 m&l for painting steel and iron surfaces, old / new surfaces of steel tublar poles / steel tublar swaged poles of any description, length n. exc 9 mtr above ground level incl angle iron / clamps bracket etc with one coat of silver aluminium paint two coat of synthetic enamel paint upto 1.5 mtr above coping in 30 cm wide strips in alternate black and yellow colour complete all as directed by engr in charge. 13 supply and fixing aluminium bus bar chamber 3 phase, 200 amp capacity with 4 nos al strips not less than 600 mm long, outdoor type including one mccb of 125 amps 4 poleas incommer with locking arangement, grouting in pcc 1:3:6 and connecting with ug xlpe cable with suitable copper thimbles complete all as specified and directed. 14 m&l for earthing complete with galvanized steel earth plate electrode 600x600x6mm thickness not less than 6mm thickburied directly in ground ( earth plate not less than 2.25 mtr deep belownormal ground level ) with top edge ofearth plate not less than 2.5 mtr below the normal ground level connected to galvanized iron wire 4 mm dia by means of nuts bolts, nuts, check nuts and washersof gi steel all as shown in electrc plate ni 5 connected to earth test point all as specified and indicatedcomplete andincludingcharcoal dust, salt etc and gi protection pipe light grade 40mm bore andgi watering pipe 20mm bore medium grade with funnel and wire mesh , 40mm thick pre cast rcc m 15 ( nominal mix ) cover reinforced with xpm weight not less than 4 kg / sqm with suitable handle of 6mm dia ms bar and angle iron 40x40x3mm frame for cover, pcc m 15 ( nminal mix ) pit, excavation and earth work in any type of soil and connected all as specified and as directed by engineer in charge. 15 m&l for earthing complete with galvanized steel earth plate electrode 600x600x6mm thickness not less than 6mm thickburied directly in ground ( earth plate not less than 2.25 mtr deep belownormal ground level ) with top edge ofearth plate not less than 2.5 mtr below the normal ground level connected to galvanized iron earthstrip of size 32 x 6 mm thick by means of nuts bolts, nuts, check nuts and washersof gi steel all as shown in electrc plate ni 5 connected to earth test point all as specified and indicatedcomplete andincludingcharcoal dust, salt etc and gi protection pipe light grade 40mm bore andgi watering pipe 20mm bore medium grade with funnel and wire mesh , 40mm thick pre cast rcc m 15 ( nominal mix ) cover reinforced with xpm weight not less than 4 kg / sqm with suitable handle of 6mm dia ms bar and angle iron 40x40x3mm frame for cover, pcc m 15 ( nminal mix ) pit, excavation and earth work in any type of soil and connected all as specified and as directed by engineer in charge. 16 excavation in trenches not exceeding 1.5 mtr wide and not exceeding 1.5 mtrs in depth for laying of cable, fixing of stay etc 10 sqm on plan and n exc 1.5 in depth and getting out in hard / dence soil complete all as specified and directed by engineer in charge. 17 returing, filling in incl spreading, levelling watering and well remming in layers n.exc 25cm width, complete all as specified and directed by engineer in charge. 18 removing excavated soil to a distance n.exc 50 m and depositing where directed at a level n.exc 1.5 m above starting point completed all as specified and diercted by engineer in charge. 19 sand cushioning for under ground cable 8 cm before laying the cable and 15 cm after laying and streching the cable complete all as specified and directed by engineer in charge. 20 m&l un reinforced precast factory made concreate cable covers, class lv type i, with flat size 250x150x40 mm complete all as specified and directed by engineer in charge. 21 supply and laying / fixing, gi pipe medium grade 40 mm bore ( dia ) including all type fittingsfixed on walls / to poles with clamps / laid in trenches as cable protection all as specified and directed. 22 supply and laying / fixing, gi pipe medium grade 50 mm bore ( dia ) including all type fittingsfixed on walls / to poles with clamps / laid in trenches as cable protection all as specified and directed. 23 supply and laying / fixing, gi pipe medium grade 80 mm bore ( dia ) including all type fittingsfixed on walls / to poles with clamps / laid in trenches as cable protection all as specified and directed. 24 s&f mccb 4 pole, 415 v, 160 amps with breaking capacity 25 ka, adjustable type complete all as specified and directed by engr in charge. 25 s&f mccb 4 pole, 415 v, 250 amps with breaking capacity 36 ka, adjustable type complete all as specified and directed by engr in charge. 26 s&f mccb 4 pole, 415 v, 400 amps with breaking capacity 50 ka, adjustable type complete all as specified and directed by engr in charge. 27 supply, laying , testing unarmoured electric cable ( service wire ) in replacement of size 10 sqmm 2 core complete complete all as specified and directed. 28 material and labour for pcc 1:3:6 type c 2 using 40mm graded crushed stone aggregate as in foundation, filling or mass concrete as in foundation stays etccomplete all as specified and directed by engr in charge. 29 supply and installation erection commissioning and testing of main lt pannel cubical out door type weather / dust proof, factory made out of 3.15 mm thick crca sheet powder coated with front and back side openable with suitable cable alley and front side shutter with locking arrangement panel base of angle iron 50x50x6mm upto 45 cm height for 433 volts, 3 phase, 4 wire system including four pole aluminium bus bar 400 amps capacity including control wiring with suitable size of pvc insulated standed copper conductor and incoming / outgoing connection with aluminium bus bar complete as per manufacture design complete mounted or fixed on pcc foundation above 0.45 mtr on floor and cable connection with suitable size of aluminium lugs and glands complete comprising the following: 30 ms sheet body of lt panel with double door angle iron frame 31 incomming 32 ( a ) mccb, 250amps, 36 ka optium 1.0 ( fixed tm range ) 4 polemake : indoasian cat no 830116 01 nos 33 outgoing 34 ( b ) mccb, 125 amps, 25 ka, optium 1.0 ( fixed tm range ) 4 pole make : indoasian cat no 830050 01 nos 35 ( b ) mccb, 63 amps, 16 ka, optium 1.0 ( fixed tm range ) 4 pole make : indoasian cat no 830050 01 nos 36 ( d ) mccb, 25 amps, 16 ka, optium 1.0 ( fixed tm range ) 4 pole make : indoasian cat no 830016 01 nos 37 ( e ) mccb, 16 amps, 10 ka, optium 1.0 ( fixed tm range ) 4 pole make : indoasian cat no 830710 01 nos 38 ( f ) led type phase indicattor lamp ( ryb ) 01 set 39 ( g ) digital ammeter 0 400a flush type square with selector switch & cts3 nos 01set 40 ( h ) digital voltmeter 0 500v flush type square with selector switch 01 nos 41 ( j ) change over 200 amps make : indoasian cat no in10a200 01 nos 42 supply and fixing lt cable route direction metal sign board, yellow color circular plate with written indication and fixing arrangement on earth all as directed and specified....

Medical And Health Services - Rajasthan

33926279 supply of lab regents and x ray 1 preg. card ( mankind ) 2 multi uristix ( mission ) 3 blood group reagent ( tulip ) 4 esr tube disposable 5 sample vial with clotapplicator 6 k 3 vial ( double cap ) 7 sugar kit ( equacheck / dibascan ) 8 widal test kit ( becon / span ) / arkray 9 glass slide 10 cover sleep 11 urea test kit ( erba ) ( 5x20m1 ) 12 erba sgot test kit ( erba ) ( 5x20m1 ) 13 erba sgpt test kit ( erba ) ( 5x20m1 ) 14 sarum alkaline phosphatase test kit ( erba ) ( 10ax2.2m1 ) 15 lancet 16 bilrubin test kit erba ( direct & total ) 17 creatinine test kit ( erba ) 18 cholesterol test kit ( erba ) 19 vdrl test kit ( sd ) 20 hbsag test kit / card ( sd ) 21 analyzer. cleaner solution ( erba ) 22 hdl cholesterol direct mahtod ( erba ) 23 tri glicride test kit ( erba ) 24 mp card ( sd ) antigen 25 dengue card ( j mitra ) 26 total protien ( erba ) 27 utistix a / s 28 gluco strip ( accu check ) / one touch 29 hb pipette 30 leishman stain ( tanbaxy ) 31 rbc diluting fluid 500m1 32 wbc diluting fluid 500m1 33 auto pipette tips 100 to 1000u1 blue 34 auto pipette tips ( 1 to 100u1 ) yellow 35 sodium citrate 500m1 36 n / 10 hcl 500m1, 37 i xyiene 500m1 38 urine container 39 sprit ( 5ltr. ) 40 test tube without cat ( riavial ) 41 touriquet 42 distilled water ( 5ltr. ) 43 jsb 1st 44 jsb 2nd 45 capillary tube •• 46 hemoglobin strip ( hemocue ) 47 hb scale strip ( hemocheck ) 48 analyzer printer roll 49 fillter paper _... 50 serum allvumin kit ( erba ) 51 marker pencil 52 parmanent marker 53 liqued hand wash ( 5ltr. can ) 54 abxlyse bio ( 1 ltr. ) ( horriba ) 55 abxcleaner ( 1 ltr. ) ( horriba ) 56 minoclair ( 0.5 ltr. ) ( horriba ) 57 minidil lmg ( 20 ltr. ) 58 albumin kit ( erba ) 59 vldl kit ( erba ) 60 hydro chloric acid solution 61 cader wood oil 62 facemask ( n 95 ) 63 sharp container 64 glassware container 65 glass beaker ( 1000m1 / 200m1 ) ....

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

North Western Railway - Rajasthan

33898466 supply of thermostatic expansion valve tubethermostatic expansion valve tube, thermostatic expansion valve tube type, suitable for using with r 22 / r 407c refrigerant, 4.5 tr, 16kgwp, 500 psi angle way 3 / 8%u201dx1 / 2%u201c angle way as per danfoss make cat no. 068u2075, confirming to rdso spec. no. rdso / pe / spec / ac / 0061 2005 ( rev. 1 ) suitable for use in lhb type rmpu and icf ac coaches. accepted make: danfoss / alco / sporlon or any other make with prior approval of rdso....

Military Engineer Services - Rajasthan

33885635 repair / replacement of ftl / cfl / mirror / bulk headlightfittings and connected items at nasirabad mil stn under ge nasirabad. taking down carefully by unscrewing from boards / outlet boxes, light fittings and fixtures such as tube light fittings, bulk head fittings, mirror light, sketch light fittings, bldg sec light etc and removing material to store for taking in credit and making good disturbed surface of wall / ceiling etc complete all as specified and directed by engr in charge. 2 s&f in repair led tube light fitting in acrylic linear tube ( 1x 18 watt ) , 230v for single led tube lightincluding 1 x 18 w ledretrofitbar professional cw 6500 k cover channel, bipin holders, led power driver, connector block, etc complete with all accessories internally prewired and including connecting up with three core flexible copper conductor cable with suitable size for connection of fitting from ceiling rose complete all as specified and directed. make: havells cat part no for batten streakt8upto1x22wssbswh, for tube rod photonultra e2.01213t8sstl18wled865spc, bajaj cat part for batten blrb db 118 i for tube rodblrb 18w cw led or equivalent make in crompton / philips 3 s&f in repair, testing and commissioning energy saving street light luminaire 35 / 36 watt led , pressure die cast housing with epoxy powder coated with colour finish and prismatic poly carbonate coverlic cover complete, ip 66 protection incl connecting with three core copper flexible wire from ceiling rose to connector of light fitting complete all as specified and directed by engr in charge. make: philips cat part no brp046 led 36cw mr s1 psu gr, havells cat part no endcitylitplat+sl35wled757sasybopcwospd or equivalent in crompton. 4 s&f in repair led light fittings, 10 w bulk head luminaries 230v, 50 hz complete with all accessories and including connecting up with three core copper conductor cable with suitable size complete all as specified and directed. make: havells / crompton / philips 5 s&f in repair led mirror light fitting, 10 watt, 600 mm length complete with all accessories pre wired and including connecting up with flexible copper conductor cable with suitable size complete all as specified and directed. make: havells / crompton / philips 6 s&fin repair wall mounted decorative luminarie fitting suitable up to 9 / 10 watt led lamp b 22 base incl led lamp 9 / 10 watt b 22 base complete all as specified and directed by engr in charge.make: make havells cat part no lhdl02160099 or equivalent in crompton / philips. 7 s&f in repair recess mounted led 12 watt slim, compact, auminum die cast edge lit panel, round fixture with opal diffuser and separate electronic drivercomplete all as specified and directed by engr in charge. make:philips cat no dn193b led12s 4000 psu wh s2, havells cat part no integraneodlr12wled857s or equivalent in crompton. 8 s&f in repair surface mounted led downlight 15 watt round shaped , slim surface mounted led panel with premium diffuser to ensure glare free & even light distribution complete all as specified and directed. make: havells cat part no integraneosurfacedls15wled830s or equivalent in crompton / philips. 9 s&fin repair surface mounted led downlight 18 watt round shaped , slim surface mounted led panel with premium diffuser to ensure glare free & even light distribution complete all as specified and directed. make: havells, model trim cosmo surface round, cat part no lheaahp7il1w018, or equivalent model of philips / compton 10 s&f in repair recess mounted 2 x 2led luminarie 36 watt, cool day / warm white light with white powder coated crca housing with led driver, efficiencey >100 lm / wcomplete all as specified and directed. make : havells cat part no venusneo2x2plr36wled857potr, philips cat part no rc383b led 36s 4000 psu od wh pir, bajaj cat part no bzrsql 43l led gx pro wh or equivalent crompton. 11 s&fin repair surface mounted 2 x 2led luminarie 36 / 32 watt, cool day / warm white light with white powder coated crca housing with led driver, efficiencey >100 lm / wcomplete all as specified and directed. make:havells cat part no planosur2x2pls36wled857s0720, philips cat part no sm366c led32 6500 psu od gr, bajaj cat part no bzssql 36l led wh gx or equivalent in crompton. 12 s & f high efficiency round highbay with circular form factor and available in both narrow & wide beam optics options of tougened glass & pc cover and luminaire in pressure die cast housing for industrial application 145 / 150 / 160 watt, lumen efficiency upto 130 lm / wor upto 4000k ip65 protection including led driver upto 15 meter height of repair bay complete all as specified and directed.make : havells cat part no saucergenxhbp150wled857pnbborl, philips cat part no by415p led145s cw nb fg psd gr s5 or equivalent in crompton. 13 s&f in repair street light bracket made of 32 mm gi pipe , 1.2 metre lenght fixed withtwo nos of clamp of suitable size , nut and bolts complete all as specified and directed. 14 total in figures 15 quoted amount in words...

Indian Army - Rajasthan

33877608 bids are invited for telephone cable 90 mtr per roll , switch 8 port , cat 6 cable , rj 45 connector , casing patti elect total quantity : 1264...

Medical College - Rajasthan

33874677 dedicated internet line work dedicated internet line work , dedicated internet line laca / kh dk;za ( fufonknkrk dks fufonk ds format for technical compliance bid ds technical specification ) ds vuqlkj izzr;sd vkbzve dh nj dksv djuh gksxha , laying of armoured optical fibre cable multi mode min. 6 core in pvc cashing / conduiting / open as per requirement. , fibre optic pigtail multi mode , optical fiber patch cord multi mode , uu 06 port , cable manager , trans receiver modular multi mode , fiber splicing , ups 1kva , network rack with power extension , coupler , fiber patch cord 1 mtr. , network poe switch 12 port with 6 sfp port , network switch 24 port with 2 sfp port , pvc cashing / conduiting , cat 6 cable , rj 45 connector , crimping and punching rj 45 , cat 6 patch cord 2 mtr. , i / o box with jack...

Indian Institute Of Technology - Rajasthan

33855769 providing and fixing cooper plate earthing with copper strip in lab no. 103 and 105 of mme building and provision of cat 6 lan cable in the existing furniture of lab no. 215 of bsbe building of iit jodhpur....

Indian Oil Corporation Limited - Rajasthan

33855191 expression of interest for additional contractor for capex rate contract under cat i rs.0 3 lakhs for carrying out of maintenance and low value capital jobs of civil electrical mechanical nature works excluding installation of tanks at retail outlet...

Rajasthan University Of Health Science - Rajasthan

33785273 cctv surveillance system with one year onsite comprehensive warranty support ip based cctv surveillance system with one year onsite comprehensive warranty support , electrical items : , 64 channel network video recorder , 8 channel network video recorder , 8 mp fixed bullet camera , 5 mp fixed dome camera , 5 mp fixed bullet camera , 24 port gbe smart managed poe switch , 8 port gbe poe switch , cat 6 utp cable , surveillance hdd ( 10 tb ) , 1kva offline ups , cctv usage display , 6u rack with 1*tray, 1*pdu, 1*cable manager , hdmi cable , cat6 cable laying charges with pvc conduit pipe and required accessories , end to end complete installation & training , optional item of boq for maintenance contract , additional cost: second year comprehensive annual maintenance contract of this ip cctv setup. , additional cost: third year comprehensive annual maintenance contract of this ip cctv setup....

North Western Railway - Rajasthan

33757479 supply of bib cock ( cat no 29037 ) bib cock ( cat no 29037 ) , bib cock ( cat no 29037 ) fusion range of m / s jaquar or m / s mark , or fnobcch of m / s dorset or hr03 of m / s ess ess or se 00202 of acmeco, subject of compliance of firm with clause 3 to clause 7 of section a of rdso / 2008 / cg 05%u201d...

Nagar Palika Nigam - Rajasthan

33713184 supply and installation of items for camera in sewerage treatment plant rigid steel conduit , earth work , pvc unsheathed flexible copper conductor , 4 u rack , port poe switch , cat 6 lan cable , etc ...

Indian Army - Rajasthan

33619056 bids are invited for electrical item 1 pvc copper frls cable insulated multi standard 2.5sqmm colour black red and green for make anchor or havells or finolex or polycab 2 pvc copper frls cable insulated multi standard 1.5sqmm colour black red and green for make anchor or havells or finolex or polycab 3 pvc copper frls cable insulated multi standard 1.0sqmm colour black red and green for make anchor or havells or finolex or polycab 4 flexible wire twin twisted for make havells or anchor or finolex or polycab or vardhman 5 pvc unarmed aluminium cable 10sqmm 2core for make havells or finolex or polycab or plaza or vardhaman 6 pvc capping and casing 25mm with accessories for make anchor or indoasian or philips bajaj or equivalent or isi marked 7 pvc insulated tape 15mm for make steel grip or faxwell or presto or plast or eqivalent 8 ms hook 12mm dia rod for fan 9 ceiling fan 1200mm sweep for make bajaj or usha or cg or khatian 10 electronic type regulator for make bajaj or usha or cg or khatian or orient or anchor 11 exhaust fan 300mm complete of pvc body with louvers for make bajaj or usha or khaitan or cg 12 led 10w light fitting 2 feet complete with tube light fitting completed for make bajaj or philips or cg 13 led 20w light fitting 4 feet complete with tube light fitting completed for make bajaj or philips or cg 14 led bulb 12w with angle holder for make bajaj or philips or cg 15 led bulb 8w with angle holder for make bajaj or philips or cg 16 recess mounting light 2x2 feet with two led tubes of 20w each including all accessories for make bajaj or philips or cg 17 socket for cable tv and socket for telephone with pvc suare box ie juction terminal and 40mm pvc conduit including accessories and clamps etc for pipe 20 rm with coaxial cable for tv and telephone cable 02 run for telephone incl 10 pair terminal box 18 switch 5amps modular type one way for make anchor or crabtree or indoasian or siemens or l and t or havells 19 switch with socket modular type 15 amps 6 pin modular box mounted for make anchor or crabtree or indoasian or siemens or l and t or havells 20 switch with socket modular type 6 amps 5 pin modular box mounted for make anchor or crabtree or indoasian or siemens or l and t or havells 21 external type bulk head fititng with 12 watt led light complete for make bajaj or philips or oreva or cg 22 celling rose for make bajaj or philips or siemens or anchor or equivalent or isi marked 23 bell dingdong ac 230v single phase for make anchor or havells or cg 24 bell push 6 amps modular 230v for make anchor or crabtree or siemens or l and t 25 pvc block 3 x 3 inch for make anchor or havells or cg 26 socket 5 amps modular 5 pin isi marked for make anchor or crabtree siemens or l and t 27 pvc gang box with modular pvc plate of suitable size for 3 way for make anchor or crabtree or indoasian or siemens or l and t or havellsreo or to be provided of same make as for switch or switch socket combination 28 pvc gang box with modular pvc plate of suitable size for 4 way for make anchor or crabtree or indoasian or siemens or l and t or havellsreo or to be provided of same make as for switch or switch socket combination 29 pvc gang box with modular pvc plate of suitable size for 5 way for make anchor or crabtree or indoasian or siemens or l and t or havellsreo or to be provided of same make as for switch or switch socket combination 30 pvc gang box with modular pvc plate of suitable size for 6 way for make anchor or crabtree or indoasian or siemens or l and t or havellsreo or to be provided of same make as for switch or switch socket combination 31 mcb db enclosure 08 way complete for sheet metal enclosures for make anchor or c and g or l and t or legrand 32 mcb db enclosure 12 way complete for sheet metal enclosures for make anchor or c and g or l and t or legrand or hager 33 mcb spn 40 amps for make anchor or indoasian or philips or bajaj or legrand or hager 34 mcb sp 10 amps 10 ka c series for make anchor or indoasian or philips or bajaj or legrand or hager 35 mcb sp 16 amps 10ka c series for make anchor or indoasian or philips or bajaj or legrand or hager 36 mcb sp 20 amps 10 ka c series for make anchor or indoasian or philips or bajaj or legrand or hager 37 mcb sp 25 amps 10 ka c series for make anchor or indoasian or philips or bajaj or legrand or hager 38 mcb sp 5 to 30 amps 10 ka c series for make anchor or indoasian or philips or bajaj or legrand or hager 39 earthing complete set 40 exhaust fan 450mm for make bajaj or usha or khaitan or cg 41 wall mouting fan 450mm sweep with clamps for make bajaj or usha or khaitan or cg 42 fan oscillation 400mm sweep 220 or 230v for pedastal fan for make bajaj or usha or khaitan or cg 43 screw 65mm 25mm and 20mm 44 screw full threaded 100mm 45 screw full threaded 100mm and 120mm 46 lightening conductor complete set 47 fuel filter cat part no 3h 132 01 000 for 62 point 05 kva 48 oil filter 01ltr cat part no 06 436 01 0 00 for 62 point 05 kva for make kirloskar 49 fuel filter fixed type inside change for 62 point 05 kva for make kirloskar 50 engine belt 1385 for 62 point 05 kva for make kirloskar 51 fuel pipe 02 feet length 02 sides female for 62 point 05 kva for make kirloskar 52 fuel pipe 02 feet length 01 sides male and another side for 62 point 05 kva for make kirloskar 53 fuel lead plus for 62 point 05 kva for make kirloskar 54 exhaust fan for 62 point 05 kva for make kirloskar 55 self starter for 62 point 05 kva for make kirloskar 56 battery 12 volt 180 ah for 62 point 05 kva for make kirloskar 57 main switch 200 amp for 62 point 05 kva for make kirloskar 58 head gas cut repair for 62 point 05 kva for make kirloskar 59 push rod seal for 62 point 05 kva for make kirloskar 60 injector with nozzal for 62 point 05 kva for make kirloskar 61 injector assembly for 62 point 05 kva for make kirloskar 62 tappet cover for 62 point 05 kva for make kirloskar 63 belt for alternator for 62 point 05 kva for make kirloskar 64 belt for engine for 62 point 05 kva for make kirloskar 65 exhaust nut bolt size 13 mm for 62 point 05 kva for make kirloskar 66 body nuts size 10 mm for 62 point 05 kva for make kirloskar 67 fuel feed pump assembly for 62 point 05 kva for make kirloskar 68 battery 12 volt 130 ah for 30 kva for make kirloskar 69 fuel filter primery cat part no 3h 132 01 0 00 for 30 kva for make kirloskar 70 fuel filter secondary cat part no 3h 132 01 0 00 for 30 kva for make kirloskar 71 oil filter cat part no 04 270 01 0 00 for 30 kva for make kirloskar 72 fan belt engine avx10x1280 la for 30 kva for make kirloskar 73 fan belt alternative avx10x1135 la for 30 kva for make kirloskar 74 change over switch 04 pole 100 amp for 30 kva for make kirloskar 75 mcb 04 pole 100 amp for 30 kva for make kirloskar 76 avr for 30 kva for make kirloskar 77 change over swithc 03 pole 125 amp for 30 kva for make kirloskar 78 main switch 04 pole 125 amp for 30 kva for make kirloskar 79 emergency stoper for 30 kva for make kirloskar 80 change over switch 04 pole 200 amp for 30 kva for make kirloskar 81 xlpe armoured cable 30 sqm 03 point 05 core for 30 kva for make kirloskar 82 self starter for 30 kva for make kirloskar 83 battery lead minus for 30 kva for make kirloskar 84 oil filter cat part no f002 h20 306 8f6 for 30 kva for make kirloskar 85 xlpe armoured cable aluminium conductor 04 core cable for 30 kva for make kirloskar 86 xlpe armoured cable aluminium conductor 04 core cable 25 sqmm for 30 kva for make kirloskar 87 engine control unit for 15 kva for make kirloskar 88 xlpe armoured cable aluminium conductor 04 cable for 15 kva for make kirloskar 89 battery 12 volt 88 ah for 15 kva for make kirloskar 90 battery 12 volt 92 ah for 15 kva for make kirloskar 91 xlpe armoured cable 03 core 16 sqmm for 15 kva for make kirloskar 92 02 x cover outer 06 x 16 12 ply for 15 kva for make kirloskar 93 02 x tube inner 06 x 16 12 ply for 15 kva for make kirloskar 94 fuel filter for 15 kva for make kirloskar 95 oil filter for 15 kva for make kirloskar 96 fan belt for 15 kva for make kirloskar 97 air filter for 15 kva for make kirloskar 98 self starter for 15 kva for make kirloskar 99 electronic multimeter for 15 kva for make kirloskar total quantity : 7244...

Indian Army - Rajasthan

33568759 bids are invited for nvr , ptz camera , hdd surveillance wd , switch , media converter giga , fiber joint box , fiber patch cable , fiber splicing , 2u network rack , 12u network rack with access , extension cord , cat 6 wire rolls , multimode fiber cable , pvc outdoor junction box for camer , 5 metre hdmi cable4k , led tv display 55 inches , inverter , inverter andbattery with 1600 1800 v 24v , installation and fitting total quantity : 8168...

Department of Information Technology and Communication - Rajasthan

33538296 rate contract rfp for stationary, computer media, consumable and other office itmes 1 canon toner 320 2 canon toner 328 3 canon toner 337 4 canon toner 324 5 toner hp 6511a 6 toner hp ce 278a 7 toner hp cc388a 8 toner hp 05a 9 toner hp 230a 10 toner hp 287a 11 toner hp cf280a, 1 canon toner 328 2 canon toner 337 3 canon toner 324 4 toner hp 6511a 5 toner hp ce 278a 6 toner hp cc388a 7 toner hp 05a 8 toner hp 230a 9 toner hp 287a 10 toner hp cf280a, ( a ) cd / dvd 1 dvd r with cover ( frontech / samsung / moserbaer / hp / sony ) ( b ) usb pen drive ( 3.1 and above ) 1 32 gb ( kingston / sandisk / hp / moserbaer / transcend ) 2 64 gb ( kingston / sandisk / hp / moserbaer / transcend ) 3 128 gb ( kingston / sandisk / hp / moserbaer / transcend ) ( c ) external hard disk drive 1 1 tb sata usb powered ( seagate / wd / transcend ) 2 2 tb sata usb powered ( seagate / wd / transcend ) 3 4 tb usb powered ( seagate / dell / sony / wd / transcend ) 4 512 gb ssd usb powered ( seagate / wd / aarvex ) 5 1 tb ssd usb powered ( seagate / wd / aarvex ) 6 2 tb ssd usb powered ( seagate / wd / aarvex ) d internal hard disk drive 1 512 gb sata hdd 7200 rpm, ( seagate / wd / transcend / aaevex ) 2 1 tb sata hdd 7200 rpm ( seagate / wd / transcend / aaevex ) 3 512 gb ssd ( seagate / wd / transcend / aaevex ) 4 1 tb ssd ( seagate / wd / transcend / aaevex ) 5 512 gb ssd nvme, m.2 port ( seagate / wd / transcend / aaevex ) 6 1 tb ssd nvme, m.2 port ( seagate / wd / transcend / aaevex ) ( e ) ram 1 desktop ram ddr4 ( 8 gb ) ( hynix / samsung / transcend / kingston ) 2 laptop ram ddr4 ( 8 gb ) ( hynix / samsung / transcend / kingston ) 3 desktop ram ddr3 ( 8 gb ) ( hynix / samsung / transcend / kingston ) 4 laptop ram ddr3 ( 8 gb ) ( hynix / samsung / transcend / kingston ) ( f ) other items 1 usb optical mouse ( logitech / iball / hp / dell ) 2 optical wireless mouse ( logitech / iball / hp / dell ) 3 usb keyboard ( logitech / iball / hp / dell ) 4 wireless keyboard ( logitech / iball / hp / dell ) 5 wireless keyboard & mouse combo ( logitech / iball / hp / dell ) 6 web camera ( logitech / iball ) ( minimum hd 720p 30fps 1280*720 resolution ) 7 vga cable standard size 1.5 meter 8 hdmi cable 1.5 meter 9 speaker set ( 2 nos. ) with usb power, 1.2 watt, 3.5 mm input 10 mechanical keyboard ( tvs gold ) , 1. all pin ( 26 mm, nw 70 gram ) 2. binder clip : a. 19 mm b. 25 mm c. 32 mm d. 41 mm 3. gem clip / u pin ( plastic cover ) 4. poker ( wooden handle ) 5. poker ( iron base ) 6. transparent adhesive tape ( scotch / cello / wonder ) , 7. brown packing tape ( scotch / cello / wonder ) a. 1, 55 meter b. 2, 55 meter 8. both side tape ( scotch / cello / 3m ) a. 1 wide both side tape thick b. 1 wide both side tape thin 9. cleaner ( colin / cleen ) ( 500 ml ) 10. gum ( camlin / kores ) a. 700 ml b. 150 ml 11. glue stick 15 gm ( kores / scotch / fevi stick ) 12. large paper cutter ( natraj or equivalent brand ) 13. hb pencil ( camlin / natraj / faber castel ) 14. non dust eraser ( camlin / natraj / faber castel ) 15. sharpener ( camlin / natraj / faber castel ) 16. scale plastic ( 12 ) ( natraj / camlin ) 17. scale iron ( 12” ) ( ajanta / camlin / natraj ) 18. stamp pad 110mm x 70mm ( ashoka ) 19. punching machine ( kangaroo or equivalent brand ) a. 14 page punching capacity ( dp 480 ) b. 22 page punching capacity ( dp 680 ) c. 60 page punching capacity ( dp 800 ) d. 1 hole punching no. 10 20. stapler ( kangaroo / max ) a. staples use :no. 10, stapling capacity upto 15 pages, loading capacity:50 staples b. staples no. 24 / 6, 26 / 6, stapling capacity upto 30 pages, loading capacity:50 staples ( 24 / 6 ) , 100 staples ( 26 / 6 ) ( kangroo hp 45 equivalent ) c. staples no. 24 / 6, 26 / 6, stapling capacity upto 30 pages, loading capacity:50 staples ( 24 / 6 ) , 100 staples ( 26 / 6 ) ( kangroo hdz 45 equivalent ) 21. stapler pin ( kangaroo / max ) a. no. 10 1m ( 20x50=1000 staples ) b. no. 24 / 6 ( 20x50=1000 staples ) c. no. 26 / 6 ( 20x50=1000 staples ) 22. envelop ( cloth ) a4 size with min. 100 gsm paper 23. envelop ( cloth ) fs size with min. 100 gsm paper 24. cd / dvd permanent marker ( camlin / faber castel / luxor ) 25. paint marker ( golden color ) ( camlin / faber castel / luxor ) 26. white board marker ( camlin / luxor / faber castel / kores ) 27. correction fluid ( camlin / luxor / faber castel / kores / kangaro ) 28. peon book 100 sheets 29. slip pad 140mm x 225mm, 70 gsm inner paper with line, 1 mm card sheet on back, 30. spiral slip pad a. 140mm x 225mm, 70 gsm, multi color inner paper with line, card sheet on back and plastic cover 80 sheets ( 160 pages ) b. 140mm x 225mm, 70 gsm, inner paper with line, card sheet on back and front 80 sheets ( 160 pages ) 31. white board duster 32. white board duster ( magnate ) 33. a4 size photo paper 180 gsm ( 50 sheets per pkt ) ( desmat / novajet / epson / kodak ) 34. 75 gsm paper a4 size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 35. 75 gsm paper fs size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 36. 75 gsm a3 size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 37. 75 gsm green pie paper fs size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 38. address label ( for laser printer a 4 size ) 100 sheet in a packet ( desmat or equivalent ) a. 16 label per page b. 24 label per page 39. basta ( cloth ) size 90*90 40. file pad – weight 32 ons, size 10*15, 36 ( dori 4*27 flap ) 41. file cover ( 31 kg cpm board ) with printing of deptt name 42. file lace best quality ( 100 nos. of laces in one bunch ) 43. file tag best quality ( 50 nos. of laces in one bunch ) 44. transparent l shape folder ( plastic ) ( solo / trio ) 45. ring binder, 1, 2 d, pvc folder a4 size, holds upto 250 sheets ( solo / trio or equivalent ) 46. index file ( box file ) 47. pen a. reynolds 0.45 b. cello fine grip c. flair writo meter d. flair ball pen e. uniball eye fine f. parker roller pen ( beta premium i. parker vector standard j. uniball gel impact k. uniball eye broad 48. duster ( cloth ) 2ft x 2ft. 49. post it ( 3m ) a. size 3” x 3” 100 sheets, 50. cell ( duracell ) a. pencil cell ( aa ) b. pencil cell ( aaa ) 51. pvc cards packet of 50 pvc cards ( 30 mil ) 52. dustbin plastic min 12 litr. ( poly propylene plastic ) without cover 53. dustbin min. 12 litr ( poly propylene plastic ) with cover 54. dustbin 15 ltr ( poly propylene plastic ) with cover 55. water jug plastic ( 2 ltr. or more ) ( poly propylene plastic ) – ( cello / prestige / orient / milton or equivalent ) 56. extension board ( make: belkin ) a. 4 socket b. 6 socket c. 8 socket 57. scissors ( kangaro munix ) stainless steel, 185 mm ( munix sl 1173 ) 58. electric kettle ( prestige, borosil ) , 1.5 litre 59. tea flask tuff insulated jug 1 litres ( cello / milton ) 60. best quality white window envelop ( 50 piece ) 11 x 5 80 gsm 61. towel 100% cotton, 75 cm x 150 cm ( bombay dyeing ) 62. refillable self inking stamp seal two line 63. refillable self inking stamp seal three line 64. refillable self inking stamp seal four line 65. refillable self inking stamp seal five line 66. refillable self inking stamp seal big size ( more than 5 line ) , 1. 9 u rack with pdu & cooling fan 2. installation charges for 9 u rack 3. i / o port set ( network keystone jack, gang box, face plate ( dlink / digisol / dax / amp / molex ) 4. cat 6 network cable box 305 mtr. ( d link / digisol / dax / amp / molex ) 5. laying of cat 6 cable 6. isi mark pvc casing 1 inch 7. laying of pvc casing 8. 5 port switch 10 / 100 / 1000 mbps ( dlink / digisol / digilink ) 9. 8 port switch 10 / 100 / 1000 mbps ( dlink / digisol / digilink ) 10. rj 45 connector ( dlink / digisol / digilink / molex ) ....

Border Security Force - Rajasthan

33529584 bids are invited for electronic surveillance equipment project misc items: clip wire, ofc joint sleeve, cable fixing clips, pvc cable ties, mounts & fixing, support wire, conduit pipe, hdpe pipe, power cable 2.5mm, insulation, flexible pipe, mcb / eqpt assys. , ict charges: installation, testing & commissioning of ip cctv surveillance system& electric misc works at 8 patches of different distances& different places at indo pak border in punjab , ptz camera with min ir range 200 mtrs , bullet camera with min ir range of 50 mtrs , nvr with 16 port input channel with 8tb hdd , monitor 55 display , 24 core ofc ( frp armoured ) , l 2 switch, 4sfp, 08 copper port , l 2 switch, 08 port , liu 24 port , inverter 1 kva with battery 12 volt 150 ahc ( incl ups ) , fiber patch cord 3 mtrs , pig tail 2 mtrs , cat 6 cable , outdoor cabinet for switch , 24 u rack , electrical cable , otdr ( optical time domain reflectometer ) , fiber optic fusion splicer , fiber optic tool kit , outdoor cabinets for inverter , bamboo liu ( ofc splice closure ) , spike booster , camera shed , joysticks for ptz ( digital key board controller total quantity : 53680...

Indian Army - Rajasthan

33519412 bids are invited for ups 1 kva , usb keyboard and mouse , led monitor , desktop computer , leser jet printer , dot matrix printer , media converter unit , 8 port switch , utp cat 6 cable 305 mtr , bar code scanner , rj45 connector , crimping tool ,lan tester , antivirus 10 users , smps repair , mother boardrepair , printer repair leser jet printer , printer repair dotmatrix , repair of lan connector , repair of cd writer total quantity : 77...

Central Railway - Rajasthan

33488093 supply of ht hrc fuse link, single bolted type 32ht hrc fuse link, single bolted type 32,ht hrc fuse link, single bolted type 32 amps confirming to is 13703 of 1993 or latest, suitable to 15 kva transformer of lhb non ac coaches as per cooper bussmann cat no. 3.6wdohs 32, confirming to rdso spec. no. rdso/pe/spec/tl/0158 2010 (rev. 1) this material is to be procured from authorised dealers only or with tender specific authorisation from oem/authorised dealers....

Raj Comp - Rajasthan

33466304 request for proposal for hiring of services for operational activities at r cat, jaipur...

Department of Higher Education - Rajasthan

33459287 bids are invited for utp cat6 cable box 305 meter , l 2 gigabit switch with 2 sfp manageable 24 port poe , cat6 single face plate io with surface mount box , 12u wall mount rack with pdu and fan , cable manager cat 6 for network rack , cat 6 utp patch cord 1 meter , cat 6 utp patch cord 2 meter , 24 port patch panel cat 6 loaded with utp io , offline ups 1kva , cat 6 cable laying with conduit and required accessoriesincluding testing , labeling , io termination and fixing ,rack fixing, installations and dressing including fixinghardware , patch panel termination and activation withmounting hardware , switch installations with mountinghardware , ups installations , 3 years onsite comprehensivewarranty and support total quantity : 11495...

Indian Army - Rajasthan

33447435 bids are invited for ip camera 4 mp , nvr 16 ch with 4 tb hdd , led display 32 inch , poe switch , cat 6 cable 305 mtr , cashingand capping , installation total quantity : 773...

Govind Guru Tribal University - Rajasthan

33436635 repair, maintenance and supply of computer peripherals and hardware at govind guru tribal university, banswara repair, maintenance and supply of computer peripherals and hardware at govind guru tribal university, banswara , cd cd ( r ) sony, amkette, moser baer , cd ( rw ) sony, amkette, moser baer , dvd dvd ( r ) sony, amkette, moser baer, zoom , dvd ( rw ) sony, amkette, moser baer, zoom , pendrives pendrive 64 gb hp, kingston 3.0 , pendrive 32 gb sandisk 3.0 , pendrive 64 gb c type / otg sandisk 3.0 , motherboards motherboard i5 with processor 7, 8, 10 generation , motherboard i7 with processor 7, 8, 10 generation , cabinet with smps , cpu fan orginal 4 i5, i7 , cpu fan dualcore , lan card pci slot , smps , ram ram ddr2 2gb kingston / highness , ram ddr3 2gb kingston / highness , ram ddr3 4gb kingston / highness , ram ddr4 4gb kingston / highness , ram ddr4 8gb kingston / highness , internal hard disk internal hard disk 1tb seagate , internal hard disk 2tb seagate , portable usb hardisk external portable usb hardisk external 1 tb sandisk , portable usb hardisk external 2 tb sandisk , ssd data ssd data 256 gb kingston , ssd data 512 gb kingston , port switch 8 port switch ( 10 / 100 mpbs ) , 16 port switch ( 10 / 100 mpbs ) , cables power cable , vga cable , laptop power cable , printer usb cable , hdmi cable , anti virus single user , 3 user , 6 user , monitor 24 inch h.p. , monitor 24 inch dell , keyboard ( usb ) tvs , keyboard ( usb ) hp , keyboard ( usb ) dell , keyboard ( usb ) logitech , keyboard ( usb ) i ball , wireless keyboards tvs , wireless keyboards hp , wireless keyboards dell , wireless keyboards logitech , wireless keyboards i ball , mouse usb logitech / hp / dell , mouse wireless logitech / hp / dell , spike guard ( long cable 5mtr ) anchor, microtek / ( 6ports ) , computer formatting , network maintenance for net , lan cable per meter cat 6 , ups batter 750va 1 no luminous / microtek , ups batter 1000va 1 no luminous / microtek , computer site visit charges ( repair and maintenance ) , printer repair , new ups 100 va luminous / microtek , modem , usb hub iball , mouse pad , printer new toner cartridge banon 2900b lbp , epson l360 color printer , canon mf 244dw , canon lbp 6018 b , canon mf 3010 , canon image 2004n , sharp ar5620s , canon pixma ink efficient color printer g570 ( gy / m / c / bk / r / y ) , canon mf 4820d , hp printer hp laserjet pro p1606dn , hp printer hp laserjet m1005 aio , hp printer hp laserjet 1020 plus , epson color printer l380 , epson color printer l361 multifunction , epson color printer l6160 multifunction , cartridge refilling canon 2900b lbp , cartridge refilling epson 360 ( color printer ) , cartridge refilling canon mfdw , cartridge refilling canon 6018 b , cartridge refilling canon 3010 , cartridge refilling canon image 2004n , cartridge refilling sharp ar5620s , cartridge refilling efficient color printer g570 ( gy / m / c / bk / r / y ) , cartridge refilling canon mf 4820d , cartridge refilling hp laserjet pro p1606dn , cartridge refilling hp laserjet m1005 aio , cartridge refilling hp laserjet 1020 plus , cartridge refilling epson color l380 , cartridge refilling epson color l361 multifunction , cartridge refilling epson color l6160multifunction , photo copier machine konica minolta bz 306 ( b&w ) , photo copier machine konica minolta bz c227 color , photo copier machine konica minolta kmbizhub 215 mfp ( b&w...

Medical College - Rajasthan

33431889 supply of cardiothorasic implants ctvs vascular products 1 lohexol for vascular procedures 35o x so ml in plastic polypropylene bottle. 2 lohexol for vascular procedures 350 x 10o ml in plastic polypropylene bottle. 3 lohexol for vascular procedures 350 x 200 ml in plastic polypropylene bottle. 4 lohexol for vascular procedures 350 x 5oo ml in plastic polypropylene bottle. 5 lodixanol vascular procedure 320 x 1o0 ml in plastic polypropylene bottle. . syringe for pressure injector compatible with imaxon injector zy6322 .— syringe for pressure injector compatible with imaxon injector art 7o0 — v adoptor for pressure injector compatible with lmaxon injector 6 — 8 9 pnumbra catheter for thrombosuction compatible to pnumbra machine cat6 10 pnumbra catheter for thrombosuction clotting compatible to pnumbra machine cat8 seprator for thrombosuctiorn clottin8 compatible to cat 6 catheter and pnumbra machine 11 12 seprator for thrombosuction clotting compatible to cat 8 catheter and pnumbra machine 13 canister for thrombosuction coting exudate compatible to pnumbra machine 1000 ml 14 tubing for thrombosuction clotting compatible to pnumbra machine 15 pur catheter 166 leflgth 15 and 2o cm with guide wire 0.9x4oomm introducing needle drug delivery system 16 2.45% activated glutaraldehyde with a powder activator, 510k cleared and effective against human corona virus. it should be endorsed by minimum five mdms: karl storz, pentax, stryker, richard wolf, philips for their rigid & flexible telescopes, fiber optic cables, tee probes . should have disinfectant manufacturer compatible tray made of glass filled polypropylene which can be steam sterilized. should also have test strip which consists of sodium sulfite and dyes impregnated and dried on filter paper. pack size= 5 litre jar 17 solution containing benzotriazole, nh ( hydroxyethyl ) ethylenediaminetriacetic acid ( he dta ) , dipotassiu m hydrogen phosphate, potassium dihydrogen phosphate and 0.55% w / v opa.. 51ok cleared and effective against human 18 corona virus and cytomegalo virus. it should be endorned by minimun five mdm’s: karl storz, pentax. stryker. richard wolf, olympus for their rigid & flexible telescopes, fiber optic cables, . also should be endorsed by aer manufacturers.should also have test strip which consists of sodium sulfite and dyes impregnated and dried on filter paper. pack slze 5 litre 19 effervescent 50% troxlosene sodium tablet sg each tablet. pack size : 5o tab / bt. 20 trays trays made of glass filled polypropylene which can be steam stenlize and ce approved ror disinfection, 21 dacron grafty 6x12 22 dacron grafty 7x14 23 dacrongraftst 6x20 24 dacron graft st 6x40 25 dacron graftst 6x70 26 dacrongraftst 7x20 27 dacron graft st 7x4o : 28 dacron graft 5t 7x70 29 dacron graft st 8x40 _____________________..._____.____________ 30 ptfe graft 6x20 _._______. ____ __________________._____ 31 ptfe graft 6x6s ____ ______..__ 32 ptfe graft 6x75 ___ .______________ 33 ptfe graft 4x4o 34 ptfe graft 5x2o _______ .._____ 3s ptfe graft 7x4o _______.________ 36 ptfe graft 8x4o ______ _________________________________.___________ 37 1abp balloon compatible to maquet machhe. 38 cardiacstablizermlcs 39 platipus 40 picco carheter continlous cardiac output monuter catheter with injector housing 3 fr x 7 cm — 41 picco catheter continious cardiac output monfter catheter with injector housing 4 fr x 8 cm picco catheter contiriious cardiac output moniter catheter with injector housing 5 fr x 20 cm ____ embolactomy catheter 44 ptfe felt 45 femoral arterial canula 46 venous arterial canula 47 ptfe bifergated graft 48 lineaar cuttur stapler 6o mm. unlversal instrument 2 rows on both cut line side with b form staple technology linear cutter reload for medium tissue, no of staples 84, open staple height 3.8mm, formed closed stapple height 1.5mm blue, cut line 6cmhnm, staple line 63 mm , compatlbe with linear cutter reload for thick tissue, staples 84, open staple height 4.8mm, formed closed stapple height 2.0mm o green, cut line 60mm, staple line 63 mm, compatible with linear cutter 60mm universal instrument 2 rows on _____ both cut line side with b form staple technology 51 disposable curved cutter stapler , open leg length 40mm, formed closed staple height 2.0 mm blue or green 52 siagle use circular stapler outer dianeter 25mm. inner diameter 17mm. no of staptes 22 . open height 4.8mm. fomned height 2.0 mm single use circular stapler outer diameter 29mm, inner diameter 21mm, no or staples 26. open height 4.8 mm. formed height 2.0mm — single use circular stapler outer diameter 3 1mm, inner diameter 23mm, no of staples 28, open height 5.0 mm. ____ formed height 2.2 mm ____ single use circular stapler outer diameter 33mm, inner diameter 25mm, no of staples 32, open heipht 5.2 mni fonned height 2.2 mm . 56 transducer open surgery ( multi use without counter limiuation. ) 57 transducer thorncoscopie ( mumti use without counter limitution. ) — 1 probe 6mn hand activated cutting& coagulating shears with 36o degrees or shaft rotation, capable or sealing 58 blood vessels up to 5mm in diameter with 36 cm shaft length. compatible with existing rf generators .ultrasoni , generator and transducer ( muhi use without counter limiaation. ) or 1 probe 9 cm shaft, curved, tapered tip for precise dissection, seals 5 mm vessels, as well as lymphatic , 360 dcgree 59 shaft rouarion, triggers support multiple hand positions. compatible with ultrasonic generator and transducer for ( multi use without counter linitation. ) 94 bronceal stapler bovine pericardlal bioprosthesis for the aortlc position. fda and european ce. the leaflets ( made from a single strip of pericardlum ) are externally mounted over a titanium stent and this allows complete opening of the leaflets and aids in proper coaptation. pericardlal cover on the stemt helps in mi..gating the tissue abrasion with tissue to tissue contact. a proprety fixation procedure aids in proper leaflet shaping for proper leaflet coaptation. presence of linx anticalcificatlon treatment resists tissue calcification and degradation of the valve.lt is avallable in sizes 19mm, _____ 2lmm.23mm2smm, 27mm and 29mm. ___ .i tissue heart valve biological tissue heart valves for mitral and aorti heart position available in sizes 19 33mm design: triple composite porcune valves. valves have patented anti calcification treatment ( linx ac technology ) . i lowest profile 9mm ( lowest in the market ) . sewing ring is made of polyester with markers for helping in suturing. 96 suture friendly cuff minimizes suture drag & parachuting forces. fixation met1od: low pressure glutaridehyde fixation. fiexfit stent to reduce leaflet stress.the f ) exflt system reduces the rinse time to 2x10 seconds. mitral ratcheting system facilitates insertion into the mitral annulus and avoids suture looping. scalloped inflow surface optimizes valve seating. usfda approved. ( regent rlex cuff ) aortlc mechanical heart valve mechanical heart valve for aortic position. individually sterilized and ready for use in individual patients. expiration date: five years from the date of manufacturing. bi leaflet and rotatable. supra annular placement. low profile.maximum protrusion of leaflets from the housing is 3.4mm. minimizes need for root enlargement. up to 84% orifice to annulus ratio. single digit pressure gradients. opening angle of 85 degrees. significantly larger eoa’s than other mechanical heart valves. significant reduction in iv 97 mass.disc: pyrolytic carbon / graphite substrate. housing: pyrolytic carbon / titanlum with pyrolytic aarbon coating. • sewing ring: made from polyestpr with markers for helping in suturing. the flex cuff is flanged and more ploable than the standard cuff. patented butterfly upstream pivot design that lowers thrombogenicity, results in larger opening angles for improved laminar flow and a reduction in turbulence radio opaque for improved visualization during x ray and fluoroscopy. the valve is mri conditional. controlled torque rotation mechanism . available in sizes 117mm to 29mm. u.s fda approved and ce approved. ______ . bileaf? ett aortic with conduit double velour woven fabric offers excellent sea ing handling and healing bileaflet aortic with conduit double velour woven fabric offers excellent sealing handling and healing characteristics .collagen impregnation provides uniform tissue in growth and biocompatibiity. rotatable valve 9 attached .auiows for upstream placement of leaflets resulting in a wide openlng anwle enhanced cuff configuratcn offers excellent implantability , conforms to the annulus, designed to minimize potential for paravalvular leak low porosity graft eliminates the need for pre clotting and reduces surgical time.no pleats allows for easy positioni:ng and attachment of coronaries.availabie in sizes: 19mm to 33 mm .us. fda approved. rings rigid repair solutions available in rigid forms. the rigid ring is a fill 3d ring which creates natural saddle shápe.the ring has a complete titanium alloy core.mimics healthy mitral anatomy and provides full remodeling which reduces stress. the ring helps in redistributing leaflet stress and chordal tension and increases repair durability. encourages tissue in growth through use of double velour polyester cuff. racilitates in suturing with the ez suture cuff supported by a unique trangular core. available in sizes 22mm to 34mm. usfda pericardial patch: indicated for cardiac and great vessel reconstruction and repair and pericardial closure. 2. designed should be for ease of use, soft, pliable tissue conforms to uneven surfaces and minimizes suture hole icals for more reliable repairs. 3. should have encapth technology, reduces adhesions enabling easier re access and structure idamtif.cation. 4. should have encap anti calcification teciuiology to minimize calcification and pronion. host endothelializatiorn resulting in a more biocompetibie material. 5. should be glutaraldehyde and encaptm technology tmeated. bovine pericardium resists shrinkage and aneurysm formntion—potentialiy reduciag the chance ol’ re operation.6. should be rinse less preparation, ready to use. nhinner patch to accommodnie pediatric appiica1ion’. 8. available sizes should be: 2x5, 5x10, 9x14, 4x5 ...._ ____ contigra vascular mimetic implant’ for distal sfa, popliteal & aeross jomnts’ o18 nitinol interwoven design 4 lmnn diameter various lengthsupto 200mm renal balloon expandable stent rx .o!4 compatible cobalt chromium 3 3 multi iink design ‘5 f compatibie acm. all sizes 5, 5.5, 6.6.5 & 7 in length 12. 15 & 18mm usfda probe 17cm shaft, curved, tapered tip for precise dissection, seals 5 mm vessels, as well as lymphatic. 360 degree ol’ 6o shant rotation, triggers support multiple hand positions. compatible with ultrasonic generator and transducer ( multi_ ____? use without counter limitation. ) — probe with bipolar 6mm hand activated curved cutting &coagulating shears with 360 degrees of shaft rotation. 61 capable of sealing blood vessels up to 5mm in dianeter with 23 cm shaft length . compatible with exiating rf generators & ultrasonic generator and transducer ( multi use without counter limitation. ) which can be used as .___ both ultrasonic & bipolar laparoscopic shears. ........ 62 virofil smoke, plume and pathogen filter with universal luer lock +3 luer caps s3 nowa 5 mm, 5 lomm, 5 12 mm, bladeless trocar w / viewfinder 100mm with virofii. patbogen filter ...t 64 cartidge small titanium red trans verac grooves heart shape wire usfda cartdige of 6 clip 6s cartidge small titanium trans verac grooves heart shape wire usfda cartdige of 6 clip . 66 cartidge medium titanium trans verac grooves heart shape wire usfda cartdige or 6 clip 67 cartidge medium large titanium trans verac grooves heart shape wire usfda cartdige or 6 clip s8 catdge large titaniun trans verac grooves heart shape wire usfda cartdige or 6 clip —.— 69 polymer ligation clip with locking machanism. cover 3mm to 16mm vessels. medium large class 3 for ce 70 polymer ligation clip with locking machanism. cover 3mm to 16mm vessels. large class 3 for ce 71 polymer ligation clip with locking machanism. cover 3mm to 16mm vessels. extra large class 3 for ce 72 poliwlecaprone 25 ) usp size 3 0 , suture lenght 70cm needle length 2s mm , 3 / 8 circle reverse cutting monofilament poly ( p dioxanone ) uni directional with end loop barbed suture, violet 1 / 2 circle taper point. usf size 2 0 , suture length 30cm, needle length 37 mm undyed, braided coated short term poly ( glycolide co l lactide ) ( polyglactin 910 ) 1 / 2 circle taper cut, usp size 2 0 , suture length 90cm , needle length 36 mm undyed, braided coated short term poly ( glycolide co l lactide ) ( polyglactin 910 ) 1 / 2 circle round bodied, 1 / 2 circle reverse cutting double armed , usp size 2 0 , suture length 140cm , needle length 40 mm 76 polyester 1 77 polyester 2 5 talc powder for pleurodesiss 91 multi hole multipurpouse catheter fo thrombolysis 92 skin stapler __ 79 endoscopic linear cutter stapler 60 mm short shaft ( open+thoracic ) 80 endoscopic linear cutter stapler 160mm standard shaft ( regular laparoscopy ) 81 endoscopic linear cutter stapler 260mm extra long shaft 82 reload 45 mm white & blue endoscopic linear cutter articulating reload for vascular tissue, staple height 2.5mm, 3.5 mm reload 60 mm white & blue endoscopic linear cutter articularing for vascular tissue, staple height 2.5mm. 3.5 mm — reload 60mm gold endoscopic linear cutter articulating for medium thick tissue, staple height 4.1mm . 8 reload 60 mm green endoscopic linear cutter articulating for thick tissue, staple height 4.8mm reload 60 mm green endoscopic linear cutter articulating ror extra thick tissue. staple height 5.0mm 86 87 pre fitted with polyester sutures : visual mark printed on polyester for easy mesh centring. 3d honeycomb knitted structure for superior tissue integration and patient comfort. dual side mesh with composition of polyester with polyurethane. mesh came with circular sizes also 12cm and 15cm circular. sizes:69 icm, 7.6o15cm.10’l5cm, 1s 15cm, 15 20cm? central 4 lumen catheter .—h 88 89 transperent dressings iegaderm 1 90 93 vascular stapler peripheral balloon expandable stem systen .otw:o35 gniewire compatible. 6f sheath compatible across all sizes 1o4 ( 7mm to 10 mm dia ) . l r05 cobalt chromium multi link nt design. thin stmuts lowest crimped profile. dual _____ lnyer._five fold_hnlloon._usfdx _____ ________.. self expanding nitinol stent for carotid anwioplasty assorted sizes rx tapered closed cell design with flured ends. 6f sheath compatible across all sizes. freestyle technology. usfda 106 self expanding nitinol stem for peripheral angioplasry assorted siaes. . 035 oiw 6f sheath compatible aeross all sizes. 135mm usable carheter length for all sizes. triaxial delivery system with i beam technology to ensure accunate stent placement. usfda vascular closure device. 5 22f potypropylene monofilament suture mediated vessel closure. with no re access restriction. immediate re access advantage. flexibility to pre close and close over the wire. for small hole and large hole closure both. usfda 107 108 — o35 peripheral angioplasty balloon. crossflex dual layer balloon technology. otw .035 guide wire compatible s 7f sheath compatible to 12mm l4mm diameter faster deflation. usable catheter lengrh 135cm for all sizesdia 4mm to 14mm up to 2s0mm length. usfda 109 o14 peripheral angioplasty balloon crossflex dual layer balloon technology. otw o14 guide wire compatible. 4f sheath compatible for din i.5 to 5 mn length upto 200mm. usable catbeter length 150cm for all sizes.. ijsd_. 11o .018 peripheral angioplasty balloon. crossflex dual layer balloon technology. orw 018 guide wire compatible. sf _____ sbeath compatible to dianeters fron 2mn to s.5 mn. usable catheter length 135cn for all siaes .usfda ___ carotid angioplasty balloon . ix 0l4 carotid balloon. 0i4 gumde wire compatible. sf sheath compatible to 4 to 7 1 mm diameter with 20mm length available in halr sizes of dianeter 4.5 & 5.5. usable catheter length 135cm for all 9izes .usfda 112 105 l ) isial embolk protection device. one size for all carotids. filter should be indepenthnt cfvine . rx .014 61: slw.atl, mpa ( ihle. 190cm bare wire workhorse wire preloaded delivery catheter.tiniform micro pore siteor 121 ) nuvrnn pore size with i inni pore free zone. non thrombogenic nylon membrane with hydrophilic coating. usfda clip based closure device . 5 8 f nitinol clip based vessel closure device. with no re . access restriction. usfda 114 o35 extra support type guidewire. supportive .035 wire with soft atraumatic tip. 1:1 torque response provides exceptional steering. hydrophobic coating to reduce friction. wire lengths of 190 cm, and 300 cm 115 peripheral cto guide wire. . 014 with various tip load stiffness from 4.8 13.0 mg.. durasteel core material. ! transitionless core taper. exposed shap.bk tip coils. wire lengths of i90cm and 300 cn. — 116 018 stainless support guide wires. various tip length 3cn / 5cn with shapeable straight &j tip.supportive stainless steel shaft for excellent tactile feedback. 1:1 torque for navigation amound vessel bends. 117 1 119 o14 hybrid peripheral guide wire. distal nitinol tip and proximal stainless steel. tip load 2.8 & 3.5g.ohydrophilic coating and radiopaque polymer cover. 1:1 torque for navigation around vessel bends. wire lengths of 190 cm arid 300cm. 018 hybrid peripheral guide wire. distal nitmol tip and proximal stainless steel. tip load 4g. hydrophilic coating and radiopaque polymer cover. available in short taper and long taper both types of tips. transitiónless weld betlen nitinol and steel part. 1:1 torque for navigation around vessel bends. wire lengths or 190cm and 300cm peripheral vascular plug multi lnyered, multiple lobed nitinol mesh design for rapid embolization within the vessel4. to embolize medium and high flow vessels. guide catheter or sheath deliverable: compatible with 4 7 f sheaths. or 5 9 f guide catheters depending on device size — bioprosthetic heart valve. triple composite bovine pericardium with e lgiloy / alloy frame stent. should have polymer support ring inside the polyester knit fabric for stent posts covering. should have anti calcification treatment done, should have tenting system for avoiding suture looping in mitral position. only latest version is acceptable. should have sizes for aortic position from 19 to 25mm and for mitral position from 25 to 31mm.dgci / ce approved 120 121 disposable bladeless trocar with bird wing tip design, 5mm in diameter, 95mm standard sleeve length, self . adjusting & detachable secondary seal which can accommodate instruments diameter upto 5mm 122 disposable bladeless trocar with bird wing tip design, 1omm in diameter, 95mm standard sleeve length, self . _____._ adjusting & detachable secondary seal which can ac nodate instruments diameter ranging from 5mm to 1omm disposable bladeless trocar with bird wing tip deijj1qiiral enty featrre, 12mm in diameter, 95mm standard 123 sleeve length, self adjusting & detachable secondiitsjvhich can accomnodate instruments diameter rangine from smmto 12mm 124 disposable bladeless trocar with bird wing tip design, 15mm in diameter, 110mm standard sleeve length, self. adjusting & detachable secondary seal which can accommodate instruments diameter ranging from 5mm to 15mm 125 ultrasonic scalpel for cutting and coagulating, 36 cm shaft length, 5 mm diameter double layer non stick ( teflon ) coatlng pad on jaw. 14cm / 23cm / 36cm / 45cm 126 radial arterial cannula with built in sliding lock system sizes 20 7 retrograde cannula catheter self inflating smooth ballon with pre shaped stylet and handle 14fr. overall length should approx 27cm & should have 18 2mm sized smooth balloon. should be fda approved aortic perfusion cannulae: wire reinforced dispersion tip sizes: 2lfr and 24fr overall length approx. 35cm and vent should be us fda approved 128 129 p.a. catheter with 3, lumens & color coding for each lumen. should be able to means p.a. pressure flow directed insertion & should be supplied with all accessorises. like guld wire op sheath etc. bulb near end hole. should be us fda approved flo trac sensor to measure contlonuous cardiac output monitoring ( to be compatible with vigileo / ev 100o cardiac output monitoring machine ) should be us fda approved 1 arterial transducer for measuring invaslve blood pressure and cvp. should be us fda approved 132 disposable yellow bulldog clamp small size of 1 2 cm with metallic spring good occluding capacity. should be us fda approved proximal aortic anastomosis device it should provide the surgeon with a stable, blood field. it allows for up to three anastormosis form one insertion site. it eliminates the need for partial occlusion clamping during coronary artery bypass grafting. size 3.smm / 4.omm / 4.5mm stemnum and ribs lock plate should be available in different sizes and shapes to be supplied with applier ( gun ) sample based selection. should be us fda apprwved 135 stemnum and ribs lock plate 2.4mm and 2.7mm dimaeter cancellous self drilling locking with applier. should be available in different sizes sample based selection. should be us fda approved 136 ultra high pressure non compllant pta dilation balloon catheter high performance balloon, nonc oomplanntmutiiaayer balloon with coaxial shaft and working pressure range of upto 12atm, highest rated burst pressure of 18 atm sizes: diameter ( 12mm to 26 mm ) & lengths ( 2cm & 4cm ) with shaft lengths of 75and l2ocms. 1 netrieval pvc filter ( window period 3 day ) clinically tested in largest longest ide filter demonstrated safely implanted to provide immediate protection againts peoptional ivc filter, two levels of filtration with the legs aproviding the lower level of filtration and the arms providing and the arms providing the upper level of filtration, highly visible snare tip seamlessly welded to the body for easy filter retrieval even after long in dwell time. the upper level of filtration 138 i self expandable ( eiectro pollshed ) with radlopk markers the stent ( implant ) should equipped with four highly visible radiopaque puzzle tantalum markers on both the proximal and distal end for accurate. it should a self expanding flexible nitinol ( nickel titanium alloy ) stent that expands to its preset diameter upon exposure to body temperature. the stent has a segmental repeating pattern and an open cell geometry with flared ends to help prevent dislocation or migration partial cuts around the circumference or the stent cylinder provide enhanced flexibility and allow segment by segment expansion it should indicated for the treatment of illiac occlusive disease in patients with symptomatic vascular diseaseof the common and / or externalillac arteries up to 126 mm in length with a reference vessel diameter of s to 9mm perfect metalic length delivery thumb delibery 60 1204 deployment for physicians convenience in deploying stent trigger, slide, combination and conventional. 133 self espending and popliteal nitlnol stent with unjque trije helix design structure self expending usfda approved for sfa and popliteal stent with uniqpdçple l$sdesign stnucture for multi dimensional fiexibilty with 139 unique delihery system having both thunb wheel ñd pir fluul mechanism it should sf vascular stent system and intended to improve umn inal diameter in the treatment or symptomatic de novo or restenostk lesions up to 240 mm in length in the native superficial femoreal arterty ( sfa ) and popliteal artery with reference vessel diameters ______ ranging from 5.0 7.0 mm usfda approved ultra high pressure non complaint balloon it should for use in percutaneous transluminal angioplasty of the femoral, iliac and renal arteries and for the treatment of obstructive lesions of native or synthetic arteriovenous diatysis flstulae. high performence balloon catheter consisting of an overthe wire catheter with a balloon fixed at 140 the distal tip.the proprietary ultr non compliant low profile balloon is designed to provide consistent balloon diameters and lengths even at high pressures.tow radiopaque markers delineate the working length of the balloon and aid in balloon placement.the coaxial catheter includes a tapered atraumatic tip to facilitate advancement of the _____ catheter to and through the stenosis balloon expandable vascular covered stent it should for treatment of atherosclerotic lesious in common and external iliac arterise with reference vessel diameters between 4.5 mm, and 12.0mm and lengths up to 100mm 141 balloon expandable vascular covered stent should comprised of an electropolished balloon expandable stent made from 316l stainless steel, encapsulated between two layers of eptfe. the covered stent should supplied prem mounted on an over the wire deliveny system with a non compliant balloon drug coated balioon drug coated balioon with 2ug mm 2 dose paditaxble with polysorbate & sorbitol as carrier — which will deliver an optimal, therapeutic drug dose to the target vessel wall after a minimum 30 second inflation 1 time available in size o35guidewire compatible 120 cm shaft 4mm 6mm dia, lenght upto 150mm, 035 guidewire compatible 75cm shaft 5mm 12mm dialength 60mm 014 guidewlre compatible 150cm shaft 2mm to 3.5mm dia length 120mm pta dilatatlon catheter semi compliant conslstlng of an over the wire ( otw ) lt should semi compliant balloon catheter consisting of an over the wire ( otw ) catheter with an arngioplasty balloon fixed at the distal tip. two radiopaque markers delineate the working the length of the balloon and aid in balloon placement inteded to dilate j 143 drug coated balloon drug coated alloon with 2ug mm 2 dose paclitaxble with polysorbate & sorbitol as carrier which will deliver an optimal, therapeutic drug dose to the target vessel wall after a minimum 30 second inflation time available in size 035guidewire compatible 120 cm shaft 4mm 6mm dia, ienght upto 150mm, 035 guidewire compatible 75cm shaft 5mm 12mm dia, length 6omm 014 guidewire compatible 1s0cm shaft 2mm to 3.5mm dia length 120mm .. . pta dilatation catheter semi compliant consistlng of an over the wire ( otw ) lt should semi compliant balloon catheter consisting of an over the wire ( otw ) catheter with an angioplasty balloon fixed at the distal tip. two radiopaque markers delineate the working the length of the balloon and aid in balloon placement inteded to dilate stenoses in the peripheral arteries to treat obstructive lesions of native or synthetic av fistulae and / or re expand endolumlnal stent graft elements in the iliac arteries. 3 12 diameter range and 20 300 balloon length. 144 pta oilatation catheter semi compliant hydrophydic balloon cathater consisting of an our the wire ( o1w ) it — should for use in percutaneous transluminal angiopiasty ( pta ) of the renal, popliteal, tibial femoral and peronmeal arteries. to facilitate catheter advancement througs the vasculature and the viessal stenosis, dual layer hydrophlic coating should present on the distal segment of the shaft and the balloon. 145 • — — 146 dual sheath 9fr and, ideal for nc filter reetrieval dual sheath 9fr and i1ir ideal for denal retreval xink resistant nitinol construction with radlopaque loop for enhanced visibility 9o loop snare for proper placement with precise 1:ltoeque facilitates filter easy hook capture marker bands for accurate positioning convenient all in kit includes new coaxial sheaths and hemostaic valve percutaneous transluminal valvuloplasty of the pulmonary valve it should for percutaneous translumin valvuloplasty of the pulmonary valve in the following patient with isolated pulmonary valve stenosis a patient with valvular pulmonary stenosis with other minor congenital heart disease that dose not require surgical intervention the proprietay non compliant low profile balloon is designed to provide consistent balloon diameters and length ecen at high pressure. ulta high pressure non complalnt balloon it should for use in precutaneous transluminal angioplasty or the peripheral vasculature induding the ilac arteries and ilac femoral veins and for the treatment of obstructive lesions or synthetic arteriovenous dialysis fistulae a high performance balloon aatheter consisting od an over thewire with a balloon fixed at the distal tip the proprietary non compliant low profile balloon is designed to provide consistent balloon diameters and lengths even at high pressure 1• 143 147 —j ultra high pressure large volume inflation deuie ( aoml ) aijuitra high pressure, larhge volume inflarion device used to inflate monitor pressure and deflate angibblasty bauoon dilatation catheters.lt should a onepiece, 30m1 disposable inflation device rated for 40 atm with a leverlock design that controls the piston a manometer and a 148 high pressure conncting tube with a male luer rotating adapter. also enclosed is a high pressure 3 way stopcock to aid in preparation and use of the devlceme manometer measures pressures ranging from 0 atm up to 40 atm in 1 atm increments. the accuracy of the manometer has been determined to be within +1.6 atm. these products are _ not made with natural nubber latex flexible self expanding prosthesis comprislng of dual layer eptef encapsulation with carbon impregnation flexible self expanding prosthesis comprising of dual layer eptef encapsulation with carbon impregnation on luminal surfaw to reduce intimal hyperplasla. the inner lumen of covered stent ( blood contacting surface ) is carbon impregnated. 149 the highly and fracture rasistant base stent architecture for tortous vessel like cephalic arch and sfa. the stent is availble in straight and flared configurations avilable from variety sizes for avf and iliac / sfa indication diameter ( 6 10mm ) . safety lock system on delivery system prevents premature release and two wheel deployment to ensure ______ accurate placement of stent at the lesion site. no stent migration high performance rossing catheter high performance catheter in 014w , 018n, 03sm platfrom desigend to be first 150 line aid to cross stenotic lesions and chronic occlusions when standard wires fall.radiopaque marking system, _...._ lcmradiopaque markers positioned 1 an apartwityh doble markers dilenate 1ocn and 20 cm self expanding nltlnol stent it should self expanding nitional stent is fda approved for treament of iliac occlusive disease in patients with symptomatic vascular disease of mommon or exteenal iliac arteerise residual stenoses witn 1 impaired perfusion followong balloon dilatation it should has optimized pin and pull delivery system for precise placement .high visibility for stent deployment and relocation under fnuroscopy 0.03s guidewire compatible, — diameter sizing of stent to target lesion reouces stent migration self expandable cover stem graft, dual layer eptfe it should vascular stent graft is used in resldual stenosis with impalred perfusion following balloon dilation especially in stages ill & iv according to rontaine dissection; detached arteriosclerotic olaaue material luminal obstruction foliowinu balloon dilatation occlusion after thrombolvsis or self expandable cover stent graft, dual layer eptfe it should vascular stent graft s used in residual stenosis with impaired perfusion following balloon dilation especially in stages ill & iv according to fontaine dissection, detached arteriosclerotic plaque material luminal obstruction following balloon dilatation oxclusion after thrombolysis or 152 after aspiration or diatation restenosis or re occlusion proven dual layer eptfr encapsulation demonstrated a significant reduction at 90 day in the incidence of in stent restenosis compared to pta proprietary bioactive carbon impregnation designed to reduce early stage platelet adhesion rlexible implant that demonstrated kink resistance placement in tortuos lesions presenting with in stent restenosis or non stented in patients mufticonnecting tube with 150 cm tube for connecting to the patient end. 2 nos 100cm connecting tube with drip 1s3 chamber to connect to the contrast and saline bottles / pack and 2 cormnectors for connecting the 2 syringes in the ____ dual head injector system. 154 custom made pressure garment below knee stockings palr. . 155 custom made pressure garment full knee stockings pair. ._.___g 1s6 custom made pressure garment fore arm custom made pressure garment full arm 158 custom made pressure garment fore arm with guantlet 1s9 custom made pressure garment full arm with guantlet 16o tegaderm chg clorhexedine gluconate iv securement oressing 1657r 161 tegaderm cig clorhexedine gluconate iv securement dressing 166cr sterile collagen sheets in wet & meshed form. pure type 1&3 triple helical membrane bovine origin preserved in 162 a mixture of iso propyl alcohol and water gamma sterilized and supp.ed in double sterile pouches. biocompatible sterile collagen sheets in wet & meshed form. pure type 1&3 triple helical membrane bovine origin preserved 163 in a mixture of iso propyl alcohol and water gamma sterilized and supplied in double sterile pouches. biocompatible as per iso 9o01 / ls01348snn loxlo 4 .c sterile collagen sheets in dry form. pure type 1&3 triple helical membrane bovine origin gamma sterilized and ________... supplied in double sterile pouches. biocompatible as per rso9oo1 / 1s01348s n 10*1o 165 sterile collagen sheets in dry form. pure type 1nelical membrane bovine origin gamma sterilized and ____ _______ supplied in double sterile pouches. biocompatible as per iso 90o1 / 15013485 n 10*20 __... sterile peru s collagen sheet in dry form ( fish origin ) 10*10 cm 167 sterile porus collagen sheet in dry form ( fish origin ) 8 x 12 168 silicone sheet pure poly siloxane based silicone scar management product in sheet form. 1oxlo 16e biofil ab sterils medicated collegan partiules s ml 170 biofil ab sterlls medicated collegan particles 1o ml lipido colloid contact layer impregnated with silver salts urgotul ag silver sterile non occulusive wound contact layer 171 consists of silver healing matrix made of polyester mesh impregnated with hydrocollold particles ( cmc ) , petroleum jelly polymers and silver sahts with demonstrated in vitro antibacterial activity upto 7 days, using patented lipido colloid technology 10x12 lipido collold contact layer impregnated with silver salts urgotul ag silver sterile non occulusive wound contact layer 172 consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid partlcles| cmc ) , petroleum jelly, polymers and silver salts with dernonstrated in vitro antibacterial activity upto 7 days, using patented .. uipido colloid technology 15x20 lipido colloid foam dressing with adhesive border urgotul sterile self adherent patented ftc matrix ( lipido colloid 173 technology ) wound contact layer combined with absorbent polyurethane foam pad, a superabsorbent layer , a vapour pemmeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. 13*13 lipido colloid foam dressing with adhesive border urgotul sterile self adherent patented ntc matrix ( lipido colloid 174 technology ) wound contact layer combined with absorbent polyurethane foam pad . superabsorbent layer .a vapour permeable waterproof outer film with soft sillcone adhesive border on the edges for atraumatic removal and _. repositioninr of dressing. 15*20 . 175 lipido collold foam dressing with adhesive border urgotul sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and 176 cabg kit off pump ( annexure 1 ) 177 single valve surgery kit ( annexure 2 ) 178 asdivsd kit ( annexure3 ) dry suction wet seal with air flow capacity of i6lpm. should maintain suction level of ( 4o ) ( 43 ) c.m.should have single chamber with capacity of 25oml 179 180 dacron graft 6x20 / 30 dacron graft 6x40 dacron graft 6x40 / 60 dacron graft 6x60 181 — 182 83 dacron graft 7x20 / 30 oacron graft 7x40 dacron graft 7x40 / 60 dacron graft 7x60 84 dacron graft 8w40 / 60 dacron graft 8x40 184 prfe graft 4x40 ptfe graft 4x1o . ptfe graft 5x20 ptfe graft sx1o ptfe graft 8x40 / 50 ptfe graft 8x4.0 embolactomy aatheter 185 186 187 188 189 cartidge snall titanium red trans verae grooves heart shape wire usfda cartdige or 6 / 9clip ._ cartidge small titanium trans verac grooves heart shape wire usfda cartdige of 6 / 9clip 190 — cartidge medium titaniun trans verac grooves heart shape wire usfda cartdige of 6 / qclip 191 cartidge medium large titanium trans verac grooves heart shape wire usfda cartdige of 6 / 9clip 192 cartidge large titanium trans verac grooves heart shape wire usfda caitdige of 6f9clip ptfe graft 1ox9ocm dacron graft 8x80 / 70 ptfe patches lox9omm, 0.4mm thickness . 193 194 195 cabg osf pump 1 chest tube 2 acttube 3 cd bottle 4 cautry pencil 5 cautry plate 6 urometer 7 loban 8 respirometer 9 bureta set 10 veinonlinee — 11 coronary shunt 12 v conector 13 avtubing 14 suction line — i pledget foil 16 vessel can ula 17 cardiac sump 18 powder free g’oves 19 nspouch 20 — papavarin 21 phempress . mister blower 22 23 buldog clamp 24 yellow buldog 25 cardlotomy resorvior 26 chest binder 27 cardiotomy resorvior circuit 28 hemostat 9a ortic? punch 0 scratch pad 25x25 31 protamin 32 lap pad 7x7 33 crusent knife 34 multiple y adoptor 35 balance salt solution (soorni) 36 pledget foil 37 lap pad 7x7cm 38 3 wav adapter s.no sinne valve surgery kit qty. 1 oxyienator heprn coated 1 2 custom tublr pack 1 3 cardioplegia dellvery system 1 4 arterial filter 1 5 chesttube 2 6 7 cdbottle 1 act tube 6 8 cautry pencil 1 9 10 11 12 cautry plate______________ 1 unometer loban steridrape 1 1 1 13 • 15 buretta 1 bulb syrirwe 1 vein o line yconector 2 3 16 17 av tubing 2 18 arch canula 1 2 19 venous canula 20 chest binder 1 21 22 sump 1 powder free gloves 5 23 p45pouch 2 24 pleglogard m 3 25 phempress 2 26 high pressure line 200 cm 3 27 purge line 1 28 multipte y adoptor 1 scrasatch pad 25x2s 1 30 protamin 5 31 balance salt solution 3 32 pledget foil 1 33 level sensor 1 34 lappad7x7 — 25 35 root canula 1 s.no. asd/vsd kit qty. 1 oxygenator heprin coated — 1 2 custom tubing pack 1 — 3 cardiople8ia delivery system 1 4 arterial.filter 5 chest tube 3 6 cdbottle 1 7 8 acttube 6 m t 1 cautrypencil 1 9 cautryplate unometer 1 1 — l 1o 11 loban 1 12 steridrape 1 13 buretta 1 14 1b vein o line yconector 2 3 avtubinj 2 17 arch canula i 18 venous canula 2 19 chest binder 1 20 vent canula 1 h — 21 powder free glove. 5 22 .. nspouch 2 23 plegiogard 3 24 phempress 2 25 protamin 3 — 26 purge line 1 e. ae i —.—? 27 scratch pad 28 hemostat 29 plleclget foil balance salt solution 31 root canula 1 1 1 3 1, 32 33 hifg pressure line 200 cm — 3 level sensor 1 34 35 aukiine activator — lappad7x7 — 1 25 — 36 under water seal drain 1 etc ...