Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Rajasthan University Of Health Science - Rajasthan

33465082 regents and consumables items for microbiology lab regents and consumables items for department microbiology lab , electrical items : , alberts stain , alkaline peptone water , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbeab elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , antiinuelear antibody ( ani ) elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , corn meal agar , cover slips 22 x 22 mm , crp test kit , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable polythene gloves , dubos medium , ecoshield , edta powder , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , mr vp medium ( glucose phosphate broth ) , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , sabraud’s dextrose agar , selenite f broth bacteriological , sim agar , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile transport medium ( stuart medium ) with test tube and swab individually packed , sulphanilamide , tcbs , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , hcv igmrapid card , occult blood stool , rpr test kit...

Medical And Health Services - Rajasthan

33453755 supply of reagents and consumables items for department of microbiology anti hbe ab t ljsa ( esi kiti . hbea elisa kit 8 anti hbs antibodyf:iujsakit? 9 aniiinuedear ant iboth ( ani ) elisa kii 10 cytomegalovirns ( cmv ) lgg elisa kit 11 cylomegalovirus ( cmv ) 1gm eiisa kit alberts stain alkaline peptone water, 12 jhav 1gm el.isa ku 13j hcvjpi elisa kit 14 hev 1gm elisa kit 15 herpes simplex virus ( hsv i & 2 ) igg eluisa kiii 16 herpes simplex virus ( hsv i & 2 ) elisa kit, 19 toxoplasma lgg lbijsa kit 20 scrb typhus 1gm ag elisa xit 21 toxoplasna lgm elisa kit 22 biodegradable plasic bags ( yellow. red, blue, black ) 23 blood agar base blood culture bottle ( aduh ) glass 24 bottle of 10w ml capacity with lid of aluminum with rubber cork in k. 25 corn meal agar 26 cover slips 22 x 22 mm 27 crptes 281 deoxycholate citrate agar 29 di sodium hydbogen phosphate, 30 discarding plastic buckets ( yelkw4. red. blue. black ) 20 litre 31 disposable polythene gloves 32 dubos medium 33 ecosh leld edta powder filter paper sheet whariman no. i 36 fluid thioglycollate broth ( anaerobic ) with indicator formalin pellets 38 h2o2 ( 30° / o ) 39 koh pellets 40 kovcks indole reagents, 42 l lysine mono dihydroehioride i ] loeffler serum medium base bovine j.rum jensen med iun macconke broth 46 multose, 47 mannitol 48 mannitol salt agar mccartney bottle 50 methyl red powder 51 52 mr vp medium ( glucose phosphate broth ) n acetyl l cysteine n naphthyl ethylene diamine dihydrochloride n.n.nhn tetra methyl p. pheny lened iam inc dihy drochioride 55 nigrosin 10%o 56 nutrient agar fr— 57 oxidase disc, perforated bucket ( red. blue ) is litre double bin . petridish ( ilass 90 mm 60 61 . petridish glass 75 mm 62 . ph lndicator strips 6.5 to 9 ph measurement 63 i phenol 64 . pottasium dihydrogen phosphate 65 pregnaney test cand readymade blood culture bottle 66 witb sterile brain heart infnsipn medium, size 5 ml ready made blood culture bottle 67 with sterile brain heart infnsion medium. size o ml 68 robertson cooked meat medium readymade, 73 sodium chloride 74 sodium hydroxide pellets sodium hypochlorite solution 76 sterile autoxlavable skirted plate 96 wells x 0.3 ml sterile ready made plates or blood agar ( 90 mm size ) 78 sterile ready made plates of macconkey agar ( 90 mm size ) sterile readymade plates of nutrient agar ( 90 mm size ) sterile transport medium ( stuart 80 medium ) with test tube and swab individually packed 81 sulphanilamide 82tcbs, etc....

Indian Army - Rajasthan

33126371 annual price agreement of 187 mh fy 2022 23 annual price agreement for procurement of medicines for 187 mh fy 2022 23 , list iii lab reagents and chemical , pencil, marking glass. , acetic acidglacial ( analar ) , alcohol dehydrated , anti nuclear antibody elisa detection kit with 96 wells. , benedict solution, qualitative. , blood agar base, pack of 0.5kg , chloroform ar ( analytical grade ) , drabkins solution ( diluting solution for haemoglobin estimation by cyanmet haemoglobin method ) , fructose , glycerine ar ( glycerol ) , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , hiv antibody 1 & 2 detection elisa kit for 96 tests. , stain leishmans powder. , stain methylene blue , stain neutral red , sudan iii , xylene ( xylol pure ) , rapid card screening for hbv , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , serum, agglutinating, bact abortus monospecific , salmonella typhi o , salmonella typhi v , salmonella typhi h , salmonella paratyphi a.h , serum anti d for saline tube test , lieshmen stain ( ready to use ) , gram stain ( ready to use ) ( hi media ) , zn stain ( ready to use ) ( hi media ) , urine strip, bott of 100 strip 2sg ( siemens ) , multistrip 10sg , bott of 100 strips ( siemens ) , kit widal, 4 x 5 ml ( tulip ) , typhoid igm / igg, pkt of 100 ( j mitra ) , malaria ag ( j mitra ) , pkt of 50 , hcv tridot , pkt of 100 ( j mitra ) , vdrl ( kit of 30 ) ( ctk ) , ra factor ( tuylip / coral ) , esr tube ( ready to use ) , swab stick ( hi media ) , sterile urine container , kit micro protein ( 1x50 ) ( erba ) , petri dish ( disposable ) ( hi media ) , blood culture bottle aerobic ( ready to use ) , ( bactech ) , ph strip , biored level 1 , biored level 2 , hiv 1&2 ( rapid tridot ) 1x100 test ( j mitra ) , hiv 1&2 ( rapid sd card ) 1x30 test ( j mitra ) , antibiotic disc ampicillin, pkt of 250 ( hi media ) , antibiotic disc gentamycin, pkt of 250 ( hi media ) , antibiotic disc amikacin, pkt of 250 ( hi media ) , antibiotic disc ciprofloxacin, pkt of 250 ( hi media ) , antibiotic disc norfloxacin, pkt of 250 ( hi media ) , antibiotic disc nalidixic acid, pkt of 250 ( hi media ) , antibiotic disc nitrofurontoin, pkt of 250 ( hi media ) , antibiotic disc imipenem, pkt of 250 ( hi media ) , antibiotic disc vancomycin, pkt of 250 ( hi media ) , antibiotic disc co trimaxazole, pkt of 250 ( hi media ) , antibiotic disc cefixime, pkt of 250 ( hi media ) , antibiotic disc ceftazidime, pkt of 250 ( hi media ) , antibiotic disc clindamycin, pkt of 250 ( hi media ) , antibiotic disc piperacillin, pkt of 250 ( hi media ) , antibiotic disc optichin, pkt of 250 ( hi media ) , antibiotic disc polymixin b, pkt of 250 ( hi media ) , cover glass 22x40 ( blue star ) , cover glass 22x50 ( blue star ) , macckonkey broth double strenght ( hi media ) , pack of 0.5kg , hbsag sd card ( 1x100 test ) sd , distilled water , hcv sd card , pkt of 100 ( sd ) , hbsag tridot ( 1x100 test ) ( j mitra ) , easylyte plus solution pack na / k / cl ( medica ) , easylyte cleaning solution bott of 90ml ( medica ) , easylyte plus wash solution bott of 50ml ( medica ) , easylyte plus urine diluent bott of 500ml ( medica ) , clead agar ( hi media ) , pack of 0.5kg , mha agar ( hi media ) , pack of 0.5kg , blood agar base ( hi media ) , pack of 0.5kg , nutrient agar ( hi media ) , pack of 0.5 kg , semen diluenting fluid, bott of 500ml , erba diluent h 360, pack of 20 ltr , erba lyse h 360, bott of 500ml , erba h clean h 360, bott of 50ml , erba printer roll 55mm, h 360 , erba control h 360 , microscopic slide pack of 50 ( blue star ) , watman filter paper 125mm x 100 circle , kit rapid pap biofix spray ( biolab ) , kit lipase , 1 x 20ml ( erba ) , ab &d antisera ( 3 x 10ml ) , ependorf tube , acidh2so4 ( sulphuric acid ) , kit t3 detection elisa kit 96 tests ( calbiotech ) , kit t4 detection elisa kit 96 tests ( calbiotech ) , microtips ( 1 200ul ) , microtips ( 500 1000ul ) , erba wash ( 5x 20 ml ) , ethanol , tmppd , kit abst tobramycin disc, pkt of 250 ( hi media ) , kit abst colistin disc, pkt of 250 ( hi media ) , kit abst meropenam disc, pkt of 250 ( hi media ) , kit abst ceftrixone disc, pkt of 250 ( hi media ) , kit abst piptaz disc, pkt of 250 ( hi media ) , kit abst cefazolin disc, pkt of 250 ( hi media ) , kit abst cefotoxime disc, pkt of 250 ( hi media ) , kit abst linezolid disc, pkt of 250 ( hi media ) , kit abst penicillian disc, pkt of 250 ( hi media ) , duram tube , india ink , sda media , lj media , lpcb , blood culture castaneda , tubing kit set ( medica easylite ) , glass, cover, microscopic, square shape, 0.127 mm thick, side 22 mm, pkt of 14 g , micropipettes, tips for 1 200 ul , micropipettes, tips for 500 1000 ul , semi auto analyser, wash solution for , semi auto analyser, printing paper roll for , slide, microscope, thickness 1.15 to 1.35 mm size 75mm x 25 mm , acetone commercial , acid, sulphuricum ( sp. gravity 1.820 1.825 ) . , alcohol amyl , aluminium foils. , alcohol methyl , ( aso ) antistreptolysin o test latex agglutination principle, complete with control serum , cled agar ( with thymol blue ) , pack of 0.5kg , liquior formaldehyde 40% w / v , kit for estimation of hdl cholesterol ( 100 ml ) , hiv antibody 1 & 2 detection rapid test kit , keto diastix bott of 50 strips , kits for estimation of albumin , kits for estimation of cholestrol , kits for estimation of glucose , kits for estimation ofprotein , kits for estimation of urea , kits for estimation of uric acid , kits for estimation of creatinine , kits for estimation of alkaline phosphatase , kits for estimation of sgot ( ast ) , kits for estimation of sgpt ( alt ) . , macconkey agar , pack of 0.5kg , methylene blue , mueller hinton agar, pack of 0.5kg , prothrombin time reagents to give control of 10 14 secs , pttk reagent , sodium hypochlorite solution 10% , strips albumin and glucose bottle of 100 strips , tsi media / triple sugar iron agar, pack of 0.5 kg , kit for triglyceride estimation ( 100 ml ) , kit for ldl cholesterol by direct estimation , kit for estimation of bilirubin , kit for estimation of ggt ( gamma gluteryl transaminase ) ( 12 x 5 ml ) , kit for estimation of cpk mb ( 2.5 ml ) , kit for estimation of calcium ( 50 ml ) , kit for estimation of amylase ( 12 x 5 ml ) , kit for estimation of ldh ( 12 x 5ml ) , kit crp ( c reactive protein kit for 50 tests ) , pt reagent ( kit of 25 tests ) , serum haemaglutnating group a ( anti b monoclonal ) , serum haemagglutnating group b ( anti a ) monoclonal , serum heamaglutinating gp. o ( anti ab ) ( monoclonal ) ...

Medical College - Rajasthan

33076251 supply of various type of test kits and consumables for microbiology dept supply of various type of test kits and consumables for microbiology dept , dengue rapid test for detecting ns1 antigen & igg & igm antibody. • should be capable of detecting dengue infection from day 1 & should be preferably capable of detecting all 04 serotypes of dengue virus. • should have high sensitivity and specificity and +ve control. , ra(latex agglutation test) • should be preferably ce marked/certified. • reagent should be calibrated against who international standard. • latex particles coated with purified human gamma globulin. • should have with +ve control. , crp(latex agglutation test) • should be preferably ce marked/certified. • latex particles coated with anti human crp. • should have with +ve control. , aso(latex agglutation test) • should be preferably ce marked/certified. • latex particles coated with purified streptolysin o. , hbsag rapid test • should be capable of detecting preferably all subtypes of hbsag. • antigen sensitivity should be around 0.5ng/ml. • should have with +ve control. note: sensitivity & specificityshould preferably be >99% , anti hcv rapid test should be preferably 4th generation test. flow through technology. should be capable of detecting preferably all subtypes of hcv. note: sensitivity & specificityshould preferably be >99% , rapid malaria antigen test based on pldh for pv & hrp 2 detection for pf i.e. should be pv & pf specific. should preferably be developed according to who guidelines & hence approved. , widal slide test stabilized reagent for long shelf life(18 months or more at 2 to 8o c.) available in 5ml vials separately salmonella o, salmonella h, salmonella a(h) & salmonella b(h). should be preferably ce marked/certified. , upt card test , rpr slide test should be preferably ce marked/certified. ready to use reagent. positive control provided with kit. stabilized reagent for long shelf life (18 months or more) specimen can be plasma/serum can be used without heat inactivation. preferrably calibrated to who reference serum for serodiagnostic test for treponemal infection. , glass slide (75 x 25mm) thickness 1.45 mm , cover slip 22 x 22 mm thickness 0.13 0.16 , measuring cylinder 100ml made up of borosilicate (borosil) , glass beaker 250 ml capacity made up of borosilicate (borosil) , reagent bottle with stopper 50ml , glass petridishautoclavable 150mm x 20mm , plasticpetridishautoclavable 100 mm x 17mm , plasticpetridishdisposable sterile100 mm x 17mm , glass petridishautoclavable 100mm x 17mm , disposable sterile petridish , glass tubes( with rim) 6 x1 inches 20ml capacity , glass tubes( with rim) 5 x1 inches 10ml capacity , glass tubes( with rim) 4 x 0.5 inches 5ml capacity , glass stock vial 10ml , plastic dustbin 10 ltr. , yellow tips (20 200 ul) , blue tips upto 1000 ul , gloves (non sterile) 7 no. , gloves (non sterile) 7 ½ no. , staining racks stainless steel , test tube stand of hard plastic/ steel • 96 vials, 12mm x 75 mm / 100 mm test tubes • 12 places for 25 mm diameter test tubes • stand for centrifuse tubes 1.5 ml, 2.2 ml & 2.7ml capacity • stand for vials 5 ml vial with 24 vial holding capacity, hole size 14mm • 2 shelves folding stand, 18 tubes holding capacity, hole size 18 mm. • 3 shelves folding stand, 18 tubes holding capacity, hole size 16 mm , magnifier hand lens , stop watch , universal sterile container screw cap 30ml capacity (plastic) , blood culture bottle (120 ml) (glass) capacity with aluminum screw cap with rubber lining of cap. , ready made pre prepared blood culture bottles with media complete for adult , ready made pre prepared blood culture bottles with media complete for children , micropipette fixed 20ul , micropipette fixed 50ul , micropipette fixed 100ul , micropipette variable 5 50ul , micropipette variable 10 100ul , micropipette variable 100 1000ul , antiseptic soap for hand wash , hand sanitizer 200 ml , sample collection tube with screw cap 10ml capacity (plastic) , tissue paper rollpremium extra large with425 sheets (2 ply ) size 95 x 110 mm. , nichrome loop d 1, 1.3mm diameter , nichrome straight wire , widal tubes , drayers tubes , felix tubes , glass flask (500 ml capacity) , glass flask (250 ml capacity) , glass flask (150 ml capacity) , aluminum bucket ( 6x 6 inches) , aluminum bucket ( 8x8inches) , disposable mask (sterile) , cotton roll , gauze roll , marker fine tip black/red/blue , glass marking pencil white/black , whatman filter paper grade 1 , postmartum gloves (7.5 inches) , match box , glass bottle with aluminum cap for l.j. medium (80mm x 20 mm) , hi flexi loop 2 sterlized flexible loop2.2 mm diameter , brucella (rose bengal test) • should be preferable ce marked/ certified. • positive control should preferably be supplied along whit kit. • more than 12 months eagent shelf life at 2 to 8 degree c. , scrub typhus rapid card test , dengue ns1 elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , dengue igm elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , dengue igg elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , scrub typhus igm elisa • should be preferable ce marked/ certified. qc certificate to be enclosed with each kit. , hav igm elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , hev igm elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , brucella iggelisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , brucella igm elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , vdrl rotator , chikungunya rapid card test. • based in sandwich immunoassay principle. • high sensitive & specific. • more than 12 months shelf life. , chikungunya igm elisa test. • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , hbsag elisa test. • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , hcv elisa test. • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , hiv (rapid tests of two different types based on different principles) • 4th generation test for differential detection of p24 antigen & hiv i & ii antibody. flow through technology & interpretation time around 5 to 10 minutes, approved & evaluated by niv/nari and who(naco). • test for detecting both antigen & antibody of hiv by examination of whole blood/ plasma/serum. should be who/naco approved. note: sensitivity & specificity should preferably be >99% , syphilis rapid strip/ card test , torch igg+igm (elisa) (toxoplasma+rubella+cmv+herpes) igg 4 nos.+igm 4 nos. (elisa) (1x96) pack+ total 8 nos. • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit....

Sardar Patel Medical College - Rajasthan

33003578 supply of various type of test kits and consumables for microbiology dept 01 [ ) engue rapid test for detecting nsi anigcn & igg & 1gm antibody. • should he caeable or&iectine dengue infect ion i runi | day i & should be preferably capable of detecting ali 04 serotypcs or dengue virus. • should have high sensitivity and spccinlcity and ‘ ye ( ‘ontrol. 02 ra ( latex agglutation test ) should be preferably ( ‘it markcdocrtiifmj? . reagent should be calibrated against who internaljonal standard. • lanex particles coated with purifind hunan gamma globulin. • should have with ve ( ‘ontrol. 03. cr p ( i aiex aggiutation test ) • should be prefemably ce narkedcer, jf, ed. • latex particles coated with anti human crp. • shound havc with 4 vc contnol, 04. 1 aso ( laiex aggiutation test ) • should be preferably ( ‘e markcdlccrtified. • latex rarticles coated winh purificd strcpeolysi.i 0. — 05. libsag rapid lest • should be capable or detecting prefernbly aul subwypes of hbsag. • antigen sensiaivity should be around o.sng / ml. • should hnve with +ve ( gontrol. note:. sensitivity & spcciricity should prcfernbly be 9p4 . 06. anti iicv rapid test hhnud? be preferablb 4th generation uest of inri%is j pnrksj, ? l isscey&s should prefera be 07. rapid malaria antigen test based oe pldii for iv & iip 2 detection for pr i.e. should be pv & pf specific. should prefernbly be developecd according to who j guidelines & hence approved. o8. widal slide test stabilized reagent for long shelr life ( is months or more at 2 to 8o c. ) available in 5m1 vials separately salmonella 0, salnonella h, salmonella a ( l i ) & salmonella b ( i i ) . 09. upt card test . to. rpr slide test should bc preferably ( ‘e markcdjcenlified ready to use reagent. positive control provided with kit. stabiiized reagent for long shelf iife ( 18 moaths or more ) specimee can he plasma / serum can be used without heat inactivation prefemnably calibrated to whio refnnence senum for 4 serodiggo%iic test for ‘onemal infection, i i. glass slide ( 75 x 2smm ) tiiainess i.45 mm 12. cover slip 22 x 22 mm thickness 0.i3 0.16 i3. measuring cyiindei i oornl made up of jjiorosjlicate ( borosil ) 14. glass beaker 250 ml capacity made up of 4i0rosllucai’e ( borosjl ) 15. reagent boiile wiih stopper somi 16. glass petridisi autoclavabie isomm x 2imm il. tpiasiic petridisii autoclayaale iao mm x i 7mm ix. f plasñc x 17mm 19. glass petridisi autoclavabie ioomm x 17mm i.noijijii a? jllmm i9. glass iitridisi auloclavabic iiomm x i7mm 20. disposabie sierile petridish 21. tg1ass thbes with iimi 6 xl inches 20m1 capacity 22. tijlass ttl1ls wits iimi s xl inches lomi capacity 23. glass iuh [ s ( wiihi.ini ) 4 xo.5 inches 5mlcapaciy 24. gilass stock siociç via!. lomi plastic dustbin 10 ltr. yellow tips ( 20 200 ul ) blue tips upto 1000 ul gloves ( non sterile ) 7 no. gloves ( non sterile ) 7 v2 no. staining racks stainless steel test tube stand of hlard plastic / steel • 96 vials, 12mm x 75 mm / 100 mm test tubes • 12 places for 25 mm diameter test tubes • stand for centrifuse tubes 1.5 ml, 2.2 ml & 2.7m1 capacity • stand for vials 5 ml vial with 24 vial holding capacity, hole size 14mm 2 shelves foldine stand, 18 tubes holding capacity, hole size 18mm. • 3 shelves folding stand, 18 tubes holding capacity, hole ______ size 16mm 32. magnifier tiand lens 33. stop watci i 34. universal sterile conjaini.r screw cap 30mnl capat ( plastic ) _____ 35. blooi ) culture bottle ( 120 ml ) rgiass ) capacity with aluminun screw cap with rubber lining of cap. 36. ready made pre prepared blood culture bottles with media .____complete for adult ._.___ compicte i1or arjuitt 37. ready made prc prepared blood culture bottles with nredia complete for children 38. micropipette fix el ) 20u1 39. micropipette fixed 50ul 40. miuropipetie fixed l00ul 41. micropipejte variable 5 50ul 42. +micropipe1te variable i0 iooul i micropiiei ] ’evariaa [ jimjóojaoouj? 44. fan11septic soap for iand iasi 45. hand saniti2er 200 ml 46. sample collection tujbe with screw cap joml capacity ( plastic ) 1w 1t [ mis? f 47. i tissue paper roll. premium extra large with 42s jshees ( 2 ply ) size95 xil 10mm. — 48. niciirome i.oopd l. l.3mm [ ) iametiir? 49. nichromf; straight wire fsffwidaltubes — . 51. i ) rayers tue3es 52. felix tubes 53. glass flask ( 500 ml capacity ) 54. glass flask ( 250 ml capaciiy ) 55. glass [ m5j ( iso ml capaciiy ) 56. 1!nlim iicket ( 6x 6 inches ) 57. aluminum hi ] ck [ t ( 8x8 inches ) 58. disposabie mask ( sterlij ) 59. cotton roll 60. gauze roll 6i. marker fine tip black / rl [ ) , l1 [ i ) e? 62. glass markin ( ; pen ( ii. wiiite / black1 61 whatman fiiter paper grnde i 64. postmartijmgloves ( 75 inches ) 65. matchbox 66. glass bottle wimi aluminum cap ior l.j. mei ) ium ( somn x 20 mm ) lw7 1u, 1m — (owomm x 20 mm) 67. [iiii huexi [.oop 2 sthrl.izii) fl fxihle 1ixw 2.2 — mm i)iameter 61t. i4rucelia rrose bengal test) • should be preferable ce marlhedj certified. • positive control shouud prefernbwy be supplied alone whit kit. • more than 12 months cagent shelr life at 2 to 8 degreec. 69. scrub typhus rapid eard [est 7i. tbcngue nsi elisa • should be preferable cf marked/ certified. . qf nriifcii to be enclosed with each kit. 71. j dcngue 1gm fiisa • should be preferable ce marked/cenfift(d? • qc certificate to be enclosed with each kit. 72. i)engue lgg elisa • shoul(l be preferable ce marked! certified. • qc certificate to be enclosed with each kit. 73. scrub typhus lgm elisa • should be preferable ce marked! certified. qc certificate to be enclosed with each kit. 74. hav lgm elisa • should be preterable ce marked! certified. ____ —e • qc centificate to be enclosed with each kit. 75. hev 1gm elisa • should be preferable ce marked! certified. • qc ccrtificate to be enclosed with each kit. 76. flrucella lgg lilisa • should be preferable ce marked! certified. • qc certificate to be enclosed with each kit. 77. brucella lgm lilisa • should be preferable (‘ii marked? certified. • qc certificate to be enclosed with each kit. 78. v1)rl rotator . tchikungunya rapid card test. ...t • based in sandwich immunoassay principle. • high sensitive & specific. e more than 12 months shelf life. 80. c’hikungunya lgm elisa test.hcv elisa test hiv rapid test of two diffretn types syphilis rapid strip / card test torch igg igm elisa etc ...

Rajasthan University Of Health Science - Rajasthan

32695056 supply of various chemical, regents and consumable item for central lab, annual rate contract for various chemicals, reagents and consumable items for microbiology central lab, ruhs hospital of medical sciences, jaipur annual rate contract for various chemicals, reagents and consumable items for microbiology central lab, ruhs hospital of medical sciences, jaipur , india ink , absolute alcohol 99.9% , filter paper sheet whartmann no. 1 ( 460 mm x 570 mm ) , plain tube ( made of plastic, without cap, capacity 5 ml ) , tips 10 200 microloite ( white in colour ) , tips 100 1000 microlitre ( white or blue in colour ) , vacutainer serum ( clot activator ) 4 5 ml capacity , sterile sample storage vial ( individually packed ) capacity 2 ml microcentrifuge tube , blood culture bottle ( adult ) glass bottle 100 ml capacity with lid of aluminium with rubber cork in it , kovacs indole reagent , liquid paraffin , ph indicator strip 6.5 to 9.0 ph measurement , alber stain ( a + b ) , koh pellets , sda with chloramphenical , chrom agar for candida , chrom agar for bacteriological purpose , lpcb , l lysine decarboxylase broth , l ornithine decarboxylase broth , l arginine dihydrolase broth , mannitol salt agar , modified hugh & leifson o / f test , loeffler serum medium base , cled , corn meal agar , andrede’s indicator , bromocresol purple , glucose phosphate broth ( mr vp medium ) , methyl red indicator , alpha naphthol , simmon citrate agar , christensen urease agar , urea 40% , triple sugar iron agar , peptone type i bacteriological , sim agar , blood agar base , bhi broth , deionized water , fluid thioglycollate broth ( anaerobic ) with indicator , macconkey agar , nutrient agar , muller hinton agar , n, n, n’, n’ tetra methyl p phenylenediamine dihydrochloride , coverslip box ( 1 x 20 small box ) , glass slide , disposable polythene gloves , disposable petridish 100 mm ( individually packed ) , disposable sterile swab ( individually packed ) , disposable sterile swab with test tube ( individually packed ) , sputum container plastic , disposable sterile universal container ( individually packed ) , stool container with spoon , h2o2 ( 30% ) , mccartney bottle , petridish glass 150 mm , petridish glass 100 mm , petridish glass 75 mm , tissue paper roll , brain heart infuson ( bhi ) agar , immersion oil for microscopy , bacitracin ( 10 unit ) , bile esculin disc , cotrimoxazole 25 ?g , fosfomycin 50 ?g , furazolidone 50 ?g , imipenam 10 ?g , meropenam 10 ?g , clotrimazole 10 ?g , fluconazole 10 ?g , ketoconazole 10 ?g , itraconazole 30 ?g , flucytosine e test strip , amphotericin b 50 ?g , caspofungin e test strip , posaconazole e test strip , luliconazole e test strip , scrub typhus igm elisa , rpr test for syphilis based on antigen coated on carbon particle , vdrl rapid test card for qualitative detection of antibodies ( igg and igm ) to treponema pallidum , rheumatoid factor ( rf ) latex test kit , antistreptolysin o ( aslo ) latex test kit , crp test latex kit , dengue rapid test card for igm, igg and ns1 , dengue igm elisa , dengue igg elisa , dengue ns1 antigen elisa , chikungunya igm elisa , hav igm elisa , anti hcv elisa , hev igm elisa , hbsag elisa , anti hdv igm , toxoplasma igm elisa , toxoplasma igg elisa , rubella igm elisa , rubella igg elisa , cytomegalovirus igm elisa , cytomegalovirus igg elisa , herpes simplex virus igm elisa , herpes simplex virus igg elisa , hbeag elisa , anti hbc igm elisa , anti hbe elisa , anti hbs elisa , ana elisa , anti ds dna elisa , widal slide test , widal tube test , malaria by card test ( antigen for p.v., p.f. / pan ) , anti hcv rapid card test , urine pregnancy test card / strip , sars cov 2 ( antibody test ) , hbsag rapid test card , hiv rapid test card , chikungunya igm rapid test card , stool for occult blood test kit , h1n1 qualitative detection & differentiation of type a influenza viruses, pandemic influenza, pandemic h1 influenza virus and human rnasep gene ( ic ) , hbv dna quantitative , hcv rna quantitative , hiv 1 rna quantitative , hpv dna qualitative ( qualitative detection of 14 high risk hpv genotypes & differentiation of hpv 16 & 18 genotypes of human papilloma viruses ( hpv ) ) , mtb / ntm ( qualitative detection & differentiation of mycobacterium tuberculosis complex & nontuberculous mycobacteria ) , dengue ( qualitative detection & differentiation of dengue virus serotypes 1 to 4 ) , chikungunya ( qualitative detection of chikungunya virus ) , hsv ( qualitative detection & differentiation of herpes simplex virus 1 & 2 ) , zika virus ( qualitative detection of zika virus ) , rna extraction kit , dna extraction kit , rpmi 1640 medium buffered with mops , cation adjusted mueller hinton broth [ camh broth ] , skirted plate 96 well x 0.2 ml ( autoclavable ) , vancomycin powder , oxacillin powder , colistin powder , fluconazole powder , itraconazole powder , ketoconazole powder , flucytosine powder , amphotericin b powder , voriconazole powder , nystatin suspension 10000 units nystatin per ml in dulbecco phosphate buffered saline ...

Rajasthan University Of Health Science - Rajasthan

32694985 annual rate contract for various chemicals, reagents and consumable items for microbiology central lab, ruhs hospital of medical sciences, jaipur annual rate contract for various chemicals, reagents and consumable items for microbiology central lab, ruhs hospital of medical sciences, jaipur , india ink , absolute alcohol 99.9% , filter paper sheet whartmann no. 1 ( 460 mm x 570 mm ) , plain tube ( made of plastic, without cap, capacity 5 ml ) , tips 10 200 microloite ( white in colour ) , tips 100 1000 microlitre ( white or blue in colour ) , vacutainer serum ( clot activator ) 4 5 ml capacity , sterile sample storage vial ( individually packed ) capacity 2 ml microcentrifuge tube , blood culture bottle ( adult ) glass bottle 100 ml capacity with lid of aluminium with rubber cork in it , kovacs indole reagent , liquid paraffin , ph indicator strip 6.5 to 9.0 ph measurement , alber stain ( a + b ) , koh pellets , sda with chloramphenical , chrom agar for candida , chrom agar for bacteriological purpose , lpcb , l lysine decarboxylase broth , l ornithine decarboxylase broth , l arginine dihydrolase broth , mannitol salt agar , modified hugh & leifson o / f test , loeffler serum medium base , cled , corn meal agar , andrede’s indicator , bromocresol purple , glucose phosphate broth ( mr vp medium ) , methyl red indicator , alpha naphthol , simmon citrate agar , christensen urease agar , urea 40% , triple sugar iron agar , peptone type i bacteriological , sim agar , blood agar base , bhi broth , deionized water , fluid thioglycollate broth ( anaerobic ) with indicator , macconkey agar , nutrient agar , muller hinton agar , n, n, n’, n’ tetra methyl p phenylenediamine dihydrochloride , coverslip box ( 1 x 20 small box ) , glass slide , disposable polythene gloves , disposable petridish 100 mm ( individually packed ) , disposable sterile swab ( individually packed ) , disposable sterile swab with test tube ( individually packed ) , sputum container plastic , disposable sterile universal container ( individually packed ) , stool container with spoon , h2o2 ( 30% ) , mccartney bottle , petridish glass 150 mm , petridish glass 100 mm , petridish glass 75 mm , tissue paper roll , brain heart infuson ( bhi ) agar , immersion oil for microscopy , bacitracin ( 10 unit ) , bile esculin disc , cotrimoxazole 25 ?g , fosfomycin 50 ?g , furazolidone 50 ?g , imipenam 10 ?g , meropenam 10 ?g , clotrimazole 10 ?g , fluconazole 10 ?g , ketoconazole 10 ?g , itraconazole 30 ?g , flucytosine e test strip , amphotericin b 50 ?g , caspofungin e test strip , posaconazole e test strip , luliconazole e test strip , scrub typhus igm elisa , rpr test for syphilis based on antigen coated on carbon particle , vdrl rapid test card for qualitative detection of antibodies ( igg and igm ) to treponema pallidum , rheumatoid factor ( rf ) latex test kit , antistreptolysin o ( aslo ) latex test kit , crp test latex kit , dengue rapid test card for igm, igg and ns1 , dengue igm elisa , dengue igg elisa , dengue ns1 antigen elisa , chikungunya igm elisa , hav igm elisa , anti hcv elisa , hev igm elisa , hbsag elisa , anti hdv igm , toxoplasma igm elisa , toxoplasma igg elisa , rubella igm elisa , rubella igg elisa , cytomegalovirus igm elisa , cytomegalovirus igg elisa , herpes simplex virus igm elisa , herpes simplex virus igg elisa , hbeag elisa , anti hbc igm elisa , anti hbe elisa , anti hbs elisa , ana elisa , anti ds dna elisa , widal slide test , widal tube test , malaria by card test ( antigen for p.v., p.f. / pan ) , anti hcv rapid card test , urine pregnancy test card / strip , sars cov 2 ( antibody test ) , hbsag rapid test card , hiv rapid test card , chikungunya igm rapid test card , stool for occult blood test kit , h1n1 qualitative detection & differentiation of type a influenza viruses, pandemic influenza, pandemic h1 influenza virus and human rnasep gene ( ic ) , hbv dna quantitative , hcv rna quantitative , hiv 1 rna quantitative , hpv dna qualitative ( qualitative detection of 14 high risk hpv genotypes & differentiation of hpv 16 & 18 genotypes of human papilloma viruses ( hpv ) ) , mtb / ntm ( qualitative detection & differentiation of mycobacterium tuberculosis complex & nontuberculous mycobacteria ) , dengue ( qualitative detection & differentiation of dengue virus serotypes 1 to 4 ) , chikungunya ( qualitative detection of chikungunya virus ) , hsv ( qualitative detection & differentiation of herpes simplex virus 1 & 2 ) , zika virus ( qualitative detection of zika virus ) , rna extraction kit , dna extraction kit , rpmi 1640 medium buffered with mops , cation adjusted mueller hinton broth [ camh broth ] , skirted plate 96 well x 0.2 ml ( autoclavable ) , vancomycin powder , oxacillin powder , colistin powder , fluconazole powder , itraconazole powder , ketoconazole powder , flucytosine powder , amphotericin b powder , voriconazole powder , nystatin suspension 10000 units nystatin per ml in dulbecco phosphate buffered saline...

North Western Railway - Rajasthan

31759828 supply of bd blood culture bottle adult (plus aerobic) for bd betel fx 40bd blood culture bottle adult (plus aerobic) for bd betel fx 40,bd blood culture bottle adult (plus aerobic) for bd betel fx 40...

Medical College - Rajasthan

31635926 chemical reagents and glass items chemical reagents and glass items , rate contract of chemical and reagents items , picric acid purified , fuchsin acid (c.i. 42685) , acetic acid glacial 100% for analysis , charcoal activated , potassium permanganate for analysis , silver nitrate for analysis , ammonia solutionfor analysis , sulfuric acid about 98% for analysis , carbol fuchsin (ziehl & neelsen stain solution) dilute for microscopy , chloral hydrate, 99+%, extra pure, slr, meets the specification of bp and ph. eur. , cycloheximide 1pc x 1gm , micro tips material: pp autoclavable 10 to 200?l , micro tips material: pp autoclavable 200 1000?l , dpx new non aqueous mounting medium for microscopy , eosin yellowish (c.i.no. 45380, s.no. 881) indicator and for microscopy , aluminium ammonium sulfate , formaldehyde solution min. 37% (stabilized with about 10% methanol) , gold(iii) chloride =99.99% trace metals basis , hydrochloric acid comerical , hydrogen peroxide 30% for analysis , 2 propanol for analysis , metanil yellow reag. ph eur , methyl blue aqueous solution , paraffin wax 60 62°c , phenol , potassium dichromate for analysis , potassium hydroxide pellets for analysis , sodium hypochlorite solution approximately 4% w/v available chlorine , xylenesulfur free , brain heart infusion agar suitable for microbiology, nutriselect® plus , brain heart infusion broth suitable for microbiology, nutriselect® plus , deoxycholate citrate agar suitable for microbiology, nutriselect® plus , fluid thioglycollate medium , formaldehyde sconcentration 40% , mannitol salt agar , macconkey agar suitable for microbiology, nutriselect® basic , mueller hinton agar for testing the sens , nutrient agar , nuclear fast red (c.i. 60760) , sabouraud glucose agar with chloramphenicol suitable for microbiology, nutriselect® plus , triple sugar iron agar for microbiology , glucose broth , hematoxylin cryst. (c.i. 75290) for microscopy , light green (c.i. 42095) for microscopy , pus culture tube 15ml , tri sodium citrate dihydrate for analysis , urea agar (base) acc. to christensen for , dextrose anhydrous purified , arabinose disks suitable for microbiology , dulcitol disks suitable for microbiology , galactose disks suitable for microbiology , lactose disks suitable for microbiology , maltose disks suitable for microbiology , mannitol disks suitable for microbiology , mannose disks suitable for microbiology , sorbitol disks suitable for microbiology , sucrose disks suitable for microbiology , trehalose disks suitable for microbiology , xylose disks suitable for microbiology , aztreonam , bacitracin disks suitable for microbiology , carbenicillin (cb) , cefixime (cfx) , cefotaxime +clavulanic acid , cefoxitin (cn) , ceftazadime , ceftazidine +clav acid , amikacin , ampicillian , amoxycillin , amoxy clave , ceftriaxone+ clavulanic acid , ceftrixone , cephalexin , ciprofloxacin , cloxacillin , co trimoxozole , doxycline , erythoromycin , gentamicin , imepenem , nalidixic acid , nitrofurantoin , norifloxacin , onpg disks suitable for microbiology , optochin disks suitable for microbiology , pipercillin+tazobactum , tetracycline , vancomycin , colistin disc , polymixin b , azithromycin , cefotaxime , chloramphenicol , cefeperazone + sulbactum , clindamycin , ertapenam , gentamicin 120 mg. , netalmycin sulphate , ticoplanin , levofloxacin , linezolid , ofloxacin , novabiocin , tigicycline , fosfomycin , meropenam , raffinose , bile esculin disks suitable for microbiology , imepenem + edta , vancomycin e strip , polymixin b e strip , colistin e strip , netalmycin e strip , benzyl penicillin e strip , crystal violet , potassium tellurite , n,n,n,n tetramethyl p phenylenediamine dihydrochloride , giemsa stain, solution pbf , paraffin liquid , methanol , capillary tube (wide hole) (1 pkt. contained100 pcs.) , citric acid , hydrochloric acid , acetic acid glacial 100% , ammonium chloride for analysis , blood culture bottle pediatric (50x20) , blood culture bottleadult (50x20) , test tubes without rim 18 x 150 mm , test tubes without rim 12 x 100 mm , ammonium oxalate pc count solution , rapid rc stain kit (new methylene blue) , eosin y solution 0.5% alcoholic for microscopy , cover slipsize18x18mm english glass mo 1thik ness(0.13mmto0.16mm) , cover slipsize22x22mm english glass mo 1thik ness(0.13mmto0.16mm) , cover slipsize22x50mm english glass mo 1thik ness(0.13mmto0.16mm) , sodium meta bisulphati , methenamine borates tab. , ihc antibody er , pr , her 2 , microtome blade , myeloperoxidase mpo stain kit , pas staining kit for detection of aldehyde and mucosubstances , leishman’s stain a , leishman’s stain b , rbcdiluting fluid , w.b.c. diluting fluid , pearl stain kit , giemsa stain, modified solution (for the staining (of cellular blood components and blood parasites)) , fields stain a solution , fields stain b solution , hemoglobino meter , neubauer chamber , sprit lamp brass , ammonium sulfate , sodium chloride , potassium chloride , rapid pap kit , nitric acid , toludine blue , agar agar , alkaline peptone water , bile esculine agar base , mr vp (glucose phosphate broth) , peptone water , phenyl alanine agar , simmons citrate agar , xld agar , hichrome uti chromogenic agar , esculin , basic fuschin , bromocresol purple , cedarwood oil , calcium chloride , horse serum , iodine cyrstal , l lysine monohydrate , l araginine monohdyrate , l ornathine monohydrate , iso amyl alcohol , potassium iodide , p diamethyl amino benzeldehyde , ph indicater strip 0 to 7 , ph indicater strip 7 to 14 , sodiumpoly anthosulphonate , petridish glass size 4 inch borosilcate , petridish plastic size 4 inch autoclaveble , petridish plastic size 6 inch autoclaveble , petridish glass size 6 inch borosilcate , dorhums tubes , flask conical 500 ml , flask conical 1 ltr , flask conical 250 ml , measursing cylender glass 1000 ml , masuring cylenderglass 500 ml , measursing cylender plastic 1000 ml , masuring cylenderplastic 500 ml , masuring cylenderplastic 100 ml , glass funnel size 4 inch , glass funnel size 3 inch , plastic funnel size 4 inch , plastic funnel size 3 inch , disposable sterile swab , disposable sterile swab with tube , carbolic soap 80 grm , dimond marker/pencil...

Rajasthan University Of Health Science - Rajasthan

31583020 chemicals reagents consumable items for department of microbiologywork list of annual rate contract for supply and installation of various chemicals & reagents & consumable items for department of microbiology sl. no. item description 1 electrical items : 2 absolute ethanol 3 acetone 4 afb (zn acid fast kit) 5 agar powder (bacteriological grade) 6 alberts stain 7 alkaline peptone water 8 anaerobic system envelope with palladium catalyst (gas pak) 9 alpha naphthol ar 10 aniline 11 anti hbc igm elisa kit 12 anti hbc (igm & igg) total test 13 anti hbe elisa test kit 14 hbeag elisa kit 15 anti hbs antibody elisa kit 16 hbs ag elisa kit 17 cytomegalovirus (cmv) igg elisa kit 18 cytomegalovirus (cmv) igm elisa kit 19 dengue ns1 antigen elisa kit 20 hav igm elisa kit 21 hcv igm elisa kit 22 hev igm elisa kit 23 ds dna elisa kit 24 ana elisa kit 25 herpes simplex virus (hsv 1 & 2) igg elisa kit 26 herpes simplex virus (hsv 1 & 2) igm elisa kit 27 rubella igg elisa kit 28 rubella igm elisa kit 29 toxoplasma igg elisa kit 30 scrb typhus igm ag elisa kit 31 toxoplasma igm elisa kit 32 biodegradable plasic bags (yellow, red, blue, black) 33 bleaching powder 34 blood agar base 35 blood culture bottle (adult) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 36 brain heart infusion broth 37 cled media 38 conc. h2so4 39 corn meal agar 40 cover slips 22 x 22 mm 41 crp test kit 42 deionized water 43 dengue rapid test card along with ns1 antigen 44 deoxycholate citrate agar 45 di sodium hydrogen phosphate 46 discarding plastic buckets (yellow, red, blue, black) 20 litre 47 disposable individually packed centrifuge tube conical bottom capacity 50 ml 48 disposable polythene gloves 49 disposable sterile test tube with swab individually packed 50 dubos medium 51 ecoshield 52 edta powder 53 face mask 54 ferric chloride 55 filter paper box whartman no. 1, 12.5 cm circular 56 filter paper sheet whartman no. 1 57 fluid thioglycollate broth (anaerobic) with indicator 58 formalin pellets 59 glass marking pencils (red, white) 60 glass test tube 100 mm x 12 mm without rim 61 glass test tube 75 mm x 12 mm without rim 62 h2o2 (30%) 63 koh pellets 64 kovcks indole reagents 65 l arginine 66 l lysine mono dihydrochloride 67 lactophenol cotton blue solution 68 liquid paraffin 69 loeffler serum medium base bovine serum 70 lowenstein jensen medium 71 macconkey agar 72 macconkey broth 73 maltose 74 mannitol 75 mannitol salt agar 76 mccartney bottle 77 methyl red powder 78 microcentrifuge tube with cap capacity 2 ml 79 mr vp medium (glucose phosphate broth) 80 muller hinton agar 81 n acetyl l cysteine 82 n naphthyl ethylene diamine dihydrochloride 83 n,n,n,n tetra methyl p phenylenediamine dihydrochloride 84 nigrosin 10% 85 nutrient agar 86 oxidase disc 87 peptone water 88 perforated bucket (red, blue) 15 litre double bin 89 petridish glass 90 mm 90 petridish glass 75 mm 91 ph indicator strips 6.5 to 9 ph measurement 92 phenol 93 pottasium dihydrogen phosphate 94 pregnancy test card 95 ra factor kit 96 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 97 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 98 robertson cooked meat medium readymade 99 vdrl rapid test card 100 sabraud’s dextrose agar 101 selenite f broth bacteriological 102 sim agar 103 simmons citrate agar 104 sodium chloride 105 sodium hydroxide pellets 106 sodium hypochlorite solution 107 sterile autoclavable skirted plate 96 wells x 0.3 ml 108 sterile readymade plates of blood agar (90 mm size) 109 sterile readymade plates of macconkey agar (90 mm size) 110 sterile readymade plates of nutrient agar (90 mm size) 111 sterile storage vial 2 ml capacity 112 sterile storage vial 5 ml capacity 113 sterile transport medium (stuart medium) with test tube and swab individually packed 114 stool container with spoon 115 sulphanilamide 116 tcbs 117 triple layer mask 118 trypticase soya broth 119 tsi agar 120 urea agar base 121 viral transport medium 122 widal slide test 123 wilson and blair medium 124 xylene 125 xylose 126 resazurin powder 127 sterile readymade plates of dca (90mm size) 128 sterile readymade plates of tcbs (90mm ) 129 vancomycin powder 130 vencomycin disc 131 amikacin 30 µg 132 amoxycillin 30 µg 133 amoxyclav 20/10 µg 134 amphotericin b 135 ampicillin + sulbactum 136 azithromycin 15 µg 137 aztreonam 30µg 138 bacitracin (0.04 unit) 139 bile esculin disc 140 cefepime 30 µg 141 cefixime 5 µg 142 cefoperazone + sulbactum 75/10 µg 143 cefoperazone 75 µg 144 cefotaxime 30 µg 145 cefotetan 146 cefoxitin 30 µg 147 cefpirome 148 cefpodoxime 10 µg 149 ceftazidime + clavulanic acid 30/10µg 150 ceftazidime 30 µg 151 ceftriaxone 30 µg 152 cefuroxime 30 µg 153 cephalexin 30 µg 154 chloramphenicol 30 µg 155 ciprofloxacin 5 µg 156 clarithromycin 15 µg 157 clindamycin 2 µg 158 clotrimazole 159 colistin 160 cotrimoxazole 25 µg 161 cyclopirox 50 µg 162 dalfopristine 163 daptomycin 164 doripenam 10µg 165 doxycycline 30 µg 166 e strip for esbl detection 167 e strip for mbl detection 168 e strip oxacillin 169 ertapenam 10µg 170 erythromycin 10 µg 171 faropenam 172 fluconazole 25 µg 173 fosfomycin 200 µg 174 furazolidone 50 µg 175 fusidic acid 176 gentamicin 120µg 177 gentamicin 30µg 178 gentamycin 10 µg 179 griseofulvin 10 µg 180 hippurate 181 imipenam 10 µg 182 itraconazole 8 µg 183 kanamycin 184 ketoconazole 15 µg 185 levofloxacin 5µg 186 lincomycin 10 µg 187 linezolid 30 µg 188 meropenam 10 µg 189 miconazole 10 µg 190 moxalactum 191 nalidixic acid 30µg 192 netilmycin 30 µg 193 nitrofurantoin 300 µg 194 norfloxacin 10 µg 195 novobiocin 196 nystatin 197 ofloxacin 5 µg 198 onpg 199 optochin 200 oxacillin 1 µg 201 piperacillin + tazobactum 100/10 µg 202 piperacillin 100 µg 203 polymyxin b 30 units 204 pristinomycin 15µg 205 quinopristin 206 teicoplanin 30 µg 207 terbinafine 1 µg 208 tetracycline 30 µg 209 ticarcillin+clavulanic acid 75/10 µg 210 ticarcillin75µg 211 tigecyclin 15µg 212 tobramycin 10 µg 213 v factor 214 vancomycin 30 µg 215 voriconazole 1 µg 216 x + v factor 217 x factor 218 immersion oil 219 (occuet blood in stool ) kit hemoccult sensa aninophezone test 220 grams stain kit 221 hcv igmrapid card 222 sterile urine container single pack 223 culture loop (nicrome)1mm 24 gauge wire loop 224 culture loop (nicrome) 2mm24 gauge wire loop 225 cotton roll 226 disposable petri disc 90 mm 227 sterile disposable swab sticks with test tube 228 sterile disposable cotton swab (individual pack) 229 hbsag rapid test card 230 aluminium foil (72 meter) 231 rpr test kit 232 vaccutainer vial 4.5ml (serum activator without gel) 233 disposable plain tube 5ml (without cap) plastic 234 disposable plain tube 8ml (without cap) plastic 235 test tube stand 96 hole plastic 236 urea solu 40% 237 glass test tube 10ml 238 glass test tube 20 ml 239 aslo test kit 240 phenyl alanin agar 241 sulphide indole motility test (sim motility medium) 242 test tube holder bighole for 20ml test tube 243 disposable test tube 20ml ...

North Western Railway - Rajasthan

30688175 supply of blood culture bottle for adult used in bd bactec fx 40blood culture bottle for adult used in bd bactec fx 40,blood culture bottle for adult used in bd bactec fx 40 => limited...

Department Of Medical Education - Rajasthan

30502430 supply of solutions / kits / regents of mnjy solutions / kits / regents of mnjy hiv microelisa d.c.g.i.approved should have iv generation test kits with p24antigen, should have w.h.o. evauation including subgroup o+ recombinant protein gp120 c terminus,gp40, gp36, sensitivity and speciticity 98% 100% , hiv immuno comb d.c.g.i. approved, should have iv generation with p24 antigen. elisa based principle., hiv (rapid spot tridot) d.c.g.i.approved iv generation with p24antigen. result should be obtained 10 to 15 mt.should detect > 15 days after seroconversion, should have recombinant and syntheticpeptide. immunofiltration, immuno chromatographic lateral flow igg, igm, ig a specific to hivi, hiv2 , hbsag. microelisa d.c.g.i approved, iv generation should have recombinant antigen of core type, should have sensitivity and specificity 100 99% respectively. direct sandwitch prindiple or antigencapture, hbsag. card d.c.g.i approved, sensitivity 99.8% (0.5ng/ml) specifiticity 100% core antigen. antigen capture or sandwitch (core antigen) immuno cromatography or lateral flow., hcv microelisa d.c.g.i approved, fourth generation test for ns3, ns4, ns5 with core organic isrile, pbs organic france. s.d. , qualpro, hcv (hepatitis c) rapid d.c.g.i. approved, antibody detection on flow through technology kits should have based on, vdrl strip d.c.g.i. approved, 100% specificity 98% sensitivity, m.p. card antigen sensitivity 100 percent, specialicity 99.99 percent, immo any as sarduih preipipar with coated manodonal ab for anti pan 8per feeipar spu ( pld8 pav) feeipar spa (plph) ab, disposable test tube plastic transparent plastic size 12x75mm, e.c.g. roll single/multichannel , e.c.g. jelly , semi auto roll , c.b.c. roll 57mm*32m, tissue paper roll , bovine albumin, comb’s serum, blood bag tripple cpd sagm 450 ml iso 9002, blood bag tripple cpda 350ml iso 9002 , blood bag tripple cpd sagm350ml iso 9002 , blood cuture bottle disposable , culture petri dishes with wireloop disposable, culture tube disposable, culture antibiotic dishes full range , blood culture bottle with media , nutrient agar, mackomeky, peptone borth , muler hilton (m.h.) agar , clot activator vial with double cap 5ml, sodium citrate vial 2ml double cap, e.d.t.a. k 3 cbc double cap 5ml, di water standard manufacturer, nipple cum sample cups for fully autoanalizer, vacou containers k3 e.d.t.a. 5ml, glucometer, glucometer strip, uristicks, multisticks, hb pipette square, r.b.c. pipette with connecting tube, w.b.c. pipette with connecting tube, neuebar chamber silver line, capillary tube fir c.t. , e.s.r. tube c stand tube (glass tube) , cover slip small large , micro slide 76x26x1.15 m, filter paper , serological test good quality sensitivity 100% specificity 99%.8% with known value control/ caliberator, r.a. test , crp test, asl o test , ra tarbi, crp tarbi, aslo tarbi, widal test card, widal test, preg card sensitivity & specificity 100% (sensitivity 10mliu/ml.) recombinant flow (iii, iv generation) through technology , coreantigen (hbcag antibody) to detect igg, igm, iga antibody recombinant/ synthetic peptide., w b c dilution fluid , tec dilution fluid , seman dilution fluid , patlets dilution fluid , liesman stain , 3.8 % sodium cirate , n/10hcl , liquid parafin oil , giemosa stain , sulphur power , fou chest regent , e.s.r stand with tube of mnimum and type (everite top) 6 or 10 tubes (5 in number) everites top (glass pipeete), iodine sultion, xylene, blood suger auto analyzer kit, blood urea liq. , total protin , hdl direct, ck nac, ck mb, serum albumin, serum ldh, serum creatinine liq., serum bilirubin t&d, serum cholestrol direct, serum triglyceride , s.g.o.t., sgpt, serum amylase, serum alkalina phosphatase, serum uricacid, serum phiosphatase, serum calcium , striperer & sealer manual standard manufacturer, lancet (pricking needle) round shape with plastic top standard manufacturer, copper sulphate standard manufacturer, shakker & mixer for vdrl standard manufacturer, funnel standard manufacturer, anti abd 10 ml (monoclonal), anti ab , anti a 1 lactine , blood collection monitor with automated scale, semi auto analyzer standard manufacturer, anti hav igm. elisa kit, anti hev igm. eliasa, typhidot igm elisa, viral transport medium (v.t.m.) standard manufacturer, dengue igg/ igm rapid card sansitivity 95 percent span 96 percent cold moun mono linal anti ab fa igg and igm, ignittion tube , h2s strip test for water quality k 19 , stool sample container , stan (jsb i), stan (jsb ii), glass slide, keto dia sticks , torniquate belt , blue tips , yellow tips , urine container 30ml, grams stain , ziemsa powder , methenol , glycerin , handdis infacted/hand santizer , bandaid , vacutainer needle , gramstain , syring needle destroyer , thermometer range 0 1000c, , oxidase strip from himedia , ph strip , glase ( borosil) petriplate 90 mm , glase tube size 10 cm * 1.5 cm , conical flask size 250 ml , 500 ml , 1000 ml , micropipette size 5 – 50 microliter , micropipette 10 – 100 microliter , micropipette 100 – 1000 microliter micropiplate, spatula, aluminium foil , weiging paper , staining rod , staining bottle with dispenser , spirit lamp ss, mr reagent (methyl red reagent), fecl3 , sodium hypochlorite 10%, mackonkey broth (single strength) , mackonkey broth (double strength) , disposable sterilized petriplate , glase tube size 15 cm * 125 mm , conical flask size 500 ml , dettol dettol, scrub typhus elisa igm anti body (imbios), nutrient agar prepared plate, indole reagent (high media), isopropyl alchohal , rubber band (large size) , disposable syringe 2 ml , disposable syringe 3 ml, disposable syringe 5 ml, disposable syringe 10 ml, white tips (1000 micro ltr.) , sample collection bottle (water) narrow mounted natural boro cillicate glass, capacity 1000 ml , bgb medium (brilliant green bile borth medium) 1 kg., glass pipette size 1 ml with bubbles 2 nos. , glass pipette size 5 ml with bubbles 2 nos. , glass pipette size 10 ml with bubbles 2 nos. , auto clave chemical indicator , ortho tolidine soluton for residual chlorine , test tube stand 48 hole , h2s strip test for water quality (prepared bottle) , vdrl rotator, centrifuge machine 16 channel (for city dispensary), scrub typhgus rapid card test, chikanguniya rapid card test, chikanguniya igm elisa kit, dengue ns 1 elisa kit, dengue igg elisa kit, dengue igm elisa kit , esr pipette disposable, plain vial with colt activator double cap 5ml, coomb sera type of specific antibody anti d titre more than 512/1024 with specific , coomb sera type of specific antibody anti d titre more than 512/1024 with specific , swine flu safty kit , swine flu mask (n 95) , tripple layer mask , mackoneky agar , nutrient agar , alkaline peptone water , peptone water , salmonella shigella agar , sarbitol dextrose agar , sorbitol mackoneky agar , tripple sugar iron (tsi) agar , simmons citrate agar , cary blair medium , elisa reader washer standard manufacturer, xray film 12 x 15 blue base standard manufacturer, xray film 10 x 12 blue base standard manufacturer, xray film 8 x 10 blue base standard manufacturer, dental xray film standard manufacturer, sonography gelly jar 5 ltr. standard manufacturer, city scan film dry imaging 14 x 17 standard manufacturer, developer 22.5 ltr. standard manufacturer, fixer 22.5 ltr. standard manufacturer, other items (radiology) standard manufacturer, x ray screen 12x15 standard manufacturer, x ray screen 10x12 standard manufacturer, x ray screen 08x10 standard manufacturer, x ray hanger 12x15 standard manufacturer, x ray hanger 10x12 standard manufacturer, x ray hanger 08x10 standard manufacturer, half film blocker (divider), size (7x17) standard manufacturer, x ray screen with cassatte size 12x15 standard manufacturer, dry x ray film (dihl) (10*12), dry x ray film (dihl) 12x15 , dry x ray film (dihl) 14x17 , dry x ray film (dihl) 08x10 , singal blood bag 350 ml cpda, double blood bag 350ml cpda, transfer blood bag. ...

Medical College - Rajasthan

30436915 supply of disposable items use for laboratory testing anti sera ( blood bank ) part c supply of disposable items use for laboratory testing anti sera ( blood bank ) part c , plain disposable screw cap and round bottom, blood collection vial / test tube of size 13x80 mm with prefixed white label of good quality , edta k2 screw cap disposable screw cap and round bottom, blood collection vial / test tube of size of 13x80 mm withprefixed label of good quality , vaccutainer plain plastic disposable caped and round bottom, blood collection test tube of size 13x110 mm with prefixed white label of good quality , vaccutainer edta k2 plastic disposable caped and round bottom, blood collection vial / test tube of size of 13x80 mm withprefixed label of good quality , normal saline for laboratory use , yellow tips of approved quality , blue tips of approved quality , liquid soap for hand washing with dispenser , sodium hypochlorite soln.lr , auto disable blood lancets, with protective guard , disposable adhesive fabric plaster strip , disposable sprit swab , disposable swab stick , cross match and blood grouping tiles , tissue paper roll of size 110x100 mm and weight 100 gm , polythylene disposable gloves packet , permanent marker pen. ( for the numbering of blood bags / test tube ) . , kitchen scale for the measurement of2 kg weight , single piece molded glass filed polycarbonated tray for the storage of frozen plasma in 80 degree centigrade temperature. , single piece molded glass filed polycarbonated tray for the storage of frozen plasma in 80 degree centigrade temperature. , povidoneiodine spray for phlebotomy ( 200mlpacking ) , antiseptic spray forphlebotomy ( 200mlpacking ) , disposable thermocol boxes with prefixed specified label ( for blood / component bagssupply ) , disposable biodegradable printed carry bags ( as per specification ) , ready to use blood culture bottles with liquid bhi broth media. , estimation of factor – 8 and fibrogenlevel in givenblood plasmasample. , non sterile rubber gloves free size , smily balls , disposable readymadecotton swab / balls big size...

Rajasthan University Of Health Science - Rajasthan

30259092 chemicals reagents consumable items for department of microbiology chemicals reagents consumable items for department of microbiology , electrical items : , absolute ethanol , acetone , afb ( zn acid fast kit ) , agar powder ( bacteriological grade ) , alberts stain , alkaline peptone water , anaerobic system envelope with palladium catalyst ( gas pak ) , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbc ( igm & igg ) total test , anti hbe elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , hbs ag elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , dengue ns1 antigen elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , ds dna elisa kit , ana elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , dengu igm elisa kit , chikungunya igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , bleaching powder , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , brain heart infusion broth , cled media , conc. h2so4 , corn meal agar , cover slips 22 x 22 mm , crp test kit , deionized water , dengue rapid test card along with ns1 antigen , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable individually packed centrifuge tube conical bottom capacity 50 ml , disposable polythene gloves , disposable sterile test tube with swab individually packed , dubos medium , ecoshield , edta powder , face mask , ferric chloride , filter paper box whartman no. 1, 12.5 cm circular , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , glass marking pencils ( red, white ) , glass test tube 100 mm x 12 mm without rim , glass test tube 75 mm x 12 mm without rim , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , lactophenol cotton blue solution , liquid paraffin , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey agar , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , microcentrifuge tube with cap capacity 2 ml , mr vp medium ( glucose phosphate broth ) , muller hinton agar , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , ra factor kit , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , vdrl rapid test card , sabraud’s dextrose agar , selenite f broth bacteriological , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile storage vial 2 ml capacity , sterile storage vial 5 ml capacity , sterile transport medium ( stuart medium ) with test tube and swab individually packed , stool container with spoon , sulphanilamide , tcbs , triple layer mask , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxycillin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , azithromycin 15 ?g , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefepime 30 ?g , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpirome , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamicin 30?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , levofloxacin 5?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , norfloxacin 10 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , tobramycin 10 ?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , grams stain kit , hcv igmrapid card , sterile urine container single pack , culture loop ( nicrome ) 1mm 24 gauge wire loop , culture loop ( nicrome ) 2mm24 gauge wire loop , cotton roll , disposable petri disc 90 mm , sterile disposable swab sticks with test tube , sterile disposable cotton swab ( individual pack ) , hbsag rapid test card , aluminium foil ( 72 meter ) , rpr test kit , vaccutainer vial 4.5ml ( serum activator without gel ) , disposable plain tube 5ml ( without cap ) plastic , disposable plain tube 8ml ( without cap ) plastic , test tube stand 96 hole plastic , urea solu 40% , glass test tube 10ml , glass test tube 20 ml , aslo test kit , phenyl alanin agar , sulphide indole motility test ( sim motility medium ) , test tube holder bighole for 20ml test tube , lugols iodine solution , plastic scurbber , test tube washing brush , disposable test tube 20ml...

Indian Army - Rajasthan

28545579 supply of consumables and expendable medical stores supply of consumables and expendable medical stores , abdominal drain kit size 26g , abg calibration gas ( opti medical ) , abg cassette ( opti tm ) , adhesive plaster micropore tape 1 , adhesive plaster micropore tape 2 , adhesive plaster micropore tape 3 , ambu bag masksize 1 , ambu bag masksize 2 , ambu bag masksize 3 , ambu bag with mask 350 ml , ambu bag with mask 500 ml , ambu bag with mask 750 ml , ampoule cutter , baby mucous sucker , bain circuit ( adult ) , blood culture bottle , blood transfusion set , bougie ( large ) , bougie ( medium ) , bougie ( small ) , bp. cuff infant , bp cuff. infant , bp cuff infant. , bp cuff infant.. , bp. cuff neonatal , bp cuff. neonatal , bp cuff neonatal , bp cuff. neonatal , bp cuff neonatal , bp cuff neonatal. , bp. cuff paediatric , bp cuff .paediatric , bp cuff paediatric , bp cuff. paediatric , brush for cleaning sharp jaws , bubble cpap short binasal prong size 0 , bubble cpap short binasal prong size 00 , bubble cpap short binasal prong size 1 , bubble cpap short binasal prong size 2 , bullnose fitting with wolf bottle , button cell for glucometer , central line 3 lumen size 4 f , central line 3 lumen size 5 f , central line 3 lumen size 7 f , central venous catheter triple luman size 10f , central venous catheter triple lumensize 12f , central venous catheter triple lumensize 14 , chest tube with under water seal drainage size 10 fr , chest tube with under water seal drainage size 12 fr , chest tube with under water seal drainage size 14 fr , chest tube with under water seal drainage size 16 fr , cleaning agent tube 5 g, for distal and proximal lenses and fiber optic surface of endoscopes , cylinder oxygen d type empty with capacity 7000 ltr , digital thermometer , disposable diaper ( large ) , disposable diaper paed ( medium ) , disposable diaper paed ( small ) , disposable diaper paed ( xtra small ) , double stage oxygen regulater , dry & wet bulb thermometer , ecg electrodes , ear bud bott of 100 , endotracheal tubecuffed size 3.0 mm , endotracheal tubecuffed size 3.5 mm , endotracheal tubecuffed size 6.5 mm , endotracheal tubeun cuffed size 3.0 mm , endotracheal tubeun cuffed size 3.5 mm , endotracheal tubeun cuffed size 6.5 mm , endotracheal tube cuffed size 4.0 mm , endotracheal tube cuffed size 4.5 mm , endotracheal tube cuffed size 5.0 mm , endotracheal tube cuffed size 5.5 mm , endotracheal tube cuffed size 6.0 mm , endotracheal tube un cuffed size 4.0 mm , endotracheal tube un cuffed size 4.5 mm , endotracheal tube un cuffed size 5.0 mm , endotracheal tube un cuffed size 5.5 mm , endotracheal tube un cuffed size 6.0 mm , epidural set 18 g , feeding tube assorted sizes s 5 , fibrin glue ( tisseel fibrin kit ) , adhesive plaster , flow sensor tubing for ventilator , fluorescein strip 1% pkt of 100 , folleys catheter size 10 fr , folleys catheter size 14 fr , folleys catheter size 8 fr , tissue gamzee , gauge surgical 3 mtr pkt , glucometer strips ( accuchek active bott of 50 ) , glucometer strips ( sugercheck bott of 50 ) , steriledisposable gown sms meterial , guedels airway ( size 0 ) , guedels airway ( size 00 ) , guedels airway ( size 1 ) , guedels airway ( size 2 ) , head box ( infant ) , head box ( neonate ) , humidefier bottle for o2 concentrator with connecting tube , i gel size 1 , i gel size 1.5 , i gel size 2 , i gel size 2.5 , i gel size 4 , i gel size 5 , intubation stylet ( large ) , intubation stylet ( medium ) , intubation stylet ( small ) , iv fix adhesive bandage , jackson rees circuit ( paed ) , knee cap large , knee cap medium , laryngayl mask airway size 1 , laryngayl mask airway size 1.5 , laryngayl mask airway size 2 , laryngayl mask airway size 2.5 , laryngayl mask airway size 3 , laryngayl mask airway size 4 , laryngayl mask airway size 5 , laryngoscope battery aa , laryngoscope with macintosh ( 1, 2, 3 ) blades ( paed ) , laryngoscope with miller blade ( 0, 1, 2 ) ( paed ) , led x ray view box white ( single film ) , male condom catheter , mersilk non absorbable braided suture black no 1 cutting bodied 76 mm , mersilk non absorbable braided suture black no 1 round bodied 76 mm , mersilk non absorbable braided suture black no 1.0 cutting bodied 76 mm , mini spike , monocryl absorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 2.0 cutting bodied 70 cm , monocryl absorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 2.0 round bodied 70 cm , monocryl absorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 4.0 cutting bodied 70 cm , monocryl absorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 4.0 round bodied 70 cm , multi piece pciol with prolene haptic +21.0 , nasal cannula ( pead ) , nasal prong ( infant ) , nasal prong adult , nasal prongs ( neonate ) , nastrogastric tube size 10 fr , nastrogastric tube size 5 fr , nastrogastric tube size 6 fr , nastrogastric tube size 8 fr , nebulizer machine , nebulizer mask with chambers ( paed ) , niv mask adult , niv mask with strap ( paediatric ) , non rebreathing mask ( infant ) , non rebreathing mask ( paed ) , oxygen mask with tubing ( child ) , oxygen mask with tubing ( neonate ) , oxygen mask with tubing ( paed ) , paediadrip set , pead bp .cuff , pead bp cuff , peripherally inserted central venous catheter size 2f , peripherally inserted central venous catheter size 3f , peripherally inserted central venous catheter size 4f , peritonial dialysis catheter ( tenckhoff ) , peritonial dialysis fluid1.5% ( 1000 ml ) , pmo line 150 cm , absorbent pad adhesive dressing , prolene non absorbable suture ( monofilament ploypropylene blue ) no 01 cutting bodied 70 cm , prolene non absorbable suture ( monofilament ploypropylene blue ) no 01 round bodied 70 cm , prolene 9 0 suture straight needles double armed pkt of 12 , radiant warmer , rams cannula size 0 , rams cannula size 00 , rams cannula size 01 , rams cannula size 02 , rechargable aa batterry with charger , scalp vein , silk non absorbable braided suture reel 25 mtr , padding cast soft , spacer with mask ( paed ) , spo2 probe neonantal. , spo2 probe neonantal , spo2 probe. neonate , spo2 probe neonate , spo2. probe neonate , spo2. probe neonate.. , spo2 probe paed , spo2. probe paed , spo2 probe paed . , spo2 probe paed . , spo2 probe paed. , spo2 probe paed , spo2 table top portable pulse oxymeter size neonatal , spo2 table top portable pulse oxymeter size paed , steam inhaler machine , sterile collagen particle 5 ml , sterile gauge swab 20*40 , suction catheter size 10 fr , suction catheter size 6 fr , suction catheter size 8 fr , surgical blade size 22 , hypodermic syringe 10 ml , hypodermic syringe 20 ml , hypodermic syringe 50 ml , hypodermic ad syringe 5 ml with needle , syringe infusion pump stand with charger , urinary bag with volume meter ( paed ) , urine bottle ( sterile ) , vaccum blood collection tubewith needles: edta 2ml / 3ml , vaccum blood collection tubewith needles: sterile tube with gel , vaccum blood collection tubewith needles: sodium flouride 2ml / 3ml , vaccum blood collection tubewith needles:sodium citrate 3ml , vein finder , ventilator circuit ( neonate ) , ventilator circuit ( paed ) , vicryl absorbable suture synthetic ( braided coated polygalatin ) no 1 cutting bodied 35 , weighing machine digital ( adult ) , weighing machine neonate / infant , yankur suction set...

Indian Army - Rajasthan

28423041 procurement of medicines procurement of medicines for 187 mh , drugs , kit pttk 2x5 ml ( siemens ) , kit g6pd ( 2x40ml ) ( coral ) , ependorf tube , elisa kit for free t3 ( j mitra/cal biotech ) , elisa kit for free t4 ( j mitra/cal biotech ) , elisa kit for tsh ( j mitra/cal biotech ) , easy lyte plus urine diluent , bott of 500ml ( medica ) , elisa kit for beta hcg ( cal biotech ) , elisa kit for lh ( cal biotech ) , elisa kit for fsh ( cal biotech ) , elisa kit for prolactin ( cal biotech ) , elisa kit for testosterone ( cal biotech ) , kit triglycerides 5x20 ml ( erba ) , kit amylase 6x6 ml ( erba ) , salmonella igg/igm ( j mitra ) typhi dot , kit ckmb 2x10ml ( erba ) , kit ldh 4x8 ml ( erba ) , mal card ( j mitra ) , kit urea 20x5 ml ( erba ) , kit creatinine 60x4 ml ( erba ) , uric acid 4x20 ml ( erba ) , kit cholesterol 20x5 ml ( erba ) , kit hdl cholesterol 5x20 ml ( erba ) , kit bilirubin total and direct 5x20 ml ( erba ) , kit sgot 5x20 ml ( erba ) , kit sgpt 5x20 ml ( erba ) , kit glucose 2x200 ml ( erba ) , kit alkaline phosphate , 6x6ml ( erba ) , kit widal 4x5ml ( tulip ) , urine strip 2 sg , ( protein and glucose ) bott of 100 strips ( siemens ) , microscopic slide , pkt of 50 ( blue star ) , multi strips 10sg , bott of 100 strips ( siemens ) , swab sticks ( hi media ) , cover slip 22x55 ( blue star ) , gram stain ( hi media ) , zn stain ( hi media ) , macconkey broth double strength ( hi media ) pack of 0 . 5kg , sysmex control ( sysmex ) bott of 4 . 5ml , cled agar , pack of 0 . 5kg ( hi media ) , mha , pack of 0 . 5kg , ( hi media ) , blood agar base , pack of 0 . 5kg , ( hi media ) , macconkey agar , pack of 0 . 5kg ( hi media ) , nutrient agar , pack of 0 . 5kg ( hi media ) , antibiotic disc ampicillin , pack of 500 disc ( hi media ) , antibiotic disc gentamycin , pack of 500 disc ( hi media ) , antibiotic disc amikacin , pack of 500 disc ( hi media ) , antibiotic disc ciprofloxacin , pack of 500 disc ( hi media ) , antibiotic disc norfloxacin , pack of 500 disc ( hi media ) , antibiotic disc nalidixic acid , pack of 500 disc ( hi media ) , antibiotic disc nitrofurontoin , pack of 500 disc ( hi media ) , antibiotic disc imipenem , pack of 500 disc ( hi media ) , antibiotic disc vancomycin , pack of 500 disc ( hi media ) , antibiotic disc co trimaxazole , pack of 500 disc ( hi media ) , antibiotic disc cefixime , pack of 500 disc ( hi media ) , antibiotic disc ceftazidime , pack of 500 disc ( hi media ) , antibiotic disc clindamycin , pack of 500 disc ( hi media ) , antibiotic disc optichin ( pack of 500 disc ( hi media ) , antibiotic disc polymixin b , pack of 500 disc ( hi media ) , antibiotic disc piptaz , pack of 500 disc ( hi media ) , antibiotic disc cefazolin , pack of 500 disc ( hi media ) , antibiotic disc cefotoxime , pack of 500 disc ( hi media ) , antibiotic disc meropenem , pack of 500 disc ( hi media ) , antibiotic disc colistin , pack of 500 disc ( hi media ) , antibiotic disc cefoxitin , pack of 500 disc ( hi media ) , antibiotic disc linezolid , pack of 500 disc ( hi media ) , antibiotic disc penicillin , pack of 500 disc ( hi media ) , tmppd for oxidase test , durams tube , india ink , bott of 100ml ( hi media ) , tsi media ( triple sugar iron ) , pack of 0 . 5kg ( hi media ) , sda media ( sabourand dextrose agar ) , pack of 0 . 5kg ( hi media ) , lowenstein jensen ( lj media ) for afb culture ( hi media ) , lacto phenol cotton blue for fungal , bott of 50ml , zone size scale for bacteriology ( hi media ) , lipase kit ( erba ) , pap stain ( rapid ) ( bio lab ) , easy lyte plus wash solution , bott of 50ml ( medica ) , easy lyte plus cleaning solution , bott of 50ml ( medica ) , esr tube ready to use , erba control ( h 360 ) ( erba ) , erba diluent ( h 360 ) , pack of 20ltr ( erba ) , erba h clean ( h 360 ) , bott of 50ml ( erba ) , kit total protein ( erba ) , kit albumin ( erba ) , kit micro protein ( 1x50ml ) ( erba ) , kit ra factor ( tulip ) , stromatolyser bott of 500ml ( sysmax ) , stool for ocult blood rapid card 1x50 ( coral/tulip ) , kit calcium 5x20 ml ( erba ) , micro tips ( 1x200ul ) , micro tips ( 1x1000ul ) , cell pack , pack of 20 ltr ( sysmex ) , cell clean ( sysmax ) , urine container , kit erba wash 5x20ml ( erba ) , sperm wash ( sar healthline ) , bd 1ml syringe 26g x 1/2 ( 0 . 45mm x 13mm ) for iui use , centrifuge tube ( capacity 10/15 ml ) for iui use , iui catheter 6/8 fr 17cm , blood culture bottle ( aerobic ) , for adult ( hi media ) , blood culture bottle ( anerobic ) , for adult ( hi media ) , blood culture bottle ( aerobic ) , for paed ( hi media ) , kit aso titre , ( tulip ) , liquor formaldehyde 40% w/v , petri dish disposal ( hi media ) , semen dilueting fluid , bott of 500ml...

Indian Army - Rajasthan

27646363 procurement of medicines for 187 mh , drugs , uric acid 4x20 ml ( erba ) , kit cholesterol 20x5 ml ( erba ) , kit triglycerides 5x20 ml ( erba ) , snap pack ( roche ) ( roche ) , kit amylase 6x6 ml ( erba ) , kit ggt 12x5 ml ( erba ) , kit ckmb 2x10ml ( erba ) , kit ldh 4x8 ml ( erba ) , stromatolyser bott of 500ml ( sysmax ) , cell clean ( sysmax ) , kit prothrombin time 5ml ( siemens ) , kit pttk 2x5 ml ( siemens ) , kit widal 4x5ml ( tulip ) , kit crp ( tulip ) , kit ra factor ( tulip ) , maleria paracheck antigen ( j mitra ) , pregnancy test card ( hcg ) ( cipla ) , tri dot test hiv rapid ( j mitra ) , tri dot test hcv rapid ( j mitra ) , tri dot hbsag rapid test ( j mitra ) , vdrl test ( ctk ) , urine collection container sterile , urine strip 2 sg , ( protein and glucose ) bott of 100 strips ( siemens ) , stool for ocult blood rapid card 1x50 ( coral/tulip ) , antisera ab&d 3x10ml ( meril ) , microscopic slide , pkt of 50 ( blue star ) , multi strips 10sg , bott of 100 strips ( siemens ) , swab sticks ( hi media ) , micro tips ( 1x200ul ) , micro tips ( 1x1000ul ) , distilled water , kit erba wash 5x20ml ( erba ) , kit g6pd ( 2x40ml ) ( coral ) , vaccutainer edta , with needle ( bd ) , vaccutainer sodium fluoride , with needle ( bd ) , vaccutainer sterile , with needle ( bd ) , vaccutainer sterile with gel , with needle ( bd ) , vaccutainer sodium citrate , with needle ( bd ) , cover slip 22x50 ( blue star ) , capillary tube bottle of 100 , ependorf tube , ethabol , methyl alcohol , acetone , gram stain ( hi media ) , zn stain ( hi media ) , macconkey broth double strength ( hi media ) pack of 0 . 5kg , sysmex thermal paper roll ( sysmex kx 21 ) , petri dish disposal ( hi media ) , sysmex control ( sysmex ) bott of 4 . 5ml , clead agar , pack of 0 . 5kg ( hi media ) , mha , pack of 0 . 5kg , ( hi media ) , blood agar base , pack of 0 . 5kg , ( hi media ) , macconkey agar , pack of 0 . 5kg ( hi media ) , nutrient agar , pack of 0 . 5kg ( hi media ) , test hiv 1 & 2 ( sd ) , test hbsag ( sd ) , test hcv ( sd ) , antibiotic disc ampicillin , pack of 500 disc ( hi media ) , antibiotic disc gentamycin , pack of 500 disc ( hi media ) , antibiotic disc amikacin , pack of 500 disc ( hi media ) , antibiotic disc ciprofloxacin , pack of 500 disc ( hi media ) , antibiotic disc norfloxacin , pack of 500 disc ( hi media ) , antibiotic disc nalidixic acid , pack of 500 disc ( hi media ) , antibiotic disc nitrofurontoin , pack of 500 disc ( hi media ) , antibiotic disc imipenem , pack of 500 disc ( hi media ) , antibiotic disc vancomycin , pack of 500 disc ( hi media ) , antibiotic disc co trimaxazole , pack of 500 disc ( hi media ) , antibiotic disc cefixime , pack of 500 disc ( hi media ) , antibiotic disc ceftazidime , pack of 500 disc ( hi media ) , antibiotic disc clindamycin , pack of 500 disc ( hi media ) , antibiotic disc optichin ( pack of 500 disc ( hi media ) , antibiotic disc polymixin b , pack of 500 disc ( hi media ) , blood culture bottle ready to use ( aerobic ) ( bactech ) , lipase kit ( erba ) , aluminium foils . , pap stain ( rapid ) ( bio lab ) , kit easy lyte plus solution pack na/k/cl ( medica ) , easy lyte plus wash solution , bott of 50ml ( medica ) , easy lyte plus cleaning solution , bott of 50ml ( medica ) , easy lyte plus urine diluent , bott of 500ml ( medica ) , watman filter paper , size 1500mm , kit rapid pap biofix spray ( bio lab ) , deproteiniser and conditioner , bott of 25ml ( roche ) , esr tube ready to use , sulphuric acid ( sp gravity 1 . 828 1 . 825 ) , acid amyld alcohol , erba control ( h 360 ) , erba diluent ( h 360 ) , pack of 20ltr , erba lyse ( h 360 ) , bott of 500ml , erba h clean ( h 360 ) , bott of 50ml , erba printer roll 55mm ( h 360 ) , kit alkaline phosphate , 6x6ml ( erba ) , kit aso titre , ( tulip ) , semen dilueting fluid , bott opf 500ml , elisa kit for free t3 ( j mitra/cal biotech ) , elisa kit for free t4 ( j mitra/cal biotech ) , elisa kit for tsh ( j mitra/cal biotech ) , elisa kit for beta hcg ( j mitra/cal biotech ) , elisa kit for lh ( j mitra/cal biotech ) , elisa kit for fsh ( j mitra/cal biotech ) , elisa kit for prolactin ( j mitra/cal biotech ) , elisa kit for amh ( ans lab/cal biotech ) , elisa kit for vit d ( cal biotech ) , elisa kit for testosterone ( cal biotech ) , inj cefotaxime sodium 1g vial , ceftriaxone sodium 500mg inj , pds loop no . 1 ( suture india ) , tab sitaglitin 50mg , syp lactulose , inj pcm infusion , tenofovir ( 300 mg ) + lamivudine ( 300 ) + efavirenz ( 600mg ) , zidovudine 300 mg , nevirapine 200 mg tab , zidovudine 300 mg + lamivudine 150 mg + nevirapine 200 mg tab , inj lmwh 60mg , syp digine , tab vit c 500mg + zinc , inj lmwh 40mg , ls belt medium ( tynor ) , ls belt large ( tynor ) , ls belt xl ( tynor ) , ls belt xxl ( tynor ) , inj tt , vial of 10 dose , spinal needle 25 g , spinal needle 26 g , monocryl 3/0 , round body ( ethicon ) , monocryl 3/0 , cutting ( ethicon ) , prolene 2/0 , round body ( ethicon ) , prolene 3/0 , cutting ( ethicon ) , prolene 4/0 , cutting ( ethicon ) , prolene 5/0 , cutting , ( ethicon ) , vicryl no 1 , round body ( ethicon ) , vicryl 2/0 , round body ( ethicon ) , pds loop no 1 , round body ( ethicon ) , pds loop 4/0 , round body ( ethicon ) , nylon 2/0 , cutting ( ethicon ) , nylon no 1 , cutting ( ethicon ) , cutasept , bott of 500ml , bacillocid , bott of 500ml , dispo coutery lead , dispo suction tubing , dispo camera cover for laproscopy surgery , g dress comfy 5 , g dress comfy 15 , g dress comfy 25 , syringe disposable , plastic , sterile , 2 ml with needle , syringe disposable , plastic , sterile , 5 ml with needle , tab vildagliptin 50 mg ( novartis ) , tab trihexyphenidyl hcl 2 mg , tab pyridoxine 100 mg , tab pyridoxine 40 mg , bisacodyl 5 mg tab , inj hmg 75iu , tab clonidine 100 mcg ( tab arkamin ) , tab febuxostat 40mg , thalidomide 100mg tab , inj ferric carboxy maltose 50mg/ml , 10ml vial , tab amlodipine 5 mg , tab ticagrelor 90mg , tab sodium valproate and valproic acid 500mg cr , enalapril 5 mg tab , lithium carbonate 300 mg cap/tab , inj multi vitamin , tab natural micronised progesterone 100 mg , tab natural micronised progesterone 200 mg , tab cabergoline 0 . 25mg , e/d cmc , syringe disposable 50 ml , syringe dosposable , plastic sterile , 10 ml with needle , tab metformin 500mg+vildagliptin 50mg ( novartis ) , tab metformin 1000 mg+ vildagliptin 50 mg ( novartis ) , inj rabipur , unsterile hand gloves , size 6 1/2 pair of , unsterilehand gloves , size 7 pair of , unsterilehand gloves , size 7 1/2 pair of , tab tadalafil 40mg , tab mosapride 5mg , tab hctz 25mg , tab derifenacin 7 . 5mg , inj metoclopramide hcl , amp of 2 ml . , inj rabieshield , tramadol hcl 50 mg cap/tab , tramodol hcl 50 mg/ml inj ( prepn:inj ) , tab glucosaimine ( 500 mg ) , tab cartilamine 500mg , urine collection bag , tab sertraline 50mg , tab resperidone 2mg , tab nifedipine 10mg , knee cap l ( tynor ) , tab acetazolamide 250mg , inj thiamine , tab antimigrain , tab imatinib 400mg , tab acamprosate 333mg , inj vitamin k , tab clomipramine 25mg , tab voglibose 0 . 2mg , tab voglibose 0 . 3mg , tab rosuvastatin 5mg , tab acarbose 25mg , tab doxycycllin 100mg , syp oflox oz , tab colchicine 0 . 5 mg , scrotal bandage , baclofen 10mg tab...

Medical College - Rajasthan

27230141 supply of various type of test kits and consumables for microbiology department 1 dengue rapid test for detecting ns1 antigen & igg & igm antibody. n• should be capable of detecting dengue infection from day 1 & should be preferably capable of detecting all 04 serotypes of dengue virus. n• should have high sensitivity and specificity and +ve control. n 2 ra ( latex agglutation test ) n• should be preferably ce marked / certified. n• reagent should be calibrated against who international standard. n• latex particles coated with purified human gamma globulin. n• should have with +ve control. n 3 crp ( latex agglutation test ) n• should be preferably ce marked / certified. n• latex particles coated with anti human crp. n• should have with +ve control. n 4 aso ( latex agglutation test ) n• should be preferably ce marked / certified. n• latex particles coated with purified streptolysin o. n 5 hbsag rapid test n• should be capable of detecting preferably all subtypes of hbsag. n• antigen sensitivity should be around 0.5ng / ml. n• should have with +ve control. nnote: sensitivity & specificity should preferably be >99% n 6 anti hcv rapid test nshould be preferably 4th generation test. nflow through technology. nshould be capable of detecting preferably all subtypes of hcv. nnote: sensitivity & specificity should preferably be >99% n 7 rapid malaria antigen test based on pldh for pv & hrp 2 detection for pf i.e. nshould be pv & pf specific. nshould preferably be developed according to who guidelines & hence approved. n 8 widal slide test nstabilized reagent for long shelf life ( 18 months or more at 2 to 8o c. ) navailable in 5ml vials separately salmonella o, salmonella h, salmonella a ( h ) & salmonella b ( h ) . nshould be preferably ce marked / certified. n 9 upt card test 10 rpr slide test nshould be preferably ce marked / certified. nready to use reagent. npositive control provided with kit. nstabilized reagent for long shelf life ( 18 months or more ) nspecimen can be plasma / serum can be used without heat inactivation. npreferrably calibrated to who reference serum for serodiagnostic test for treponemal infection. n 11 glass slide ( 75 x 25mm ) thickness 1.45 mm 12 cover slip 22 x 22 mm thickness 0.13 0.16 13 measuring cylinder 100ml made up of borosilicate ( borosil ) 14 glass beaker 250 ml capacity made up of borosilicate ( borosil ) 15 reagent bottle with stopper 50ml 16 glass petridish autoclavable 150mm x 20mm 17 plastic petridish autoclavable 100 mm x 17mm 18 plastic petridish disposable sterile 100 mm x 17mm 19 glass petridish autoclavable 100mm x 17mm 20 disposable sterile petridish 21 glass tubes ( with rim ) 6 x1 inches 20ml capacity 22 glass tubes ( with rim ) 5 x1 inches 10ml capacity 23 glass tubes ( with rim ) 4 x 0.5 inches 5ml capacity 24 glass stock vial 10ml 25 plastic dustbin 10 ltr. 26 yellow tips ( 20 200 ul ) 27 blue tips upto 1000 ul 28 gloves ( non sterile ) 7 no. 29 gloves ( non sterile ) 7 ½ no. 30 staining racks stainless steel 31 test tube stand of hard plastic / steel n• 96 vials, 12mm x 75 mm / 100 mm test tubes n• 12 places for 25 mm diameter test tubes n• stand for centrifuse tubes 1.5 ml, 2.2 ml & 2.7ml capacity n• stand for vials 5 ml vial with 24 vial holding capacity, hole size 14mm n• 2 shelves folding stand, 18 tubes holding capacity, hole size 18 mm. n• 3 shelves folding stand, 18 tubes holding capacity, hole size 16 mm n 32 magnifier hand lens 33 stop watch 34 universal sterile container screw cap 30ml capacity ( plastic ) 35 blood culture bottle ( 120 ml ) ( glass ) capacity with aluminum screw cap with rubber lining of cap. 36 ready made pre prepared blood culture bottles with media complete for adult 37 ready made pre prepared blood culture bottles with media complete for children 38 micropipette fixed 20ul 39 micropipette fixed 50ul 40 micropipette fixed 100ul 41 micropipette variable 5 50ul 42 micropipette variable 10 100ul 43 micropipette variable 100 1000ul 44 antiseptic soap for hand wash 45 hand sanitizer 200 ml 46 sample collection tube with screw cap 10ml capacity ( plastic ) 47 tissue paper roll premium extra large with 425 sheets ( 2 ply ) size 95 x 110 mm. 48 nichrome loop d 1, 1.3mm diameter 49 nichrome straight wire 50 widal tubes 51 drayers tubes 52 felix tubes 53 glass flask ( 500 ml capacity ) 54 glass flask ( 250 ml capacity ) 55 glass flask ( 150 ml capacity ) 56 aluminum bucket ( 6x 6 inches ) 57 aluminum bucket ( 8x8 inches ) 58 disposable mask ( sterile ) 59 cotton roll 60 gauze roll 61 marker fine tip black / red / blue 62 glass marking pencil white / black 63 whatman filter paper grade 1 64 postmartum gloves ( 7.5 inches ) 65 match box 66 glass bottle with aluminum cap for l.j. medium ( 80mm x 20 mm ) 67 hi flexi loop 2 sterlized flexible loop 2.2 mm diameter...

Sardar Patel Medical College - Rajasthan

27181690 supply of various type of test kits and consumables for microbiology department. dengue rapid test for detecting ns1 angigen and 1gg and igm antibody 2 ra latex agglutation test 3 crp 4 aso 5 hbsag rapid test 6 anti hcv rapid test 7 rapid malaria antigen test based on pldh 8 widal slide test 9 upt card test 10 rpr slide test 11 glass slide 12 cover slip 13 measuring cylinder 14 glass beaker 15 reagent bottle with stopper 16 glass petridish autoclavable 17 plastic petridish autoclavable 18 plastic petridis disposable sterile 19 glass petridish autoclavable , disposable sterile petridish 21 glass tube with rim 22 glass stock vial 23 plastic dustbin 24 yello tips 25 blue tips 26 gloves 29 staining racks stainless steel 30 test tube stand of hard plastic / steel, magnifier hand lens , stop watch , universal sterile container screw cap 3, blood culture bottle, ready made pre prepared blod culture bottles with media complete for adult, eady made pre prepared blod culture bottles with media complete for childeren , micropipette fixed , micropipette variable , antiseptic soap for hand wash, hand sanitizer, sample collection tube with screw cap, tissue paper roll, nichrome loop diameter, nichrome straight wire, widal tubes, drayers tubes, felix tubes, glass flask, aluminum bucket , disposable mask, cotton roll, gauze roll, marker fine tip black / red / blue, glass marking pencils , whatman filter paper, postmartum gloves, match box, glass bottle with aluminium cap, hi flexi loop, sterized flexible loop 2.2 mm diameter...

Rajasthan University Of Health Science - Rajasthan

27023275 annual rate cont for various regents consumable chemicals for department of pathology microbio biochem blood bank 2 edta vial with cap & label ( 5ml ) 3 plain vial with cap & label ( 5ml ) 4 plain vial working ( riya ) vial 5 ml 5 glass slides 6 band aid ( round ) 7 thermacol box 8 donor pressure ball 9 permanent marker pen ( blunt ) 10 permanent marker pen ( pointed ) 11 hand sanitiser ( alcorub ) 12 10% sodium hypochloride 13 tips 100 ul 14 tips 1000 ul 15 dropper 16 distilled water 17 tissue paper roll 18 all types of blood bags 19 transfer blood bag 300 ml 20 double blood bag 350 / 450ml ( sagm ) 21 triple blood bags 350 / 450ml ( sagm ) 22 rapid card test 23 rapid card hbsag test 24 rapid card hcv ( tri dot ) test 25 rapid card hiv ( tri dot ) test 26 rapid card malaria antigen test 27 rapid card vdrl test 28 elisa kit 29 hbsag elisa kit 30 hcv elisa kit 31 hiv ( 4th generation ) elisa kit 32 abd blood grouping anti sera 33 anti a blood grouping antisera 34 anti b blood grouping antisera 35 anti d ( igg+igm ) rh blood grouping antisera 36 anti a1 blood grouping antisera 37 anti ab blood grouping antisera 38 bbr temperature chart 39 microbiology 40 alpha naphthol ar 41 aniline 42 autoclave indicator strip 43 bleaching powder 44 blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 45 brain heart infusion broth 46 conc. h2so4 47 corn meal agar 48 di sodium hydrogen phosphate 49 dubos medium 50 face mask 51 ferric chloride 52 glass marking pencils ( red and white ) 53 l arginine 54 l lysine mono dihydrochloride 55 liquid paraffin 56 loeffler serum medium base bovine serum 57 mannitol 58 mannitol salt agar 59 mccartney bottle 60 methyl red powder 61 microcentrifuge tube with cap capacity 2 ml 62 n acetyl l cysteine 63 n naphthyl ethylene diamine dihydrochloride 64 n, n, n, n tetra methyl p phenylenediamine dihydrochloride 65 oxacillin powder 66 perforated bucket ( red, blue ) 15 litre double bin 67 ph indicator strips 6.5 to 9 ph measurement 68 phenol 69 pottasium dihydrogen phosphate 70 sim agar 71 simmons citrate agar 72 sodium hydroxide pellets 73 sterile autoclavable skirted plate 96 wells x 0.3 ml 74 sterile readymade plates of blood agar ( 90 mm size ) 75 sterile readymade plates of macconkey agar ( 90 mm size ) 76 sterile readymade plates of nutrient agar ( 90 mm size ) 77 sterile storage vial 2 ml capacity 78 sterile storage vial 5 ml capacity 79 stool container with spoon 80 sulphanilamide 81 triple layer mask disposable 82 xylose 83 gram stain kit 84 vancomycin powder 85 amphotericin b 86 cefotetan 87 cyclopirox 50 μg 88 dalfopristine 89 daptomycin 90 doripenam 10μg 91 doxycycline 30 μg 92 e strip for esbl detection 93 e strip for mbl detection 94 e strip oxacillin 95 ertapenam 10μg 96 erythromycin 10 μg 97 faropenam 98 fosfomycin 200 μg 99 griseofulvin 10 μg 100 imipenam 10 μg 101 kanamycin 102 meropenam 10 μg 103 netilmycin 30 μg 104 oxacillin 1 μg 105 piperacillin + tazobactum 100 / 10 μg 106 piperacillin 100 μg 107 polymyxin b 30 units 108 pristinomycin 15μg 109 quinopristin 110 teicoplanin 30 μg 111 terbinafine 1 μg 112 tigecyclin 15μg 113 voriconazole 1 μg 114 ( occuet blood in stool ) kit hemoccult sensa aninophezone test 115 micro pipette tips 200 micro liter 116 micro pipette tips 1000 micro liter 117 micro pipette tips 10 micro liter 118 hbsag rapid card ( test kit ) 119 rpr slide method ( test kit ) 120 vacutainer vial ( serum activator without gel ) 4ml. size 13x75mm 121 disposable plain tube without cap ( plastic ) 5ml. size 13x75mm 122 disposable plain tube without cap ( plastic ) 8ml 123 test tube stand 96 hole ( plastic ) 124 pathology 125 anti a ( sera ) 126 anti b ( sera ) 127 anti d ( sera ) 128 sodium metabisulfite 129 sprit 130 g6pd kit ( 12 tests ) 131 ocult blood kit 132 coombs anti sera 133 disposible nediles ( 24guage ) 134 ketone strips 135 microscope bulf 136 cedar wood oil 137 rapid h & e 138 sodium citrate 3.2% 139 small test tube plastic 140 small test tube glass 141 urine multi strips 142 new improved neubaur counting chamber having nsilwar watad 9 mm 2 ruled area 143 giemsa stain liquid 144 hematoxiline powder 145 myloproxidase 146 disposable syringes 2ml 147 disposable syringes 5ml 148 disposable syringes 10ml 149 disposable syringes 20ml 150 cotton roll 151 petridish disposable 152 hand senitiser 153 dlc counter ( 8 diffrential min ) 154 activated charcoal 155 chloral hydrate 156 formalin ( formaldehyde 37 40 % 157 glycerin 158 malt diastase 159 numbering paper 160 peanut oil 161 sulfurous acid 162 disposable gloves n1. sterile n2. unsteriliged 163 non specihe esterase kit 164 bovine albumin 22% 165 control for five part cbc analayser ( high ) 166 control for five part cbc analayser ( low ) 167 control for five part cbc analayser ( normal ) 168 csf fluid 169 disposinle sterile urine container 170 edta coated vial with cap and lebal 171 platelet diluting fluid 172 vacutainer edta vial 173 vacutainer sodium citrate 3.2 % vial 174 biochemistry 175 amylase 176 calcium 177 ck mb kit with calibrator 178 ck mb control 179 csf protein control 180 csf protein / urine protein estimation kit with standard / calibrator 181 glucose 182 hba1c kit with calibrator 183 hb1ac control level i and ii 184 hdl kit with calibrator 185 lipase kit with calibrator and control 186 acid phosphatase 187 s.magnecium 188 tips 100 1000 μl 189 tips 10 200 μl 190 vacutainer ( fluoride ) 191 vacutainer serum clot activator 192 micro pipette 100 1000 micro liter 193 micro pipette 1000 micro liter 194 micro pipette 10 100 micro liter 195 sample storage vials ( plastic ) 196 ada with calibrator & control 197 ada with calibrator & control 198 ada with calibrator & control 199 sample cup for auto analyzer ( hitachi cups ) 200 ada with calibrator & control 201 test tube stand...

Medical And Health Services - Rajasthan

26969203 annual rate contract for supply and installation of various chemicals reagents consumable items for department of biochemistry pathology microbiology blood bank i alpha naphthol ar 2 aniline 3 — autoclave indicator strip 4 — bleaching .powder blood culture bottle ( adult ) glass bottle of 100 ml capacit> with lid of aluminum with rubber cork in it. 6 brain heart infusion broth 7 conc. h2so4 — 8 corn meal agar 9 — di sodium hydrogen phosphate dubos medium 10 11 face mask 12 ferric chloride 13 glass marking pencils ( red and hite ) 14 l — arginine 15 l lysine mono dihydrochioride 16 liquid paraffin 17 loeffler serum medium base bovine serum 18 mannitol 19 mannitol salt agur 20 mccartney bottle 21 methyl red powder . microcentritiige lube ith cap 22 capacity 2 ml 23 n acetyl l cysteine 24 n naphthyl ethylene diarninc dihydrochloride n.n.n’..n tetra methy l p2 2? phenylenediarnine dihydrochloride 26 oxacillin powder 27 pertbrated bucket ( red, blue ) 15 litre double bin 28 p11 indicator sirips 6.5 to 9 p1i measurement 29 phenol 30 potassium i ) ih drogen phosphuim dihydrogen phosphate sim agar , simmons citrate agar , , sodium hydroxide pellets , sterile autoclavable skirted plate , sterile ready made plates of blood agar , sterile ready made plates of macconkey agar , sterile readymade plates of nutrient agar , sterile stoorage vial , sterile storage , stool container with spoon , sulphanilamide , triple layer mask disposable , xylose , gram stain kit , vancomycin powder , amphotericin b , cefotetan , cyelopirox , dalfopristine , daptomycin , doripenam , doxycycline , e strip for esbi detection mbl detection , e strip oxacillin , ertapenam , erythromycin , faropenam , fosfomycin , griseofulvin , imipenam , kanamycin , meropenam , netilmycin , oxacillin , piperacillin tazobactoum , piperacillin , polymyxin , pristinomycin , quinopristin teicoplanin , terbinafine , ...

Indian Army - Rajasthan

26099480 procurement of expendable medical stores for 187 mh 1. 170196 kit glucose 2x200 ml ( erba ) 2. 170202 kit urea 20x5 ml ( erba ) 3. 170204 kit creatinine 60x4 ml ( erba ) 4. 170203 uric acid 4x20 ml ( erba ) 5. 170195 kit cholesterol 20x5 ml ( erba ) 6. 171001 kit triglycerides 5x20 ml ( erba ) 7. 170102 kit hdl cholesterol 5x20 ml ( erba ) 8. 171003 kit bilirubin total and direct 5x20 ml ( erba ) 9. niv / 17 snap pack ( roche ) ( roche ) 10. 171008 kit amylase 6x6 ml ( erba ) 11. 171004 kit ggt 12x5 ml ( erba ) 12. 170206 kit sgot 5x20 ml ( erba ) 13. 170207 kit sgpt 5x20 ml ( erba ) 14. 171005 kit ckmb 2x10ml ( erba ) 15. 170073 kit ck ( nac ) 2x10ml ( erba ) 16. niv / 17 kit micro protein ( 1x50ml ) ( erba ) 17. 171009 kit ldh 4x8 ml ( erba ) 18. niv / 01 stromatolyser bott of 500ml ( sysmax ) 19. niv / 17 cell pack 20 litres ( sysmax ) 20. niv / 17 cell clean ( sysmax ) 21. 170330 kit prothrombin time 5ml ( siemens ) 22. 170334n kit pttk 2x5 ml ( siemens ) 23. niv / 17 kit widal 4x5ml ( tulip ) 24. niv / 17 kit crp ( tulip ) 25. niv / 17 kit ra factor ( tulip ) 26. niv / 17 dengu test ( j mitra ) 27. niv / 17 maleria paracheck antigen ( j mitra ) 28. niv / 17 salmonella igg / igm ( ctk ) 29. niv / 17 pregnancy test ( hcg ) ( cipla ) 30. 170156 test hiv rapid ( tri dot ) 31. niv / 17 test hcv rapid ( tri dot ) 32. niv / 17 hbsag rapid test ( tri dot ) 33. niv / 17 vdrl test ( ctk ) 34. niv / 17 urine collection container sterile 35. niv / 17 urine strip ( protein and glucose ) bott of 100 strips ( siemens ) 36. niv / 17 stool for ocult blood rapid card 1x50 ( coral / tulip ) 37. 171006 kit calcium 5x20 ml ( erba ) 38. niv / 17 antisera ab&d 3x10ml ( meril ) 39. niv / 17 lieshmen stain ( ready to use ) bott of 1 ltr ( hi media ) 40. niv / 17 methyline blue stain ( ready to use ) 1x100ml bottle ( ( hi media ) 41. 160419 microscopic slide ( blue star ) pkt of 50 ( blue star ) 42. niv / 17 multi strips 10sg, bott of 100 strips ( siemens ) 43. 170192 keto strips 1x100 strips ( siemens ) 44. niv / 17 swab sticks ( hi media ) 45. 160292n micro tips ( 1x200ul ) 46. 160293n micro tips ( 1x1000ul ) 47. niv / 17 distilled water 48. niv / 17 kit erba wash 5x20ml ( erba ) 49. niv / 17 kit g6pd ( 2x40ml ) ( coral ) 50. 050600 vaccutainer edta, with needle ( bd ) 51. 050605 vaccutainer sodium fluoride, with needle ( bd ) 52. 050603 vaccutainer sterile, with needle ( bd ) 53. niv / 17 vaccutainer sterile with gel, with needle ( bd ) 54. 050604 vaccutainer sodium citrate, with needle ( bd ) 55. niv / 17 cover slip 22x40 ( blue star ) 56. niv / 17 capillary tube bottle of 100 57. niv / 17 ependorf tube 58. 270717 sodium hypochlorite 5% solution 59. niv / 17 ethabol 60. 170077 liquor formaldehyde 40 % 61. niv / 17 methyl alcohol 62. 170005 acetone 63. 011337 glycerine, bott of 500gm 64. niv / 17 gram stain ( hi media ) 65. niv / 17 zn stain ( hi media ) 66. niv / 17 macconkey broth double strength ( hi media ) pack of 0.5kg 67. niv / 17 sysmex thermal paper roll ( sysmex kx 21 ) 68. niv / 17 petri dish disposal ( hi media ) 69. niv / 17 sysmex control ( sysmex ) bott of 4.5ml 70. niv / 17 clead agar, pack of 0.5kg ( hi media ) 71. niv / 17 mha, pack of 0.5kg, ( hi media ) 72. niv / 17 blood agar base, pack of 0.5kg, ( hi media ) 73. niv / 17 macconkey agar, pack of 0.5kg ( hi media ) 74. niv / 17 nutrient agar, pack of 0.5kg ( hi media ) 75. niv / 17 bio red level 1 76. niv / 17 bio red level 2 77. niv / 17 hiv 1 & 2 ( sd ) 78. niv / 17 hbsag ( sd ) 79. niv / 17 hcv ( sd ) 80. niv / 17 antibiotic disc ampicillin, pack of 500 disc ( hi media ) 81. niv / 17 antibiotic disc gentamycin, pack of 500 disc ( hi media ) 82. niv / 17 antibiotic disc amikacin, pack of 500 disc ( hi media ) 83. niv / 17 antibiotic disc ciprofloxacin, pack of 500 disc ( hi media ) 84. niv / 17 antibiotic disc norfloxacin, pack of 500 disc ( hi media ) 85. niv / 17 antibiotic disc nalidixic acid, pack of 500 disc ( hi media ) 86. niv / 17 antibiotic disc nitrofurontoin, pack of 500 disc ( hi media ) 87. niv / 17 antibiotic disc imipenem, pack of 500 disc ( hi media ) 88. niv / 17 antibiotic disc vancomycin, pack of 500 disc ( hi media ) 89. niv / 17 antibiotic disc co trimaxazole, pack of 500 disc ( hi media ) 90. niv / 17 antibiotic disc cefixime, pack of 500 disc ( hi media ) 91. niv / 17 antibiotic disc ceftazidime, pack of 500 disc ( hi media ) 92. niv / 17 antibiotic disc clindamycin, pack of 500 disc ( hi media ) 93. niv / 17 antibiotic disc optichin ( pack of 500 disc ( hi media ) 94. niv / 17 antibiotic disc polymixin b, pack of 500 disc ( hi media ) 95. niv / 17 kit sugar set ready to use ( hi media ) 96. niv / 17 blood culture bottle ready to use ( aerobic ) ( bactech ) 97. niv / 17 lipase kit ( erba ) 98. niv / 17 pap stain ( rapid ) ( bio lab ) 99. niv / 17 kit easy lyte plus solution pack na / k / cl ( medica ) 100. niv / 17 easy lyte plus wash solution , bott of 50ml ( medica ) 101. niv / 17 easy lyte plus cleaning solution, bott of 50ml ( medica ) 102. niv / 17 easy lyte plus urine diluent, bott of 500ml ( medica ) 103. niv / 17 watman filter paper 1500mm 104. niv / 17 kit rapid pap biofix spray ( bio lab ) 105. niv / 17 sodium electrode ( roche ) 106. niv / 17 pottasium electrode ( roche ) 107. niv / 17 reference electrode ( roche ) 108. niv / 17 deproteiniser and conditioner, bott of 25ml ( roche ) 109. niv / 17 esr tube ready to use 110. niv / 17 sulphuric acid ( sp gravity 1.828 1.825 ) 111. niv / 17 acid amyld alcohol 112. niv / 17 erba control ( h 360 ) 113. niv / 17 erba diluent ( h 360 ) , pack of 20ltr 114. niv / 17 erba lyse ( h 360 ) , bott of 500ml 115. niv / 17 erba h clean ( h 360 ) , bott of 50ml 116. niv / 17 erba printer roll 55mm ( h 360 ) 117. 050137 sterile hand gloves, size 6 1 / 2 pair of 118. 050138 sterile hand gloves, size 7 pair of 119. 050139 sterile hand gloves, size 7 1 / 2 pair of 120. 050140 sterile hand gloves size 8 pair of...

Medical And Health Services - Rajasthan

25334358 e tender supply of various diagnosis kits solutions and instruments under m.n.j.y. sikar. 1 hiv microelisa 2 hiv immuno comb 3 hiv ( rapid spot tridot ) 4 hbsag. microelisa 5 hbsag. card 6 hcv microelisa hcv ( hepatitis c ) rapid ( spot test ) method 8 vdrl strip 9 m.p. card antigen 10 disposable test tube plastic 11 e.c.g. roll single / multichannel 12 e.c.g. jelly 13 semi auto roll 14 c.b.c. roll 15 tissue paper roll 16 bovine albumin 19 blood bag sagm tripple 20 blood cuture bottle disposable culture petri dishes with wireloop disposable 22 culture tube disposable 23 culture antibiotic dishes full range blood culture bottle with media nutrient agar mackomeky peptone borth 7 18 blood bag tripple 17 comb’s serum 25 21 25 muler hilton ( m.h. ) agar haemo check strip ( haemogolobinometer strip ) 27 i.d. grouping card 28 liss / coombs microtype cards e.d.t.a. k 3 cbc double cap e.d.t.a. k 4 cbc 30 di water 31 nipple cum sample cups 33 urosticks for uriscan erba lachema 34 glucostrips 35 uristicks 36 multisticks 37 hb pipette square 38 r.b.c. pipette with connecting tube 39 w.b.c. pipette with connecting tube 40 neuebar chamber silver line 41 capillary tube fir c.t. 42 e.s.r. tube c stand tube ( glass tube ) 43 cover slip small large 44 micro slide 76x26x1.15 m 45 filter paper serological test r.a. test crp test asl o test widal test 47 preg card laboratory chemicals required w b c dilution fluid tec dilution fluid seman dilution fluid patlets dilution fluid liesman stain 3.8 % sodium cirate n / 10hcl liquid parafin oil giemosa stain 26 32 vacou containers with needle k3 e.d.t.a. 29 46 48 49 e.s.r stand with tube mnimum and type ( everite top ) 6 or 10 tubes ( 5 number ) 52 blood suger auto analyzer kit 53 blood urea liq. 54 total protin 55 hdl direct 57 ck mb 58 serum albumin 59 serum ldh 60 serum creatinine liq. 61 serum bilirubin t&d 62 serum cholestrol direct 63 serum triglyceride 64 s.g.o.t. 65 sgpt 66 serum amylase 67 serum alkalina phosphatase 68 serum uricacid 69 serum phiosphatase 70 serum calcium 71 dielectric sealar static / mobile unit ( portable ) 72 striperer & sealer manual 73 lancet ( pricking needle ) round shape with plastic top 74 copper sulphate 75 shakker & mixer for vdrl 76 funnel 79 blood collection monitor 80 semi auto analyzer 81 anti hav igm. elisa kit 82 anti hev igm. eliasa 83 typhidot igm elisa 84 viral transport medium ( v.t.m. ) 85 dengue igg / igm rapid card 86 ignittion tube 87 h2s strip test for water quality k 19 88 stool sample container 89 stan ( jsb i ) 51 xylene 50 iodine sultion 56 ck nac 78 anti a 1 lactine 77 anti abd 10 ( monoclonal ) 90 stan ( jsb ii ) 92 keto dia sticks 93 torniquate belt 94 blue tips 95 yellow tips 96 urine container 97 k2 edta vial 98 grams stain 99 ziemsa powder 100 methenol 101 glycerin 102 handdis infacted / hand santizer 103 bandaid 104 vacutainer needle 105 gramstain 106 syring needle destroyer 107 thermometer range 0 1000c, 108 oxidase strip from himedia 109 ph strip 110 glase ( borosil ) petriplate 90 mm glase tube size 10 cm * 1.5 cm 112 conical flask size 250 ml 114 1000 ml 116 micropipette 10 – 100 microliter 117 micropipette 100 – 1000 microliter 118 spatula ¼yksgs okyk½ 119 aluminium foil 120 weiging paper 121 staining rod 122 staining bottle with dispenser 123 spirit lamp 124 mr reagent ( methyl red reagent ) 125 fecl3 126 sodium hypochlorite 10% 127 mackonkey broth ( single strength ) 129 disposable sterilized petriplate glase tube size 15 cm * 125 mm 131 conical flask size 500 ml 91 glass slide 113 500 ml 111 128 mackonkey broth ( double strength ) 115 micropipette size 5 – 50 microliter 130 136 isopropyl alchohal 137 rubber band ( large size ) disposable syringe 2 ml disposable syringe 3 ml disposable syringe 5 ml disposable syringe 10 ml 139 white tips ( 1000 micro ltr. ) 140 sample collection bottle ( water ) narrow mounted natural boro cillicate glass, capacity 1000 ml 141 bgb medium ( brilliant green bile borth medium ) 1 kg. 142 glass pipette size 1 ml with bubbles 2 nos. 143 glass pipette size 5 ml with bubbles 2 nos. 144 glass pipette size 10 ml with bubbles 2 nos. 145 auto clave chemical indicator 146 ortho tolidine soluton for residual chlorine 147 test tube stand 48 hole 148 h2s strip test for water quality ( prepared bottle ) from himedia 149 vdrl rotator 150 centrifuge machine 16 channel ( for city dispensary ) 151 erba xlalbumin 154 erba xl bilirubin direct 155 erba xl bilirubin total 156 erba xl calcium 157 erba xl cholesterol 158 erba xl ck nac 159 erba xl ck mb 132 dettol 135 indole reagent ( high media ) 134 nutrient agar prepared plate 133 scrub typhus elisa igm anti body ( imbios ) 138 153 erba xl amylase 152 erba xl alkaline phosphatase...

Medical And Health Services - Rajasthan

24700268 annual rate contract for supply and installation of various chemicals & reagents & consumable items for department of microbiology absolute ethanol, acctone, afb, agar powder, alber stain, alkaline peptone water, alpha naphthol ar, aniline, anti hbc, autoclave indicator strip, biodegradable plastic bags, bleaching powder, blood agar base, blood culture bottle, glass bottle, lid with aluminium with tubber cork, brain heart infusion broth, repid test kit, cled media, corn meal agar, cover slip, crp test kit, cytomegalovirus, deinoized water, dengue nsi antigen elisa kit, dengue rapid test card, deocychlolate citrate agar, di sodium hydrogen phosphage, disposable individual packed centrifugal tube conical bottom capacity, dubos medium, ecoshield, face mask, ferric chloride, filter paper, box, filter paper sheet, formalin pellets, glass marking pencils, glass test tube, h202, hav igm elisa, koh pellets, kovks indole reagents, l arginite, liquid paraffin, loeffler serum medium base bovine, maconkey broth, malariya rapid test card, maltose, mannitol salt agar, meropenam, moxalactum, nalidixid acid, novobiocin nystatin, ofloxacin, onpg, optochin, piperacillin, piperacillin, teicoplanin, terbinafine, tobramycine, x v factor, x factor, immersion oil, occuet blood, hcv igm rapid card, micro pipette tips,...

Rajasthan University Of Health Science - Rajasthan

24693213 annual rate contract for supply and installation of various chemicals and regents and consumable items for department of microbiology 2 absolute ethanol 3 acetone 4 afb (zn acid fast kit) 5 agar powder (bacteriological grade) 6 albert’s stain (a+b each) 7 alkaline peptone water 8 anaerobic system envelope with palladium catalyst (gas pak) 9 alpha naphthol ar 10 aniline 11 anti hbc igm elisa kit 12 anti hbe ab elisa test 13 anti hbs antibody elisa test kit 14 antinuclear antibody (ana) elisa kit 15 autoclave indicator strip 16 biodegradable plasic bags (yellow, red, blue, black) 17 bleaching powder 18 blood agar base 19 blood culture bottle (adult) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 20 brain heart infusion broth 21 chikungunya rapid test kit for igm 22 chlamydia trachomatis igm elisa kit 23 cled media 24 conc. h2so4 25 corn meal agar 26 cover slips 22 x 22 mm 27 crp test kit 28 cytomegalovirus (cmv) igg elisa kit 29 cytomegalovirus (cmv) igm elisa kit 30 deionized water 31 dengue ns1 antigen elisa kit 32 dengue rapid test card 33 dengue rapid test card along with ns1 antigen 34 deoxycholate citrate agar 35 di sodium hydrogen phosphate 36 discarding plastic buckets (yellow, red, blue, black) 20 litre 37 disposable individually packed centrifuge tube conical bottom capacity 50 ml 38 disposable polythene gloves 39 disposable sterile test tube with swab individually packed 40 dubos medium 41 ecoshield 42 edta powder 43 face mask 44 ferric chloride 45 filter paper box whartman no. 1, 12.5 cm circular 46 filter paper sheet whartman no. 1 47 fluid thioglycollate broth (anaerobic) with indicator 48 formalin pellets 49 glass marking pencils (red, white) 50 glass test tube 100 mm x 12 mm without rim 51 glass test tube 75 mm x 12 mm without rim 52 h2o2 (30%) 53 hav igm elisa kit 54 hcv igm elisa kit 55 hev igm elisa kit 56 koh pellets 57 kovcks indole reagents 58 l arginine 59 l lysine mono dihydrochloride 60 lactophenol cotton blue solution 61 liquid paraffin 62 loeffler serum medium base bovine serum 63 lowenstein jensen medium 64 macconkey agar 65 macconkey broth 66 malaria rapid test card (antigen) 67 maltose 68 mannitol 69 mannitol salt agar 70 mccartney bottle 71 methyl red powder 72 microcentrifuge tube with cap capacity 2 ml 73 mr vp medium (glucose phosphate broth) 74 muller hinton agar 75 n acetyl l cysteine 76 n naphthyl ethylene diamine dihydrochloride 77 n,n,n,n tetra methyl p phenylenediamine dihydrochloride 78 nigrosin 10% 79 nutrient agar 80 oxacillin powder 81 oxidase disc 82 peptone water 83 perforated bucket (red, blue) 15 litre double bin 84 petridish glass 100 mm 85 petridish glass 75 mm 86 ph indicator strips 6.5 to 9 ph measurement 87 phenol 88 pottasium dihydrogen phosphate 89 pregnancy test card 90 ra factor kit 91 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 92 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 93 robertson cooked meat medium readymade 94 rpr rapid test card 95 sabraud’s dextrose agar 96 selenite f broth bacteriological 97 sim agar 98 simmons citrate agar 99 sodium chloride 100 sodium hydroxide pellets 101 sodium hypochlorite solution 102 sterile autoclavable skirted plate 96 wells x 0.3 ml 103 sterile readymade plates of blood agar (90 mm size) 104 sterile readymade plates of macconkey agar (90 mm size) 105 sterile readymade plates of nutrient agar (90 mm size) 106 sterile storage vial 2 ml capacity 107 sterile storage vial 5 ml capacity 108 sterile transport medium (stuart medium) with test tube and swab individually packed 109 stool container with spoon 110 sulphanilamide 111 tcbs 112 triple layer mask disposable 113 trypticase soya broth 114 tsi agar 115 urea agar base 116 viral transport medium with dacron swab (d/s 2 nos. each vtm tube 117 widal slide test 118 wilson and blair medium 119 xylene 120 xylose 121 ds dna elisa kit 122 gram stain kit 123 hbeag elisa kit 124 herpes simplex virus (hsv 1 & 2) igg elisa kit 125 herpes simplex virus (hsv 1 & 2) igm elisa kit 126 resazurin powder 127 rubella igg elisa kit 128 rubella igm elisa kit 129 sterile readymade plates of dca (90mm size) 130 sterile readymade plates of tcbs (90mm ) 131 toxoplasma igg elisa kit 132 scrb typhus igm elisa kit 133 toxoplasma igm elisa kit 134 vancomycin powder 135 vancomycin disc 136 amikacin 30 µg 137 amoxycillin 30 µg 138 amoxyclav 20/10 µg 139 amphotericin b 140 ampicillin + sulbactum 141 azithromycin 15 µg 142 aztreonam 30µg 143 bacitracin (0.04 unit) 144 bile esculin disc 145 cefepime 30 µg 146 cefixime 5 µg 147 cefoperazone + sulbactum 75/10 µg 148 cefoperazone 75 µg 149 cefotaxime 30 µg 150 cefotetan 151 cefoxitin 30 µg 152 cefpirome 153 cefpodoxime 10 µg 154 ceftazidime + clavulanic acid 30/10µg 155 ceftazidime 30 µg 156 ceftriaxone 30 µg 157 cefuroxime 30 µg 158 cephalexin 30 µg 159 chloramphenicol 30 µg 160 ciprofloxacin 5 µg 161 clarithromycin 15 µg 162 clindamycin 2 µg 163 clotrimazole 164 colistin 165 cotrimoxazole 25 µg 166 cyclopirox 50 µg 167 dalfopristine 168 daptomycin 169 doripenam 10µg 170 doxycycline 30 µg 171 e strip for esbl detection 172 e strip for mbl detection 173 e strip oxacillin 174 ertapenam 10µg 175 erythromycin 10 µg 176 faropenam 177 fluconazole 25 µg 178 fosfomycin 200 µg 179 furazolidone 50 µg 180 fusidic acid 181 gentamicin 120µg 182 gentamicin 30µg 183 gentamycin 10 µg 184 griseofulvin 10 µg 185 hippurate 186 imipenam 10 µg 187 itraconazole 8 µg 188 kanamycin 189 ketoconazole 15 µg 190 levofloxacin 5µg 191 lincomycin 10 µg 192 linezolid 30 µg 193 meropenam 10 µg 194 miconazole 10 µg 195 moxalactum 196 nalidixic acid 30µg 197 netilmycin 30 µg 198 nitrofurantoin 300 µg 199 norfloxacin 10 µg 200 novobiocin 201 nystatin 202 ofloxacin 5 µg 203 onpg 204 optochin 205 oxacillin 1 µg 206 piperacillin + tazobactum 100/10 µg 207 piperacillin 100 µg 208 polymyxin b 30 units 209 pristinomycin 15µg 210 quinopristin 211 teicoplanin 30 µg 212 terbinafine 1 µg 213 tetracycline 30 µg 214 ticarcillin+clavulanic acid 75/10 µg 215 ticarcillin75µg 216 tigecyclin 15µg 217 tobramycin 10 µg 218 v factor 219 vancomycin 30 µg 220 voriconazole 1 µg 221 x + v factor 222 x factor 223 immersion oil 224 occuet blood on stool kit hemoccult sensa aninophezone test 225 hcv igm rapid card 226 micro pipette tips 200 micro liter 227 micro pipette tips 1000 micro liter 228 micro pipette tips 10 micro liter ...

Rajasthan University Of Health Science - Rajasthan

23529414 nit for annual rate contract of various chemicals & reagents and consumable items for central lab (biochemistry, pathology & microbiology) dept. at hospital of ruhs college of medical sciences, jaipur dengue test elisa for igm 3 dengue test elisa for igg 4 dengue test elisa for ns1 antigen 5 chikungunya test elisa for igm 6 toxoplasma igm elisa 7 toxoplasma igg elisa 8 cytomegalovirus igm elisa 9 cytomegalovirus igg elisa 10 rubella igm elisa 11 rubella igg elisa 12 herpes simplex 1 & 2 igm elisa 13 herpes simplex 1 & 2 igg elisa 14 scrub typhus igm elisa 15 hepatitis a igm elisa 16 hbsag elisa 17 anti hbs elisa 18 hbeag elisa 19 anti hbe elisa 20 anti hbc igm elisa 21 anti hbc igg elisa 22 hepatitis e igm elisa 23 chikungunya rapid test card for igm 24 dengue rapid test card for igm, igg and ns1 antigen 25 tissue roll 26 disposable polyethylene gloves 27 disposable petridish 100 mm ( individually packed ) 28 albert stain ( a + b each ) 29 antinuclear antibody ( ana ) elisa 30 ds dna elisa 31 chlamydia trachomatis igm elisa 32 cled media 33 corn meal agar 34 disposable individually packed centrifuge tube conical bottom 50 ml capacity 35 disposable sterile swab ( individually packed ) 36 thioglycollate medium 37 hcv igm elisa 38 hcv rapid test card 39 india ink 40 occult blood test for stool sample 41 sabouraud dextrose agar 42 urea ( 40% ) solution 43 edta vial 44 diamond pencil 45 pregnancy test card 46 vdrl rapid kit 47 hiv rapid kit 48 z.n. kit for afb 49 kits for ra factor 50 kits for crp 51 kits for aslo 52 kits for hbsag 53 kits for dengue ( for igm and igg ) 54 kits for malaria antigen test 55 kits for widal test ( kit of 5 ml of each antigen ) 56 absolute alcohol 57 methanol ar 58 filter paper 59 distilled water 60 immersion oil for microscopy 61 glass slide 75x25x1.33 mm 62 urine / sputum container plastic 63 cover slip 22x22 mm 64 plain tube 65 tips 100 1000 μl 66 tips 10 200 μl 67 vacutainer serum ( clot activator ) 68 sample storage vials ( plastic ) 69 acetone 70 autoclave indicator strip 71 blood agar base 72 blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 73 brain heart infusion broth 74 disposable sterile test tube with swab individually packed 75 ecoshield 76 face mask 77 filter paper sheet whartman no. 1 78 glass test tube 100 mm x 12 mm without rim 79 glass test tube 75 mm x 12 mm without rim 80 h2o2 ( 30% ) 81 koh pellets 82 kovcks indole reagents 83 liquid paraffin 84 macconkey agar 85 macconkey broth 86 mannitol salt agar 87 mccartney bottle 88 microcentrifuge tube with cap capacity 2 ml 89 mueller hinton agar 90 n, n, n, n tetra methyl p phenylenediamine dihydrochloride 91 nutrient agar 92 oxidase disc 93 peptone water 94 petridish glass 100 mm 95 petridish glass 75 mm 96 ph indicator strips 6.5 to 9 ph measurement 97 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 98 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 99 selenite f broth bacteriological 100 sim agar 101 simmons citrate agar 102 sodium chloride 103 sodium hydroxide pellets 104 sterile storage vial 2 ml capacity 105 sterile storage vial 5 ml capacity 106 sterile transport medium ( stuart medium ) with test tube and swab individually packed 107 stool container with spoon 108 triple layer mask 109 tsi agar 110 urea agar base 111 viral transport medium 112 gram stain kit 113 amikacin 30 μg 114 amoxycillin 30 μg 115 amoxyclav 20 / 10 μg 116 ampicillin + sulbactum 117 amphotericin b 118 azithromycin 15 μg 119 aztreonam 30μg 120 bacitracin ( 0.04 unit ) 121 bile esculin disc 122 cefepime 30 μg 123 cefixime 5 μg 124 cefoperazone + sulbactum 75 / 10 μg 125 cefoperazone 75 μg 126 cefotaxime 30 μg 127 cefotetan 128 cefoxitin 30 μg 129 cefpirome 130 cefpodoxime 10 μg 131 ceftazidime + clavulanic acid 30 / 10μg 132 ceftazidime 30 μg 133 ceftriaxone 30 μg 134 ceftriaxone + clavulanic acid 30 / 10μg 135 cefuroxime 30 μg 136 cephalexin 30 μg 137 chloramphenicol 30 μg 138 ciprofloxacin 5 μg 139 clarithromycin 15 μg 140 clindamycin 2 μg 141 clotrimazole 142 colistin 143 cotrimoxazole 25 μg 144 doripenam 10μg 145 doxycycline 30 μg 146 ertapenam 10μg 147 erythromycin 10 μg 148 faropenam 149 fluconazole 150 flucytosine 151 fosfomycin 200 μg 152 furazolidone 50 μg 153 fusidic acid 154 gentamicin 120μg 155 gentamicin 30μg 156 gentamycin 10 μg 157 hippurate 158 imipenam 10 μg 159 imipenam + edta 160 itraconazole 161 kanamycin 162 ketoconazole 15 μg 163 levofloxacin 5μg 164 lincomycin 10 μg 165 linezolid 30 μg 166 meropenam 10 μg 167 moxalactum 168 nalidixic acid 30μg 169 netilmycin 30 μg 170 nitrofurantoin 300 μg 171 norfloxacin 10 μg 172 novobiocin 173 nystatin 174 ofloxacin 5 μg 175 onpg 176 optochin 177 oxacillin 1 μg 178 piperacillin + tazobactum 100 / 10 μg 179 piperacillin 100 μg 180 polymyxin b 30 units 181 pristinomycin 15μg 182 teicoplanin 30 μg 183 tetracycline 30 μg 184 ticarcillin+clavulanic acid 75 / 10 μg 185 ticarcillin75μg 186 tigecyclin 15μg 187 tobramycin 10 μg 188 v factor 189 vancomycin 30 μg 190 voriconazole 1 μg 191 x + v factor 192 x factor 193 dept. of pathology 194 combi stick urine strips 195 leishmans stain 196 buffer for leishman stain ph6.8 197 anti – a ( monoclonal ) 10ml 198 anti – b ( monoclonal ) 10ml 199 anti – d ( monoclonal ) 10ml 200 trisodium citrate 3.8% 201 pt test kits 202 aptt test kits 203 ethanol lr 204 methanol lr 205 distilled water 206 csf diluting fluid 207 wbc diluting fluid 208 immersion oil for microscopy 209 hypochlorite solution 210 glass test tube 100 mm x 12 mm without rim 211 glass test tube 75 mm x 12 mm without rim 212 spirit 213 gauze roll 214 disposable syringe 2ml 215 disposable syringe 5ml 216 disposable syringe 10ml 217 disposable syringe 20ml 218 disposable needle 22g 219 disposable gloves latex 7½ inch 220 disposable gloves latex 7 inch 221 disposable gloves latex 6 inch 222 tourniquet 223 cotton roll 224 edta vial 225 lancet 226 adhesive tap 2 inch roll 227 2.5% sodium hypochlorite 228 40% formaldehyde formalin 229 tissue paper rolls 230 glass slide 75x25x1.33 mm 231 pasture pipettes with rubber teat ( 10 ml ) 232 urine container plastic 233 cover slip 20x20 mm 234 filter paper watsman 1x90mm 235 disposable esr pipette 236 capillary tube for ct 237 tips 100 1000 μl 238 tips 10 200 μl 239 face mask 240 test tube plastic 5 ml for esr 241 dept. of biochemistry 242 albumin 243 acid phosphatase 244 alk phasphate 245 amylase 246 alt ( sgpt ) 247 ast ( sgot ) 248 blood urea 249 bilirubin total 250 bilirubin direct 251 calcium 252 cholesterol 253 hdl kit with calibrator an qc 254 creatinine 255 glucose 256 ck mb kit with calibrator 257 ck nac 258 hba1c kit with calibrator 259 t. protein 260 s.magnecium 261 triglycerides 262 s. ldh 263 uric acid 264 serum phosphorous 265 lipase kit with calibrator 266 ggt 267 csf protein 268 csf protein control 269 ck mb control 270 hb1ac control level i and ii 271 multi calibrator 3 272 quality control ( normal ) level 2 273 quality control ( pathological / abnormal ) level 3 274 hypochlorite solution 275 methonol 70% 276 aliquot tubes up to 1.0 ml 277 plain tube without cap 278 plain tube with cap 279 tips 100 1000 μl 280 tips 10 200 μl 281 vacutainer ( fluoride ) 282 vacutainer serum clot activator 283 sample storage vials ( plastic ) 284 tissue paper rolls 285 distilled water...

Rajasthan University Of Health Science - Rajasthan

23489221 nit for annual rate contract of various chemicals and reagents and consumable items for central lab at ruhs hospital of medical sciences , jaipur 2 dengue test elisa for igm 3 dengue test elisa for igg 4 dengue test elisa for ns1 antigen 5 chikungunya test elisa for igm 6 toxoplasma igm elisa 7 toxoplasma igg elisa 8 cytomegalovirus igm elisa 9 cytomegalovirus igg elisa 10 rubella igm elisa 11 rubella igg elisa 12 herpes simplex 1 & 2 igm elisa 13 herpes simplex 1 & 2 igg elisa 14 scrub typhus igm elisa 15 hepatitis a igm elisa 16 hbsag elisa 17 anti hbs elisa 18 hbeag elisa 19 anti hbe elisa 20 anti hbc igm elisa 21 anti hbc igg elisa 22 hepatitis e igm elisa 23 chikungunya rapid test card for igm 24 dengue rapid test card for igm, igg and ns1 antigen 25 tissue roll 26 disposable polyethylene gloves 27 disposable petridish 100 mm ( individually packed ) 28 albert stain ( a + b each ) 29 antinuclear antibody ( ana ) elisa 30 ds dna elisa 31 chlamydia trachomatis igm elisa 32 cled media 33 corn meal agar 34 disposable individually packed centrifuge tube conical bottom 50 ml capacity 35 disposable sterile swab ( individually packed ) 36 thioglycollate medium 37 hcv igm elisa 38 hcv rapid test card 39 india ink 40 occult blood test for stool sample 41 sabouraud dextrose agar 42 urea ( 40% ) solution 43 edta vial 44 diamond pencil 45 pregnancy test card 46 vdrl rapid kit 47 hiv rapid kit 48 z.n. kit for afb 49 kits for ra factor 50 kits for crp 51 kits for aslo 52 kits for hbsag 53 kits for dengue ( for igm and igg ) 54 kits for malaria antigen test 55 kits for widal test ( kit of 5 ml of each antigen ) 56 absolute alcohol 57 methanol ar 58 filter paper 59 distilled water 60 immersion oil for microscopy 61 glass slide 75x25x1.33 mm 62 urine / sputum container plastic 63 cover slip 22x22 mm 64 plain tube 65 tips 100 1000 μl 66 tips 10 200 μl 67 vacutainer serum ( clot activator ) 68 sample storage vials ( plastic ) 69 acetone 70 autoclave indicator strip 71 blood agar base 72 blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 73 brain heart infusion broth 74 disposable sterile test tube with swab individually packed 75 ecoshield 76 face mask 77 filter paper sheet whartman no. 1 78 glass test tube 100 mm x 12 mm without rim 79 glass test tube 75 mm x 12 mm without rim 80 h2o2 ( 30% ) 81 koh pellets 82 kovcks indole reagents 83 liquid paraffin 84 macconkey agar 85 macconkey broth 86 mannitol salt agar 87 mccartney bottle 88 microcentrifuge tube with cap capacity 2 ml 89 mueller hinton agar 90 n, n, n, n tetra methyl p phenylenediamine dihydrochloride 91 nutrient agar 92 oxidase disc 93 peptone water 94 petridish glass 100 mm 95 petridish glass 75 mm 96 ph indicator strips 6.5 to 9 ph measurement 97 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 98 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 99 selenite f broth bacteriological 100 sim agar 101 simmons citrate agar 102 sodium chloride 103 sodium hydroxide pellets 104 sterile storage vial 2 ml capacity 105 sterile storage vial 5 ml capacity 106 sterile transport medium ( stuart medium ) with test tube and swab individually packed 107 stool container with spoon 108 triple layer mask 109 tsi agar 110 urea agar base 111 viral transport medium 112 gram stain kit 113 amikacin 30 μg 114 amoxycillin 30 μg 115 amoxyclav 20 / 10 μg 116 ampicillin + sulbactum 117 amphotericin b 118 azithromycin 15 μg 119 aztreonam 30μg 120 bacitracin ( 0.04 unit ) 121 bile esculin disc 122 cefepime 30 μg 123 cefixime 5 μg 124 cefoperazone + sulbactum 75 / 10 μg 125 cefoperazone 75 μg 126 cefotaxime 30 μg 127 cefotetan 128 cefoxitin 30 μg 129 cefpirome 130 cefpodoxime 10 μg 131 ceftazidime + clavulanic acid 30 / 10μg 132 ceftazidime 30 μg 133 ceftriaxone 30 μg 134 ceftriaxone + clavulanic acid 30 / 10μg 135 cefuroxime 30 μg 136 cephalexin 30 μg 137 chloramphenicol 30 μg 138 ciprofloxacin 5 μg 139 clarithromycin 15 μg 140 clindamycin 2 μg 141 clotrimazole 142 colistin 143 cotrimoxazole 25 μg 144 doripenam 10μg 145 doxycycline 30 μg 146 ertapenam 10μg 147 erythromycin 10 μg 148 faropenam 149 fluconazole 150 flucytosine 151 fosfomycin 200 μg 152 furazolidone 50 μg 153 fusidic acid 154 gentamicin 120μg 155 gentamicin 30μg 156 gentamycin 10 μg 157 hippurate 158 imipenam 10 μg 159 imipenam + edta 160 itraconazole 161 kanamycin 162 ketoconazole 15 μg 163 levofloxacin 5μg 164 lincomycin 10 μg 165 linezolid 30 μg 166 meropenam 10 μg 167 moxalactum 168 nalidixic acid 30μg 169 netilmycin 30 μg 170 nitrofurantoin 300 μg 171 norfloxacin 10 μg 172 novobiocin 173 nystatin 174 ofloxacin 5 μg 175 onpg 176 optochin 177 oxacillin 1 μg 178 piperacillin + tazobactum 100 / 10 μg 179 piperacillin 100 μg 180 polymyxin b 30 units 181 pristinomycin 15μg 182 teicoplanin 30 μg 183 tetracycline 30 μg 184 ticarcillin+clavulanic acid 75 / 10 μg 185 ticarcillin75μg 186 tigecyclin 15μg 187 tobramycin 10 μg 188 v factor 189 vancomycin 30 μg 190 voriconazole 1 μg 191 x + v factor 192 x factor 193 dept. of pathology 194 combi stick urine strips 195 leishmans stain 196 buffer for leishman stain ph6.8 197 anti – a ( monoclonal ) 10ml 198 anti – b ( monoclonal ) 10ml 199 anti – d ( monoclonal ) 10ml 200 trisodium citrate 3.8% 201 pt test kits 202 aptt test kits 203 ethanol lr 204 methanol lr 205 distilled water 206 csf diluting fluid 207 wbc diluting fluid 208 immersion oil for microscopy 209 hypochlorite solution 210 glass test tube 100 mm x 12 mm without rim 211 glass test tube 75 mm x 12 mm without rim 212 spirit 213 gauze roll 214 disposable syringe 2ml 215 disposable syringe 5ml 216 disposable syringe 10ml 217 disposable syringe 20ml 218 disposable needle 22g 219 disposable gloves latex 7½ inch 220 disposable gloves latex 7 inch 221 disposable gloves latex 6 inch 222 tourniquet 223 cotton roll 224 edta vial 225 lancet 226 adhesive tap 2 inch roll 227 2.5% sodium hypochlorite 228 40% formaldehyde formalin 229 tissue paper rolls 230 glass slide 75x25x1.33 mm 231 pasture pipettes with rubber teat ( 10 ml ) 232 urine container plastic 233 cover slip 20x20 mm 234 filter paper watsman 1x90mm 235 disposable esr pipette 236 capillary tube for ct 237 tips 100 1000 μl 238 tips 10 200 μl 239 face mask 240 test tube plastic 5 ml for esr 241 dept. of biochemistry 242 albumin 243 acid phosphatase 244 alk phasphate 245 amylase 246 alt ( sgpt ) 247 ast ( sgot ) 248 blood urea 249 bilirubin total 250 bilirubin direct 251 calcium 252 cholesterol 253 hdl kit with calibrator an qc 254 creatinine 255 glucose 256 ck mb kit with calibrator 257 ck nac 258 hba1c kit with calibrator 259 t. protein 260 s.magnecium 261 triglycerides 262 s. ldh 263 uric acid 264 serum phosphorous 265 lipase kit with calibrator 266 ggt 267 csf protein 268 csf protein control 269 ck mb control 270 hb1ac control level i and ii 271 multi calibrator 3 272 quality control ( normal ) level 2 273 quality control ( pathological / abnormal ) level 3 274 hypochlorite solution 275 methonol 70% 276 aliquot tubes up to 1.0 ml 277 plain tube without cap 278 plain tube with cap 279 tips 100 1000 μl 280 tips 10 200 μl 281 vacutainer ( fluoride ) 282 vacutainer serum clot activator 283 sample storage vials ( plastic ) 284 tissue paper rolls 285 distilled water...

Medical College - Rajasthan

23395092 supply of disposable items used for laboratory testing anti sera ( blood bank ) part c 1 1 plain disposable screw cap and round bottom, blood collection vial / test tube of size 13x110 mm with prefixed white label of good quality item1 1 each pkt. of 100 vial 2 2 edta k2 screw cap disposable screw cap and round bottom, blood collection vial / test tube of size of 13x110 mm with prefixed label of good quality item2 1 each pkt. of 100 vial 3 3 vaccutainer nplain plastic disposable caped and round bottom, blood collection test tube of size 13x110 mm with prefixed white label of good quality item3 1 each pkt. of 100 vial 4 4 vaccutainer nedta k2 plastic disposable caped and round bottom, blood collection vial / test tube of size of 13x110 mm with prefixed label of good quality item4 1 each pkt. of 100 vial 5 5 normal saline for laboratory use item5 1 5 ltr. jar 6 6 yellow tips of approved quality item6 1 each pkt. of 1000 tips 7 7 blue tips of approved quality item7 1 each pkt. of 500 tips 8 8 liquid soap for hand washing with dispenser item8 1 500 ml 9 9 sodium hypochlorite soln.lr item9 1 5 ltr. 10 10 auto disable blood lancets, with protective guard item10 1 each pkt. of 100 piece 11 11 disposable adhesive fabric plaster strip item11 1 each pkt. of 100 piece 12 12 disposable sprit swab big size item12 1 each pkt. of 100 piece 13 13 disposable swab stick big size ( 15 cm long ) item13 1 each pkt. of 100 piece 14 14 cross match and blood grouping tiles item14 1 each 15 15 tissue paper roll of size 110x100 mm and weight 100 gm item15 1 each 16 16 polythylene disposable gloves packet ( free size ) item16 1 each pkt. of 100 gloves 17 17 permanent marker pen. ( for the numbering of blood bags / test tube ) . item17 1 each pkt. of 10 marker 18 18 kitchen scale for the measurement of 2 kg weight item18 1 each piece 19 19 single piece molded glass filed polycarbonated tray for the storage of frozen plasma in 80 degree centigrade temperature. item19 1 each 20 20 single piece molded glass filed polycarbonated tray for the storage of frozen plasma in 80 degree centigrade temperature. item20 1 each 21 21 povidone iodine spray for phlebotomy ( 200ml packing ) item21 1 each 22 22 antiseptic spray for phlebotomy ( 200ml packing ) item22 1 each 23 23 disposable thermocol boxes with prefixed specified label ( for blood / component bags supply ) item23 1 each 24 24 disposable biodegradable printed carry bags ( as per specification ) item24 1 each 25 25 ready to use blood culture bottles with liquid bhi broth media. item25 1 each 26 26 estimation of factor 8 and fibrogen level in given blood plasma sample. item26 1 per test...

Medical College - Rajasthan

23352813 item4 supply of disposable items used for laboratory testing anti sera (blood bank) part c plain disposable screw cap and round bottom, blood collection vial/test tube of size 13x110 mm with prefixed white label of good quality, edta k2 screw cap disposable screw cap and round bottom, vaccutainer plain plastic disposable caped and round bottom blood collection test tube, normal saline for laboratory use, yellow tips, blue tips, liquid soap, sodium hypochlorite soal lr, auto disable blood lancet with protective guard, disposable adhesive fabric plaster strip, disposable sprit swab, cross and blood grouping tiles, tissue paper roll, polythylene disposable gloves packet, permanent marker pen, kitchen scale, single piece molded glass filed polycarbonated tray, povidone iodine spray, antiseptic spray, disposble thremocol boxes with prefixed specified label blood/components bags, disposable biodegradable printed carry bags, ready to use blood culture bottle with liquid bh1 broth media, estimation of factor 8 and fibrogen level in given blood plasma sample...

Government Medical College - Rajasthan

23054639 supply of chemical and reagents for microbiology lab : rate contract for 02 years 1 oxalic acid ( powder ) ( 500 gm ) 2 sodium hypochlorite ( liquid 10% ) solution ( 35 lt ) 3 acetone ( 500 ml ) 4 liquid ammonia ( 500 ml ) 5 absolute alcohol ( 500 ml ) 6 ammonium sulphate ( 500 gm ) 7 glacial acetic acid ( 500 ml ) 8 urea powder ( 500 gm ) 9 paradimethyl amino benzaldehyde ( 100 gm ) 10 ammonium oxalate crystals ( 500 gm ) 11 actidione ( 1 gm ) 12 phenyl crystal ( 500 gm ) 13 ferric ammonium sulphate ( 100 gm ) 14 di sodium hydrogen phosphate ( na2hpo4 ) ( 100 gm ) 15 sodium hydrogen phosphate ( nah2po4 ) ( 100 gm ) 16 sulphuric acid conc. ( 5 lt ) 17 nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) ( 5 gm ) 18 basic carbolfuschin powder ( practical grade ) ( 100 gm ) 19 barium chloride ( 100 gm ) 20 glycerol ( 500 ml ) 21 glucose anhydrous ( 500 gm ) 22 iso amyl alcohol ( 500 ml ) 23 malachite green ( practical grade ) ( 100 gm ) 24 sodium nitrite ( 100 gm ) 25 sulphanililc acid ( 100 gm ) 26 toluidine blue ( 100 gm ) 27 magnesium sulphate ( mgso4.7h2o ) ( 100 gm ) 28 n acetyl l cystine ( 25 gm ) 29 formaldehyde solution 40 % ( 5 lt ) 30 nigrocin ( himedia ) ( 100 gm ) 31 koh pallets ( 500 gm ) 32 naoh pallets ( 500 gm ) 33 concentrated hcl ( 500 ml ) 34 albert’s stain a and b for diphtheria ( staining solution ) ( 100 ml ) 35 brilliant cresyl blue ( 100 ml ) 36 liquid paraffin ( 500 ml ) 37 sodium acetate ( 500 gm ) 38 sodium sulphite ( 500 gm ) 39 sodium carbonate ( 500 gm ) 40 potassium bromide ( 500 gm ) 41 sodium thiosulphate ( 500 gm ) 42 spirit ( 500ml ) 43 poly vinyl alcohol ( 250ml ) 44 ammonium chloride ( 500 gm ) 45 sodium meta bisulphite ( 500 gm ) 46 sodium bicarbonate extra pure ( 500 gm ) 47 crystal violet ( practical grade ) ( 100 gm ) 48 bromothymol blue powder ( 25 gm ) 49 cetylpyridinium chloride ( 100 gm ) 50 alpha naphthylamine ( 100 gm ) 51 sodium deoxycholate ( 100 gm ) 52 magnesium citrate ( 500 gm ) 53 asparagine ( 5 gm ) 54 sodium citrate ( 500 gm ) 55 lactophenol ( cotton blue ) ( 100 ml ) 56 omera reagent / v p reagent ( 100 ml ) 57 potassium tellurite ( 25 gm ) 58 ferric chloride ( 500 gm ) 59 cyanogen bromide ( 100 gm ) 60 andrade’s indicator ( 125 ml ) 61 dimethyl sulphoxide ( dmso ) ( 500 ml ) 62 iodine crystal ( 500 gm ) 63 potassium idodide ( 250 gm ) 64 safarnine ( 100 gm ) 65 neutral red ( 100 gm ) 66 dpx mount ( 250 ml ) 67 paradimethylaminocinnamaldehyde ( 100 gm ) 68 hydrogen peroxide ( h2o2 ) ( 100 ml ) 69 alpha – naphthalamine ( 100 gm ) 70 sodium hippurate ( 100 gm ) 71 alpha – naphthol ( 100 gm ) 72 creatinine ( 100 gm ) 73 l – pyrolidonyl b – nephthalamide ( 50 gm ) 74 gelatin ( 500 gm ) 75 sodium borohydrate ( 100 gm ) 76 cobalt chloride ( 100 gm ) 77 agarrose with high eeo ( 100 gm ) 78 dextrose anhydrous ( 500 gm ) 79 lactose ( 500 gm ) 80 maltose ( 500 gm ) 81 mannitol ( 500 gm ) 82 dulcitol ( 500 gm ) 83 sucrose ( 500 gm ) 84 xylose ( 500 gm ) 85 arabinose ( 500 gm ) 86 sorbitol ( 500 gm ) 87 schaudinns solution ( 250 ml ) 88 microsporidiatrichome blue stain ( 250 ml ) 89 merthiolate iodine formalin ( 250 ml ) 90 chloroform ( 500 ml ) 91 formamide ( 500 ml ) 92 methylene blue ( 25 gm ) 93 nonidet p 40 ( 100 ml ) 94 phosphoric acid ( 500 ml ) 95 potassium di hydrogen phosphate ( 500 gm ) 96 potassium permanganate ( 500 gm ) 97 isopropanol ( 500 ml ) 98 sodium bicarbonate ( 500 gm ) 99 giemsa stain solutoin ( 1 kit ) 100 disposable syringe 5ml with needle 101 disposable syringe 10ml with needle 102 disposable syringe 20ml with needle 103 disposable syringe 50 ml with needle 104 measuring cylinder 50 ml plastic 105 measuring cylinder 100 ml plastic 106 measuring cylinder 500 ml plastic 107 measuring cylinder 1000 ml plastic 108 test tube racks 48 holes for 12 mm test tubes 109 test tube racks 48 holes for 15 mm test tubes 110 nitril gloves medium size 6.5 each 111 nitril gloves small size 6.5 each 112 latex gloves 6.5” unsterilized ( pack of 100 pc. ) 113 latex gloves 7.5” unsterilized ( pack of 100 pc. ) 114 disposable needle 18 gauge 115 staining jars 100 ml 116 plastic dropping bottle 125 ml 117 plastic dropping bottles 500 ml 118 sterile disposable petri dish 90mm 119 disposable container for urine sample / sputum for c / s sterile ( individually packed ) 120 disposable plastic test tubes 75 x12 mm 121 beaker plastic various size 50 ml. 122 beaker plastic various size 100 ml. 123 beaker plastic various size 250 ml. 124 beaker plastic various size 500 ml . 125 beaker plastic various size 1000 ml. 126 thumb press disposable dropper 127 screw cap plastic vial 3 ml disposable with label self standing 128 autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter 129 vacutainer ( 5 ml without edta ) 130 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 131 . sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm, 150x12mm. ) 132 wash bottle ( 100 ml ) 133 microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 134 beaker 50 ml glass borosil ( cornig ) 135 beaker 100 ml glass borosil ( cornig ) 136 beaker 250 ml glass borosil ( cornig ) 137 beaker 500 ml glass borosil ( cornig ) 138 beaker 1000 ml glass borosil ( cornig ) 139 flat bottom conical flask 100 ml borosil ( cornig ) 140 flat bottom conical flask 200 ml borosil ( cornig ) 141 flat bottom conical flask 500 ml borosil ( cornig ) 142 flat bottom conical flask 1000ml borosil ( cornig ) 143 round flat bottom flask 100 ml borosil ( cornig ) 144 round flat bottom flask 250 borosil ( cornig ) 145 round flat bottom flask 500 ml borosil ( cornig ) 146 test tubes 12x100mm borosil 147 durham’s tube 25 mm x 6 to 7 mm dia. 148 bijou bottle with aluminium cap and silicon rubber washer 149 petri dish 110 mm borosil ( cornig ) 150 petri disc 90mm borosil ( cornig ) 151 glass cover slips 18 x 18mm, 8 x 0.1 mm english glass 152 glass funnel with 10 cm dia. ( small ) 153 glass funnel with 10 cm dia. ( medium ) 154 glass cover slip 22 x 22 mm x 0.1 mm, english glass 155 glass slide with concavities 156 test tube glass 12 x75 mm ( borosil ) 157 reagent bottle with cap ( borosil ) ( clear ) size 50 ml 158 reagent bottle with cap ( borosil ) ( clear ) size 100 ml 159 reagent bottle with cap ( borosil ) ( clear ) size 500 ml 160 reagent bottle with cap ( borosil ) ( clear ) size 1000 ml 161 reagent bottle with cap ( borosil ) ( brown ) size 50 ml 162 reagent bottle with cap ( borosil ) ( brown ) size 100 ml 163 reagent bottle with cap ( borosil ) ( brown ) size 500 ml, 164 reagent bottle with cap ( borosil ) ( brown ) size 1000 ml 165 150 x 15 mm dia., glass borosil 166 pasteur pipette with rubber bulbs capacity of 1 ml 167 pasteur pipette with rubber bulbs capacity of 2 ml 168 amphotericin b 169 micafungin 170 caspofungin 171 posaconazole 172 fluconazole 173 voriconazole 174 flucytosine 175 ketoconazole 176 itraconazole 177 adonitol 1 x25 178 arabinose 1 x25 179 cellobiose 1 x25 180 dextrose 1 x25 181 dulcitol 1 x25 182 galactose 1 x25 183 fructose 1 x25 184 inositol 1 x25 185 inulin 1 x25 186 lactose 1 x25 187 maltose 1 x25 188 mannitol 1 x25 189 mannose 1 x25 190 melibiose 1 x25 191 raffinose 1 x25 192 rhamnose 1 x25 193 salicin 1 x25 194 sorbitol 1 x25 195 sucrose 1 x25 196 trehalose 1 x25 197 xylose 1 x25 198 d arabitol 1 x25 199 colistin 25μg 100 x1 200 oxacillin 1 μg 100 x1 201 fusidic acid 30 μg 100 x1 202 pipracillin 100 μg 100 x1 203 polymyxin b 300 units 100 x1 204 tobramycin 10 μg 100 x1 205 nitrofurantoin 300 μg 100 x1 206 ticarcillin – 75 μg 100 x1 207 nalidixic acid 30 μg 100 x1 208 gatifloxacin 5 / 10 μg 100 x1 209 cefixime 10 μg 100 x1 210 levofloxacin 5 μg 100 x1 211 cefpodoxime 10 μg 100 x1 212 clindamycin 2 μg 100 x1 213 doxycycline 30 μg 100 x1 214 cloxacillin 10 μg 100 x1 215 co trimoxazole 30 μg 100 x1 216 aztreonan 30 μg 100 x1 217 erythromycin 15 μg 100 x1 218 netilmicin 30 μg 100 x1 219 sulphadiazine 100 μg 100 x1 220 clathromycin 15 μg 100 x1 221 griseofulvin 100 x1 222 neomycin 30 μg 100 x1 223 terbinafine 100 x1 224 norfloxacin 10 μg 100 x1 225 imipenem+ edta 10 / 750 100 x1 226 cefotaxime 30 μg 100 x1 227 novobiocin 5 μg 100 x1 228 amikacin 30 μg 100 x1 229 bacitracin 8 μg 100 x1 230 amoxyclave 10 μg 100 x1 231 ampicillin 10 μg 100 x1 232 cefazolin 30 μg 100 x1 233 cefaperazone 75 μg 100 x1 234 ceftizoxime 30 μg 100 x1 235 ceftazidime 30 μg 100 x1 236 ceftriaxone 30 μg 100 x1 237 amoxycilin 10 μg 100 x1 238 imipenum 10 μg 100 x1 239 cefapim 30 μg 100 x1 240 lomefloxacin 10 μg 100 x1 241 cephadroxil 30 μg 100 x1 242 ofloxacin 5 μg 100 x1 243 cefdinir 5 μg 100 x1 244 tetracycline 40 μg 100 x1 245 azithromycin 30 μg 100 x1 246 itraconazole 10& 30 μg 100 x1 247 vancomycin 10 μg 100 x1 248 ketoconazole 10 μg 100 x1 249 methicillin 5 μg 100 x1 250 amphotericin b 20, 50 &100 μg 100 x1 251 lincomycin 30 μg 100 x1 252 fluconazole 25 μg 100 x1 253 linezolid 30 μg 100 x1 254 clotrimmazole 10 μg 100 x1 255 doripenem 10μg 100 x1 256 mecillinam 10 μg 100 x 1 257 faropenem 5 μg 100 x1 258 mezocillin 75 μg 100 x 1 259 fosfomycin 200 100 x1 260 mupirocin 200 μg 100 x 1 261 piperacillin + tazobactam 100 / 10 μg 100 x1 262 ampicilline + clavulinic acid 10 / 10 μg x 10 263 cefoxitin 30 μg100 x1 264 mupirocin 5 μg 100 x1 265 meropenem 10 μg100 x1 266 ceftaroline 30 μg100 x1 267 nystatin100 units 268 miconazole 50 mcg 269 chloramphenicol 30 mcg 100x1 270 tigecycline 15 mcg 100 x1 271 penicillin 10 unit 272 voriconazole 1μg 273 gentamycin 120 μg 274 fluconazole 10 μg 275 polymyxin –b 50 units 276 rifampicin 30 μg 277 daptomycin 278 gentamycin 30 μg 279 amoxycilin&clavulanic acid 20 / 10 mcg 280 amoxycilin&sulbactum 10 / 10 mcg 281 ceftazidime&clavulanic acid 30 / 10 mcg 282 ticarcillin&clavulanic acid 75 / 10 mcg 283 cefaperazone&sulbactum 75 / 10 mcg 284 ceftazidime&tazobactam 30 / 10 mcg 285 parafloxin&mezulate 286 imipenam&cilastatin 10 / 10 mcg 287 piperacillin&tazobactam 30 / 6 mcg 288 clavulanic acid 10 mg &cefotaxime 30 mg 289 ampicillin &cloxacillin10 / 10 mcg 290 lysine hydrochloride 1 x25 ( amino acid disc ) 291 arginine hydrochloride 1 x25 ( amino acid disc ) 292 ornithine hydrochloride 1 x25 ( amino acid disc ) 293 onpg disc 294 oxidase disc 295 bacitracin disc 296 optochine disc 297 plain disc 298 nitrate reagent disc 299 x factor disc 300 v factor disc 301 x / v factor disc 302 vibrio 0129 differential disc 303 pyr disc 304 bile esculin disc 305 kovac’s reagent disc 306 lead acetate paper strip for h2s 307 spore strips 308 cefepime / cefepime+clavulanic acid ( cpm 0.25 16 : cpm+ca 0.064 4 ) 309 cefotaxime / cefotaxime+clavulanic acid ( ctx 0.25 16 : ctx+ca 0.016 1 ) 310 ceftazidime / ceftazidime+clavulanic acid ( caz 0.5 32 : caz+ca 0.064 4 ) 311 ceftriaxone / ceftriaxone+clavulanic acid ( ctr 0.025 16 : caz+ca 0.016 1 ) 312 esbl and ampc detection strip ( caz, ctx, cpm & clo with ca & taz 0.032 4 : caz, ctx, cpm & clo 0.125 16 ) 313 amikacin ( 256–0.15 ) 314 amoxycillin ( 256–0.015 ) 315 amoxycillin / clavulanic acid ( 256–0.015 ) 316 ampicillin ( 256–0.015 ) 317 cefotaxime ( 32–0.002 ) 318 cefotaxime ( 256–0.015 ) 319 ceftaroline ( 32–0.002 ) 320 ceftazidime† ( 256–0.015 ) 321 ceftriaxone ( 32–0.002 ) 322 ciprofloxacin ( 32–0.002 ) 323 clindamycin ( 256–0.015 ) 324 daptomycin ( 256–0.015 ) 325 erythromycin ( 256–0.015 ) 326 polymyxine ( 256 .016 ) 327 cefoxitin ( 256 .016 ) 328 levofloxacin ( 32–0.002 ) 329 linezolid ( 256–0.015 ) 330 meropenem ( 32–0.002 ) 331 metronidazole ( 256–0.015 ) 332 oxacillin ( 256–0.015 ) 333 penicillin g ( 32–0.002 ) 334 penicillin g ( 256–0.015 ) 335 teicoplanin ( 256–0.015 ) 336 tetracycline ( 256–0.015 ) 337 tigecycline ( 256–0.015 ) 338 vancomycin ( 256–0.015 ) 339 gentamicin ( 256–0.015 ) 340 imipenem ( 32–0.002 ) 341 colistin ( 256 .016 ) 342 fosfomycin ( 256 .016 ) 343 combi 94 for gram positive bacteria ( od 298 ) 344 combi 92 for gram negative bacteria ( od 293 ) 345 combi 512 for highly resistant pseudomonas ( od 88 ) 346 combi 677 for highly resistant staph aureus ( od 277 ) 347 meropenem with & without edta ( mpm+edta 1 64 mpm 4 256 ) 348 rapideccarba np 349 widal kit 4x5ml rapid slide test kit 350 mp card test ( for antigen pan, pf & pv detection ) 351 ra test kit 352 aso test kit 353 crp test kit 354 rpr 3rd generation / vdrl 355 hbs ag card test kit 356 hcv card test kit 357 rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) 358 rapid specific test for syphilis ( strip test ) kit 3rd generation 359 indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit 360 hepatitis a card test rapid card antibody test with control 361 rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) 362 h. pylori detection of all isotypes ( igg, igm, iga ) 363 brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml 364 rapid card test for troponin i for acute mi 365 rapid dengue card test for ns antigen igm and igg 366 latex agglutination for cryptococcalneoformans. 367 hiv rapid card test 4th generation ( nib / who / naco approved ) 368 rapid test kit device for toxoplasma infection with built in control test device 369 peptone water powder 370 macconkey agar 371 hichrome uti agar 372 nutrient agar 373 muller hinton agar 374 alkaline peptone water powder 375 hichrome candida differential agar 376 sda with cycloheximide 377 sda with chloramphenicol 378 potato dextrose agar base 379 rpmi 1640 380 glucose phosphate broth 381 simmons citrate agar 382 urease base agar ( christensen ) 383 c.zapekdox agar 384 triple sugar iron agar 385 phenyl pyruvic acid agar 386 bile esculin agar 387 hugh leifson oxidation fermentation media 388 stuart transport medium 389 dnaase agar media 390 l arginine dihydrolasehiveg medium 391 lysine decarboxylase hiveg broth 392 ornithine decarboxylase hiveg broth 393 cetrimide agar 394 anaerobic hiveg agar 395 thioglycolate agar 396 brain heart infusion broth 397 agar – agar powder 398 selenite f broth 399 tetra thionate broth 400 yeast extract “cr 027” 401 bacto peptone ( peptone ) “rm 015” 402 tryptose soya broth 403 carry blair w / o charcoal 404 tcbs agar 405 dca aagr 406 bile salt agar 407 coagulase manitol broth base 408 soyabincasin digest broth 409 l.j. medium base 410 miu medium 411 xylose lysine deoycholate agar 412 c.l.e.d. agar with andrde indicator 413 cooked meat medium broth 414 mannitol salt agar 415 phenol phthelinediphosphate agar 416 gelatin agar 417 sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) 418 cetrimide agar 419 hi combi dual performance media ( blood culture ) 420 bact alert blood culture bottle ( adult ) 421 bact alert blood culture bottle ( paediatric ) 422 yeast nitrogen base 423 muller decarboxylase 424 biomedical waste bags ( red, yellow, black, blue ) 25 lit. capacity 425 dustbin ( red yellow black blue ) 25 lt. 426 deionised triple distilled water reagent grade with conductivity <1.0 427 liquid soap dettol 428 teasing needle for fungus 429 markers blue red and black, finetip 430 nichrome wire 26g 431 adjustable loop holder 432 self adhesive autoclvable tape ( 18mmx50mt ) 433 self adhesive dry heat tape ( a8mmx50mt ) 434 hand guard disinfectant gel 435 hi spark alkaline clear solution biodegradable 436 filter paper full size 46x57 cm 437 spirit lamp glass with batti 438 slide boxes wooden / plastic 439 sterile polyester tipped swab 440 para film ( sealing film for glassware ) 2” 441 short range ph paper sticks ( 3 to 9 ) 442 ( grinded vessel ) 5, 10, 20ml 443 halogen bulb for microscope 6 v, 20w 444 stainless steel forceps blunt ( rust resistant ) 445 stainless steel forceps printed ( rust resistant ) 446 match box 447 disposable gloves 448 broom 449 disposable face masks 450 disposable apron 451 disposable shoe cover 452 disposable caps 453 aluminum tray for slide horizontal & vertical 454 phenyl solution 455 glass marking pencil white & red 456 test tube brush for cleaning tubes small / large 457 diamond pencil 458 rubber tourniquet 459 triple layer surgical mask with elastic earband 460 serology reporting register 461 koh reporting form 462 culture reporting form 463 serology reporting form 464 carbon brush ( for centrifuge machine ) 465 microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) 466 bamboo stick 467 cotton roll 468 ph indicator paper 469 slide tray plastic 470 cellophane tape 1’ 471 surgical blade 472 aluminium foil 473 match boxes 474 tissue paper roll 475 distilled water 476 disposable sterile container for urine sample / sputum for c / s 477 disposable plastic test tube 75x12mm 478 falcons tubes 50ml 479 falcons tubes 15ml 480 hav igm ( 96 well ( 1kit ) ) 481 hev igm ( 96 well ( 1kit ) ) 482 anti hbs ag ( 96 well ( 1kit ) ) 483 anti adenovirus iga ( 96 well ( 1kit ) ) 484 anti rotavirus antigen in stool elisa & serum ( 96 well ( 1kit ) ) 485 anti ebv igm ( 96 well ( 1kit ) ) 486 anti herpes simplex 2 igg ( 96 well ( 1kit ) ) 487 anti herpes simplex 2 igm ( 96 well ( 1kit ) ) 488 anti parainfluenzaigg ( 96 well ( 1kit ) ) 489 anti parainfluenza iga ( 96 well ( 1kit ) ) 490 measles igm ( 96 well ( 1kit ) ) 491 rubella igm ( 96 well ( 1kit ) ) 492 anti varicella zoster igg ( 96 well ( 1kit ) ) 493 anti varicella zoster igm ( 96 well ( 1kit ) ) 494 elisa ns1 antigen for dengue ( 96 well ( 1kit ) ) 495 anti respiratory syncitial virus igm ( 96 well ( 1kit ) ) 496 anti measles igg, igm ( 96 well ( 1kit ) ) 497 anti parainfluenzaigm ( 96 well ( 1kit ) ) 498 mumps igm ( 96 well ( 1kit ) ) 499 anti nmda receptor encephalitis ( 96 well ( 1kit ) ) 500 elisa for enterovirus ( 96 well ( 1kit ) ) 501 anti varicella zoster iga ( 96 well ( 1kit ) ) 502 hcvigm elisa ( 96 well ( 1kit ) ) 503 anti ds dna ( 96 well ( 1kit ) ) 504 ( apla ) anti phospholipid antibody igg, igm ( 96 well ( 1kit ) ) 505 ttg iga ( 96 well ( 1kit ) ) 506 dengue antigen elisa ( 96 well ( 1kit ) ) 507 chikunguniyaigm elisa ( 96 well ( 1kit ) ) 508 anti h. pylori iga ( 96 well ( 1kit ) ) 509 anti h. pylori igg elisa ( 96 well ( 1kit ) ) 510 anti rota virus ( antigen ) elisa ( 96 well ( 1kit ) ) 511 anti japanese b encephalitis igm ( 96 well ( 1kit ) ) 512 anti paravovirus 19 igg ( 96 well ( 1kit ) ) 513 anti paravovirus 19 igm ( 96 well ( 1kit ) ) 514 anti sm ( 96 well ( 1kit ) ) 515 anti rnp ( 96 well ( 1kit ) ) 516 anti panca, canca ( 96 well ( 1kit ) ) 517 scrub typhus ( 96 well ( 1kit ) ) 518 anti cardilopin igg ( 96 well ( 1kit ) ) 519 anti cardilopin igm ( 96 well ( 1kit ) ) 520 anti echinococcaligg ( 96 well ( 1kit ) ) 521 hbs antibodies ( 96 well ( 1kit ) ) 522 anti hsv 1 igm ( 96 well ( 1kit ) ) 523 anti hsv 1 igg ( 96 well ( 1kit ) ) 524 cmv igm ( 96 well ( 1kit ) ) 525 cmv –igg ( 96 well ( 1kit ) ) 526 anti parainfluenzaigg ( 96 well ( 1kit ) ) 527 anti parainfluenzaigm ( 96 well ( 1kit ) ) 528 anti brucellaigg ( 96 well ( 1kit ) ) 529 anti brucellaigm ( 96 well ( 1kit ) ) 530 anti thyroid peroxidase antibodies ( microsomall ) ( 96 well ( 1kit ) ) 531 west nile igm elisa ( 96 well ( 1kit ) ) 532 hbeag elisa ( 96 well ( 1kit ) ) 533 hbs ag elisa ( 96 well ( 1kit ) ) 534 anti neulear antibody ( elisa ) ( 96 well ( 1kit ) ) 535 nucleic acid isolation ( rna & dna both ) ( 250 rxn ) 536 nucleic acid isolation kits ( from blood & bacterial culture ) ( 250 rxn ) 537 viral rna isolation kit ( 250 rxn ) 538 viral dna isolation kit ( 250 rxn ) 539 gel extraction / purification kit ( 250 rxn ) 540 quantitative estimation pcr kits for hbv ( available pack size ) 541 quantitative estimation pcr kits for hcv ( 100 rxn ) 542 quantitative estimation pcr kits for hpv 16 ( 100 rxn ) 543 quantitative estimation pcr kits for hpv 18 ( 100 rxn ) 544 rt pcr kits for japanese enchephalitis ( 100 rxn ) 545 rt pcr kit for zika virus. ( 100 rxn ) 546 rt pcr multiplex kits for viral meningitis ( ( ftd neuro 9 ) ( 100 rxn ) 547 rt pcr multiplex kits for neonatal meningitis ( 100 rxn ) 548 rt pcr multiplex kits for respiratory tract virus ( 100 rxn ) 549 quantitative estimation pcr kits for viral encephalitis. ( 100 rxn ) 550 steel instrument tray medium size ( 1 pc. ) 551 lab trays ( 6 ) 450 x 350 x 75 ( 1 pc. ) 552 cryo box ( 100 places ) ( plastic ) ( 5 pc. / per box ) 553 falcons tubes50ml, ( 100 pc. / pkt. ) 554 falcons tubes 15 ml ( 100 pc. / pkt. ) 555 micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) a )       2 ml ( 500 pc. / pkt. ) 556 micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) b )       1.5 ml ( 500 pc. / pkt. ) 557 brush ( nylon bristles seated in galvanized wire with a wire handle ) ( 90 x 150 x 340 mm ) 558 volumetric flask brush ( 50 x 70 x 170 mm ) 559 beaker brush ( 30 x 110 x 260 mm ) 560 test tube brush 561 float rack ( 6 pc. / pkt. ) 562 pipette stands for every pipette set vertical revolving ( 1 pc. ) 563 multipurpose racks / stand ( 5 pc. / pkt. ) 564 laboratory spatula 565 micro spatula, set of 3 (  220 mm ) 566 spatula, spoon end ( ) 567 thermometer, mercury ( 0 150°c x 1°c ) 568 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 50 ml ) 569 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 100 ml ) 570 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 500 ml ) 571 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 1000 ml ) 572 flat bottom conical flask ( with screw cap, graduated, clear ) ( 100 ml ) 573 flat bottom conical flask ( with screw cap, graduated, clear ) ( 250 ml ) 574 flat bottom conical flask ( with screw cap, graduated, clear ) ( 1000 ml ) 575 glass funnel ( 5 cm dia. ) 576 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 50 ml ) 577 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 100 ml ) 578 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 500 ml ) 579 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 1000 ml ) 580 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 50 ml ) 581 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 100 ml ) 582 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 500 ml ) 583 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 1000 ml ) 584 measuring cylinder plastic ( 100 ml ) 585 measuring cylinder plastic ( 500 ml ) 586 measuring cylinder plastic ( 1000 ml ) 587 nitril gloves small ( 6.5 inch. ( 100 / pack ) 588 latex gloves ( 6.5 inch. ( 100 / pack ) 589 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 0.5 – 10 μl ) 590 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 10 – 100 μl ) 591 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 20 – 200 μl ) 592 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 100 – 1000 μl ) 593 beaker plastic ( with spout, graduated, autoclavable ) ( 50 ml ) 594 beaker plastic ( with spout, graduated, autoclavable ) ( 100 ml ) 595 beaker plastic ( with spout, graduated, autoclavable ) ( 500 ml ) 596 beaker plastic ( with spout, graduated, autoclavable ) ( 1000 ml. ) 597 screw cap plastic vial 2 ml disposable with label self standing, autoclavable ( 500 pc / pkt. ) 598 k3 edta blood collection vials vaccunized 599 pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat cap ( 500 pc / pkt. ) 600 pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml ( 500 pc / pkt. ) 601 micro amp fast reaction tubes ( 8 tubes / strips ) compatable in use with quants studio ( abi ) system  ( 0.2 ml ) 602 micro amp fast reaction caps ( 8 tubes / strips ) compatable in use with quants studio ( abi ) system  ( 0.2 ml ) 603 micro amp fast reaction tubes ( 8 tubes / strips ) compatable in use with 7500 fast dx system, stepone,  steponeplus system  ( 0.1 ml ) 604 micro amp fast reaction caps ( 8 tubes / strips ) 7500 fast dx system, stepone,  steponeplus system  ( 0.1 ml ) 605 ptfe magnetic stir bar retrievers ( 18 24 inch ) 606 rapid test for detection of igm antibodies against salmonella infection ( lam test ) ( 96 test ) 607 rapid specific test for syphilih ( card test ) kit 3rd generation ( igg / igm / iga ) tpha ( 96 test ) 608 hepatitis a card test rapid card antibody test with control ( 96 test ) 609 rotavirus detetion of rota virus detecation ag of all serotypes ( 96 test ) 610 h. pylori detection of all isotypes ( igg, igm, iga ) ( 96 test ) 611 brucellaantibodyslide agglutination test b. abortus 5 mlb.mclitersis 5ml ( 96 test ) 612 rapid card test for troponin i foracute mi ( 96 test ) 613 rapid dengue card test for ns1 antigen igm and igg ( 96 test ) 614 hiv rapid card test4th generation ( nib / who / naco approved ) ( 96 test ) 615 acetone 4x2.5 ltr ( 4x2.5 ltr ) 616 agar agar powder 2x500 gm ( 2x500 gm ) 617 amikacin 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 618 amoxycillin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 619 amoxyclave 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 620 ampicillin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 621 aslo 5 box = 500 ( 1 box = 500 ) 622 azithromycin 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 623 bijou bottle with aluminium cap and silicon rubber washer ( each ) ( each ) 624 blue tips ( 5000 nos ) ( 5000 ) 625 cefaperazone 75μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 626 cefapim 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 627 cefdinir 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 628 cefixime 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 629 cefotaxime 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 630 cefoxitin 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 631 cefpodoxime 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 632 ceftazidime 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 633 ceftriaxone 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 634 cephadroxil 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 635 chromogenic uti agar ( 5x500 gm ) ( 5x500 gm ) 636 clindamycin 2μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 637 colistin 25μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 638 disinfecctent soap ( 150 nos. ) ( 150 nos. ) 639 disinfectent solution for hand wash 500ml ( 20 nos ) ( 20 nos ) 640 disposable container for urine ( 40000 nos. ) ( 40000 nos. ) 641 disposable plastic test tube 75x12ml ( 10000 nos. ) ( 10000 nos. ) 642 distilled water ( 2000 nos. ) ( 5000 nos. ) 643 gulcose phosphate broth ( 2x500 gm ) ( 2x500 gm ) 644 hugh leifson oxidation fermentation ( 2x500 gm ) ( 2x500 gm ) 645 imipenum 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 646 itraconazole 10&30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 647 ketoconazole 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 648 levofloxacin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 649 linezolid 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 650 lomefloxacin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 651 mac conkey agar ( 6x500 gm ) ( 6x500 gm ) 652 methicillin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 653 mr. vp medium ( 2x500 gm ) ( 1x500 gm ) 654 muller hinton agar ( 10x500 gm ) ( 5x500 gm ) 655 nalidixic acid 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 656 nitrofurantoin 300μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 657 normal saline solution ( 500mlx510 ) ( 500mlx510 ) 658 novobiocin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 659 nrfloxacin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 660 nutrient agar ( 10x500 gm ) ( 10x500 gm ) 661 ofloxacin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 662 paraffin liquid ( 2x500 ml ) ( 2x500 ml ) 663 peptone water ( 2x500 gm ) ( 2x500 gm ) 664 pipracillin 100μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 665 procalcitonin ( 300 box = 3000 test ) ( 300 box = 3000 test ) 666 rpmi 1640 ( 6x500 ml ) ( 6x500 ml ) 667 simmons citrate agar ( 2x500 gm ) ( 2x500 gm ) 668 spirit lamp ( 2 nos ) ( 5 nos ) 669 sterile cotton swab in screw capped polypropylene tube ( 20x100 = 2000 nos ) ( 20x100 = 2000 nos ) 670 sterile disposable petri dises 99 mm ( 200x100=20, 000 nos ) ( 200x100=20, 000 nos ) 671 suborounds d extrose agar with cyclohexmide ( 2x500 gm ) ( 2x500 gm ) 672 teasing needle for fungus ( 10xeach ) ( 5xeach ) 673 test tube borosilicate with rim ( 12x100 ) ( 10000 ( piece ) tube nos ) ( 10000 ( piece ) tube nos ) 674 test tube borosilicatee with rim ( 18*150 ) ( 1000 nos ) ( 1000 nos ) 675 test tube brushes for cleaning tube small / large ( 50 nos ) ( 50 nos ) 676 tissue paper roll ( 4450 nos ) ( 4450 nos ) 677 tobramycin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 678 triple blood bag with sagm 350ml ( 12000 nos ) ( 12000 nos ) 679 urease base agar ( 2x500 gm ) ( 2x500 gm ) 680 vancomycin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 681 xyline ( 1x25 ltr ) ( 1 bottle ) 682 sterile cotton swab in screw capped polyprohylietube ( 10x100 box ) ( 10x100 box ) 683 hicrome rapid mrsa agar base ( 1x500gm ) ( 1x500gm ) 684 sabouraved agar+chlormphnicol+ gentamicin ( 1x500gm ) ( 1x500gm ) 685 loeffler serum slant ( 100 slants ) ( 50 slants ) 686 v.t.m. ( 500 nos ) ( 500 nos ) 687 ethanol ( 1 bottle ) 688 isoamylalcohal ( 1 bottle ) 689 paradimethyl diamobenjaldenyde ( 100 ml ) 690 hcl ( 1 ltr ) 691 h2o2 ( 1 ltr ) 692 gycerol ( 1 ltr ) 693 lpcb ( 1 ltr ) 694 grams staining ( 1 bottle ) 695 zn staining ( 1 bottle ) 696 albert staining a&b ( 1 bottle each for a&b ) 697 bhi ( brain heart infusion ) ( 1 bottle ) 698 foceps ( 12 pcs ) 699 methanol ( 5 ltr ) 700 bile exulin agar ( 1x500 ) 701 ppa ( phenyl pyrumi acid ) ( 1x500 ) 702 feu3 ( 100 ml ) 703 dtm ( dermatophyte testing media ) ( 1x500 ) 704 pda ( potato dextrose agar ) ( 2x500 ) 705 formaline ( 10 ltr ) 706 paraffin oil ( 1 ltr ) 707 petri dish ( 15000 ) 708 tecopanin anitibiotic ( 50vl=5000 disc ) 709 ciprofloxacin ( 50vl=5000 disc ) 710 cefuroxime ( 50vl=5000 disc ) 711 gentamycin ( 50vl=5000 disc ) 712 piperacillin & tazobactum ( 50vl=5000 disc ) 713 ampicillin and sulbactum ( 50vl=5000 disc ) 714 ticarcillin & clavulinic ( 50vl=5000 disc ) ...

Medical College - Rajasthan

22996828 supply of chemical & reagents for microbiology lab : rate contract for 02 years oxalic acid, sodium hypochloride solution, acetone, liquid ammonia, absolute alcohol, ammonium sulphate, glacial acetic acid, urea powder, paradimethy amino benzaledehyde, ammonium oxalate crystals, actidione, phenyl crystal, ferric ammonium sulphate, di sodium hydrogen phosphate, sodium hydrogen phosphate, sulphuric acid, basic carbofuischin powder, barium chloride, glycol, glucose alcohol, malachite green, sodium nitrate, sulphanillic acid, toluidine blue, magnesium sulphate, n acety l cystine, formaldehyde solution, nigrocin, koh pallets, concentrated hcl, albert stain a and b for diphtheria, brilliant cresyl blue, liquid paraffin, sodium acetate, sodium sulphite, potassium bromide, sodium, thiosulphate, spirit, poly vinyl alcohol, ammonium chloride, sodium metal bisulphite, sodium deoxycholate, magnesium citrate, asparagine, sodium citrate, lactophenol, omera regagent vp reagent, ferric chloride, cyanogen bromide, andrades indicator, dimethyl sulphodie, iodine crystal, safarmine, neutral red, dpx mount, hydrogen peroxide, sodium hippurate, gelatin, sodium borohydrate, cobalt chloride, dextrose anhydrous, lactose, maltose, mannitol, dulcitol, xylose, arabinose, sorbitol, schaudinn solution, microsporidia trichome blue stain, chloroform, formamide, methylene blue, phosphoric acid, potassium di hydrogen phosphate, isopropanol, sodium bicarbonate, giemsa stain solution, disposable syringe, measuring cylinder, test tube rack, nitril gloves, latex gloves, disposable needle, staining jars, plastic dropping bottle, sterile disposable petri dish, disposable container, plastic test tubes, thumb press disposable dropper, screw cap plastic vial 3 ml disposable with label self standing, autoclavable tubes, vacutainer, wash bottle, microslide, breaker, flat bottom conical flask, test tubes, durham tubes, glass funnel with 10 cm dia, glass cover, glass slide with concavities, reagent bottle with cap, pasteur pipette rubber bulbs, antifungal enzyme strips, disc for carbohydrate fermentation test dics, antibiotics disk and antifungal disk, tetracycline, vancomycin, azithromycin, fluconazole, mezocillin, fosfomycin, piperacillin, meropenem, nystain, miconazole, tigercyline, penicillin, voriconazole, gentamycin, fluconazole, rifampicin, daptomycin, gentamycin, amoxycilln&clavulanic acid, ticarcillin&sulbactum, pyr disc, bile esculin disc, kova regaent disc, lead acetate paper, cofepime, ceftazidime, esbl and ampc detection strip, e strip, high media antibiotic, rapiodedcarba np, serological test, widal kit, rapid slide test kit, mp card test, ra test kit, aso test kit, crp test kit, rpr generation, hbs ag card test kit, hcv card test kit, rapid specific test, hiv rapid card test, rapid test kit device, muller hinton agar, alkaline petone water powder, hichrome candida differential agar, sda with cycloheximide, potato dextrose agar base, rpmi 1640, glucose phosphate broth, simmons citrate agar, urease base agar, triple sugar iron agar, phenyl pyruvic acid agar, dna ase agar media, cetrimide agar, thioglycolate agar, brain heart infusion broth, tcbs agar, dca agar, bile salt agar, coagulase manitol broth base, l medium base miu medium, cied agar with andrde indicator, cooked meat medium broth, phenol phtheline diphosphate agar, geltain agar, cetrimide agar, sugar assimilation media, h1 comi dual performance media, bact alert blood culture bottle, yeast nitrogen base, muller decarboxylase, biomedical waste bags, dustbin, deionised triple distilled water reagent grade with conducitivity, liquid soap dettol, teasing needle for fungus, markers blue red and black finetip, adjustable loop holder, self adhesive autoclavable tape, self adhesive dry heat tape, hand guard disinfectant gel, display face masks, disposable shoes cover, disposable caps, phenyl solution, glass marking pencil white and red, test tube brush, diamond pencil, triple layer surgical mask with elastic earband, koh reporting form, culture reporting form, carbon brush, serology reporting form, microscope bulb, cotton roll, ph indicator paper, slide tray, cellophante tape, surgical blade, aluminium foil, distilled water falcons tubes, hav igm, anti hbs ag, anti adenovirus, anti rotavirus antgen in stool elisa and serum, anti herps simplex, measles igm, rubella igm, anti varicella zoster igg, elisa nsi antigen for dengue, anti measles igg igm, mumps igm, anti nmda receptor encephalitis, anti ds dna, dengue antigen elisa, anti rota virus elisa, anti paravovirus, anti sm, anti thyroid peroxidase antibodies, viral rna isolation kit, gel extraction/purification kit, quantitative estimation pcr kits, steel instrument tray, falcoms tubes, micro centrifuge tubes, test tube brush, volumetric flask brush, spatula spoon end, thermometer mercury, glasss ware, breaker with handle, graduated with spout, flat bottom conical flask, reagent bottle clear, measuring cylinder plastic, nitril gloves small, latex gloves, micro pipette tips, breaker plastic, k3 edta blood collection vials vaccunized, pcr tubes autoclavable, pcr tubes, micro amp fast reaction tubes, ptfe magnetic stir bar retrievers, rapid test, hepatitis a card test rapid card antibody test with control, hiv rapid card test, acetone, agar agar powder, amikacilin, aslo 5 box, azithromycin, cefdinir, cefoxitin, ceohadroxil, chromogentic uti agar, disposable plastic test tube, itraconazole, ketoconazole, muller hinton agar, novobiocin, nutrient agar, peptone water, paraffin liquid, rpmi 1640, test tube brushes, tissue paper roll, tobramycin, triple blood bag with sagm, vancomycin, xylene, sterile cotton swab in screw capped polyprohylietube, vtm, ethanol, isoamylachol, hcl, h202, glycerol, lpcb, gram staining, zn staining, bhi, foceps, methanol, bile exulin agar, ppa, feu3 dtm, pda, formaline, petri dish, tecopanin antibiotic, ciprofloxacin, gentamycin, piperacillin & tazobactum, ampicillin and sulbactum, ticarcillin & clavulinic. for microbiology lab : rate contract for 02 years...

Rajasthan University Of Health Science - Rajasthan

21527857 supply of regents and chemicals regents and chemicals biochemistry and microbiology 2 alkaline phosphatase estimation kit 3 albumin estimation kit 4 amylase alpha estimation kit 5 bilirubin total & direct estimation kit 6 cholesterol total estimation kit 7 calcium estimation kit 8 c. k. mb ( creatine kinase mb ) estimation kit with calibrators 9 c. k. nac ( creatine kinase nac ) estimation kit 10 c. k. mb ( creatine kinase mb ) control kit 11 creatinine estimation kit 12 csf protein control kit 13 csf and urine protein estimation kit standard / calibrators 14 gamma g.t.estimation kit 15 glucose estimation kit 16 hba1c estimation kit with calibrators 17 hba1c control set kit 18 hdl cholesterol control kit 19 hdl cholesterol estimation kit with calibrators 20 lipase estimation kit 21 multi assay human sera based chemistry calibrators for laboratory 22 multiassay chemistry control level 1, 2 & 3 / ( normal and pathological controls ) 23 inorganic phosphorous estimation kit 24 ldh estimation kit 25 lipase estimation kit with calibrators & control 26 sgot / ast estimation kit 27 sgpt / alt alanine transaminase estimation kit 28 total protein estimation kit 29 triglyceride estimation kit 30 urea estimation kit 31 uric acid estimation kit 32 aliquot tubes 33 plain tube without cap plastic , 5ml 34 plain tube without cap plastic , 8ml 35 sample cups for randox imola, beckman coulter 36 tips 100 1000 μl ( blue colour ) 37 tips 10 200 μl ( yellow colour ) 38 vacutainer vial ( fluoride ) 39 vacutainer vial ( serum gel clot activator ) 40 sample storage vials ( plastic ) 41 test tube stand 42 hypochlorite solution 6% &10% 43 methanol 70% 44 absolute ethanol 45 afb ( zn acid fast kit ) 46 autoclave indicator strip 47 blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 48 cled media 49 l arginine 50 l lysine mono dihydrochloride 51 mr vp medium ( glucose phosphate broth ) 52 n naphthyl ethylene diamine dihydrochloride 53 n, n, n, n tetra methyl p phenylenediamine dihydrochloride 54 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 55 rpr slide test 56 sim agar 57 sterile autoclavable skirted plate 96 wells x 0.3 ml 58 sterile readymade plates of nutrient agar ( 90 mm size ) 59 stool container with spoon 60 sulphanilamide 61 chloramphenicol 30 μg 62 cyclopirox 50 μg 63 dalfopristine 64 daptomycin 65 faropenam 66 fluconazole 25 μg 67 fosfomycin 200 μg 68 furazolidone 50 μg 69 fusidic acid 70 gentamicin 120μg 71 gentamicin 30μg 72 gentamycin 10 μg 73 griseofulvin 10 μg 74 hippurate 75 imipenam 10 μg 76 itraconazole 8 μg 77 kanamycin 78 ketoconazole 15 μg 79 levofloxacin 5μg 80 lincomycin 10 μg 81 linezolid 30 μg 82 meropenam 10 μg 83 miconazole 10 μg 84 moxalactum 85 nalidixic acid 30μg 86 netilmycin 30 μg 87 nitrofurantoin 300 μg 88 norfloxacin 10 μg 89 novobiocin 90 nystatin 91 ofloxacin 5 μg 92 onpg 93 optochin 94 oxacillin 1 μg 95 piperacillin+tazobactum 100 / 10 96 piperacillin 100 μg 97 polymyxin b 30 units 98 pristinomycin 15μg 99 quinopristin 100 teicoplanin 30 μg 101 terbinafine 1 μg 102 tetracycline 30 μg 103 ticarcillin+clavulanic acid 75 / 10 104 ticarcillin75µg 105 tigecyclin 15μg 106 tobramycin 10 μg 107 v factor 108 vancomycin 30 μg 109 voriconazole 1 μg 110 x + v factor 111 x factor 112 cefotaxine + clavulanic acid 113 vacutainer edta vial 114 vacutainer sodium citrate 3.2 % vial 115 andrades indicator 116 antibiotic zone scale 117 aslo test kit 118 disposable petridishes 10mm diameter individiually packed ( sterile ) 119 disposable sterile swab individiually packed ( sterile ) 120 disposable sterile universal container individiually packed ( sterile ) 121 glucose 122 hbsag rapid test card 123 india ink 124 microscopic lens cleaner 125 occult blood test for stool sample 126 parafilm 127 plasticin 128 scrub typhus igm elisa 129 sterilium 130 thick cotton thread 131 urea ( 40% ) 132 anti hcv rapid test kit 133 chikungunya for igm elisa kit 134 dengue igm elisa kit 135 bile esculin agar 136 immersion oil 137 phenylalanine agar 138 salmonella polyvalent h antiserum 139 salmonella polyvalent o antiserum 140 salmonella typhi h d antiserum 141 tellurite blood agar base 142 vibrio cholerae polyvalent antisera 143 vibrio choleraeserovarlnaba antisera 144 vibrio choleraeserovar ogawa antisera 145 urine multi strip 10 parameter 146 sterile urine contaioner 50ml...

Rajasthan University Of Health Science - Rajasthan

21488183 supply of regents and chemicals regents and chemicals biochemistry and microbiology 2 alkaline phosphatase estimation kit 3 albumin estimation kit 4 amylase alpha estimation kit 5 bilirubin total & direct estimation kit 6 cholesterol total estimation kit 7 calcium estimation kit 8 c. k. mb ( creatine kinase mb ) estimation kit with calibrators 9 c. k. nac ( creatine kinase nac ) estimation kit 10 c. k. mb ( creatine kinase mb ) control kit 11 creatinine estimation kit 12 csf protein control kit 13 csf and urine protein estimation kit standard / calibrators 14 gamma g.t.estimation kit 15 glucose estimation kit 16 hba1c estimation kit with calibrators 17 hba1c control set kit 18 hdl cholesterol control kit 19 hdl cholesterol estimation kit with calibrators 20 lipase estimation kit 21 multi assay human sera based chemistry calibrators for laboratory 22 multiassay chemistry control level 1, 2 & 3 / ( normal and pathological controls ) 23 inorganic phosphorous estimation kit 24 ldh estimation kit 25 lipase estimation kit with calibrators & control 26 sgot / ast estimation kit 27 sgpt / alt alanine transaminase estimation kit 28 total protein estimation kit 29 triglyceride estimation kit 30 urea estimation kit 31 uric acid estimation kit 32 aliquot tubes 33 plain tube without cap plastic , 5ml 34 plain tube without cap plastic , 8ml 35 sample cups for randox imola, beckman coulter 36 tips 100 1000 μl ( blue colour ) 37 tips 10 200 μl ( yellow colour ) 38 vacutainer vial ( fluoride ) 39 vacutainer vial ( serum gel clot activator ) 40 sample storage vials ( plastic ) 41 test tube stand 42 hypochlorite solution 6% &10% 43 methanol 70% 44 absolute ethanol 45 afb ( zn acid fast kit ) 46 autoclave indicator strip 47 blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 48 cled media 49 l arginine 50 l lysine mono dihydrochloride 51 mr vp medium ( glucose phosphate broth ) 52 n naphthyl ethylene diamine dihydrochloride 53 n, n, n, n tetra methyl p phenylenediamine dihydrochloride 54 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 55 rpr slide test 56 sim agar 57 sterile autoclavable skirted plate 96 wells x 0.3 ml 58 sterile readymade plates of nutrient agar ( 90 mm size ) 59 stool container with spoon 60 sulphanilamide 61 chloramphenicol 30 μg 62 cyclopirox 50 μg 63 dalfopristine 64 daptomycin 65 faropenam 66 fluconazole 25 μg 67 fosfomycin 200 μg 68 furazolidone 50 μg 69 fusidic acid 70 gentamicin 120μg 71 gentamicin 30μg 72 gentamycin 10 μg 73 griseofulvin 10 μg 74 hippurate 75 imipenam 10 μg 76 itraconazole 8 μg 77 kanamycin 78 ketoconazole 15 μg 79 levofloxacin 5μg 80 lincomycin 10 μg 81 linezolid 30 μg 82 meropenam 10 μg 83 miconazole 10 μg 84 moxalactum 85 nalidixic acid 30μg 86 netilmycin 30 μg 87 nitrofurantoin 300 μg 88 norfloxacin 10 μg 89 novobiocin 90 nystatin 91 ofloxacin 5 μg 92 onpg 93 optochin 94 oxacillin 1 μg 95 piperacillin+tazobactum 100 / 10 96 piperacillin 100 μg 97 polymyxin b 30 units 98 pristinomycin 15μg 99 quinopristin 100 teicoplanin 30 μg 101 terbinafine 1 μg 102 tetracycline 30 μg 103 ticarcillin+clavulanic acid 75 / 10 104 ticarcillin75µg 105 tigecyclin 15μg 106 tobramycin 10 μg 107 v factor 108 vancomycin 30 μg 109 voriconazole 1 μg 110 x + v factor 111 x factor 112 cefotaxine + clavulanic acid 113 vacutainer edta vial 114 vacutainer sodium citrate 3.2 % vial 115 andrades indicator 116 antibiotic zone scale 117 aslo test kit 118 disposable petridishes 10mm diameter individiually packed ( sterile ) 119 disposable sterile swab individiually packed ( sterile ) 120 disposable sterile universal container individiually packed ( sterile ) 121 glucose 122 hbsag rapid test card 123 india ink 124 microscopic lens cleaner 125 occult blood test for stool sample 126 parafilm 127 plasticin 128 scrub typhus igm elisa 129 sterilium 130 thick cotton thread 131 urea ( 40% ) 132 anti hcv rapid test kit 133 chikungunya for igm elisa kit 134 dengue igm elisa kit 135 bile esculin agar 136 immersion oil 137 phenylalanine agar 138 salmonella polyvalent h antiserum 139 salmonella polyvalent o antiserum 140 salmonella typhi h d antiserum 141 tellurite blood agar base 142 vibrio cholerae polyvalent antisera 143 vibrio choleraeserovarlnaba antisera 144 vibrio choleraeserovar ogawa antisera 145 urine multi strip 10 parameter 146 sterile urine contaioner 50ml...

Indian Army - Rajasthan

21360688 procurement of medical stores of 187 mh procurement of medicines ( dglp ) , drugs , tab tramadol hcl 50 mg , tab azathioprine 50mg , tab shelcal , tab ondansetron 8 mg , tab metoprolol tarterate 50 mg , inj metoprolol 1 mg/ml , amp of 5 ml , tab telmisartan 40 mg + hydrochlorthiazide 12 . 5 mg , tab antispasmodic containing mefenamic acid 250 mg & dicyclomine , tab domperidone 10 mg , oral rehydration powder sachet of 20 . 5g each containing sodium chloride ip 2 . 6g anhydrous dextrose ip 13 . 5g , potassium chloride ip 1 . 5g & sodium citrate ip 2 . 99 to make 1 ltr mixture , tab linagliptin 5mg , sodium chloride 0 . 65% w/v nasal drops , tab betahistine dihydro chloride 8mg , syp calcium phosphate ( 80mg/5ml ) 200 ml , tab aripiprazole 10 mg , tab n acetyl cysteine 600mg , tab quitiapine 100 mg , inj dextrose 50% , 25 ml , inj dextrose 25% , 25 ml , tab ascorbic acid 100 mg , tab ascorbic acid 500 mg , inj b 12 , 500 mcg/ml , multi vit inj iv 2 10 ml with minimum constituents having thiamine ( b1 ) 30mg/ml , pyridoxine ( b6 ) 30mg/ml and ( b12 ) cyanocobelemine 300mcg/ml , sterile gloves size 7 . 5 ( suture india ) , sterile gloves size 8 ( suture india ) , knife bard parker , blade size 1 fitting ( commercial no . 10 ) packet of 6 , knife bard parker , blade size 1 fitting ( commercial no . 11 ) packet of 6 , knife bard parker , blade size 1 fitting ( commercial no . 12 ) packet of 6 , knife bard parker , blade size 1 fitting ( commercial no . 15 ) packet of 6 , knife bard parker , blade size 2 fitting ( commercial no . 20 ) packet of 6 , knife bard parker , blade size 2 fitting ( commercial no . 22 ) packet of 6 , knife bard parker , blade size 2 fitting ( commercial no . 23 ) packet of 6 , tab quitapine 50mg , tab quitapine 200mg , tab gliclazide 80mg , nasal drop saline , eye drop olopatadine , inj testosterone 250mg , tab tadalafil 10mg , tab divalprox sodium 1gm , cap isotretinoin 20mg , tab clinidipine 10mg , ketoconazole lotion 2% bott of 75ml , monopolar cautery lead , surgeon cap disposable , inj amphotericin liposomal 50 mg/ml , lotion topisal 6% , lotion topisal 3% , syp atarax , tab silodosin 8mg + dutasteride ( silofast ) , tab bethanechol 25mg , tab biotin forte , drop multivitamin , drop calcium , paediatric bain circuit , syp ambroxol , syp cough containing codeine phosphate and chlorphenaramine , catheter mount , inj vasopressin 20 units/ml , tab terbinafine hcl 250mg , monoguard shampoo , cream sunscreen , distilled water can of 5 ltr , strepsils , cream clobetasol and miconazol , tab betnesol forte 1mg , tab bromocriptine 2 . 5 mg , blood culture bottle , vent mask adult , vent mask child , inj pentazocin , inj insulin lispro humalog 25/75 , tab zorbax 500mg , tab zorbax 250mg , inj rabipur , ecg roll 210mm x 20mtr , glucostrip sugar check advance bott of 50 strip ( one glucometer free with 3 bott ) , mouth ulcer gel , syp ofloxacin and ornidazole , inj drotaverine hcl 1% , 20 mg/ml , 2 ml , inj streptomycin 1 gm , inj tranexamic acid 500 mg/5ml , paracetamol infusion 1gm , inj neurobion , inj methylergometrine maleate 0 . 2mg , amp of 1ml , hepatitis b vaccine vial of 10ml , inj iron sucrose , inj haloperidol 5mg/ml , inj insulin glargine , inj leviteracetam 500mg/5ml , inj diltiazem 5mg/ml , inj calcium gluconate 10% , amp of 10ml , inj progesterone 25mg/2ml , inj triptorellin 3 . 75mg , inj liraglutide 1 . 8mg , injectable typhoid vaccine , inj iohexol , vial of 50ml , inj adenosine 3mg/1ml , amp of 2ml , tab rosuvastatin 10mg , tab lithium 450mg , tab hydroxy chloroquine sulphate 300mg , tab apixaban 5mg , tab ropinorole 2mg , tab metoprolol xl 25mg , tab metoprolol xl 50mg , tab dapaglifloxin 10mg , tab atazavir 300mg and ritonavir 100mg , tab lopinavir 200mg and ritonavir 50mg , tab clonazepam 0 . 5mg , tab tenofovir 300mg , tab lamivudine 150mg , tab zidovudine 300mg , tab efavirenz 600mg , tab s adenosyl methionine 400mg , tab olanzepine 5mg , tab nor ethisterone 5mg , tab pioglitazone 15mg , tab betahistine 16mg , tab amisuplride 50mg , tab alprazolam 0 . 25mg , tab promethazine hcl 25 mg , tab pregabalin 75mg , tab sumatriptin 50mg , tab pregabalin 75mg and methylcobalamine 1500mcg , tab linezoild 600mg , tab telmisartan 40mg , tab telmisartan 80mg , tab imatinib 400mg , inj artesunate 60mg , tab gliclazide xr 60mg , tab trihexyphenidyl hcl 2 mg , tab resperidone 2mg , tab betamethasone 1mg , cap alfacalcidol vit d3 0 . 25mcg , tab paroxetin cr 25mg , tab thyroxin 125mcg , tab thyroxin 100mcg , tab thyroxin 75mcg , tab tenagliptin 20mg , tab pantoprazole 40mg , tab carbimazole 5mg , tab labetalol hcl 100mg , tab glipizide 5mg , tab acenocoumarol 1 mg , tab acenocoumarol 2mg , tab fexofenadine hydrochloride 120 mg , tab amoxycillin 500mg +clavulanic acid 125mg , tab amoxycillin 875mg + clavulanic acid 125mg , tab acarbose 50mg , tab diclofenac sodium , paracetamol and chloroxazone , tab enalapril 5mg , tab ethambutol 400mg , tab ethambutol 800mg , tab imipramine 25mg , tab frusemide 20mg + spironolactone 50 mg , tab levetiracetam 500mg , tab levetiracetam 1000mg , tab losartan 50mg and hydrochlorothiazide 12 . 5 , tab lansoprazole 15mg , tab lansoprazole 30mg , tab isosorbite dinitrate 10mg , tab nitrofurantoin 100mg , cap itraconazole 100mg , tab pre biotic , tab rabeprazole 20mg , tab sodium valporate 500mg , tab vit e 400mg , syp levetiracetam , syp azithromycin bott of 100ml , syp b complex bott of 200ml , syp cyproheptadine hcl , 2mg /5ml bott of 60 ml , syp piracetam , syp sulphamethoxazole 200 mg and trimethoprim 40mg per 5ml bottle of 50ml , syp enzyme bott of 200ml , syp calcium and vit d3 , drop enzyme 200ml , drop vit d3 bott 60ml , drop calcium , oint benzoyl peroxide 5% tube of 20gm , oint triamcinolone 0 . 1% cream , oint acyclovir 5% , oint clobetasol propionate and fusidic acid 2% , oint topisal 3% , oint topisal 6% , oint tacrolimus 3% , cream fusidic acid 2% , of 10gm tube , cream aziderm 10% , cream luliconazole , cream emcure , cream glycolic acid 6% , cream glycolic acid 12% , cream ketoconazole , cream hydrocortisone , silver sulphadiazine 1% cream , jar of 500gm , lotion beclomethasone , lotion minoxidil 2% bott of 60 ml , lotion minoxidil 5 % bott of 60 ml , mdi salbutamol 100 mcg + ipratropium 20 mcg ( duolin ) , mdi seroflo 125mcg , mdi seroflo 250mcg , mdi tiova , mdi ipratropium bromide ( ipravent ) , rotacap ipravent bott of 30 , rotacap formoterol 6 mg + budesonide 200mg ( foracort 200 ) , para dichlorobenzene 2% w/v benzocaine 2 . 7% w/v chlorbutol 5% , turpentine oil 15% , w/v ) bott of 10 ml , nasal spray fluticasone , nasal azelastine spray , l s belt size medium , l s belt size large , ecg electrodes ( disposable ) , l s belt size xl , folleys catheter size 14fr , tube feeding smooth plastic infant 38 cm long , 8 f with red flexible connector , tube feeding smooth plastic infant 38 cm long , 10 f with red flexible connector , urine collection container , urine collection bag 450ml , insulin syringe 1ml , vaccum blood collection tubes with needles : sterile tube with gel 5ml , vaccum blood collection tubes with needles : sterile tube with out gel 5ml , vaccum blood collection tubes with needles : edta , vaccum blood collection tubes with needles : sodium fluoride 3ml , pmo line , sterile gloves size 7 , sterile gloves size 6 . . 5 , three way stop cock , silicon heel cusion pad , bandage dvt stocking small , bandage dvt stocking medium , bandage dvt stocking large , kits for estimation of hdl cholestrol kit 20x5ml ( erba ) , stromatolyser , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , malaria ag kit ( 1x40 ) ( sd ) , kit dengue rapid ( j mitra ) , snap pack , hiv 1 & 2 rapid test , widal kit 4x5ml ( tulip ) , sodium hypochlorite 5% , salmenolla typhoid igm/igg kit ( sd ) , enema sodium phosphate pack of 100ml , film x ra...

Rajasthan University Of Health Science - Rajasthan

19311579 supply of chemicals and regents for microbiology mannitol, mannitol salt agar, mccartney bottle, methyl red powder, microcentrifuge tube with cap capacity 2 ml, mr vp medium (glucose phosphate broth), muller hinton agar, n acetyl l cysteine, n naphthyl ethylene diamine dihydrochloride, n,n,n,n tetra methyl p phenylenediamine dihydrochloride, nigrosin 10%, nutrient agar, oxacillin powder, oxidase disc, peptone water, perforated bucket (red, blue) 15 litre double bin, petridish glass 100 mm, petridish glass 75 mm, ph indicator strips 6.5 to 9 ph measurement, phenol, pottasium dihydrogen phosphate, pregnancy test card, ra factor kit, readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml, readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml, robertson cooked meat medium readymade, rpr rapid test card, sabraud’s dextrose agar, selenite f broth bacteriological, sim agar, simmons citrate agar, sodium chloride, sodium hydroxide pellets, sodium hypochlorite solution, sterile autoclavable skirted plate 96 wells x 0.3 ml, sterile readymade plates of blood agar (90 mm size), sterile readymade plates of macconkey agar (90 mm size), sterile readymade plates of nutrient agar (90 mm size), sterile storage vial 2 ml capacity, sterile storage vial 5 ml capacity, sterile transport medium (stuart medium) with test tube and swab individually packed, stool container with spoon, sulphanilamide, tcbs, triple layer mask, trypticase soya broth, tsi agar, urea agar base, viral transport medium, widal slide test, wilson and blair medium, xylene, xylose, ds dna elisa kit, gram stain kit, hbeag elisa kit, herpes simplex virus (hsv 1 & 2) igg elisa kit, herpes simplex virus (hsv 1 & 2) igm elisa kit, resazurin powder, rubella igg elisa kit, rubella igm elisa kit, sterile readymade plates of dca (90mm size), sterile readymade plates of tcbs (90mm ), toxoplasma igg elisa kit, toxoplasma igm elisa kit, vancomycin powder,...

Rajasthan University Of Health Science - Rajasthan

19311573 supply of chemicals and regents for microbiology absolute ethanol, acetone, afb (zn acid fast kit), agar powder (bacteriological grade), albert’s stain (a+b each), alkaline peptone water, anaerobic system envelope with palladium catalyst (gas pak), alpha naphthol ar, aniline, anti hbc igm elisa kit, anti hbe ab elisa test, anti hbs antibody elisa test kit, antinuclear antibody (ana) elisa kit, autoclave indicator strip, biodegradable plasic bags (yellow, red, blue, black), bleaching powder, blood agar base, blood culture bottle (adult) – glass bottle of 100 ml capacity with, of aluminum with rubber cork in it., brain heart infusion broth, chikungunya rapid test kit for igm, chlamydia trachomatis igm elisa kit, cled media, conc. h2so4, corn meal agar, cover slips 22 x 22 mm, crp test kit, cytomegalovirus (cmv) igg elisa kit, cytomegalovirus (cmv) igm elisa kit, deionized water, dengue ns1 antigen elisa kit, dengue rapid test card, dengue rapid test card along with ns1 antigen, deoxycholate citrate agar, di sodium hydrogen phosphate, discarding plastic buckets (yellow, red, blue, black) 20 litre, disposable individually packed centrifuge tube conical bottom capacity 50 ml, disposable polythene gloves, disposable sterile test tube with swab individually packed, dubos medium, ecoshield, edta powder, face mask, ferric chloride, filter paper box whartman no. 1, 12.5 cm circular, filter paper sheet whartman no. 1, fluid thioglycollate broth (anaerobic) with indicator, formalin pellets, glass marking pencils (red, white), glass test tube 100 mm x 12 mm without rim, glass test tube 75 mm x 12 mm without rim, h2o2 (30%), hav igm elisa kit, hcv igm elisa kit, hev igm elisa kit, koh pellets, kovcks indole reagents, l arginine, l lysine mono dihydrochloride, lactophenol cotton blue solution, liquid paraffin, loeffler serum medium base bovine serum, lowenstein jensen medium, macconkey agar, macconkey broth, malaria rapid test card (antigen), maltose,...

Indian Army - Rajasthan

17869489 supply of consumables and expendable medical stores : 33 hdl cholestrol kit ( 4x50 ml ) ( erba ) 34 highprofile microtome blades silver ( pkt of 50 ) 35 hiv antibody 1 & 2 detection elisa kit for 96 tests 36 hiv rapid test kit of 30test 37 kit for estimation of creatinine ( 4x50 ml ) ( erba ) 38 kit for estimation of sgot ( 10 x 10ml ) 39 kit for estimation of urea ( 5x20 ml ) ( bertholet reaction method ) ( erba ) 40 ldh test estimation kit ( kit of 5 x 10ml ) 41 leishman stain bott of 500 ml 42 mac conkey agar bott of 500gm 43 methylene blue ( must mention size of bott ) 44 micro abst disc amikacin 45 micro abst disc cefepime 46 micro abst disc cefotoxime 47 micro abst disc ceftazidime 48 micro abst disc ciprofloxacin 49 micro abst disc clindamycin 50 micro abst disc gentamycin 51 micro abst disc nalidixic acid 52 micro abst disc netilmycin 53 micro abst disc nitrofurantoin 54 micro abst disc norfloxacin 55 micro abst disc ofloxacin 56 micro abst disc oxacillin 57 micro tips 1000 μl pack of 1000 58 micro tips 200 μl pack of 1000 59 microscopic cover slips sunbeam 18 mm ( 14gm ) 60 microscopic slides 75 x 25 x 1.35 mm 61 multi strip for urine estimation for urine auto analyser 62 occult blood kit ( kit of 50 tests ) 63 pap stain kit 64 parafin wax 60 degree 2kg pkt 65 pediatric blood culture bottle 66 pregnancy test kit ( one step kit of 100 tests ) 67 printer roll ( sysmex ) 57mm x 20mtr 68 prothrombin test kit ( isi value less than 1.1 ) 1 x 5ml 69 pttk test kit 70 ra factor test ( 50 test kit ) 71 rapid test for malaria pan / p.f antigen ( 40 test kit ) ( erba ) 72 raticulin stain 73 serum anti a1 lactin ( bott of 5 ml ) 74 serum anti d for saline tube test 75 serum haemagglutnating gp a ( anti b monoclonal ) 76 serum haemagglutnating gp b ( anti a ) monoclonal 77 sgpt test kit ( erba ) ...

Indian Army - Rajasthan

17869484 supply of consumables and expendable medical stores : 1 absolute alchohol ( ethonol ) ( must mention size of bott ) 2 aerobic blood culture bottle ( must mention size of bott ) 3 albumin kit ( 20 x 5ml ) ( erba only ) 4 alkaline phospate test kit ( 6 x 5ml ) erba only 5 amylase test kit ( 2x50 ml ) 6 anaerobic blood culture bottle ( must mention size of bott ) 7 aso titre estimation kit ( kit of 50 test ) 8 bilirubin direct estimation test kit ( 4 x 50 ) 9 blood agar ( must mention size of bott ) 10 blood culture bottles bact alert ( 25 x 1 ) 11 blood glucose test kit ( 5x100 ml ) 12 broth maconkey ( d s ) 500 gm bottle with neutral red ( water culture media ) 13 chloroform ar ( analytical grade ) 500ml bottle 14 cholesterol estimation test kit ( 5 x 30 ml ) 15 ckmb test kit ( tulip ) 16 cled agar 500gm bottle 17 cpk ( ck nac ) ( uv kinetic method ) estimation kit ( kit of 30 test ) 18 crp test kit 19 csf protein kit 2x50ml 20 dengue rapid test to detect ns1 ag and igg and igm ( kit of test ) 21 distilled water jar of 5 ltr 22 filter paper small ( pkt of 100 ) ( whatman ) 23 formaldihyde solution jar of 5 ltr 24 formaline bott of 500ml 25 glass, coverslip microscope, rectangular ( 22 mm x 50 mm ) , 0.127 mm thick, pkt of 14 g 26 glucose for gct test pkt of 500gm ( glucon d ) 27 glucose kit ( 2 x 200ml ) ( erba ) 28 gram stain 29 hbsag elisa test ( kit of 96 tests ) 30 hbsag rapid test ( kit of 30 tests ) 31 hcl bott of 500ml 32 hcv elisa test kit ( kit of 96 tests ) ...

Government Medical College - Rajasthan

17128231 tender for disposable items use for laboratory testing anti special repair ( blood bank ) part c supply of disposable items plain disposable screw cap edta k2 screw cap and round bottom, blood collection vial. test tube, , vaccutainer, normal saline, liquid soap, sodium hypao chloride soln, disposable blood lancets, adhesive fabric plaster strip, sprit swab, swab stick, cross match and blood grouping tiles,tissue paper roll, polythylene disposable gloves packet, permanent marker pen, kitchen scale, measurement, single piece molded glass filed polycarbonoted tray, povidone iodine spray, antiseptic spray, thermocol boxes with prefixed specified label, disposable nd biodegradable printed carry bags, ready to use blood culture bottles to use blood culture bottles with liquid bhi broth media, ...

Medical College - Rajasthan

16446405 supply of microbiology 342 soyabincasin digest broth 343 l.j. medium base 344 miu medium 345 xylose lysine deoycholate agar 346 c.l.e.d. agar with andrde indicator 347 cooked meat medium broth 348 mannitol salt agar 349 phenol phthelinediphosphate agar 350 gelatin agar 351 sugar assimilation media ( nitrogen base ) 500gm ( 1 pkt ) 352 hi combi dual performance media ( blood culture ) 353 bact alert blood culture bottle ( adult ) 354 bact alert blood culture bottle ( paediatric ) 355 yeast nitrogen base 356 muller decarboxylase list of miscellaneousitems 357 dustbin ( red yellow black blue ) 25 it. 358 deionised triple distilled water reagent grade with conductivity <1.0 359 teasing needle for fungus 360 nichrome wire 26g 361 adjustable loop holder 362 self adhesive autoclvable tape ( 18mmx50mt ) lx250no 363 self adhesive dry heat tape ( a8mmx50mt ) 364 hand guard disinfectant gel 365 hi spark alkaline clear solution biodegradable...

Government Medical College - Rajasthan

16342169 supply of various type of test kits and regent for microbiology department 35 magnifier hand lens 36 stop watch 37 universal sterile container screw cap 30ml capacity 38 blood culture bottle ( 120 ml ) capacity with aluminum screw cap with rubber lining of cap. 39 micropipette fixed 20ul 40 micropipette fixed 50ul 41 micropipette fixed 100ul 42 micropipette variable 5 50ul 43 micropipette variable 10 100ul 44 micropipette variable 100 1000ul 45 antiseptic soap for hand wash 46 hand sanitizer 200 ml 47 sample collection tube with screw cap 10ml capacity ( plastic ) 48 tissue paper roll ( toilet type ) 49 nichrome loop d 1, 1.3mm diameter 50 nichrome straight wire 51 widal tubes drayers tubes 52 widal tubes felix tubes 53 glass flask ( 500 ml capacity ) 54 glass flask ( 250 ml capacity ) 55 glass flask ( 150 ml capacity ) 56 aluminum bucket ( 6x 6 inches ) 57 aluminum bucket ( 8x8 inches ) 58 mask ( sterile ) 59 whatman filter paper grade 1 60 postmartum |gloves ( 7.5 inches ) 61 match box 62 glass bottle with aluminum cap for l.j. medium ( 80mm x 20 mm ) 63 hi flexi loop 2 sterlized flexible loop 2.2 mm diameter...

Government Medical College - Rajasthan

16235745 supply of various type of test kits and regent for microbiology department 35 magnifier hand lens 36 stop watch 37 universal sterile container screw cap 30ml capacity 38 blood culture bottle ( 120 ml ) capacity with aluminum screw cap with rubber lining of cap. 39 micropipette fixed 20ul 40 micropipette fixed 50ul 41 micropipette fixed 100ul 42 micropipette variable 5 50ul 43 micropipette variable 10 100ul 44 micropipette variable 100 1000ul 45 antiseptic soap for hand wash 46 hand sanitizer 200 ml 47 sample collection tube with screw cap 10ml capacity ( plastic ) 48 tissue paper roll ( toilet type ) 49 nichrome loop d 1, 1.3mm diameter 50 nichrome straight wire 51 widal tubes drayers tubes 52 widal tubes felix tubes 53 glass flask ( 500 ml capacity ) 54 glass flask ( 250 ml capacity ) 55 glass flask ( 150 ml capacity ) 56 aluminum bucket ( 6x 6 inches ) 57 aluminum bucket ( 8x8 inches ) 58 mask ( sterile ) 59 whatman filter paper grade 1 60 postmartum |gloves ( 7.5 inches ) 61 match box 62 glass bottle with aluminum cap for l.j. medium ( 80mm x 20 mm ) 63 hi flexi loop 2 sterlized flexible loop 2.2 mm diameter...