34096956 supply of bfsi bfsi , computer system core i3, 7th gen., 3.9 ghz, 4gb ram, 1tb hdd, dvd, usb drives, speakers, keyboard, mouse, operating system win10, 3 year onsite warranty , ups 600 va, input 140 / 300 volts, bis / ce certified. , work station 01 computer table ( size 4’ x 2’ x 2’.6” ) &03 no. student chair , trading software currently available educational software’s for trading for class 9 12 students. ( multiuser ) , core banking software currently available banking software for educational / training purpose for class 9 12. ( multiuser ) , technical analysis software meta stock, falcon or currently available related software for educational purpose for class 9 12 students. ( multiuser ) , accounting software tally or related product for educational purpose ( multiuser ) , networking lan to be done using cat6 cable 50mtr, switch 24 port, i / o box 10nos., 20 rj45 connectors, 50 mtr.patch card. , internet connection high speed broadband. bsnl / airtel / idea / jio / othres any as per availability ) , writing board with white board marker and duster 6’ x 4’ white board, 4 color white board marker in a pack of 10 each color, 01 duster , projector portable projector hdmi interface, 3300 lumens, 50 watts, screen resolution: 1024 x 768, connector type: usb, hdmi, vga weight around 2.4 kg approx. , projector screen projector screen in 4:03 ratio aspect, ultra hd & 4k technology, 3d active projector screen 120 inch 8ft. ( w ) x 6 ft. ( h ) , multimedia speaker 2.1 any good brand 40 watt rms ( subwoofer 20w + satellite 10w x 2 ) , 2.1 multimedia speaker with bluetooth and multiple playback options – bt / usb / sd / aux, weight around 2.5 to 3 kg. , electrical work ( includes isi wiring and fitting ) 1 mcb 32 amp fixing of 01no. 2 power point with 3 socket per board fixing of 04 board per lab. 3 ceiling fan 02 nos. includes wiring and fitting. 4 exhaust fan 01 no. includes wiring and fitting. 5 tube light 03 nos. with complete fitting and fixtures. , laser printer function print / copy / scan, cartridge facility, 2400x600 dpi, mono print resolution / duplex, 2 side copy, 30ppm , air conditioner ( ac 1.5 ton / 2 ton depending on the room size ) split ac with inverter, with 4 star energy rating, 5 year warranty in total and 5 years separate warranty for compressor. , fire extinguishers 1 co2 type fire extinguisher for electrical equipment’s, minimum 4.5 kg, 1 abc type fire extinguisher for lpg, minimum 4.5 kg , frist aid kit must contains all major first aid accessories: crepe bandage , adhesive bandage, adhesive bandage round, pain relief gel, povidone iodine ointment, oral clinical thermometer, antiseptic liquid, absorbent cotton i.p., micro porous surgical tape, paracip / parachoice, gauze swab, roller gauze, a pair of scissors, first aid leaflet sticker...

Indian Army - Rajasthan

34083098 purchase of medicines purchase of medicines out of echs fund for fy 2022 23 , drugs , tab acitrom 4 mg ( nicoumalone ) , tab zolpidem 10 mg , tab sevelamer 400 mg , tab amlodipine 5+ atenolol 50 mg , tab allopurinol 100 mg , tab amlodipine 10 mg , tab baclofen 10 mg , tab betahistidine 8 mg , tab cinnarazine 25 mg , tab alfa ketoanlogue , tab fenofibrate 200 mg , tab febuxostate 40 mg , tab levetiracetam 500 mg , tab ketorolac 10mg , tab sodium valporate 200 mg , tab / cap heamatinic containing ferrous fumarate 350mg and above, vit b 12 1 3 mcg and above folic acid 400 600 mcg and above vit c 75 90mcg and above , tab acenocoumarole 1 mg , tab diltiazem 60 mg , tab digoxin 0.25 mg , tab olanzapine 5 mg , tab prednisolone 20 mg , tab bisoprolol 5 mg , tab cilnidipine 5 mg , tab alendronic acid 70 mg , tab nicorandil 10 mg , tab isosorbide dinitrate 10 mg , tab bisacodyl 5 mg , tab apixaban 2.5 mg , tab vildagliptin 50 mg , tab piroxicam 20 mg , tab pioglitazone hydrochloride15 mg , cap alfacalcidol vit d3 0.25 mg , anti cold ( paracetamol+ cetrizine+ chlorpheneramin ) , tab sodium bicarbonate 500 mg , tab alprazolam 0.25 mg , tab clonazepam 0.5mg , tab propranolol 40 mg , tab enalapril 5 mg , tab telmisartan 40 mg + hydrochlorothiazide 12.5 mg , tab enalapril 2.5 mg , tab enalapril maleate 10 mg , tab fluoxetine 20 mg , tab duloxetine 20 mg , tab lorazepam 1 mg , tab risperidone 2 mg , tab olanzapine 10 mg , tab phenobarbitone 30mg , tab pheniramine maleate 25 mg ( avil 25mg ) , tab venlafaxine 37.5 mg , tab vitamin e 200 mg , tab glucosamine 250 mg + chondroitin sulphate 200 mg , tab ranolazine500 mg , tab propranolol 20 mg , tab silodosin 8 mg , tab ticagrelor 90 mg , tab leflunamide 10 mg , tab levosulpride 25 mg , tab atorvastatin 10 mg + asprin 75 mg , tab carbamazepine 200 mg cr , tab etorcoxib 120 mg , tab lithium carbonate 400 mg , tab ondasterone 8mg , tab metoprolol 25 mg , tab prednisolone 5mg , tab metformin 500mg+ vildagliptin 50mg , tab chlorzoxazone 500mg+ diclofen sodium 50 mg+ paracetamol 325 mg , tab ivabradine 5mg , tab deflazacort 6 mg , inj rabies vaccine vial of 1 ml , inj anti tetanus immunoglobulin / tetanus immune globulin ( tig ) & tetanus antitoxin 250 iu , inj pantoprazole40mg , inj ferric hydroxide sucrose complex 20 mg in 5ml for injection , inj vitamin b1 ( 100mg ) b2 ( 100mg ) & b12 1000mcg with stablity , oint ketoconazole cream 2% 30 g , oint betamethasone + salicylic acid, tube of 10 gms & above , oint clindamycine phosphate 1% tropical gel tube of 10gm , oint clobetasol propionate 0.05%in tube of 10 gm with salicylic acid , lotion chlorhexidine mouth wash , pulv clotrimazole 1% bott of 75 g , ketoconazole shampoo 2% w / w bottl of 60 ml , isabgol / ispaghula husk 3.5 gm , nasal drop xylometazoline hcl 0.1% bott of 10 ml , e / d ciprofloxacin 0.3%+ dexamethasone 0.1% ) , eye drops ciprofloxacin 0.3% 3mg / ml vial of 5 ml , eye drops flurbiprofen sodiumophthalmic solution0.03%vial of 5 ml , eye drops gatifloxacin 0.3% bott of 5 ml , eye drops moxifloxacin 0.5% preservative free bott of 5ml , e / d candibiotic ( lidicaine 2%+clotrimazole 1% ) , e / d sustane ultra ( polyethylene glycol+ propyleen ) , eye drops sulphacetamide , eye drops travoprost 0.004% bott of 2.5 ml , syp sucralfate suspension bott of 200 ml , syp antacid antigas gel , syp cremaffin white each 15 mlcontaingmilk of magnesia1125 ml, liq paraffin3.75 mlbott of 170 ml , syp lactulose syp each 5ml , syrup bromhexine bottle of 100 150 ml , mdi inhaler beclomethasone dipropionate 50 mcg and levo salbutamol sulphate 50 mcg per metereddose aerosol, 200 dose ( eg aerocort ) , mdi tiotropium bromide 9 mcg, 120 metered doses / unit , mdi salmeterol 25 mcg + fluticasone 250 mcg autohaler , mdi duolin ( levo salbutamol 50+ ipratropion 20 mcg 200 dose ( , mdi inhaler formoterol 6 mcg and budesonide 400 mcg cfc free ( 120 doses ) , insulin disposable syringe 1 ml 100 iu , urine collecting bag with volume meter , gauze surgical, open wove, unmedicated: 60 cm wide , bandage crepe: 10 cm , cervical coller soft m , hydroxymethylecellulose , band aid , bandage open wove uncompressed: 6 cm x 4 metres , cotton wool, absorbent pkt of 500 gm , levo salbutamol sulphate, 2.5 ml, containing 1.25 mg, respule , knee cap size assorted size ( large, m, xl, xxl ) , budesonide 0.5 mg respules , gamma benzene hexachloride 1% w / v, cetrimide 0.1% w / v in alcoholic solution bott of 100 ml , follys catheters 16 , hand gloves, size 7 pair of , syringe dosposable, plastic sterile, 10 ml with needle , syringe disposable, plastic, sterile, 2 ml with needle , syringe disposable, plastic, sterile, 5 ml with needle , tab methylcobalamin500 mcg , tab clinidipine 10 mg , tab amlodipine 2.5 mg , tab atorvastatin 20+ecosprin 75+ clopidogrel 75mg , tab atorvastatin 20 + ecosprin 75 mg , tab allopurinol 300 mg , tab itopride 50 mg , tab sitagliptin phosphate 50 mg , tab spironolactone 50 mg , tab carvedilol 6.25 mg , tab lorazepam 2 mg , tab librium 10 mg ( chlordiazepoxide 10mg ) , tab chlordiazepoxide 5+ clidinium 2.5 mg+ dicyclomine 10 mg , tab olmisartan 20 mg , tab olmisartan 40 mg , tab sevelamer 800 mg , tab rosuvastatin 10 mg , tab rosavastation 40 mg , tab glimipride 2mg + pioglitazone 15mg +metformin 500mg , tab gliclazide 80 mg , tab etiozolam 0.25 mg , tab eplerenone 25 mg , tab escitalopram 5 mg , tab escitalopram 20 mg , tab etiozolam 0.5 mg , tab flunnarazine 10 mg , tab febuxostate 80 mg , tab escitalopram 10 mg + clonazepam 0.05 mg , tab spironolactone 50+ torasemide 5 mg , tab metformin 500 +glimepride 1 mg , tab methotrexate 7.5mg , tab metformin 500+ glimepride 2 mg , tab methtylprednisolone5 mg , tab pioglitazone 30 mg , tab pantoprozole 40 mg + domperidone 30 mg , cap rabeprazole 20 mg+ domperidone 10mg , tab montelucast 10mg , tab memantine 5 mg , tab rabeprazole 20 mg , tab nicorandil 5 mg , tab oxcarbazepine 450 , tab nicoumalone 3 mg , tab nicoumalone 2 mg , tab acebrophylline 200 mg , tab acarbose 25 mg , tab mesalamine 800 mg , tab atorvastatin 40 mg , tab gaba m ( gabapentin 300mg+ methycobalamine 500mg ) , tab itraconazole 200 mg , tab gabapentin 400mg+nortriptylinr 10mg , tab donepezil 5 mg , tab diclofenac 50 mg + paracetamol 500 mg , tab diclofenac 50+ seratio 10 mg , tab asprin 75mg + clopidogril 75mg , tab tenagliptin 20 mg , tab mesalamine 1200 mg , tab thyroxine 125 mcg , tab thyroxine 100 mcg , tab thyroxine 25 mcg , tab carvedilol 10 mg , tab hydroxyzine 25 mg , tab hydrochlorothiazide 12.5 mg , tab telmisartan 80 mg , tab torsemide 20 mg , tab torsemide 5 mg , tab toleteridine 4 mg , tab telmisartan 20 mg , tab sodium valporate 500 mg , sulphasalazine 1000 mg delayed release tab , tab sodium valporate 300 mg , tab tolperisone 150mg , tab clonazepam 0.25 mg , tab losartan 50+ hctz 12.5 mg , tab diclofenac 50 mg + paracetamol 325 mg + serratiopeptidase 10 mg , tab silodosin 8mg dutasteride 0.5mg , tab gabapentine 100 mg , tab lamotrigene 100 mg , tab ketoconazole 200 mg , tab glyceryl trinitrate cr 6.4 mg , tab trimetazidine 35 mg , tab ursodeoycholic acid 600 mg , tab ursodeoycholic acid 300 mg , tab vasograin ( caffeine100+ergotamine1+paracetamol 250+prochlorperazine 2.5 mg ) , tab risperidone 2+ trihexyphenidyl 2 mg , tab merabegrrain 50 mg , tab metoprolol 12.5 mg , tab mebeverine 200 mg , tab nitrofurantoin 100 mg , tab methyprednisolone 4 mg , tab grisofulvin 25 mg , tab rivastigmine 1.5 mg , tab trazodone 25 mg , tab omega 3 fatty acid 1000mg , tab diltiazem120 mg , tab solifenacin 10 mg , tab tramadol hcl 50 mg , tab vitamin e 400 mg , tab calcium dobesilt 500mg , tab risperidone 1mg , tab tamsulosin 0.4 mg + dutasteride 0.5 mg , tab diclofenac 100 mg sr , tab / cap lystok ( lycopene +vit c & e +copper+chromium+zinc+selenium+manganese , tab / cap rutofine d ( trypsin 48 mg+bromelain 90mg+rutoside100+diclofenac 50 mg ) , tab voglibose 0.3 mg , tab ultracet ( paracetamol+tramadol ) , tab pregabolin 75 mg+ nortriptyline 10 mg , diclofenac spray 55 gm , inj huminsulin r ( soluble insulin injection ip 40iu / ml ) 10 ml , inj deriphyllin ( etofylline 84.7+ theophylline 25.3 mg ) , oint chlorhexidine gluconate + metronidazole + lignocain hydrochloric gel , inj insulin apidra ( insulin glulisine ) pen , tannic acid + zinc chloride + cetrimide liqued gel , eye drop timolol +brimonidine ( combigen ) , syp iron with folic acid and cynocobalamine , syp aristozyme liquid pineapple ( diastase and pepsin liquid ) , syp piracetam 100 ml , syp tricholine ciotrate 0.55 gm+ sorbitrol 7.15 gm , syp disodium hydrogen citrate 100 ml , follys catheters 14 , e / d nepafenac 0.1% , e / d soliwax ( benzocaine+paradichlorobenzene+chlo ) , e / d i tone , povidone iodine gargle 2% 50 ml , heel cusion on silicon , insulin syringe 40 iu , ung lignocane jelly 2% , micro disposable insulin needle , mdi asthalin ( salbutamol 100mcg ) , lumber belt size m, l, xl, xxl , nepro hp high protian powder 400 gm , neosprin powder , n / sazelastinehcl+ fluticosone nasal spray , r / c aerocort ( levosalbutamol +beclometasone mcg ) , rotahaler , ung annovate ( phenylephrine 0.10% +beclometasone 0.025% +lidocaine 2.5 % w / w ) 20 gm , ung silver sulphadoxin , ung terbinafine 10 gm , bandage dressing 10 cm , tab alfuzocin 10 mg , tab clobazem 5 mg , creape bandage 15 cms , tab cyproheptadine 4 mg , tab efavirenz 600 mg , tab finasteride 5 mg , tab gliclazide 60 mg , tab glucosamine 500 mg + msm , inh levosalbutamol aerosal pack of 200md , inj adrenaline , inj botulinum toxin 100 iu , i v fluid ringer lactate500 ml , tab leflunamide 20 mg , tab lopramide 2 mg , tab methotrexate 5 mg , tab nebivolol 5 mg , tab ofloxacin + ornidazole , oint betamethasone , oint tacrolimus 0.3 % , tab pacitane 2 mg ( trihexyphenydyl ) , tab paroxetine 25 mg , tab sertraline 50mg , tab betahistidine 16 mg , tab bisoprolol 2.5 mg , tab carvedilol 12.50 mg , tab cilnidipine 20 mg , tab cilnidipine 10 mg , tab cinnarazine 25 mg + domperidone 10 mg , tab clonazepam 1 mg , colostomy bag inner 01972 , colostomy bag outer 01755 , cotton roll 75 gms , cotton roll 200 gms , cotton roll 500gm , daflon 500 mg , desonide cream / oint , disposable mask , eye drop normo tear , elastoplast adhesive plaster 70 mm , tab empagliflogin 25 mg + linagliptin 5 mg , tab fenofibrate 160 mg , tab tamsulosin 0.4+ finasteride 5mg , fluticasone 0.05% w / w 10 gm , gbhc lotion 100 ml , glycerine 100 ml , gum paint , insulin pen needle , inj neurobion 3 ml , inj multivitamine amp of 10ml , inj methylcobalimine , inj ondasetron , inj tetnus toxoid 0.5 ml , inj nandrolone 25 mg , inj nandrolone 50 mg , inj nandrolone 100 mg , isapgol 100 gm powder , i v fluid normal saline 0.9500 ml , knee support l, xl, xxl , tab frusemide 20 mg + spironolactone 50 mg , tab levocarnitine 500 mg , tab lorazapam 2 mg , mouth wash chlorhexidine 150 ml , micropore 2.5 cms width , n 95 mask , oint clobetasol + gentamycin + miconazole , oint fusidic acid , oint mouth ulcer gel , tab ondansetron 4 mg , tab prednisolone 10 mg , tab rosuvastatin 10 mg + asprin 75 mg , tab shampoo selinium sulphide , palv sporlac sachets , tooth paste sensodent , tab thiocolchiside 4 mg , tab torsemide 5 mg +spiranolactone 25 mg , trypsin with chymotrypsin tab , tab ursodeoycholic acid 150 mg , sodium hypochloride 5 ltr , hepa merz sacets , povidine iodine vaginal tablets , adult diapers xl, xxl 10 pcs pkt , cap cyclosporin 50 mg , tab etizolam 0.5 mg + propanolor 20 mg hcl , tab acitrom 1 mg ( nicoumalone ) , tab gabapentine 300 mg + nortryptillin 25 mg , inj iron sucrose , oint miconazole , tab olmisartan 20 mg + amlodipine 5 + hctz 12.50 , tab olmisartan 40 mg + amlodipine 5 + hctz 12.50 , tab sulphasalazine 500 mg , tab tapentadol 50 mg , tab valgancyclovir 450 mg , urine strips , erbah 360 dil ( 20 litterkit ) , eliteh 360 clean ( 50 mlkit ) , eliteh 360 lyse ( 500 mlkit ) , control for ( hematology analysererbah360 ) , tab diltiazem ( controlled delivery ) 90 mg , tab quetiapine 50mg , abdominal support , tab aceclofenac 200 mg , tab acotiamide 100 mg , acne star soap , tab alprazolam 0.5 mg , tab amitriptyline 10 mg , tab amlodipine 5mg +metoprolol 50mg , ankle brace ( m, l, xl ) , asprin 75 mg + atorvastatin 10 mg capsule , asprin 75 mg + atorvastatin 20 mg capsule , asprin 75 mg + clopidogrel 75 mg tablet , asprin 75 mg+atorvastatin10mg + clopidorel 75mg capsule , tab calcium+calcitrol+zinc , cannula 18g , cannula 22 g , cannula 24 g , tab cefixime 200mg +ofloxacin , tab cefpodxime 200mg+cefixime 200mg , ensure protein powder , tab fluoxe+alprazolam , foley cather size 16 , tab flunarazine 10mg , tab isosorbide dinitrate 5mg , dnsbott of 100 ml , dextrose 5 %bott of 100 ml , liquor chloroxylenol ( dettol ) , tab losartan 50+ amlodipine 5 mg , tab propranolol 20 mg + clonazepam 0.5mg , tab propranolol 20 mg + alprazolam 0.25mg , r / c formetrol +budesonide , r / c foracort 200 mcg , r / c levosulbutamol 100 mcg pack of 30cap , tab sildosin 8mg +dutastaride 0.5mg , spirited methylated , syp combiflam ( pcm +ibuprofeen ) , syp cough ( bromhexine hcl +ammonium chloride + dextromethorphen ) bott of 100 ml , syp cough ( phenylephrine +chloepheniramin + dextromethorphen ) bott of 100 ml , syp cough ( ambroxol 15 mg / 5 ml +guaifenesin50 mg / 5 ml +terbutaline 1.25 mg / 5 ml ) bott of 100 ml , syp febrex plus ( pcm+phenylephrine +chlorpheniramine ) 100 ml bott , milk of megnesia , tamsulosin 0.4 mg + am;lodip 5 mg +hctz 12.5 mg , tenagliptin + metformin 500 mg tablet , iv set , multi vit drops ( child ) , estimation of sgot kit of 100ml , kit for estimation of bilirubin kit of 4x 60ml , vacutainer edta tube , s . calcium kit , total protein kit ( span ) , albumin kit ( span ) , total cholesterol kit ( erba ) , glucose kit ( erba ) , rapid malaria test card , widal kit of 4 x 5 ml , dengu cards ( jmitra ) , glucose strip ( control d ) 50 strip pack , tippes yellow , blood urea erba kit , serum triglyceride kit ( erba ) , hdl cholesterol ( erba ) , serum amylase kit ( span ) , s. creatinine kit ( erba ) , alkaline phosphatase kit ( span ) , urine strip , sgpt kit , uric acid kit , hydrochloric acid n / 10 solution 500 ml , sodium citrate solution 3.8 % 500 ml , urine container small for lab test , tab alendronate sodium 70mg , tab tacrolimus 0.5mg , tab tacrolimus 1mg , surgical gloves 6.5size , surgical gloves 7.5size , syp cyproheptadine 100ml , syp multivitamine bott , tab zudovudine 300mg+lamivudine 150mg , tab ademetionine 400mg , ra factor kit , triglyceride kit , mp card , tab sofobuvir 400mg velpatavir 100mg...

Medical And Health Services - Rajasthan

34045938 rate contract for surgical & sutures for mndy sr. no. drug code drug name packing unit 1 r1 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 1x12 foils 2 r2 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 1x12 foils 3 r3 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 4 r4 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 1x12 foils 5 r5 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 1x12 foils 6 r6 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 7 r7 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 1x12 foils 8 r8 absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) 1x12 foils 9 r9 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm 1x12 foils 10 r10 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm 1x12 foils 11 r11 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm 1x12 foils 12 r12 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm 1x12 foils 13 r13 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm 1x12 foils 14 r14 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed 1x12 foils 15 r15 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) 1x12 foils 16 r16 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm 1x12 foils 17 r17 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) 1x12 foils 18 r18 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm rc not exists 19 r19 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm 1x12 foils 20 r76 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) 1x12 foils 21 r77 chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) rc not exists 22 r80 chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) 1x12 foils 23 r20 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) 1x12 foils 24 r21 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) 1x12 foils 25 r22 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) 1x12 foils 26 r23 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) 1x12 foils 27 r24 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) 1x12 foils 28 r25 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) 1x12 foils 29 r26 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) 1x12 foils 30 r27 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 31 r28 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 32 r29 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm 1x12 foils 33 r30 non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 rc not exists 34 r31 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) 1x12 foils 35 r32 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) 1x12 foils 36 r33 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) 1x12 foils 37 r34 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) 1x12 foils 38 r35 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) 1x12 foils 39 r36 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) 1x12 foils 40 r37 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm 1x12 foils 41 r38 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) 1x12 foils 42 r39 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm 1x12 foils 43 r40 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm 1x12 foils 44 r41 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) 1x12 foils 45 r42 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm 1x12 foils 46 r43 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) 1x12 foils 47 r44 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) 1x12 foils 48 r45 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) 1x12 foils 49 r46 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) 1x12 foils 50 r47 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) 1x12 foils 51 r48 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) 1x12 foils 52 r49 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm 1x12 foils 53 r50 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm 1x12 foils 54 r51 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm 1x12 foils 55 r52 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) rc not exists 56 r53 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 1x12 foils 57 r54 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) 1x12 foils 58 r55 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 59 r56 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 60 r57 non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm 1x12 foils 61 r75 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 1x12 foils 62 r78 b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) 1x12 foils 63 r79 b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) 1x12 foils 64 r82 absorbable surgical suture polyglyconate, monofilament sutures ( 1 / 2 circle oval rb contrast needle 20 26mm, suture length 70cm ) rc not exists 65 r81 absorbable surgical suture, sterilised surgical needled suture polyglyconate, monofilament sutures ( 1 / 2 circle oval rb needle 26 30mm needle, suture length of 70cm ) rc not exists 66 r61 absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) 1x12 foils 67 r62 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) 1x12 foils 68 r63 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) 1x12 foils 69 r64 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) 1x12 foils 70 r65 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) 1x12 foils 71 r66 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) 1x36 foils 72 r67 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) 1x12 foils 73 r68 absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 74 r69 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 75 r70 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm 1x12 foils 76 r71 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm 1x12 foils 77 r72 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm 1x12 foils 78 r73 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm 1x12 foils 79 r74 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm 1x12 foils 80 s140 eye pressure shield rc not exists 81 s141 eyelid occlusion dressing rc not exists 82 s138 core biopsy instrument with compatible co axial needle ( automatic disposal ) rc not exists 83 s139 disposable bone marrow biopsy needle rc not exists 84 s99.p2 sanitary napkin beltless with wings ( udan yojna ) 6 napkin / pack 85 s1 absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) piece 86 s3 asepto syringe with transparent bulb sterile, 60 ml rc not exists 87 s4 blood administration set blood transfusion set ( details in rc ) unit 88 s5.a gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 89 s5.b gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 90 s6.a gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 91 s6.b gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 92 s7.a gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 93 s7.b gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) pair 94 s8.a suction catheter, sterile.size: fg 5 ( details in rc ) each piece 95 s8.b suction catheter, sterile. size: f g 6 ( details in rc ) each piece 96 s8.c suction catheter, sterile. size: f g 8 ( details in rc ) each piece 97 s8.d suction catheter, sterile. size: f g 10 ( details in rc ) each piece 98 s8.e suction catheter, sterile. size: f g 12 ( details in rc ) each piece 99 s8.f suction catheter, sterile. size: f g 14 ( details in rc ) each piece 100 s8.g suction catheter, sterile. size: f g 16 ( details in rc ) each piece 101 s8.h suction catheter, sterile. size: f g 18 ( details in rc ) each piece 102 s8.i suction catheter, sterile. size: f g 20 ( details in rc ) each piece 103 s8.j suction catheter, sterile. size: f g 22 ( details in rc ) each piece 104 s9.a catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 105 s9.b catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 106 s9.c catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 107 s9.d catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 108 s9.e catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 109 s9.f catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 110 s9.g catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 111 s10.a infant feeding tube size 10fg ( details in rc ) each piece 112 s10.b infant feeding tube size 8fg ( details in rc ) each piece 113 s10.c infant feeding tube size 5fg ( details in rc ) each piece 114 s11 perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) unit 115 s12 perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) unit 116 s13 infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) unit 117 s14 insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 unit 118 s15.a sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) each piece 119 s15.b sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) each piece 120 s15.c sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) each piece 121 s15.d sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) each piece 122 s15.e sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) each piece 123 s16 mucus extractor sterile ( details in rc ) unit 124 s17.a nasal oxygen set, twin bore all sizes adult ( details in rc ) each piece 125 s17.b nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) each piece 126 s18 paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 127 s19 paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 128 s20 paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 129 s21 plaster of paris bandage 15cm x 2.7 mts / roll unit 130 s22 plaster of paris bandage 10cm x 2.7mts unit 131 s23.a ryles tube / nasogastric tube size: 10 ( details in rc ) each piece 132 s23.b ryles tube / nasogastric tube size: 12 ( details in rc ) each piece 133 s24.a ryles tube / nasogastric tube size:14 ( details in rc ) each piece 134 s24.b ryles tube / nasogastric tube size: 16 ( details in rc ) each piece 135 s24.c ryles tube / nasogastric tube size: 18 ( details in rc ) each piece 136 s25.a scalp vein set ( disposable ) size 18g ( details in rc ) each piece 137 s25.b scalp vein set ( disposable ) size 20g ( details in rc ) each piece 138 s25.c scalp vein set ( disposable ) size 22g ( details in rc ) each piece 139 s25.d scalp vein set ( disposable ) size 24 g ( details in rc ) each piece 140 s26 syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 141 s27 syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 142 s28 syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 143 s29 syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 144 s30.a surgical blade sterile, size 11 ( details in rc ) 100 blades / packet 145 s30.b surgical blade sterile, size 15 ( details in rc ) 100 blades / packet 146 s30.c surgical blade sterile, size 22 ( details in rc ) 100 blades / packet 147 s39.a sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) each piece 148 s39.b sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) each piece 149 s40 urine collecting bag, disposable 2000 ml ( details in rc ) unit 150 s41.a double j stent, sterile, both ends open size 4f, length 16 cm each piece 151 s41.b double j stent, sterile, both ends open, size 5f, length 20 cm each piece 152 s42.a double j stent, sterile, one end closed size 4f, length 16 cm each piece 153 s42.b double j stent, sterile, one end closed, size 5f, length 20 cm each piece 154 s43.a endotracheal tube, plain size 2.5 ( details in rc ) each piece 155 s43.b endotracheal tube, plain size 3 ( details in rc ) each piece 156 s43.c endotracheal tube, plain size 3.5 ( details in rc ) each piece 157 s43.d endotracheal tube, plain size 4 ( details in rc ) each piece 158 s43.e endotracheal tube, plain size 4.5 ( details in rc ) each piece 159 s43.f endotracheal tube, plain size 5 ( details in rc ) each piece 160 s43.g endotracheal tube, plain size 5.5 ( details in rc ) each piece 161 s43.h endotracheal tube, plain size 6 ( details in rc ) each piece 162 s43.i endotracheal tube, plain size 6.5 ( details in rc ) each piece 163 s43.j endotracheal tube, plain size 7 ( details in rc ) each piece 164 s43.k endotracheal tube, plain size 7.5 ( details in rc ) each piece 165 s43.l endotracheal tube, plain size 8 ( details in rc ) rc not exists 166 s43.m endotracheal tube, plain size 8.5 ( details in rc ) each piece 167 s44.a endotracheal tube, cuffed size 4 ( details in rc ) each piece 168 s44.b endotracheal tube, cuff size 4.5 ( details in rc ) each piece 169 s44.c endotracheal tube, cuff size 5 details in rc each piece 170 s44.d endotracheal tube, cuff size 6 ( details in rc ) each piece 171 s44.e endotracheal tube, cuff size 6.5 ( details in rc ) each piece 172 s44.f endotracheal tube, cuff size 7 ( details in rc ) each piece 173 s44.g endotracheal tube, cuff size 7.5 ( details in rc ) each piece 174 s44.h endotracheal tube, cuff size 8 ( details in rc ) each piece 175 s44.i endotracheal tube, cuff size 8.5 ( details in rc ) each piece 176 s44.j endotracheal tube, cuff size 9 ( details in rc ) each piece 177 s45 tracheostomy tube, plain all sizes ( details in rc ) each piece 178 s46 tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) each piece 179 s47.a abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) each piece 180 s47.b abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) each piece 181 s47.c abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) each piece 182 s73 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm piece 183 s74 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm piece 184 s79 sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) each piece 185 s80 bone wax sterilised 2.5 gram / packet 186 s82 skin graft knife blade ( sterile ) ( details in rc ) one pack each 187 s84.a k wire, length 375 mm; 1mm ( details in rc ) each piece 188 s84.b k wire, length 375 mm; 1.6mm ( details in rc ) each piece 189 s84.c k wire, length 375 mm; 1.8mm ( details in rc ) each piece 190 s85 face mask, disposable ( details in rc ) piece 191 s86.a surgical cap disposable ( for surgeons ) ( details in rc ) unit 192 s86.b surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) piece 193 s87.a foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 each piece 194 s87.b foldable intra ocular lense with injector ( details in rc ) 18 to 24 each piece 195 s87.c foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 each piece 196 s88.a standard pama intra ocular lenses ( details in rc ) 11 to 17.5 each piece 197 s88.b standard pama intra ocular lenses ( details in rc ) 18 to 24 each piece 198 s88.c standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 each piece 199 s89.a disposable sterile surgical rubber gloves size 8 inches, powdered pair 200 s89.b disposable sterile surgical rubber gloves size 8 inches, powder free pair 201 s90.a rubber examination gloves, non sterile, extra small ( details in rc ) dispenser box of100 gloves 202 s90.b rubber examination gloves, size small ( details in rc ) dispenser box of100 gloves 203 s90.c rubber examination gloves, size medium ( details in rc ) dispenser box of100 gloves 204 s90.d rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) dispenser box of100 gloves 205 s91 pressure monitoring line / high pressure extension line ( details in rc ) each piece in blister pack 206 s92 urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) each piece 207 s93 umbilical catheter for new born, all sizes ( details in rc ) each piece 208 s94 umbilical cord clamp ( details in rc ) each piece 209 s95 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) each piece 210 s96.a close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) each piece 211 s96.b close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) each piece 212 s98 bone cement rc not exists 213 s99.a sanitary napkin beltless ( details in rc ) 6 napkin / pack 214 s99.b sanitary pads belt type ( details in rc ) rc not exists 215 s99.p sanitary napkin beltless with wings ( details in rc ) rc not exists 216 s100 oxygen mask ( adult ) unit 217 s101 oxygen mask ( pediatric ) unit 218 s102 foleys catheter no. 14 ( detail in rc ) each piece 219 s103 nelaton catheter size 14 fg ( detail in rc ) each piece 220 s104 ecg electrode ( detail in rc ) each piece 221 s105 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) each piece 222 s106 sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) each piece 223 s107 urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) each piece 224 s108 urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) each piece 225 s109 vaccum suction set, 2.5 meter length ( detail in rc ) each piece 226 s110 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) each piece 227 s111 vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 228 s112 vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 229 s113 vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 230 s114 vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 231 s115 vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) each piece 232 s116 vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) each piece 233 s117 vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) rc not exists 234 s118 vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) rc not exists 235 s119 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) each piece 236 s120 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) each piece 237 s121 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) each piece 238 s122 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) each piece 239 s123 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) each piece 240 s124 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) each piece 241 s125 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) each piece 242 s126 nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) each piece 243 s127 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) each piece 244 s128 sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) rc not exists 245 s129 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) each piece 246 s130 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) each piece 247 s131 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) each piece 248 s132 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) each piece 249 s133 niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) each piece 250 s134 nebulization mask adult ( detail in rc ) each piece 251 s135 nebulization mask paediatric ( detail in rc ) each piece 252 s136 chemotherapy port and non coring needles ( adult ) ( detail in rc ) rc not exists 253 s137 chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) rc not exists 254 nrr 1 braided e caprolactone coated lactomer 1, 90cm gs 25, 37 40mm1 / 2 circle taper point each foil 255 nrr 2 braided e caprolactone coated lactomer 2 0 90cm gs 25, 3omm1 / 2 circle taper point each foil 256 nrr 3 braided e caprolactone coated lactomer 1 90cm gs 25, 37 40mm1 / 2 circle reverse cutting each foil 257 nrr 4 braided e caprolactone coated lactomer 1, 90cm gs 24 , violet 40mm 1 / 2 circle taper point each foil 258 nrr 5 braided e caprolactone coated lactomer 3 0 75cm c 14 , undyed 24mm 3 / 8 circle reverse cutting each foil 259 nrr 6 braided e caprolactone coated lactomer 2 0 90cm gs 21 , undyed 30mm 1 / 2 circle taper point each foil 260 nrr 7 braided e caprolactone coated lactomer 1 90cm gs 25 , undyed 37 40mm 1 / 2 circle reverse cutting each foil 261 nrr 8 braided e caprolactone coated lactomer 0 90cm gs 24 , violet 40mm 1 / 2 circle taper point each foil 262 nrr 9 braided e caprolactone coated lactomer 3 0 75cm cv 25 , violet 20 22mm 1 / 2 circle taper point each foil 263 nrr 10 braided e caprolactone coated lactomer 1 0 90cm gs 25 , undyed 37 40mm 1 / 2 circle reverse cutting each foil 264 nrr 11 polyglactin 910 violet braided, 1, 35 cm 1 / 2 circle reverse cutting ( heavy ) 23 mm each foil 265 nrr 12 polyglactin 5 0 rb oval ½ circle 16 mm 45 cm each foil 266 nrr 13 polyglactin 5 0 cc 3 / 8 circle 16 mm 45 cm each foil 267 nrr 14 polyglactin 6 0 micro point ¼ circle 8 mm 45 cm each foil 268 nrr 15 polyglactin 910, braided coated with antibacterial 2 / 0, 70 cm undyed with ½ circle 25 mm rb each foil 269 nrr 16 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cm size 3 0 each foil 270 nrr 17 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cm size 4 0 each foil 271 nrr 18 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cm size 5 0 each foil 272 nrr 19 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm each foil 273 nrr 20 absorbable surgical suture sterilized surgical needled suture loop monofilament polydiaxanone violet no 1 40mm1 / 2 circle reverse cutting length 90 cm each foil 274 nrr 21 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 2 0 rb 30 mm needle length 75 cm each foil 275 nrr 22 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 6 0 rb 17 mm needle length 90 cm each foil 276 nrr 23 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 6 0 rb 11 mm needle length 90 cm each foil 277 nrr 24 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 5 0 rb 11 mm needle length 90 cm each foil 278 nrr 25 absorbable surgical suture sterilized surgical single armed needled suture monofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm each foil 279 nrr 26 monofilament polyglyconate 1 150cm gs 25 loop, green 48mm 1 / 2 circle taper point each foil 280 nrr 27 monofilament polyglyconate 2 0, 75cm green 26 30mm 1 / 2 circle taper point each foil 281 nrr 28 monofilament polyglyconate 3 0, 75cm green 20 26mm 1 / 2 circle taper point each foil 282 nrr 29 monofilament polyglyconate 4 0, 75cm green 17 20mm 1 / 2 circle taper point each foil 283 nrr 30 polydioxanone voilet monofilament, 3 0, 70 cm, 1 / 2 circle taper point rb 1, 17mm, each foil 284 nrr 31 polydioxanone voilet monofilament, 4 0, 70 cm, 1 / 2 circle taper point rb 1, 17mm, each foil 285 nrr 32 polydioxanone monofilament ( voilet ) , 5 0, 70 cm 1 / 2 circle round body double needle 13 mm each foil 286 nrr 33 monofilament glycomer 1, 90cm gs 21 , volet 37mm 1 / 2 crcle taper pont each foil 287 nrr 34 monofilament glycomer 2 0 90cm gs 21 , volet 37mm 1 / 2 crcle taper pont each foil 288 nrr 35 non absorbable surgical suture, sterilized surical needled black braided silk with needle 1 / 2 circle round bodied 30 mm needle , length 70 cm size 2 0 each foil 289 nrr 36 silk reel 1 0 each foil 290 nrr 37 silk reel 2 0 each foil 291 nrr 38 silk reel 3 0 each foil 292 nrr 39 silk reel 4 0 each foil 293 nrr 40 braided polyester caoted with silicon 2 0 8x75cm 2xy 31 plgt , blue & white 16mm 1 / 2 circle tapercutting oval pledget each foil 294 nrr 41 braided polyester caoted with silicon 2 0 10x75 2xcv 305 pgt , blue & white 25mm 1 / 2 circle taper point oval pledget each foil 295 nrr 42 braided polyester caoted with polybutylate 2 0 8x75cm 2x plgt , blue & white 16mm 1 / 2 circle tapercutting oval pledget each foil 296 nrr 43 braided polyester caoted with polybutylate 2 0 10x75 2x plgt, blue & white 25mm 1 / 2 circle taper point oval pledget each foil 297 nrr 44 braided polyester caoted with silicon 2, 26mm 1 / 2 circle rc 75cm each foil 298 nrr 45 braided polyester caoted with silicon 5, 55mm 1 / 2 circle rc 75cm each foil 299 nrr 46 braided polyester caoted with polybutylate 2, 26mm 1 / 2 circle rc 75cm each foil 300 nrr 47 braided polyester caoted with polybutylate 5, 55mm 1 / 2 circle rc 75cm each foil 301 nrr 48 monofilament polypropylene with peg additive 3 0 90cm 2xvf 20 , blue 26mm 1 / 2 circle taper point each foil 302 nrr 49 monofilament polypropylene with peg additive 2 0 90cm 2xv 20 , blue 30mm 1 / 2 circle taper point each foil 303 nrr 50 monofilament polypropylene with peg additive 4 0 90cm 2xcv 23 , blue 17mm 1 / 2 crcle taper cut each foil 304 nrr 51 monofilament polypropylene with peg additive 5 0 90cm 2xcv 23 , blue 17mm 1 / 2 crcle taper pont each foil 305 nrr 52 monofilament polypropylene with peg additive 6 0 75cm 2xcv 22 , blue 13mm 1 / 2 crcle taper pont each foil 306 nrr 53 monofilament polypropylene with peg additive 7 0 60cm 2xkv 1 , blue 9mm 3 / 8 crcle tapercuttng each foil 307 nrr 54 polypropylene blue monofilament, 2 0, 90 cm 1 / 2 circle round body double needle 26 mm each foil 308 nrr 55 polypropylene blue monofilament, 3 0, 90 cm 1 / 2 circle round body double needle 26 mm each foil 309 nrr 56 polypropylene blue monofilament, 4 0, 75 cm 1 / 2 circle round body double needle 17 mm each foil 310 nrr 57 polypropylene blue monofilament, 5 0, 90 cm 1 / 2 circle round body double needle 17 mm each foil 311 nrr 58 polypropylene blue monofilament, 6 0, 75 cm 3 / 8 circle round body ( 380 microns ) double needle 13 mm each foil 312 nrr 59 polypropylene blue monofilament, no. 7 0, 60 cm 3 / 8 circle round body, taper point double needle 9 mm each foil 313 nrr 60 monofilament polybuetester coated with polytribiolate 6 0 75cm 2xcv 1x36 , blue 9mm 3 / 8 circle taper point each foil 314 nrr 61 monofilament polybuetester coated with polytribiolate 4 0 90cm 2xcv 23x36 , blue 17mm 1 / 2 circle taper point each foil 315 nrr 62 monofilament polybuetester coated with polytribiolate 7 0 60cm 2xmv 175 8 , blue 8mm 3 / 8 circle taper point each foil 316 nrr 63 monofilament polybuetester coated with polytribiolate 2 0 90cm 2xv 20x36 , blue 26mm 1 / 2 circle taper point each foil 317 nrr 64 monofilament polybuetester coated with polytribiolate 3 0 90cm 2xv 20x36 , blue 26mm 1 / 2 circle taper point each foil 318 nrr 65 non absorbable synthetic unidrectional dual cut angle barb with welded loop end made up with polybeutester size 1, 37mm, 30cm, 1 / 2 circle, tp each foil 319 nrr 66 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polybeutester blue size 2 0, 1 / 2 circle, 37mm, 30cm tp, each foil 320 nrr 67 absorbable synthetic unidirectional dual cut angle barbed with welded loop end made up with polyglyconate 2 0 26 30 mm 30 cm 1 / 2 circle taper point each foil 321 nrr 68 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 1 0, 1 / 2 circle, 37mm, 30cm tp each foil 322 nrr 69 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 2 0, 1 / 2 circle, 26mm, 30cm tp each foil 323 nrr 70 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 3 0, 1 / 2 circle, 26mm, 30cm tp each foil 324 nrr 71 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with glycomer blue size 2 0, 1 / 2 circle, 24mm, 30 45cm rc each foil 325 nrr 72 laproscopic knotless pga pcl surgical suture self fixation device with autolock mechanism made up of pga pcl unidirectional taper point 26 mm & 20 cm size 2 0 each foil 326 nrr 73 polyester ethylene terephthalate nonabsorbable surgical suture polyester suture is a nonabsorbable, braided, sterile, surgical suture composed of poly ( ethylene terephthalate. ) it is prepared from fibers of high molecular weight, long chain, linear polyesters 1 / 2 circle tapercut 2 x v 5 double needle 26 mm 90 cm green color size 2 0 each foil 327 nrr 74 laproscopic knotless pga pcl bidirectional taper point surgical suture self fixation device with autolock mechanism made up of pga pcl bidirectional taper point 17 mm & 32cm each foil 328 nrr 75 absorbable antibacterial polydiaxonone monofilament taper point surgical suture absorbable antibacterial suture made up of polydiaxonone coated with triclosan voilet monofilament 1 / 2 circle taper point ct 1 40 mm needle 90 cm suture size 1 each foil 329 nrr 76 absorbable antibacterial polydiaxonone monofilament taper point surgical suture absorbable antibacterial suture made up of polydiaxonone coated with triclosan voilet monofilament 1 / 2 circle taper point loop ct sgle armed 65 mm needle 122 cm suture size 1 each foil 330 nrr 77 laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab reverse cutting 36 mm & 45 cm suture size 1 each foil 331 nrr 78 laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab taper point 36 mm & 45 cm suture size 1 0 each foil 332 nrr 79 non absorbable surgical suture black braided silk 1 0 rb ½ circle 30 mm 90 cm each foil 333 nrr 80 non absorbable surgical suture black braided silk 1 0 rc 3 / 8 circle 45 mm 76 cm each foil 334 nrr 81 non absorbable surgical suture black braided silk 5 0 rc 3 / 8 circle 12 mm 76 cm each foil 335 nrr 82 non absorbable surgical suture black braided silk 5 0 rb 3 / 8 circle 16 mm 76 cm each foil 336 nrr 83 non absorbable surgical suture black braided silk 6 0 rc mp 3 / 8 circle 8 mm each foil 337 nrr 84 non absorbable monofilament 3 0 reverse cutting 24mm needle each foil 338 nrr 85 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 2 0 rb ½ circle 30 mm 70 cm each foil 339 nrr 86 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 6 0 rb micro point ¼ circle 8 mm 45 cm 2670 each foil 340 nrr 87 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 4 0 cc 3 / 8 circle 16 mm 45 cm 2442 each foil 341 nrr 88 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 3 0 cc 3 / 8 circle 16 mm 45 cm 2442 each foil 342 nrr 89 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 6 0 rc micro point ¼ circle 8 mm 45 cm 2670 each foil 343 nrr 90 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 5 0 cc 3 / 8 circle 16 mm 45 cm 2442 each foil 344 nrr 91 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 5 0 rb oval 1 / 2 circle 16 mm 45 cm each foil 345 nrr 92 endoloop ligature made with polyglactin suture length18 inch, narrow at one end and scored at other each foil 346 nrr 93 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) ( 3 / 8 cir micropoint royund body 6mm length 38 cm ) 9 0 each foil 347 nrr 94 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) ( 3 / 8 cir micropoint royund body 6mm length 38 cm ) 10 0 each foil 348 nrr 95 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm3 0 each foil 349 nrr 96 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm4 0 each foil 350 nrr 97 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm 5 0 each foil 351 nrr 98 non absorbale surgical suture sterlised surgical needle suture monofilament polypropylene blue 1 / 2 circle round body 13 mm needle length 75 cm 6 0 each foil 352 nrr 99 non absorbale surgical suture sterlised surgical needle suture monofilament polypropylene blue 1 / 2 circle round body 13 mm needle length 75 cm 7 0 each foil 353 nrr 100 non absorbale surgical suture sterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm3 0 each foil 354 nrr 101 non absorbale surgical suture sterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm4 0 each foil 355 nrr 102 non absorbale surgical suture sterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm 5 0 each foil 356 nrr 103 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 3 0 each foil 357 nrr 104 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 4 0 each foil 358 nrr 105 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 5 0 each foil 359 nrr 106 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 6 0 each foil 360 nrs 1 nonabsorbable polypropylene light weight macroporous mesh each unit 361 nrs 2 three dimensional monofilament polyester composite mesh with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial each unit 362 nrs 3 three dimensional monofilament polyester composite mesh with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial each unit 363 nrs 4 three dimensional monofilament polyester composite mesh with with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial each unit 364 nrs 5 absorbable 5 mm hernia mesh fixation device 30 screw shaped with proximal wings of pgla tacks of 4.1 mm length along with flexible shaft up to 3 cm. each unit 365 nrs 6 absorbable 5 mm hernia mesh fixation device 15 screw shaped with proximal wings of pgla tacks of 4.1 mm length along with flexible shaft up to 3 cm. each unit 366 nrs 7 non absorbable 5 mm hernia mesh fixation device with 30 helical shaped titanium tacks 3.96mm width and 0.61 mm diameter each unit 367 nrs 8 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatic polymer ( peek ) cap to avoid metal exposure with 15 fasteners each unit 368 nrs 9 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatic polymer ( peek ) cap to avoid metal exposure with 30 fasteners each unit 369 nrs 10 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 370 nrs 11 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 371 nrs 12 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 372 nrs 13 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 373 nrs 14 battery operated 60mm articulating endo cutter with a disposable battery pack, for enhanced distal tip stability while firing, having closed channel in the cartrdige jaw for better stability during firing, 360 degree rotation shaft and one handed natural articulation up to 45 degrees, precision machined anvil to deliver initial, system wide compression, wide proximal to distal jaw aperture ( proximal 8mm , distal 22mm ) , 3 point gap control for alignment and calibration throughout the 60 mm staple line, knife direction / reverse control to discontinue the firing and return the knife, interchangeable 6 row cartridge options of white, blue , gold, green and black, all fits down to 12mm trocar sleeve, 440 mm shaft length 60 mm stapler each unit 374 nrs 15 linear cutter 55mm with six rows, 3d staple formation, option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only each unit 375 nrs 16 linear cutter 75mm with six rows, 3d staple formation, option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only each unit 376 nrs 17 universal linear cutter cartridge 75mm open linear cutter compatible with selectable staple height linear cutter 75mm.option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only. 6 rows 3 d staple technology. each unit 377 nrs 18 universal linear cutter cartridge 55mm for open linear cutter compatible with selectable staple height linear cutter 55mm.option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only. 6 rows 3 d staple technology. each unit 378 nrs 19 curved cutter stapler 40 mm linear cutter simultaneous cutting and stapling each unit 379 nrs 20 curved green cartridge having close staple height of 2.0 mm, tactile feedback on completion of firing sequence, new anvil, knife with every catridge each unit 380 nrs 21 powered circular stapler 29 mm with 3d staple and not slip grip each unit 381 nrs 22 powered circular stapler 31mm with 3d staple and not slip grip each unit 382 nrs 23 circular stapler 33mm with controlled tissue compression with adjustable staple height ( 1.0 2.5 mm ) for controlled tissue compression, longer staple leg 5.5mm & non slip grip surface each unit 383 nrs 24 laparoscopic cartridge for stapler 60 mm blue, 1.5 mm closed staple height with gripping surface technology and six rows compatible with all range of endoscopic linear cutter 60mm each unit 384 nrs 25 laparoscopic cartridge for stapler 60 mm green, 2.0 mm closed staple height with gripping surface technology and six rows compatible with all range of endoscopic linear cutter 60mm each unit 385 nrs 26 pph stapler 33mm hemorrhoidal stapler kit consists of 33mm hemorrhoidal circular stapler ( with fixed anvil, adjustable closed staple height from 0.75 mm – 1.5 mm, staple open leg length of 5.5 mm ) , suture threader, circular anal dilator, purse string suture anoscope, suture for purse string. each unit 386 nrs 27 optically guided bladeless trocar 12mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer, 150mm length. each unit 387 nrs 28 optically guided bladeless trocar 12 mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer length 100mm. each unit 388 nrs 29 facial closure device contain optical bladeless trocar with facial closure device comaptible with clear cannula have two side opening meant for uniform port closure each unit 389 nrs 30 varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length each unit 390 nrs 31 varied staple height reloads / cartridges for 80 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length each unit 391 nrs 32 linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 60 mm tristaple gia stapler, compatible with tri staple gia 60 mm open linear cutter reloads / cartridges purpule and black each unit 392 nrs 33 eea circular stapler purple colour medium thick , triple row with tristaple technology ( three row of staple inner to outer row 3.0, 3.5 and 4.0 mm with sloped cartridges face in one stapler ) diameter 31mm each unit 393 nrs 34 linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 80 mm tristaple gia stapler, compatible with tri staple gia 80 mm open linear cutter reloads / cartridges purpule and black each unit 394 nrs 35 wound protector with double ring in small 2.5 6 cm usfda approved each unit 395 nrs 36 wound protector with double ring in medium 5 9 cm each unit 396 nrs 37 wound protector with double ring in large in size 9 14 cm usfda approved each unit 397 nrs 38 endo catch specimen removal kit:with continuous ring , polyurethane pouch with 34.5 cm shaft length , 10mm with leakproof and impervious material to cancer cells of 0.5 microns / pretied purse string on pouch usfda approved each unit 398 nrs 39 disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logic technology and digital display titanium clips u shaped each unit 399 nrs 40 laparoscopic liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 30mmcapable of loading all length cartridges on same gun only each unit 400 nrs 41 laparoscopic liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 45mm capable of loading all length cartridges on same gun only each unit 401 nrs 42 laparoscopic liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 60mm, capable of loading all length cartridges on same gun only each unit 402 nrs 43 hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, 9cm length, 16mm curved active blade with adaptive tissue technology capable of sealing blood vessels up to and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 9 each unit 403 nrs 44 hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, 17cm length, 16mm curved active blade with adaptive tissue technology capable of sealing blood vessels upto and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 17 each unit 404 nrs 45 advance bipolar hand activated probe with 5mm shaft diameter and 35 cm shaft length with 5 mm wide straight jaw design with seal length of 20mm and cut length of 16mm, sealing vessel upto and including 7mm through radio frequency energy and having a temperature controlled mechanism within the jaw and having articulation of 110 degree ( 55 degrees on both sides ) and capable of 360 degrees rotation each unit 405 nrs 46 advance bipolar hand activated probe with 5mm shaft diameter and 45 cm shaft length with 5 mm wide straight jaw design with seal length of 20mm and cut length of 16mm, sealing vessel upto and including 7mm through radio frequency energy and having a temperature controlled mechanism within the jaw and having articulation of 110 degree ( 55 degrees on both sides ) and capable of 360 degrees rotation each unit 406 nrs 47 advance bipolar hand activated probe for open surgery with 13mm shaft diameter and 20 cm shaft length, 6 mm wide straight jaw design with jaw length of 38 mm , sealing vessel upto and including 7mm through radio frequency energy , having separate seal and cut buttons, capable of 360 degrees rotation each unit 407 nrs 48 laparoscopic shears 5mm diameter, 36cm long, 15mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 5mm in diameter, 360 degrees rotation, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation each unit 408 nrs 49 advanced bipolar tissue sealer 25 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in open surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation each unit 409 nrs 50 advanced bipolar tissue sealer 37 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation each unit 410 nrs 51 advanced bipolar tissue sealer 45 cms with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation each unit 411 nrs 52 laparoscopic shears 5mm diameter, 36cm long, 18mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter , ergonomic handle compatible with ultrasonic energy source, capable of hand and foot activation with an integrated hand piece and transducer. each unit 412 nrs 53 connecting cable for ultrasonic harmonic scalpel for open energy probes compatible with focus plus shear hp blue each unit 413 nrs 54 connecting cable for ultrasonic harmonic scalpel for lap energy probes compatible with ace plus shear hp054 each unit 414 nrs 55 laparoscopic shears 5mm diameter, 45cm long, 15mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation each unit 415 nrs 56 nasal haemostatic sponge pack ( with airway ) 10 inch each unit 416 nrs 57 platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 2*2 ) hole drill bit machine with insertion tools each unit 417 nrs 58 platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 1*2 ) hole drill bit machine with insertion tools each unit 418 nrs 59 platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 1*1 ) hole drill bit machine with insertion tools each unit 419 nrs 60 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 2 mm ) diameter drill bit machine with insertion tools each unit 420 nrs 61 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 1.5 mm ) diameter drill bit machine with insertion tools each unit 421 nrs 62 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 2.5 mm ) diameter drill bit machine with insertion tools each unit 422 nrs 63 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 3 mm ) diameter drill bit machine with insertion tools each unit 423 nrs 64 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 4 mm ) each unit 424 nrs 65 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 6 mm ) each unit 425 nrs 66 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 8 mm ) each unit 426 nrs 67 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 10 mm ) each unit 427 nrs 68 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 12.5 mm ) each unit 428 nrs 69 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 4 mm ) each unit 429 nrs 70 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 6 mm ) each unit 430 nrs 71 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 8 mm ) each unit 431 nrs 72 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 10 mm ) each unit 432 nrs 73 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 12.5 mm ) each unit 433 nrs 74 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 6 mm ) each unit 434 nrs 75 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 8 mm ) each unit 435 nrs 76 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 10 mm ) each unit 436 nrs 77 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 12.5 mm ) each unit 437 nrs 78 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 4 mm ) each unit 438 nrs 79 block used in thyroplasty ( sialestic and gortex ) 70*50 mm with 20 mm thickness each unit 439 nrs 80 disposable needle 16g x 1 inch each unit 440 nrs 81 curved tip & stepped cartridges face from inner to outer side 2.0, 2.5 and 3.0 mm staple heights row for variable thickness tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 45 mm tan colour code for vascular applications each unit 441 nrs 82 curved tip & stepped cartridges face from inner to outer side 3.0, 3.5 and 4.0 mm staple heights row for variable thickness tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 45 mm purpule colour code for medium to thick tissue each unit 442 nrs 83 varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with black varied staple height of 4, 4.5 and 5mm leg length each unit 443 nrs 84 disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logic technology and digital display titanium clips u shaped each unit 444 nrs 85 synthetic oxidised re generated cellulose double layered with peg and trilysine size 2*4cm each unit 445 nrs 86 synthetic oxidised re generated cellulose double layered with peg and trilysine size 5*10cm each unit 446 nrs 87 disposable 10 mm endoscopic clip applier with facility of loading clips independent of the firing mechanism: medium / large size each unit 447 nrs 88 disposable 10 mm endoscopic clip applier with facility of loading clips independent of the firing mechanism large size each unit 448 nrs 89 endo liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 30mm, capable of loading all length cartridges on same gun only each unit 449 nrs 90 endo liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 45mm capable of loading all length cartridges on same gun only each unit 450 nrs 91 endo liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 60mm, capable of loading all length cartridges on same gun only each unit 451 nrs 92 disposable clip applier preloaded with 20 clips, superinterlock security with clip design technology medium each unit 452 nrs 93 disposable clip applier preloaded with 20 clips, superinterlock security with clip design technology small each unit 453 nrs 94 sterile hypodermic syringe with needle attached, 22g, single use 2 ml each unit 454 nrs 95 sterile hypodermic syringe with needle attached, 22g, single use 5 ml each unit 455 nrs 96 biological glue with thrombin & aprotinin 1ml each unit 456 nrs 97 biological glue with thrombin & aprotinin 2ml each unit 457 nrs 98 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 458 nrs 99 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 459 nrs 100 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 460 nrs 101 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 461 nrs 102 sterile oxidized regenerated cellulose hemostating agent in netform fibrillar and in thick sheath as per ip each unit 462 nrs 103 urine collecting bag, disposable 2000 ml with uroflow meter each unit 463 nrs 104 central neck line double lumen ( 3 nobel metal coated ( gold, silver, palladium ) central lumen catheter, double lumen ) each unit 464 nrs 105 microcatheter selective infusion microcatheters for intra cranial aneurysm treatment with 2 tip markers each unit 465 nrs 106 microcatheter selective infusion microcatheters for deploying intracranial device: stent deployment each unit 466 nrs 107 microcatheter selective infusion microcatheters for flow diverter delivery with single tip markers 0.027inch each unit 467 nrs 108 microcatheter flow dependent super selective high flow infusion microcatheters for cerebral / spinal avms ( compatible with dmso ) each unit 468 nrs 109 micro guide wire for microcatheter shapable distal end and with torque 0.014inch each unit 469 nrs 110 bare platinum coil complex shape, soft, electrolytic detachable framing and filling each unit 470 nrs 111 bare platinum coil complex shape, soft, mechanically detachable framing and filling each unit 471 nrs 112 bare platinum coil helical shape, soft, electrolytic detachable each unit 472 nrs 113 bare platinum coil helical shape, soft, mechanically detachable each unit 473 nrs 114 aortic punch 2.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 474 nrs 115 aortic punch 3 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 475 nrs 116 aortic punch 3.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 476 nrs 117 aortic punch 4 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 477 nrs 118 aortic punch 4.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 478 nrs 119 aortic punch 5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 479 nrs 120 aortic punch 5.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 480 nrs 121 aortic punch 3.6 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 481 nrs 122 folleys catheter fixation divice foley catheter holder universal size should have leg band and is disposable single patiemnt use device should have catheter grip of 18 to 24 fr catheter and made of crobelt or any other. each unit 482 nrs 123 tur set tur irrigation set disposable urology instrument urology equipment endosurgery, mfg from clinical grade non toxic medical transparent pvc sheet, y shaped connector with pointed spike to easy pierce facilities alternative change solution, thumb operated clamp smooth chnage of bottle, proximal end fitted with flexible latest tubing for easy connection to endoscope, eto steril individual pack. should have minium lenght of 260 cm or more. each unit 483 nrs 124 laproscopic port with trocar 5mm optically guided bladeless trocar 5mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer, 150mm length. each unit 484 nrs 125 each unit 485 nrs 126 each unit 486 nrs 127 each unit 487 nrs 128 each unit 488 nrs 129 each unit 489 nrs 130 each unit 490 nrs 131 each unit 491 nrs 132 each unit 492 nrs 133 each unit 493 nrs 134 each unit 494 nrs 135 each unit 495 nrs 136 each unit 496 nrs 137 each unit 497 nrs 138 each unit 498 nrs 139 each unit 499 nrs 140 patient pre operative skin prepration solution 26 ml in one step sterile applicator container for single use with 2% chlorohexdine gluconate ( chg ) and 70% ipa with orange tint colour or easy visulization, us fda approved each unit 500 nrs 141 rem and non rem single use, corded patient return electrodes conductive adhesive hydrogel with usfda. each unit 501 nrs 142 chlorhexidine impregnated paraffin gauze 30x10 cm each unit 502 nrs 143 chlorhexidine impregnated paraffin 15 cm x 1 roll each unit programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. 503 nrs 144 surgical gloves 6.5 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved each unit 504 nrs 145 surgical gloves 7 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved each unit 505 nrs 146 surgical gloves 7.5 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved each unit 506 nrs 147 ionic silver dressings with broad spectrum antimicrobial, bactericidal, biofilm destruction & reformation efficacies recommended for low to high exuding wounds 5 cms x 5 cms each unit 507 nrs 148 ionic silver dressings with broad spectrum antimicrobial, bactericidal, biofilm destruction & reformation efficacies recommended for low to high exuding wounds 10 cms x 10 cms each unit 508 nrs 149 self adherent moist wound dressing made up of triple hydrocolloid matrix, elastomeric polymer for pressure ulcers / bed sores 10 cms x 10 cms each unit 509 nrs 150 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand broad spectrum antimicrobial & bactricidal activity with high exudate management capability with a wear time of 21 days & locking in edudates in gel form 23 x 100 cms each unit 510 nrs 151 double wall resuscitator with peep valve in adult it should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve for adult bag volume: mark iv ( 1300 ml ) weight: adult ( 415 g ) it should be us fda, ce & iso certified each unit 511 nrs 152 double wall resuscitator with peep valve in paediatrics it should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve for peadiatric it should have provision to attach manometer for paediatrics ambu bag bag volume: mark iv baby ( 300 ml ) weight: baby ( 190 g ) it should be us fda, ce & iso certified each unit 512 nrs 153 single patient use sebs resuscitator ( spur ii with peep valve in adult ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: adult ( 1475 ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. each unit 513 nrs 154 single patient use sebs resuscitator ( spur ii with peep valve in paed ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip.it should have provision to attach manometer for paediatrics ambu bag. • resuscitator volume: pediatric ( 635 ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. each unit 514 nrs 155 single patient use sebs resuscitator ( spur ii with peep valve in neonatal ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: neonate ( 220ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. each unit 515 nrs 156 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 516 nrs 157 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 517 nrs 158 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 518 nrs 159 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 519 nrs 160 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 520 nrs 161 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 521 nrs 162 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 522 nrs 163 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 523 nrs 164 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 524 nrs 165 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 525 nrs 166 silicone pre formed sga total size 8 • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 526 nrs 167 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 527 nrs 168 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 528 nrs 169 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 529 nrs 170 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 530 nrs 171 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 531 nrs 172 cervical collar with 12 sizes settings • it should be latex free adjustable collar with 12 size setting in paediatric collar • it should have standard sizing line for easy and accurate sizing • it should be ce / iso, us fda certified each unit 532 nrs 173 cervical collar with 16 sizes settings • it should be latex free adjustable collar with 16 size setting in adult collar • it should have standard sizing line for easy and accurate sizing • it should be ce / iso, us fda certified each unit 533 nrs 174 offset connector cardio sensor electrodes • it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm each unit 534 nrs 175 offset connector cardio sensor electrodes • it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm each unit 535 nrs 176 offset connector cardio sensor electrodes • it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm each unit 536 nrs 177 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone each unit 537 nrs 178 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 538 nrs 179 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 539 nrs 180 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 540 nrs 181 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 541 nrs 182 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 542 nrs 183 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 543 nrs 184 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 544 nrs 185 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 545 nrs 186 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 546 nrs 187 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 547 nrs 188 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 548 nrs 189 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 549 nrs 190 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 550 nrs 191 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 551 nrs 192 rhinolaryngo single patient use slim scope insertion tube diameter : 3.0mm. working length: 300 mm bending range : 130 degree up & 130 degree down field of view : 85 degree or more direction of view : 0 degree ( forward view ) depth of field : 6 50 mm or better complete system should be us fda and european ce certified each unit 552 nrs 193 rhinolaryngo single patient use invtervention scope channel width : 2.2mm insertion tube diameter : 5.0 mm. working length : 350 mm bending range :130 degree up & 130 degree down field of view : 85 degree or more direction of view : 0 degree ( forward view ) depth of field : 6 50 mm or better complete system should be us fda and european ce certified each unit 553 nrs 194 ultrasorbs ap disposable drypads, dry pad for moisture management, 58.4x90cm, with breathable layer, super absorbent core, aqua shield film and air permeable back sheet, absorbency of 1800 2300gm, usfda / ce / bis compliant, iso13485 compliant each unit 554 nrs 195 elastic head strap cannulas pediatric elastic head strap cannulas pediatric must be soft siliconised, transparent vinyl; adjustable elastic band for comfortable, snug fit below the ears; complete kit with 7 ft oxygen supply tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 555 nrs 196 over the ear nasal cannula over the ear nasal cannula with star lumen, 50 tubing, must be flexible contoured lip tab provides a high level of stability and patient comfort. over the ear design for a comfortable and secure fit, crush and kink resistant tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 556 nrs 197 pediatric nasal cannula pediatric nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight, flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs help maximize patient comfort. individually packaged for convenience and sterility. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 557 nrs 198 infant nasal cannula infant nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight, flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs to help maximize patient comfort. individually packaged for convenience and sterility. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 558 nrs 199 volumetric incentive spirometer ( adult ) volumetric incentive spirometer ( adult ) 4000 ml with handle. volume measurement must be compact comfortable designed to accommodate large inspired volumes. must have goodbetter best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 559 nrs 200 volumetric incentive spirometer ( pediatric ) volumetric incentive spirometer ( pediatric ) 2500 ml with handle. volume measurement must be compact comfortable designed to accommodate large inspired volumes. must have good better best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 560 nrs 201 inspiratory exerciser with 3 color coded balls, 3 chambers inspiratory exerciser with 3 color coded balls, 3 chambers & wide flow rate range from 600 to 1200 cc / sec, with minimum flow imprinted on each chamber. must be compact design and made of break resistant plastic. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 561 nrs 202 adult mask for tracheostomy adult mask for tracheostomy and laryngectomy aerosol therapy tubing connector must swivels 360° for ease of positioning; 22 mm od connector accepts 22 mm, corrugated tubing and nebulizer tees. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 562 nrs 203 pardiatric mask for tracheostomy pediatric mask for tracheostomy and laryngectomy aerosol therapy tubing connector must swivels 360° for ease of positioning; 22 mm od connector accepts 22 mm, corrugated tubing and nebulizer tees. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 563 nrs 204 elongated aerosol mask adult elongated aerosol mask adult with under the chin design for excellent fit on wide range of face sizes must be clear, soft vinyl for patient comfort; adjustable nose clip assures comfortable fit; specifically designed for aerosol therapy; must be with supplied with 6 ft. corr a flex corrugated tubing, featuring cuttable sections every 6 in. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 564 nrs 205 elongated aerosol mask pediatric elongated aerosol mask pediatric with under the chin design for excellent fit on wide range of face sizes must be clear, soft vinyl for patient comfort; adjustable nose clip assures comfortable fit; specifically designed for aerosol therapy; must be with supplied with 6 ft. corr a flex corrugated tubing, featuring cuttable sections every 6 in. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 565 nrs 206 elongated three in one adult mask elongated three in one adult mask must be able to use as a medium concentration, highconcentration or nonrebreathing mask which includes mask with flapper valve, nonrebreathing bag assembly; adjustable nose clip assures comfortable fit; with 7 ft. star lumen oxygen supply tubing; 750 ml reservoir bag. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 566 nrs 207 adult conventional single water trap adult conventional single water trap ( non heated ) ventilator circuits are available in a variety of different configurations and styles.to incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector inspiratory limb water trap ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 567 nrs 208 adult ventilator circuit single limb portable adult ventilator circuit with universal single limb. must be complete kit with main circuit hose, exhalation valve manifold, aerosol hose, patient elbow connector, proximal airway pressure line, exhalation valve line, and humidifier limb. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 568 nrs 209 adult ventilator circuit single water trap adult conventional single water trap ( non heated ) ventilator circuits are available in a variety of different configurations and styles.to incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector inspiratory limb water trap ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 569 nrs 210 adult conventional dual limb water trap adult conventional dual limb water trap ( non heated ) ventilator circuits are available in a variety of different configurations and styles.to incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector dual limb inspiratory & expiratory water trap 22mm tubing, ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 570 nrs 211 infant prong cpap cannula infant prong cpap cannula nasal size 0 with designed to reduce trauma associated with delivery of infant nasal cpap. must be soft siliconised, anatomically curved prongs to enhance fit. luer fitting on expiratory connector to allow proximal airway pressure monitoring. each set to include, soft siliconised cannula; inspiratory & expiratory elbow connector; knit cap; two 6 in. hook and loop fastener sections; two 10 to 7.5 mm adaptors. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 571 nrs 212 fhme heat and moisture exchangers with bacteria viral filters bacterial filtration efficiency> 99.99 % and viral filtration efficiency > 99.9999% . filter membrane should be of a hydrophobic non woven polypropylene material. should be tailored to meet the specific needs of both anaesthesia and intensive care. each unit 572 nrs 213 tracheostomy hme: 1 heat and moisture exchangers for spontaneously breathing tracheotomy patients. 2 should have in built oxygen port. 3 should be compact & light wt. 4 should be suitable for ambulatory patients, sampling and suctioning can be done without removing it. 5 the system should have kink resisting oxygen tubing each unit 573 nrs 214 double lumen endobronchial tube left: size 28fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 574 nrs 215 double lumen endobronchial tube left: size 32fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 575 nrs 216 double lumen endobronchial tube left: size 35fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 576 nrs 217 double lumen endobronchial tube left: size 37fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 577 nrs 218 double lumen endobronchial tube left: size 39fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 578 nrs 219 double lumen endobronchial tube left: size 41fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 579 nrs 220 double lumen endobronchial tube right: size 35fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 580 nrs 221 double lumen endobronchial tube right: size 37fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 581 nrs 222 double lumen endobronchial tube right: size 39fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 582 nrs 223 sub glottic tube taper guard evac: sizes 6mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 583 nrs 224 sub glottic tube taper guard evac: sizes 6.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 584 nrs 225 sub glottic tube taper guard evac: sizes 7mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 585 nrs 226 sub glottic tube taper guard evac: sizes 7.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 586 nrs 227 sub glottic tube taper guard evac: sizes 8mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 587 nrs 228 sub glottic tube taper guard evac: sizes 8.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 588 nrs 229 sub glottic tube taper guard evac: sizes 9mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 589 nrs 230 inflation device inflation device in 30atm & 20ml with clear polycarbonate barrel for easy visualisation of bubbles, luminescent dial, airless rotator, lock release handle for easy one handed control and primelok for easy preparation.usfda approved each unit 590 nrs 231 manifold manifolds in 2, 3, 5 port with configuration of left right orientation, on off handle, full half body, 200 psi 500 psi rating and wide port spacing. should have clear polycarbonate body to provide durability and visibility, airless rotator and large bore inner lumen throughout including rotator.usfda approved each unit 591 nrs 232 high pressure tube high pressure tubing in 25cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 592 nrs 233 high pressure tube high pressure tubing in 51cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 593 nrs 234 high pressure tube high pressure tubing in 76, cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 594 nrs 235 high pressure tube high pressure tubing in 122, cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 595 nrs 236 high pressure tube high pressure tubing in 183cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 596 nrs 237 torque device torque device for .014 to .038 standard and hydrophilic guide wires with squeeze load release mechanism.usfda approved each unit 597 nrs 238 radial band radial hemostatis band in 24 cm . curved backer plat with large area & clear unobstructed site visibility, convinient tubing clip with two check valve options and device stickers. should be available with standard luer and specialized connection syringe. us fda approved each unit 598 nrs 239 radial band radial hemostatis band in 29 cm. curved backer plat with large area & clear unobstructed site visibility, convinient tubing clip with two check valve options and device stickers. should be available with standard luer and specialized connection syringe. us fda approved each unit 599 nrs 240 angiography needle angiography needle in 18g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 600 nrs 241 angiography needle angiography needle in 19g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 601 nrs 242 angiography needle angiography needle in 20g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 602 nrs 243 angiography needle angiography needle in 21g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 603 nrs 244 angiography wire ptfe guidewire in .035, .038, in regular length. should have 3mm j tip, straight tip, precoating for smooth surface with less friction, finger straight able with precise j tip memory and packed in flush hoop with j straightener. should have option of fixed core, movable core, heparin coating, 1.5mm j tip. usfda approved each unit 604 nrs 245 angiography wire long length ptfe guidewire in .035, .038, with exchange length. should have 3mm j tip, straight tip, pre coating for smooth surface with less friction, finger straight able with precise j tip memory and packed in flush hoop with j straightener. should have option of fixed core, movable core, heparin coating, 1.5mm j tip. usfda approved each unit 605 nrs 246 amplatz wire ptfe amplatz type wire in .035 and .038, length of 75cm, 145cm, 180cm. should be available in multiple flexible tip length of 1.0cm, 3.5cm, 4.0cm, 6cm, 7cm and j 3.0mm. usfda approved. usfda approved each unit 606 nrs 247 hydrophilic wire hydrophilic guidewire of .018, .025, .035, .038 in 80cm, 150cm with straight, angled tip. should come in stiff & standard configuration, nitinol core polyurethane jacket hydrophilic coated guide wires with radiopaque jacket for enhanced visibility, hydrated gel coating and true 1:1 torque. usfda approved each unit 607 nrs 248 hydrophilic wire long length hydrophilic guidewire of .018, .025, .035, .038 in 180cm, 220cm, 260cm length with straight, angled tip. should come in stiff & standard configuration, nitinol core polyurethane jacket hydrophilic coated guide wires with radiopaque jacket for enhanced visibility, hydrated gel coating and true 1:1 torque. usfda approved each unit 608 nrs 249 hydrophillic braided sheath hydrophilic braided sheath introducer in 4f to 7f, length of 7, 11, 16, 23cm with the option of .018, .021, .025 plastic jacketed and spring coil guidewire. should have ultra thin wall and flat wire braiding technology to provide support and low profile.usfda approved each unit 609 nrs 250 femoral sheath with needle femoral sheath in 5f to 8f, length of 11 23cm with puncher needle of 18g and guidewire of .035, .038. should have rotating suture ring, snap fit dilator to prevent slipping during insertion and holster pack. should be available in polypropylene. usfda approved each unit 610 nrs 251 angiography catheter diagnostic catheter in 4f 6f, length of 70 110cm & 125cm , should come in various shapes & curve length including jl & jr ( 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6 cm ) , al, ar, tig, mp, im, sones, pigtail ( straight, angle, radial ) . should have flat wire braiding, nylon material, thin wall design for higher flow rates, radio opaque tip, strain relief and winged polycarbonate hub. should be available in various configurations braided, non braided, short tip, bumper tip, sideholes as applicable. usfda approved each unit 611 nrs 252 angiography radial catheters diagnostic radial catheter with radial ultimate curve in 4 6f. lenght of 100cm, 110cm, 125cm. should have four type of radial ultimate curves. should have flat wire braiding, nylon material, thin wall design for higher flow rates, radio opaque tip, strain relief and winged polycarbonate hub. us fda approved each unit 612 nrs 253 one loop & triple loop snare snare kit ( 2 35mm diameter, 90 degree nitinol & gold plated tungsten loop ) and multiloop snare kit ( 2 45mm diameter, three interlaced nitinol loops ) for foreign body retrieval, should come with flexible, reinforced, strain relief hub to reduce buckling and unique peel away insertion tool. usfda approved each unit 613 nrs 254 ptca kit ( 1 ) three port manifold with knobs to turnright when open ( 2 ) one pressure line, ( 3 ) fluid connecting line, ( 4 ) contrast connecting line, ( 5 ) one three way stop cock, ( 6 ) one yconnector hemoststic valve with spring type push and release mechanism, ( 7 ) one inflation device with manometer upto 30 atm ( easy to operate with luminescent dial ) , ( 8 ) one luer lock controlled syringe of 10 ml with finger grip, ( 9 ) insertion needle, ( 10 ) torque device.usfda approved each unit 614 nrs 255 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes are 5fr. each unit 615 nrs 256 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes are 6fr each unit 616 nrs 257 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes are 7fr. each unit 617 nrs 258 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes 8fr. each unit 618 nrs 259 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes are 10fr. each unit 619 nrs 260 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes 12fr. each unit 620 nrs 261 paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3mm. each unit 621 nrs 262 paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3.5mm. each unit 622 nrs 263 paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 5.5mm each unit 623 nrs 264 adult endotracheal tube cuff is made up of polyurethane.thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 20 cmh2o.burst pressure of cuff is 800cmh2o.cuff with play mode function. sizes 5.5mm. each unit 624 nrs 265 adult endotracheal tube cuff is made up of polyurethane.thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 20 cmh2o.burst pressure of cuff is 800cmh2o.cuff with play mode function. sizes 10mm. each unit 625 nrs 266 kimvent bal cath non bronchoscopic bal for bronchial aspirate sampling. can be performed in minutes at bedside. directional tip allows right or left lung sampling.maintains peep when used with supplied ventilator adapter. soft, cushioned, radiopaque tip for safe sampling. protected with outer catheter covering. t size 13fr . each unit 626 nrs 267 kimvent bal cath non bronchoscopic bal for bronchial aspirate sampling. can be performed in minutes at bedside. directional tip allows right or left lung sampling.maintains peep when used with supplied ventilator adapter. soft, cushioned, radiopaque tip for safe sampling. protected with outer catheter covering. sizes 16fr. each unit 627 nrs 268 disposable spo2 sensor it should be base on original nellcor technology with original oximax technology each unit 628 nrs 269 catheter mount double swivel connector, it should have bronchoscopy port . it sholud be approved by us fda each unit 629 nrs 270 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilized size – 12, length ( 0.8 – 5.0 ) each unit 630 nrs 271 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 14 length ( 0.8 – 5.0 ) each unit 631 nrs 272 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 16 length ( 0.8 – 5.0 ) each unit 632 nrs 273 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 18, length ( 0.8 – 5.0 ) each unit 633 nrs 274 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 20 length ( 0.8 – 5.0 ) each unit 634 nrs 275 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilized size – 24fr length ( 0.8 – 5.0 ) each unit 635 nrs 276 percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 14fr each unit 636 nrs 277 percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 20fr each unit 637 nrs 278 percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 24fr each unit 638 nrs 279 silk protein based sterile surgical pu foam dressing non adhesive biomodified, silk protein based, sterile, soft, conformable, absorbent, double layered polyurethene foam dressing comprised of silk protein 8% and asiaticoside nlt 0.6%, with super fluid handling capacity, decreases the risk of maceration, sterlization gamma sterlized each unit 639 nrs 280 silk protein & antimicrobial nanosilver based sterile surgical pu foam dressing non adhesive biomodified, silk protein & silver impregnated, soft, conformable, absorbent, double layered polyurethene foam dressing comprised of silk protein 8%, asiaticoside nlt 0.6% and silver 1.2%, with super fluid handling capacity, decreases the risk of maceration, sterlization gamma sterlized each unit 640 nrs 281 silk protein & antimicrobial silver based sterile surgical mesh wound dressing biomodified, bilaminated silk protein and silver wound dressing with mesh pores to facilitate the easy drainage of exudates, comprised of activated silk matrix 46% and asiaticoside nlt 0.6% and, sterlization gamma sterlizedsilver :1.2%. non adhesive, square / rectangular in shape, sterlization gamma sterlized each unit 641 nrs 282 silk protein & antimicrobial nanosilver based sterile surgical wound dressing sheet biomodified, bilaminated silk protein & silver based surgical wound dressing comprised of activated silk matrix 46% and asiaticoside 0.6% and silver :1.2%. non adhesive, square / rectangular in shape, sterlization gamma sterlized each unit 642 nrs 283 silk protein derived sterile surgical meshed wound dressing biomodified, bilaminated silk protein wound dressing with mesh pores to facilitate the easy drainage of exudates, comprised of activated silk matrix 46% and asiaticoside nlt 0.6%. non adhesive dressing, square / rectangular in shape, sterlization gamma sterlized each unit 643 nrs 284 silk protein based sterile surgical wound dressing sheet biomodified, bilaminated silk protein wound dressing comprised of activated silk matrix 46% and asiaticoside nlt 0.6%. non adhesive dressing, square / rectangular shape, sterlization gamma sterlized each unit 644 nrs 285 silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver biomodified silk protein and silver based wound healing ointment comprised of silk powder 8% , asiaticoside nlt 0.6% and silver:1.2%, sterlization gamma sterlized each unit 645 nrs 286 silk protein and nanosilver based microbicidal sterile surgical wound dressing sprinkling powder bottle biomodified silk protein and silver based microbicidal sprinkling powder, comprised of silk powder 8%, asiaticoside nlt 0.6% and silver :1.2% . conforms to any wound shape and size, easy to apply, sterlization gamma sterlized each unit 646 nrs 287 silk protein based sterile surgical wound dressing sprinkling powder bottle biomodified silk protein based wound healing sprinkling powder, comprised of silk powder 8% and asiaticoside nlt 0.6% . conforms to any wound shape and size, easy to apply, sterlization gamma sterlized each unit 647 nrs 288 centella asiatica extract based skin moisturization and antiscar gel centella asiatica extract based skin moisturization and antiscar gel, comprised of centella asiatica extract, glycerol and vitamin e., sterlization gamma sterlized each unit 648 nrs 289 silk protein based sterile surgical particle wound dressingbiomodified, bioabsorbable silk protein and collagen containing particle wound dressing, comprised of silk powder 8% , asiaticoside 0.6% and collagen , having natural moisturizing factor ( nmf ) , suitable for cavity wound and any kind of slow and non healing wound, sterlization gamma sterlized each unit 649 nrs 290 silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 5ml biomodified, bioabsorbable silk protein, collagen and silver containing broadspectrum antimicrobial particle wound dressing , comprised of silk powder 8%, asiaticoside 0.6% , having natural moisturizing factor ( nmf ) , suitable for deep, tunneling cavity wound or any kind of slow and non healing wound, sterlization gamma sterlized each unit 650 nrs 291 silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 10ml biomodified, bioabsorbable silk protein, collagen and silver containing broadspectrum antimicrobial particle wound dressing , comprised of silk powder 8%, asiaticoside 0.6% , having natural moisturizing factor ( nmf ) , suitable for deep, tunneling cavity wound or any kind of slow and non healing wound, sterlization gamma sterlized each unit 651 nrs 292 silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*20cm, silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized each unit 652 nrs 293 silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*25cm, silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized each unit 653 nrs 294 silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 15*15cm silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized each unit 654 nrs 295 silk protein and pu foam pad with self adhesive border, water proof dressing for postoperative scar or any scar management 10*20cm , silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlization gamma sterlized each unit 655 nrs 296 silk protein and pu foam pad with self adhesive border, water proof dressing for postoperative scar or any scar management 10*25cm , silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlization gamma sterlized each unit 656 nrs 297 silk protein and pu foam pad with self adhesive border, water proof dressing for postoperative scar or any scar management 10*21.5cm s silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlizationgamma sterlized each unit 657 nrs 298 silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 9*21.5cm silk protein, nanocrystalline silver & asiaticoside based highly conformable sterile antimicrobial surgical and scar free wound healing dressing with adhesive backing and absorbent layer, sterlization gamma sterlized each unit 658 nrs 299 silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 10*25cm silk protein, nanocrystalline silver & asiaticoside based highly conformable sterile antimicrobial surgical and scar free wound healing dressing with adhesive backing and absorbent layer, sterlization gamma sterlized each unit 659 nrs 300 silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*10cm . silk protein & nanocrystalline silver based sterile, nonadherent, antimicrobial gauze dressing , sterlization gamma sterlized each unit 660 nrs 301 silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*25cm . silk protein & nanocrystalline silver based sterile, nonadherent, antimicrobial gauze dressing , sterlization gamma sterlized each unit 661 nrs 302 silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*10cm silk protein based sterile, non adherent, antimicrobial gauze dressing , sterlizationgamma sterlized each unit 662 nrs 303 silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*25cm . silk protein based sterile, non adherent, antimicrobial gauze dressing , sterlization gamma sterlized each unit 663 nrs 304 papain urea & silk protein based wound debriding ointment and cream 25gm papain urea based debriding ointment and cream for removal of necrotic tissue and slough in infected wounds, containing papain ip : >521700 units and urea ip : 100mg each unit 664 nrs 305 papain urea & silk protein based wound debriding ointment and cream 50gm papain urea based debriding ointment and cream for removal of necrotic tissue and slough in infected wounds, containing papain ip : >521700 units and urea ip : 100mg each unit 665 nrs 306 silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 25gm broad spectrum antiseptic and antimicrobial topical ointment containing povidone iodine usp: 5% w / w, silk protein, centella asiatica for prevention of skin and wound infections. each unit 666 nrs 307 silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 50gm broad spectrum antiseptic and antimicrobial topical ointment containing povidone iodine usp: 5% w / w, silk protein, centella asiatica for prevention of skin and wound infections. each unit 667 nrs 308 anti microbial gloves each unit 668 nrs 309 anterior chamber iol pmma material, single piecekelman multiflex design5 6 mm optic size with 12 13 mm overall size biconvex power range +12 to +24should be iso or ce certified. manufacturer should be asked to sample for approval. each unit 669 nrs 310 capsular tension ring standard capsular tension ringpmma material with one eyelet each at each end 10 mm to 12 mm overall diameter sterile should be iso / ce certified mfg. each unit 670 nrs 311 iris hooks / retractors set of five disposable sterile iris hooks with soft silicon stopper sterile peek should be made pmma iso / ce certified mfg. each unit 671 nrs 312 silicone rod for ptosis repair implantable flexible silicon rod attached to malleable sharp needles with a silicon sleeve. needlelength 60 70mm diameter 920 μ length of silicone rod 40cm, length of silicon sleeve 0.7 mm. each unit 672 nrs 313 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 673 nrs 314 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 674 nrs 315 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 675 nrs 316 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 676 nrs 317 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 677 nrs 318 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 678 nrs 319 flow regulator extension set flow rate 2ml to 350ml per hour each unit 679 nrs 320 sterile disposable hypodermic needle no. 18x1½ each unit 680 nrs 321 sterile disposable hypodermic needle no. 21x1½ each unit 681 nrs 322 sterile disposable hypodermic needle no. 23x1½ each unit 682 nrs 323 neonatal single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. each unit 683 nrs 324 paed. single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. each unit 684 nrs 325 adult single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. each unit 685 nrs 326 neonatal high flow nasal cannula having 8 litre flow. should have soft tip . each unit 686 nrs 327 pur xro catheter 20 cm, 28g / 1fr picc line with stylet, splitting needle with securing wings with 8 cm extension tubing ( flow rate 1ml / min ) each unit 687 nrs 328 pur xro catheter 30 cm, 24g / 2fr picc line with split cannula and 10cm extension tubing over catheter ( flow rate 0.2ml / min ) each unit 688 nrs 329 dead body bag 7x3 ft size leak proof material pp closed on all other sides and zipped on front or on 3 sides each unit 689 nrs 330 introducer sheath with puncture needle for adults us fda approved· 10 11 cm long· pack must include 18 g, 6 7.5 cm long puncture needle: 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 690 nrs 331 introducer sheath with puncture needle for adults us fda approved· 10 11 cm long· pack must include 18 g, 6 7.5 cm long puncture needle: 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 691 nrs 332 intoducer sheath for adults ( size 10 fr.. ) ( standard length ) us fda approved us fda + ce / dgci approved· 10 11 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertionus fda + ce / dgci approved each unit 692 nrs 333 intoducer sheath for adults ( size 11 fr. ) ( standard length ) us fda approved us fda + ce / dgci approved· · 10 11 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertionus fda + ce / dgci approved each unit 693 nrs 334 long introducer sheath ( 20 30 cm long ) ( size 5fr.. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 694 nrs 335 long introducer sheath ( 20 30 cm long ) ( size 6fr. ) us fda + ce / dgci approved· .· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 695 nrs 336 long introducer sheath ( 20 30 cm long ) ( size 7fr. ) us fda + ce / dgci approved· · sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 696 nrs 337 long introducer sheath ( 20 30 cm long ) ( size 8fr ) us fda + ce / dgci approved· · sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 697 nrs 338 long introducer sheath ( 20 30 cm long ) ( size 9fr. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 698 nrs 339 long introducer sheath ( 20 30 cm long ) ( size 10fr.. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 699 nrs 340 long introducer sheath ( 20 30 cm long ) ( size 11fr. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 700 nrs 341 trans radial introducer sheeths 4f us fda + ce / dgci approved· sizes 4 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 701 nrs 342 trans radial introducer sheeths 5f us fda + ce / dgci approved· sizes 5 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 702 nrs 343 trans radial introducer sheeths 6f us fda + ce / dgci approved· sizes 6 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 703 nrs 344 steerable introducer sheeths 5f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 704 nrs 345 steerable introducer sheeths 6fr us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 705 nrs 346 steerable introducer sheeths 7f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 706 nrs 347 steerable introducer sheeths 8fus fda + ce / dgci approved· size 55 to 90 cms·to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 707 nrs 348 steerable introducer sheeths 9f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 708 nrs 349 steerable introducer sheeths 10f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 709 nrs 350 steerable introducer sheeths 11f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 710 nrs 351 steerable introducer sheeths 12f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 711 nrs 352 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 712 nrs 353 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 713 nrs 354 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 714 nrs 355 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 715 nrs 356 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 716 nrs 357 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during ins ertion each unit 717 nrs 358 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 718 nrs 359 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 719 nrs 360 long introducer sheath ( 30 50 cm long ) ( size 5fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 720 nrs 361 long introducer sheath ( 30 50 cm long ) ( size 6 fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 721 nrs 362 long introducer sheath ( 30 50 cm long ) ( size 7fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 722 nrs 363 long introducer sheath ( 30 50 cm long ) ( size 8fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 723 nrs 364 long introducer sheath ( 30 50 cm long ) ( size 9fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 724 nrs 365 long introducer sheath ( 30 50 cm long ) ( size 10fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 725 nrs 366 long introducer sheath ( 30 50 cm long ) ( size 11fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 726 nrs 367 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 727 nrs 368 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 728 nrs 369 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 729 nrs 370 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 730 nrs 371 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 731 nrs 372 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 732 nrs 373 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 733 nrs 374 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 734 nrs 375 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 735 nrs 376 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 736 nrs 377 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.035 size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 737 nrs 378 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.038 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 738 nrs 379 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 739 nrs 380 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032, inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 740 nrs 381 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in , 0.035 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 741 nrs 382 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.038 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 742 nrs 383 ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.032 inches size· should be between 240 300 cm long· should be available as straight & jshaped tip each unit 743 nrs 384 ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.035 inches size· should be between 240 300 cm long· should be available as straight & jshaped tip each unit 744 nrs 385 ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.038 inches size· should be between 240 300 cm long· should be available as straight & jshaped tip each unit 745 nrs 386 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long each unit 746 nrs 387 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032 inches size·should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long each unit 747 nrs 388 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved·should be available in 0.035 inches size·should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 120 300 cm long each unit 748 nrs 389 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.038 inches size·should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long each unit 749 nrs 390 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.025 inchessize· should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 150 180 cm long each unit 750 nrs 391 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.032, inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 150 180 cm long each unit 751 nrs 392 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.035 inches size· should have superelastic alloy core· should have super flexible wire tip· should be available in straight and angled tip·should be between 150 180 cm long each unit 752 nrs 393 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.038 inches size·should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip·should be between 150 180 cm long each unit 753 nrs 394 radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.025, inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved each unit 754 nrs 395 radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.032 inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip·should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved each unit 755 nrs 396 radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.038 inches size·should have superelastic alloy core· should have super flexible wire tip· should be available in straight and angled tip·should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved each unit 756 nrs 397 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 757 nrs 398 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 758 nrs 399 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 759 nrs 400 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 760 nrs 401 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 761 nrs 402 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 762 nrs 403 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 763 nrs 404 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 764 nrs 405 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 765 nrs 406 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 766 nrs 407 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 767 nrs 408 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 768 nrs 409 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 769 nrs 410 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 770 nrs 411 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 771 nrs 412 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 772 nrs 413 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 773 nrs 414 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 774 nrs 415 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 775 nrs 416 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 776 nrs 417 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 777 nrs 418 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 778 nrs 419 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 779 nrs 420 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 780 nrs 421 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 781 nrs 422 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 782 nrs 423 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 783 nrs 424 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 784 nrs 425 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 785 nrs 426 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 786 nrs 427 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 787 nrs 428 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 788 nrs 429 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 789 nrs 430 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 790 nrs 431 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 791 nrs 432 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 792 nrs 433 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 793 nrs 434 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 794 nrs 435 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 795 nrs 436 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 796 nrs 437 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 797 nrs 438 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 798 nrs 439 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 799 nrs 440 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 800 nrs 441 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 801 nrs 442 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 802 nrs 443 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 803 nrs 444 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 804 nrs 445 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 805 nrs 446 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 806 nrs 447 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 807 nrs 448 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 808 nrs 449 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 809 nrs 450 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 810 nrs 451 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 811 nrs 452 introducer sheaths for pediatric use ( size 4 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion each unit 812 nrs 453 introducer sheaths for pediatric use ( size 5 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion each unit 813 nrs 454 introducer sheaths for pediatric use ( size 6 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion each unit 814 nrs 455 judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved each unit 815 nrs 456 judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved each unit 816 nrs 457 judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved each unit 817 nrs 458 special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved each unit 818 nrs 459 special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved each unit 819 nrs 460 special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved each unit 820 nrs 461 angiographic double leumen tracking catheter us fda + ce / dgci approved each unit 821 nrs 462 angiographic double leumen tracking catheter us fda + ce / dgci approved each unit 822 nrs 463 angiographic double leumen tracking catheter us fda + ce / dgci approved each unit 823 nrs 464 3 ‘french’ diagnostic catheters for neonatal use us fda + ce / dgci approved· pigtail, judkins, multipurpose, cobra and other diagnostic catheters of 3 fr. size·varying lengths and shapes each unit 824 nrs 465 swan ganz catheter us fda + ce / dgci approved each unit 825 nrs 466 swan ganz catheter us fda + ce / dgci approved each unit 826 nrs 467 balloon tipped angiography catheter us fda + ce / dgci approved each unit 827 nrs 468 balloon tipped angiography catheter us fda + ce / dgci approved each unit 828 nrs 469 balloon tipped angiography catheter us fda + ce / dgci approved each unit 829 nrs 470 berman catheter us fda + ce / dgci approved· sizes· should have 6 8 holes proximal to the balloon for dye injection· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· 10 cm marking along catheter body to confirm insertion depth each unit 830 nrs 471 berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection·catheter should be tapered at tip to ensure uniform diameter of the whole catheter·10 cm marking along catheter body to confirm insertion depth each unit 831 nrs 472 berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection·catheter should be tapered at tip to ensure uniform diameter of the whole catheter·10 cm marking along catheter body to confirm insertion depth each unit 832 nrs 473 berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· 10 cm marking along catheter body to confirm insertion depth each unit 833 nrs 474 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 834 nrs 475 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 835 nrs 476 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 836 nrs 477 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 837 nrs 478 arterial pressure monitor lines ( 100 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. each unit 838 nrs 479 arterial pressure monitor lines ( 150 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. each unit 839 nrs 480 arterial pressure monitor lines ( 200 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. each unit 840 nrs 481 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 841 nrs 482 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 842 nrs 483 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 843 nrs 484 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 844 nrs 485 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 845 nrs 486 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 846 nrs 487 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip each unit 847 nrs 488 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible with radio opaque tip each unit 848 nrs 489 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible· with radio opaque tip each unit 849 nrs 490 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip each unit 850 nrs 491 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port·with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip each unit 851 nrs 492 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port.with 0.035 or 0.038 inch guide wire compatible· with radio opaque tip each unit 852 nrs 493 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port·with 0.035 or 0.038 inch guide wire compatible with radio opaque tip each unit 853 nrs 494 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 4f size with the largest id· should have lengths ranging from 40 110 cm each unit 854 nrs 495 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 5f size with the largest id· should have lengths ranging from 40 110 cm each unit 855 nrs 496 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 6f size with the largest id· should have lengths ranging from 40 110 cm each unit 856 nrs 497 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 7 f size with the largest id· should have lengths ranging from 40 110 cm each unit 857 nrs 498 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 8 f size with the largest id· should have lengths ranging from 40 110 cm each unit 858 nrs 499 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 9 f size with the largest id· should have lengths ranging from 40 110 cm each unit 859 nrs 500 mullin’s sheath for special dilation us fda + ce / dgci approved should be in septal puncture needle should be in 6f septal puncture needle each unit 860 nrs 501 angio.kit / ptca kit ( 3 port many fold with attached tubing one pressure line + two iv set connecting tube and two leurlock syringe ) us fda / ce / approved each unit 861 nrs 502 micro catheter for super selective catherization usfda / ce approved each unit 862 nrs 503 micro catheter for super selective catherization usfda / ce approved each unit 863 nrs 504 micro catheter for super selective catherization usfda / ce approved each unit 864 nrs 505 micro catheter for super selective catherization usfda / ce approved each unit 865 nrs 506 multi side port catheter infusion for catheter directed thromobolysis usa / fda / ce approved each unit 866 nrs 507 clot retrieval sheath usa / fda / ce approved aspiration catheter 16 f including flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm each unit 867 nrs 508 clot retrieval sheath usa / fda / ce approved aspiration catheter 20 f including flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm each unit 868 nrs 509 clot retrieval sheath usa / fda / ce approved aspiration catheter 24 f including flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm each unit 869 nrs 510 loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved each unit 870 nrs 511 loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved each unit 871 nrs 512 loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved each unit 872 nrs 513 pcd set puncture needle 18g, 0.035, j stiff stiff wire 0.035 / 80 cm , dilator set , pig tail / malecot catheter 8 24f each unit 873 nrs 514 ring biliary catheter usa / fda / ce approved catheter 8.5 f / 10 / 3 compatible 0.038 length~40 cm , catheter side ports 32 , side port segment length 8 cm , catheter introducer, stiffening cannula , secured device each unit 874 nrs 515 venaseal closure system for varicose veins usa / fda approved n butyl based adhesive formation 50 / 90 / 105 / 120 cm 145 cm ( 3 / 4 / 6 / 8 f , 014 / 0.35 compatible each unit 875 nrs 516 liver access and biopsy needle set usa / fda approved usa / fda approved 18g / 60 cm biopsy needle , 14 g cannula / 53.5 cm length sheath 7f each unit 876 nrs 517 tran jugular intrahepatic porto sytemic shunt ( tips set ) intoducer 10f / 40 cm , toclar diameter 0.038 legth60 cm , cannula 14 g / 51.5 cm each unit 877 nrs 518 percutaneous gastrostomy balloon retention tube set catheter 12 20 f, length 10 cm , balloon 5 20 ml each unit 878 nrs 519 each unit 879 nrs 520 each unit 880 nrs 521 each unit 881 nrs 522 each unit 882 nrs 523 each unit 883 nrs 524 each unit 884 nrs 525 each unit 885 nrs 526 each unit 886 nrs 527 each unit 887 nrs 528 each unit 888 nrs 529 breast nodule localizationwire should have curved locking element that provide superior migration resistance. the localization wire can be repositioned or removed after placement if required. usfda / ce approved each unit 889 nrs 530 disposable semi automatic core biopsy instrument with compatible coaxial needle. should be available with dual penetration throw of 10 and 20mm in single instrument. should be available with fire ready indicator. should be available with compatible coaxial needle set with a blunt tip needle & trocar needle. should be usfda approved. each unit 890 nrs 531 ultra clip disposable breast tissue marker should be available in coil shape & ribbon shape. should have color coded dual triggers identify different marker shape. should be visible in ultrasound, mri, mammography imaging. should be available in needle size of 17 gauge. should be available in coil shape and ribbon shape. each unit 891 nrs 532 bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verification marking should be available in 8, 11, 13 gauze usfda / ce approved each unit 892 nrs 533 bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verfication marking should be available in 8, 11, 13 gauze usfda / ce approved each unit 893 nrs 534 bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verfication marking should be available in 8, 11, 13 gauze usfda / ce approved each unit 894 nrs 535 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 895 nrs 536 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 896 nrs 537 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 897 nrs 538 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 898 nrs 539 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 899 nrs 540 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 900 nrs 541 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm. should have sharp beveled trocar. should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. with compatible disposable coaxial needle: should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar 901 nrs 542 cutting & coagulations device with tissue fusion ligasure technology having maryland jaw sealer and divider with wide jaw aperture 13mm and cut length 18.5mm with shaft rotation of 350 degrees and with one step sealing mechanism. should have the manual cutting mechanism. and it should have including 7mm cutting and coag with usfda . each unit 902 nrs 543 cutting &coagulations device with tissue fusion ligature technology have small jaw tissue sealing system for open procedures vessel sealing instrument with cut length of 14.7 mm, seal length of 16.5mm, jaw angle 28 degrees. should have the manual cutting mechanism.and its should have including 7mm cutting and coag with usfda . each unit 903 nrs 544 cutting &coagulations device with tissue fusion ligature technology laparoscopic blunt tipped vessel sealer and divider 37 cm long 5mm instrument. wide jaw aperture 14.5 mm with shaft rotation of 180 degrees ; multifunctional laparoscopic device for tissue fusion.and its should have including 7mm cutting and coag with usfda . each unit 904 nrs 545 cutting &coagulations device with tissue fusion ligasure technology instrument for open surgeries with instrument length between 18 19cm and electrode length between 16 17cm, having 28 degree curved jaw with contoured tip for blunt dissection and having activation both through hand activation and foot activation with a manually controlled cutting mechanism. each unit 905 nrs 546 cutting &coagulations device with tissue fusion ligasuretechnology have36mm jaw length, 180 degree rotatable instrument with curved blade for large volume tissue. should have the manual cutting mechanism. each unit 906 nrs 547 cutting &coagulations device with tissue fusion ligasuretechnology have vessel sealing instrument for open surgeries with reusable clamp length between 16 18cm, with 12 14 degree jaw curve.and its should have including 7mm cutting and coag with usfda . each unit 907 nrs 548 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 908 nrs 549 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 909 nrs 550 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 910 nrs 551 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 911 nrs 552 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 912 nrs 553 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 913 nrs 554 each unit 914 nrs 555 each unit 915 nrs 556 each unit 916 nrs 557 each unit 917 nrs 558 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 918 nrs 559 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 919 nrs 560 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 920 nrs 561 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 921 nrs 562 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit long term double lumen dialysis catheter with kit accessories should be provided ( catheter, pull apart sheath, dialator, tunneling stylet, guide wire j / s, with disppencer and injection caps, symmetrical tip retrograde and antigrade 922 nrs 563 non fibre optic single use adult scope channel width :2.2 mm insertion tube diameter :5.0mm. working length :600 mm bending range :180 degree up & 180 degree down field of view :85 degree or more direction of view : 0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :6 mm illumination method :led complete system should be us fda and european ce certified each unit 923 nrs 564 multi vent mask pediatric, multi vent mask pediatric, air entrainment masks, must be safe, simple delivery of variable oxygen concentrations. each mask to includes color coded diluters: green for low concentration, white for medium concentration. locking ring to secure flow setting. must include adaptor for high humidity entrainment. complete kit with 7 ft oxygen tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 924 nrs 565 incentive spirometer incentive spirometer with wide flow range between 200 cc / sec and 1200 cc / sec. must have dual chamber design to help create constant resistance that lifts ball when patient maintains inspiration equal to selected adjustable flow setting & clearly marked flow settings for easy monitoring. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification each unit 925 nrs 566 closed suction catheter mdi port has isolated turbo cleaning chamber for cleaning catheter tip with mdi port.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version. can be used for 72hr. each unit 926 nrs 567 closed suction catheter mdi port has isolated turbo cleaning chamber for cleaning catheter tip with mdi port.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version. can be used for 72hr. each unit 927 nrs 568 closed suction catheter has isolated turbo cleaning chamber for cleaning catheter tip.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version.can be used for 72hr. each unit 928 nrs 569 closed suction catheter has isolated turbo cleaning chamber for cleaning catheter tip.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version.can be used for 72hr. each unit 929 nrs 570 fenestrated tracheostomy tube cuffed with 2 inner cannula, inner cannula should reduce the id by 1mm of tracheostomy tube one inner cannula is with five fenestration holes and one is without fenestration each unit 930 nrs 571 multifocal iol biconvex, single piece designoptic size 6 mm, overall 12 13 mm sizetwo haptics, modified cuv blocking capability360 degrees square edge, sterile packingfoldable lens with insertion via injector, should able to insert in sub 2.8 m.msterile disposable injector with cartridge along with each iolinjector should be of good quality with smooth injection without damaging ioldiopters required +16 to +25 ddiffractive multifocal design with +3 to +4 dioptre additionshould be iso or ce certifiedmanufacturer should be asked to supply samples for approval3 piece feldable 11 28 d each unit 931 nrs 572 glaucoma drainage implant ( valved ) with silicon tube adult each unit 932 nrs 573 glaucoma drainage implant ( valved ) with silicon tube paediatric each unit 933 nrs 574 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 934 nrs 575 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 935 nrs 576 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 936 nrs 577 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 937 nrs 578 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 938 nrs 579 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 939 nrs 580 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 940 nrs 581 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 941 nrs 582 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 942 nrs 583 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 943 nrs 584 monocanalicular self retaining silicone stent for canalicular repair medical graded silicone implant for reconstructing traumatic canalicular lacerations. silicone rod length40mm, silicone rod diameter 0.64 mm each unit 944 nrs 585 lacrimal intubation set for dcr surgery – bicanalicular lacrimal intubation set comprised of two flexible stainless steel probes attached through a hollow medical tube which is used in conventional dcr procedure. probe length probe diameter silicon tube length silicon tube id silicon tube od 11 cm 0.60 mm ( 23g ) 30 cm 0.30 mm 0.64 mm each unit 945 nrs 586 scleral fixiated intraoccular lense having multifoccal toric , three piece foldable intraoccular lense each unit 946 nrs 587 vibratory pep therapy device for pead . patients , deliver airflow vibrations to the patients from 5 30 hz expiratory resistance / frequency dial to allow therapy to be adjusted to patientss needs each unit 947 nrs 588 tracheostomy tube cuffed with sub glotic suction line and with 2 inner cannula kit, inner cannula should reduce the id by 1mm of tracheostomy tube each unit 948 nrs 589 dry lithium heparin pre filled abg syringe with air removal filter cap 1ml each unit 949 nrs 590 dry lithium heparin pre filled abg syringe with air removal filter cap 3ml each unit 950 nrs 591 epidural and spinal needle kit 16 / 18g should have needle to needle technique without backeye on epidural needle with lenght of 8cm . should have locking mechanism with graduation marking on hub of epidural needle and pencil point spinal needle , should have the marking on the epidural needle with 1 cm distance and marking should starts from 3 cm distance from the tip of the epidural needle . each unit 951 nrs 592 epidural kit with epidural needle marking starts from 3cm from the tip and catheter fixation device with locking mechanism 16 / 18g each unit 952 nrs 593 central line triple lumen with y needle and nitinol guide wire 8.5 fr with 16cm / 20cm catheter with tecoflex material each unit 953 nrs 594 central line quadra lumen with y needle and nitinol guide wire 8.5 fr with 15cm / 20cm catheter with tecoflex material each unit 954 nrs 595 central line quadra lumen with straight needle and nitinol guide wire 8.5 fr with 15cm / 20cm catheter with tecoflex material each unit 955 nrs 596 peripherally inserted central line for high flow / power injection sterile made of polyurethane single 55 cm long, 5 french single, double and triple lumen made of polyutherane with guide wire & microintroducer. should deliever infusion at 5 ml / sec rate and have reverse taper hub to provide kink resitance. introducer needle of 21 g. and used for power injection & monitoring cvp . each unit 956 nrs 597 latex folley balloon catheter each unit 957 nrs 598 latex folley balloon catheter each unit 958 nrs 599 ryle’s tube each unit 959 nrs 600 ryle’s tube each unit 960 nrs 601 post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved each unit 961 nrs 602 post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved each unit 962 nrs 603 post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved each unit 963 nrs 604 2 pcs flat base ostomy body fit 60 mm kit 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm, elastic tape in semi circular shape with hydrocolloid adhesive for extra security of base plate. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 964 nrs 605 2 pcs flat base ostomy body fit 70 mm kit 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. 70mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 965 nrs 606 2 pcs convex base ostomy body fit 60 mm kit two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 966 nrs 607 2 pcs convex base ostomy body fit 70 mm kit two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 70mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 967 nrs 608 1 pcs trasnparent colostomy body fit 60mm kit one piece colostomy bag body fit additional elastic adhesive technology ( elastic modulus0.34 n / mm ) , bag consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection 60mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) each unit 968 nrs 609 2 pcs flat base ostomy body fit bag 60 mm 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm each unit 969 nrs 610 2 pcs flat base ostomy body fit bag 70 mm 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. 70mm. each unit 970 nrs 611 2 pcs convex base ostomy body fit bag 60 mm two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm. each unit 971 nrs 612 2 pcs convex base ostomy body fit bag 70 mm two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 70mm. each unit 972 nrs 613 1 pcs trasnparent colostomy body fit bag 60mm one piece colostomy bag body fit additional elastic adhesive technology ( elastic modulus0.34 n / mm ) , bag consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection 60mm. each unit 973 nrs 614 non fibre optic single use large scope channel width :2.8mm insertion tube diameter :5.8 mm. working length :600 mm bending range :180 degree up & 160 degree down field of view :85 degree or more direction of view :0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :7 mm illumination method :led complete system should be us fda and european ce certified. each unit 974 nrs 615 antimicrobial silver dresssing sterile non occulusive wound contact layer consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid particles ( cmc ) , petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity upto 7 days, using patented lipido colloid technology ( tlc ) each unit 975 nrs 616 antimicrobial silver dresssing sterile non occulusive wound contact layer consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid particles ( cmc ) , petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity upto 7 days, using patented lipido colloid technology ( tlc ) each unit 976 nrs 617 non fibre optic single use cysto scope for djr & diagnostic cystoscope it should be capable of easy navigation and fast identification of anatomical landmarks the scopes should be sterile packed one cmos camera and two led light source should be integrated at the distal end minimum length of the scope should be 380 400mm working channel should be of 6.5 6.6 fr the control lever on handle for the movement of distal tip up & down in a single plane with 210 degree up and 120 degree down each unit 977 nrs 618 non fibre optic single use paediatrics scope channel width :1.2mm insertion tube diameter :3.8 mm. working length :600 mm bending range :180 degree up & 180 degree down field of view :85 degree or more direction of view :0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :5 mm illumination method :led complete system should be us fda and european ce certified. each unit 978 nrs 619 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 979 nrs 620 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 980 nrs 621 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 981 nrs 622 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 982 nrs 623 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 983 nrs 624 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 984 nrs 625 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 985 nrs 626 100% polysiloxane based scar management in gel form pure poly siloxane based silicone scar management product in sheet form ( we also should mention about the 100% poly siloxane and nylon polyamide mesh ) each unit 986 nrs 627 triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. each unit 987 nrs 628 triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. each unit 988 nrs 629 triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. each unit 989 nrs 630 drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure each unit 990 nrs 631 drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure each unit 991 nrs 632 drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure each unit 992 nrs 633 sulu stepped cartridges for variable tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 60 mm inner to outer side 3.0, 3.5 and 4.0 mm , purple colour code, usfda approved each unit 993 nrs 634 titanium total ossocular replacement prosthesis ( torp ) each unit 994 nrs 635 titanium partial ossocular replacement prosthesis ( porp ) each unit 995 nrs 636 piston titanium ( 0.4mm ) diameter each unit 996 nrs 637 piston titanium ( 0.4mm ) diameter each unit 997 nrs 638 piston titanium ( 0.4mm ) diameter each unit 998 nrs 639 piston titanium ( 0.4mm ) diameter each unit 999 nrs 640 piston titanium ( 0.6mm ) diameter each unit 1000 nrs 641 piston titanium ( 0.6mm ) diameter each unit 1001 nrs 642 piston titanium ( 0.6mm ) diameter each unit 1002 nrs 643 piston titanium ( 0.6mm ) diameter each unit 1003 nrs 644 piston titanium teflon mix ( 0.4mm ) diameter each unit 1004 nrs 645 piston titanium teflon mix ( 0.4mm ) diameter each unit 1005 nrs 646 piston titanium teflon mix ( 0.4mm ) diameter each unit 1006 nrs 647 piston titanium teflon mix ( 0.4mm ) diameter each unit 1007 nrs 648 piston titanium teflon mix ( 0.6mm ) diameter each unit 1008 nrs 649 piston titanium teflon mix ( 0.6mm ) diameter each unit 1009 nrs 650 piston titanium teflon mix ( 0.6mm ) diameter each unit 1010 nrs 651 piston titanium teflon mix ( 0.6mm ) diameter each unit 1011 nrs 652 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1012 nrs 653 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1013 nrs 654 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1014 nrs 655 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1015 nrs 656 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1016 nrs 657 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1017 nrs 658 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1018 nrs 659 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1019 nrs 660 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 0.5 mm each unit 1020 nrs 661 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 0.6 mm each unit 1021 nrs 662 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting / 0.8 mm each unit 1022 nrs 663 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 1.6 mm each unit 1023 nrs 664 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 2.3 mm each unit 1024 nrs 665 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 2.8 mm each unit 1025 nrs 666 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 3 mm each unit 1026 nrs 667 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 3.5 mm each unit 1027 nrs 668 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 4 mm each unit 1028 nrs 669 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 5 mm each unit 1029 nrs 670 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 0.5 mm each unit 1030 nrs 671 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 0.6 mm each unit 1031 nrs 672 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond / 0.8 mm each unit 1032 nrs 673 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 1.6 mm each unit 1033 nrs 674 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 2.3 mm each unit 1034 nrs 675 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 2.8 mm each unit 1035 nrs 676 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 3 mm each unit 1036 nrs 677 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 3.5 mm each unit 1037 nrs 678 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 4 mm each unit 1038 nrs 679 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 5 mm each unit 1039 nrs 680 burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 1 mm each unit 1040 nrs 681 burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 3, mm each unit 1041 nrs 682 burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 5 mm each unit 1042 nrs 683 sialestic sheet 55*75 mm and thickness 0.5 mm each unit 1043 nrs 684 ear pack / wick ( 12*24 mm length ) each unit 1044 nrs 685 t tube ( silicone ) 9 mm length each unit 1045 nrs 686 nasal haemostatic sponge pack with out airway 8 inch each unit 1046 nrs 687 nasal haemostatic sponge pack with out airway 10 inch each unit 1047 nrs 688 nasal haemostatic sponge pack ( with airway ) 8 inch each unit 1048 nrs 689 tracheostomy tube ( pvc material ) double lumen 3.5 8mm all size each unit 1049 nrs 690 tracheostomy tube ( pvc material ) fenestrated 3.5 8mm all size each unit 1050 nrs 691 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1051 nrs 692 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1052 nrs 693 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1053 nrs 694 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1054 nrs 695 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1055 nrs 696 diagnostic catheter ar 1 aka amplatz right each unit 1056 nrs 697 diagnostic catheter ar 1 aka amplatz right each unit 1057 nrs 698 diagnostic catheter vert angled tip 125cm each unit 1058 nrs 699 diagnostic catheter sim 1 aka simmon’s each unit 1059 nrs 700 diagnostic catheter sim 1 aka simmon’s each unit 1060 nrs 701 diagnostic catheter sim 2 aka simmon each unit 1061 nrs 702 diagnostic catheter sim 3 aka simmon each unit 1062 nrs 703 diagnostic catheter h 1 aka headhunter each unit 1063 nrs 704 diagnostic catheter pigtail each unit 1064 nrs 705 guide wire hydrophilic coated angled tip soft regular standard each unit 1065 nrs 706 guide wire hydrophilic coated angled tip extra stiff each unit 1066 nrs 707 guiding catheter braided guiding catheter in various shapes each unit 1067 nrs 708 guiding catheter braided guiding catheter in various shapes each unit 1068 nrs 709 guiding catheter braided guiding catheter in various shapes each unit 1069 nrs 710 guiding catheter braided guiding catheter in various shapes each unit 1070 nrs 711 guiding catheter braided guiding catheter in various shapes each unit 1071 nrs 712 guiding catheter braided guiding catheter in various shapes each unit 1072 nrs 713 guiding catheter balloon tipped guiding catheter size each unit 1073 nrs 714 distal access catheter each unit 1074 nrs 715 distal access catheter each unit 1075 nrs 716 intracranial support catheter with flat soft distal segment each unit 1076 nrs 717 intracranial support catheter with flat soft distal segment each unit 1077 nrs 718 flexometlic tube 3 8.5 with stylet reinforce et tube with wiring from tip to end it should be approved by *us fda each unit 1078 nrs 719 act tubes us fda + ce / dgci approved· disposable act tubes compatible with existing medtronic machines at smsh· should meet highest medical industrial standards· quality certification should be provided from authorized agencies. each unit 1079 nrs 720 high – presure injector lines us fda + ce / dgci approved· should be available in various lengths· should have male and female luer locks· should be transparent and kink resistant· should be able to take high pressure of angiographic injections each unit 1080 nrs 721 disposable transducers for invasive pressure monitoring compatible with available system in cath lab in smsh us fda + ce / dgci approved· disposable transducers for invasive pressure monitoring· should be compatible with available system in cath lab ( iabp – data scope & cath lab transducer ) and iccu at smsh· should meet highest medical industrial standards· quality certification should be provided form authorized agencies each unit 1081 nrs 722 renal double curve catheter us fda + ce / dgci approved· each unit 1082 nrs 723 simmons / sidewinder catheter us fda + ce / dgci approved· each unit 1083 nrs 724 vertebral catheter each unit 1084 nrs 725 coeliac axis catheter us fda + ce / dgci approved· each unit 1085 nrs 726 shepherd’s hook catheter us fda + ce / dgci approved· each unit 1086 nrs 727 vtk diagnostic catheter us fda + ce / dgci approved· each unit 1087 nrs 728 angiographic sizing pigtail catheter 5fr us fda + ce / dgci approved each unit 1088 nrs 729 angiographic sizing pigtail catheter 6fr us fda + ce / dgci approved each unit 1089 nrs 730 angiographic sizing pigtail catheter 7fr us fda + ce / dgci approved each unit 1090 nrs 731 balloon inflation catheter for brto usa / fda / ce approved 9 / 10 f 0.035 compatible , length100 / 120 cm , max volume 30 / 40 cc each unit 1091 nrs 732 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1092 nrs 733 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1093 nrs 734 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1094 nrs 735 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1095 nrs 736 pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1096 nrs 737 pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1097 nrs 738 multirate elastomeric disposable infusion pump with air vent blue end cap for air bubble removal and with two micro iv filters in 100 ml & 275 ml with flow rate from 1 7 / hr and 2 14ml / hr each unit 1098 nrs 739 single rate elastomeric disposable infusion pump with air vent blue end cap for air bubble removal and with two micro iv filters in 100 ml & 275 ml with flow rate of 2, 5, 8, 10ml / hr each unit 1099 nrs 740 pct kit with griggs forceps and with subglotic suction line tracheostomy tube with usfda / european ce each unit 1100 nrs 741 pct kit without griggs forceps and with subglotic suction line tracheostomy tube with usfda / european ce each unit 1101 nrs 742 double lumen closed suction set for et and tt , with mdi adopter , trach wedge , swiel connector and with reservoir each unit 1102 nrs 743 et tube with yellow subglotic suction line with inverted and soft seal cuff. with usfda / european ce each unit 1103 nrs 744 tt tube with yellow sub glotic suction line with inverted and soft seal cuff. with usfda / european ce each unit 1104 nrs 745 catheter stabilization device sterile latex free sutureless with sliding post each unit 1105 nrs 746 titanium maxillofacial fracture fixation miniplate 2.5 mm each unit 1106 nrs 747 titanium maxillofacial fracture fixation miniplate 2.0 mm each unit 1107 nrs 748 titanium maxillofacial fracture fixation miniplate 1.5 mm each unit 1108 nrs 749 titanium maxillofacial fracture fixation miniplate 1.5 mm c plate each unit 1109 nrs 750 titanium maxillofacial fracture fixation miniplate 2.5 mm l plate right and left side each unit 1110 nrs 751 titanium maxillofacial fracture fixation miniplate 2.0 mm l plate right and left side each unit 1111 nrs 752 titanium maxillofacial fracture fixation screws 1.5 mm each unit 1112 nrs 753 titanium maxillofacial fracture fixation screws 2.0 mm each unit 1113 nrs 754 titanium maxillofacial fracture fixation screws 2.5 mm each unit 1114 abdominal suction set each unit 1115 arterial line each unit 1116 av blood line each unit camscanner...

Sarva Shiksha Abhiyan Authority - Rajasthan

34031525 supply and installation of lab equipments and material for vocational education lab supply and installation of lab equipments and material for vocational education lab bfsi , computer system core i3, 7th gen., 3.9 ghz, 4gb ram, 1tb hdd, dvd, usb drives, speakers, keyboard, mouse, operating system win10, 3 year onsite warranty , ups 600 va, input 140 / 300 volts, bis / ce certified. , work station 01 computer table ( size 4’ x 2’ x 2’.6” ) &03 no. student chair , trading software currently available educational software’s for trading for class 9 12 students. ( multiuser ) , core banking software currently available banking software for educational / training purpose for class 9 12. ( multiuser ) , technical analysis software meta stock, falcon or currently available related software for educational purpose for class 9 12 students. ( multiuser ) , accounting software tally or related product for educational purpose ( multiuser ) , networking lan to be done using cat6 cable 50mtr, switch 24 port, i / o box 10nos., 20 rj45 connectors, 50 mtr.patch card. , internet connection high speed broadband. bsnl / airtel / idea / jio / othres any as per availability ) , writing board with white board marker and duster 6’ x 4’ white board, 4 color white board marker in a pack of 10 each color, 01 duster , projector portable projector hdmi interface, 3300 lumens, 50 watts, screen resolution: 1024 x 768, connector type: usb, hdmi, vga weight around 2.4 kg approx. , projector screen projector screen in 4:03 ratio aspect, ultra hd & 4k technology, 3d active projector screen 120 inch 8ft. ( w ) x 6 ft. ( h ) , multimedia speaker 2.1 any good brand 40 watt rms ( subwoofer 20w + satellite 10w x 2 ) , 2.1 multimedia speaker with bluetooth and multiple playback options – bt / usb / sd / aux, weight around 2.5 to 3 kg. , electrical work ( includes isi wiring and fitting ) 1 mcb 32 amp fixing of 01no. 2 power point with 3 socket per board fixing of 04 board per lab. 3 ceiling fan 02 nos. includes wiring and fitting. 4 exhaust fan 01 no. includes wiring and fitting. 5 tube light 03 nos. with complete fitting and fixtures. , laser printer function print / copy / scan, cartridge facility, 2400x600 dpi, mono print resolution / duplex, 2 side copy, 30ppm , air conditioner ( ac 1.5 ton / 2 ton depending on the room size ) split ac with inverter, with 4 star energy rating, 5 year warranty in total and 5 years separate warranty for compressor. , fire extinguishers 1 co2 type fire extinguisher for electrical equipment’s, minimum 4.5 kg, 1 abc type fire extinguisher for lpg, minimum 4.5 kg , frist aid kit must contains all major first aid accessories: crepe bandage , adhesive bandage, adhesive bandage round, pain relief gel, povidone iodine ointment, oral clinical thermometer, antiseptic liquid, absorbent cotton i.p., micro porous surgical tape, paracip / parachoice, gauze swab, roller gauze, a pair of scissors, first aid leaflet sticker...

Medical And Health Services - Rajasthan

33983316 supply of mnjy lab item consumable 1 n / 10 hcl 2 i hb meter 3 i hb tube ( square ) 4 hb pipette 5 i whatmans filter paper ( cirular ) 6 l lanscet 7 capillary tube fine 8 i wbc diluting fluid 9 neubars chamber 10 wbc pipette 11 methanol 12 13 14 15 field stain 1x500 ml a, 1x500ml b glass slides oil cedar wood platelate count fluid 16 reticulocyte count fluid 17 esr stand with marking and disposal cup and pipettes ( top tech ) 18 for esp test cup ( plastic ) top tei 19 esr pipette ( glass ) top tech 20 esp. epeite with hub ( disposal auto such 21 tii co ( loilf11 citrate 3 8% ( solution ) , 23 k3 edta tube ( double cap ) 24 urine albumin / sugar 25 urine cover slip 26 urine pregnancy test card 27 lugols idoine 28 benedict reagent 29 3% sulfosalicylic acid 30 modified rothras nitroprysside 31 33% acetic acid 32 5% barrium chloride powder 33 fouchets reagent 34 sulpher powder 35 hydrogen peroxide 36 benzidine powder 37 hepatitis b ( hbsag ) card 38 hepatitis c ( hcv ) card 39 vdrl strip 40 blood vdrl test kit 41 hiv card 42 hiv tridot 43 hiv combaids / elisa 44 dengue card antigen +antibody 45 dengue elisa 46 malaria card 47 widal test kit ( vials ) ( to. th. ah, bh ) 48 abo rh a, b, d, vials 49 coombs reagent 50 bovine albumin 22% 51 aso reagents vials 52 rf reagent vial 53 jsb i & ii , 55 z n stain rapid kit 56 sprit lamp 57 test tube 4for all serology glass / p 58 blood sugar 59 gldh kinetic system pack for xl 300 ureasi 60 urea for semi auto urease 61 creatinine for semi auto ( initial rtae ) 62 sgot without pyridoxal phosphate for semi auto ifcc method 63 sgpt without pyridoxal phosphate for semi auto ifcc method alkaline phosphates for semi auto __ kinetic ( pnpp ) total protein serail auto analyzer 66 albumin semi auto analyzer _ 67 bilirubin total for semi auto for total & direct biluribin 68 bilirubin direct for semi auto for total & direct biluribin 69 serum uric acid semi auto analyzer ( mono vial ) serum calcium semi auto analyzer ( mono vial ) 71 serum ldh semi auto analyzer 64 65 70 72 ckmb semi auloanalyzer 73 cknac semi autoanalyzei 74 serum arnlyase semi autoanalyzer kinetic 75 chole:strol semi auto 76 hd_ cholestrol semi auto analyzer 77 serum triglyceride for semi auto urease end point 78 crp 79 trbc :11 / 1.01 80 810 medical wr, ip iuckra 131w• wah ;if wo 81 bio medical wane bucket pee ) with ;jew 82 micro pipette 0 to 50 micio1.11 fix 83 micro pipette 0 in 10 micro lu f ix 8 86 87 i micro pipette 0 to 1000 micro ltr fix micro pipette 10 to 100 micro lti varaible micro pipette 20 to 200 micro ltr varaible micro pipette 100 to 1000 micro ltr varaible 88 gloves latex disposable lms 89 gloves latex 6 6% 90 hand wash liquid 91 92 3 parts dilucel plus 3 parts lycel plus 93 3 parts rincel plus 94 cemical h 560 five parts dilucel plus 95 cemical h 560 five parts lycel plus 96 cemical h 5605 parts rincel plus 97 auto pipet 98 mp staend 99 test tube 5 ul 100 101 102 103 104 test tube bad! test tube stand test tube holdar sprit sfri 5 parts dilucel plus 105 sfri 5 parts lycel plus 106 sfir 5 parts rincel plus 107 sodium hypo chlorite 5% 108 test tube rack plastic ( 1x48 wells ) 109 test tube rack plastic ( 1x24 wells ) 110 slide tray aluminum for 20 slides 111 112 113 needle 18 20 22 gauge csf diluting fluid semen diluting fluid 114 keton diastix 115 hemo spot test for occult blood 116 disposable syringe with needle 10 cc 117 disposable syringe with needle 5 ( . ( ., 118 disposable syringe with needle 2cc 119 120 121 122 123 blue tips yello tips tissue paper d.i. water glass marking pencil 124 125 126 127 black permanenl marker pen cotton sample cup plastic staining box glass 128 129 130 131 132 coplin jar dropper plastic disposable cap dispo mask cpd beg 350 ml 133 cpd beg 100 ml ( peadiatnc bag ) 134 135 forrnaline soul gloves powder 136 137 suger strip 138 139 blood sugar strip rapid accucheck go blood sugar strip rapid accucheck proforma blood sugar strip rapid accucheck sens ( 140 blood sugar strip rapid accucheck active 141 142 143 blood sugar strip rapid abbot optium blood sugar strip rapid easy touch coombs test 144 prothrombin test ( tulip ) 145 hdl direct method ( arta ) 1461 ldl direct method ( arba ) 147 148 149 150 electrolyte solution pack ( na, k, cl ) daily rinse kit quality control print roll 151 i leshmin stain 152 ec ) 1 / 4, solution gla acitic acid 154 gram iodine 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 erba wash printer roll ( 56mm ) adhesive roll cloth tonikete slide hb stripe, hemocue multistix ( urine strip for multiple test ) p t reagent bulb for microscope plain vail all antigen vovine albumin 22% coomb sera anti h anti d ( polyclonp ) anti ab ( polyclonp ) hcv card hbsag elisa hiv elisa hcv elisa betadine solution ph enyle solution anti d ( polyclonp ) anti ab ( polyclonp ) adhesive papper 180 liquid paraffin , 181 giemsa stain 182 183 184 185 186 187 chikunganya scrub typhus card swine flue vtm test tube brush plastic dropping bottle semi auto anaiyzer p.m. kit 188 ayres spatula 189 slide fixative 190 oil ermersion lence ( 100x ) 191 edta solution 192 193 194 sodium citrate vail anti al lectine anti human comb sera 195 anti h lactin 196 blood collection bag adult 197 blood collection bag pediatric 198 blood bank i bandage / hansaplast 199 bloodheamochek 200 esr tube 201 ethanol bottle 202 preventive and maintance kit for lab earba 203 hydrocloride acid 204 bbr graph paper...


33977251 supply and installation tools, equpment &amp furniture for lab of vocational education 1 ambu mask (adult) 1600ml. self inflating double ended silicone bag with mounts incorporating reservoir valve and side feed oxygen inlet. nos 3 2 aed trainer with adult pad vermed physio control multifunction defibrillator nos 1 3 stop watch royals digital stopwatch timer nos 3 4 oxygen cylinder portable oxygen cylinder (10 l, 150 breaths) nos 1 5 oxygen key for in gas cylinder nos 1 6 oxygen cylinder trolley suitable for 20 litre size gas cylinder nos 1 7 hospital bed single function bed in which head end of the patient can be raised with a handle length: at least 2000 mm ,breadth at least 900 mm & height at least 500 mm nos 2 8 bedside locker • 760mm l x 360mm w x 750 mm h • square & rectangular tube frame • ss top • trolley mounted on 50 mmdia wheels • pre treated & powder coated made of square / rectangular tube frame as well as stainless steel top and trolley mounted famish on 50 mmdia wheels isi / ce certification nos 2 9 cardiac table over bed table (cardiac table) table top height adjustable • frame: tubular mild steel. • finishing: epoxy powder coated, chrome plated adjustable nos 2 10 mattress alternating pressure mattress system with adjustable pump the otica alternating pressure mattress was designed specifically to provide relief from bed sores and ulcers caused from prolonged bed rest. nos 2 11 bed sheet, pillow, pillow cover made from cotton. size approx. : 145 x 225 cm. nos 4 12 blanket pure woollen hosiery blanket single bed 13 wheel chair nylon upholstery • full length arms padded • carry straps on seat allow for ease of folding and lifting • footrest • fold down back • light weight nos 2 14 walker standard oem product nos 2 15 crutch standard oem product nos 2 16 table (3 ft by 6 ft) made of wooden nos 2 17 cupboard steel cupboard for storage nos 1 18 stretcher should be light, safe and reliable, made of aluminium 1alloy and hold for the same, easy to lock and unlock features product dimensions: 192 x 43 x 8cm net weight: 9kg stretcher bearing: 120kg nos 1 19 cane 360 degree anti slip pivoting base provides easy walk on all terrain. the support weight is up to 100 kg, 5 levels adjustable height from 34 inch to 39 inch in 1 inch increment. this walking stick provides additional support for people with arthritic / painful hands when walking indoors and outdoors. nos 4 20 back rest • angle adjustable • foldable for easy storage nos 4 21 foot rest overall approx. step size: 505l x 305w x 230h mm. 800 • frame made of 1 x 18g crc tubes fitted with pvc stumps. • pre treated & epoxy powder coated. nos 4 22 steel basin (large) stainless steel kitchen sink (16 x 18 x 8 inches, silver) nos 4 23 bed pan standard product nos 24 urinal (male) nos 2 25 urinal (female) nos 2 26 air cushion standard oem product nos 2 27 sand bag standard oem product nos 2 28 weighing machine standard oem with isi / ce certification nos 1 29 steel tray (large) standard product nos 8 30 steel tray (medium) nos 8 31 artery forcep standard product rust free nos 5 32 dissecting forcep nos 8 33 scissor 34 nail cutter & filer nos 5 35 splint (large) malleable splints, made of aluminium alloy, can be strapped, x ray compatible, easy to fix nos 10 36 splint (medium) malleable splints, made of aluminium alloy, can be strapped, x ray compatible, easy to fix nos 10 37 splint (small) malleable splints, made of aluminium alloy, can be strapped, x ray compatible, easy to fix nos 10 38 cervical collar (large) standard oem with isi / ce certification nos 6 39 cervical collar (medium) standard oem with isi / ce certification nos 6 40 cervical collar (small) standard oem with isi / ce certification nos 6 41 spine board standard product •tapering from approx. 18 to 14 from head end to foot end. 74.2 long x 3.2 high at height of concave patient surface. • internal padding non absorbent, contoured, bevelled edges, adhesive backed, easy for sanitizing and reapplying. 65 x 11.375 x 6mm. nos 4 42 steel plate standard product rust free nos 4 43 steel glass nos 4 44 steel bowl nos 4 45 spoon nos 8 46 steel jug nos 2 47 bath tub standard product nos 2 48 kidney tray standard product large & small nos 2 49 iv stand • 22 diameter chrome plated heavy bar steel base • lock to ensure secured height positioning • twohook rams horn with secure grip tips • based on a four leg stand • height adjustment from 51 1/2 to 93 • bottom pole diameter is 1, upper pole diameter is 0.75 nos 2 50 measuring glass standard product non breakable nos 4 51 measuring tape standard product nos 4 52 goggles 53 suction apparatus a/c power with collection capacity of 200 ml with 20 litres per minute flow rate. backup for 20 min. provision with manual operation in case of any power failure nos 2 54 syringe destroyer standard oem with isi / ce certification electronic with cutter. nos 4 55 syringe steriliser nos 4 56 needle burner nos 1 57 thermometer nos 8 58 syringe 50 cc/ml nos 8 59 b.p. monitoring machine nos 5 60 hot water bottle as per standard nos 6 61 ice caps as per standard nos 4 62 transfer forceps as per standard nos 4 63 drum as per standard nos 1 64 dressing kit as per standard nos 1 65 dressing scissor as per standard nos 5 66 folley catheter as per standard nos 2 67 euro bags standard oem with isi / ce certification nos 6 68 ryle’s tube as per standard nos 4 69 vaccutanour (red/black/viol et) as per standard nos 10 70 tourniquet as per standard nos 2 71 examination table as per standard nos 1 72 call bell as per standard nos 2 73 rubber sheet/mackinto nossh as per standard nos 10 74 draw sheet as per standard nos 4 75 bandage as per standard nos 10 76 suction catheater as per standard nos 2 77 bulb syringe as per standard nos 2 78 oxygen mask 79 stethoscope double sided aluminium chest piece with matt anodising. it is precisely machined for enhanced performance & durability. it features dual tunable diaphragms with brass chrome plated rings. the larger diaphragm is used for adult patients whereas the smaller diaphragm is used for paediatric patients. nos 5 80 towel cotton nos 4 81 gown different size nos 10 82 gloves (disposable) – packet as per standard nos 8 83 gloves (surgical) – packet as per standard nos 8 84 liquid soap bottle as per standard nos 4 85 mask – packet as per standard nos 4 86 shoe cover packet as per standard nos 4 87 hair cap packet as per standard nos 1 88 sponge cloth as per standard nos 2 89 wet wipes packet as per standard nos 2 90 comb as per standard nos 4 91 tooth brush as per standard nos 4 92 toothpaste as per standard nos 2 93 hair oil as per standard nos 2 94 shampoo bottle as per standard nos 2 95 bath soap as per standard nos 8 96 talcum powder as per standard nos 2 97 different colour plastic bags with dustbins (red) as per standard nos 1 98 different colour plastic bags with dustbins (blue) as per standard nos 1 99 different colour plastic bags with dustbins (black) as per standard nos 1 100 different colour plastic bags with dustbins (yellow) 101 uro bag t tap type 2000 millilitre nos 10 102 sample collection bottle as per standard nos 10 103 gauze piece (4x4) as per standard nos 10 104 betadine solution bottle germicide gargle nos 4 105 cotton rolls as per standard nos 2 106 cotton absorbent supper cotton nos 2 107 normal saline bottle as per standard nos 2 108 micro pore 9.14 meter (length on a roll) without dispenser surgical tapes nos 5 109 spatula to collect pep smear, cytology specimen. nos 10 110 hydrogen peroxide bottle stabilized hydrogen peroxide nos 2 111 cleaning solution (colin) as per standard nos 2 112 stationary set multi functional multi toolkit for office works, stationary organizer | stapler, scissor, punch, ruler, sharpener, opener, remover, ring, clip holder (all in one kit) nos 5 113 paper (ream of 500) a4 size nos 1 114 extension cord with 4 sockets nos 1 115 speaker as per standard nos 1 116 fire extinguisher 2 kg nos 2 117 alcohol based hand sanitizer herbal, alcohol nos 5 litre 118 n 95 mask capelo with exhalation valve nos 10 119 rubber gloves latex water proof hand gloves pairs nos 10 120 unbranded steel tool box for basic tools nos 1 121 temperature gun non contact digital infrared thermometer nos 2 122 manikin (male & female) standard oem with isi / ce certification nos 1 each 123 oximeter finger tip pulse oximeter with spo2, p ...

Medical Health And Family Welfare - Rajasthan

33963400 supply of mnjy laboratory consumable item supply in govt hospital nathdwara mnjy laboratory consumable item supply in govt hospital nathdwara , category : laboratory , n / 10 hcl ( aspen ) , hb meter , hb tube ( square ) , hb pipette , whatmansfilter paper ( cirular ) , lanscet , capillary tube fine , wbc diluting fluid , neubars chamber , wbc pipette , methanol , field stain 1x500 ml a, 1x500ml b , glass slides , oil cedar wood , platelate count fluid , reticulocyte count fluid , esr stand with marking and disposal cup and pipettes ( top tech ) , for esr testcup ( plastic ) top tech , esr pipette ( glass ) top tech , esr pipette with blub ( disposal auto suck ) , tri sodium citrate 3.8% ( solution ) ( aspen ) , stop watch , k3 edta tube ( double cap ) , urine albumin / sugar , urine cover slip , urine pregnancy test card , lugols idoine , benedict reagent , 3% sulfosalicylic acid , modified rothrasnitroprysside , 33% acetic acid , 5% barrium chloride powder , fouchets reagent , sulpherpowder , hydrogen peroxide , benzidine powder , hepatitis b ( hbsag ) card ( aspen / sd / merilisa ) , hepatitis c ( hcv ) card , vdrl strip ( aspen / sd / merilisa ) , blood vdrl test kit , hiv card ( aspen / sd / merilisa ) , hiv tridot , hiv combaids / elisa , dengue cardantigen +antibody , dengue elisa , malaria card ( aspen / sd / merilisa ) , widal test kit ( vials ) ( to, th, ah, bh ) , abo rh a, b, d, vials ( tulip / eryclone ) , coombs reagent , bovine albumin 22% , asoreagents vials , rfreagent vial , jsb i & ii , jsb i & ii , z.n. stain rapid kit , sprit lamp , test tube 4 for all serology glass / plastic , blood sugar ( erba ) , kinetic system pack for xl 300 urease gldh , urea forsemi auto urease ( erba ) , creatinine for semi auto ( initial rtae ) ( erba ) , sgot without pyridoxal phosphate for semi auto ifcc method ( erba ) , sgpt without pyridoxal phosphate for semi auto ifcc method ( erba ) , alkaline phosphates for semi auto kinetic ( pnpp ) ( erba ) , total protein sermi auto analyzer ( erba ) , albumin semi auto analyzer ( erba ) , bilirubin total for semi auto for total & direct biluribin ( erba ) , bilirubin direct for semi auto for total & direct biluribin ( erba ) , serum uric acid semi auto analyzer ( mono vial ) ( erba ) , serum calcium semi auto analyzer ( mono vial ) ( erba ) , serum ldh semi auto analyzer ( erba ) , ckmb semi autoanalyzer ( erba ) , cknac semi autoanalyzer ( erba ) , serum amlyase semi autoanalyzer kinetic ( erba ) , cholestrolsemi auto ( erba ) , hdl cholestrol semi auto analyzer ( erba ) , serum triglyceride forsemi auto urease end point ( erba ) , crp , trbc reagent , bio medical waste bucket blue with sieve , bio medical waste bucket red with sieve , micro pipette 0 to 50 micro ltr fix , micro pipette 0 to 10 micro ltr fix , micro pipette 0 to 1000 micro ltr fix , micro pipette 10 to 100 micro ltr varaible , micro pipette 20 to 200 micro ltr varaible , micro pipette 100 to 1000 micro ltr varaible , gloves latex disposable lms , gloves latex 6 6½ 7 , hand wash liquid , 3 parts dilucel plus , 3 parts lycel plus , 3 parts rincel plus , cemical h 560 five parts dilucel plus , cemical h 560 five parts lycel plus , cemical h 5605 parts rincel plus , auto pipet , mp staend , test tube 5 ul , test tube badi , test tube stand , test tube holdar , sprit , sfri 5 parts dilucel plus , sfri 5 parts lycel plus , sfir 5 parts rincel plus , sodium hypo chlorite 5% , test tube rack plastic ( 1x48 wells ) , test tube rack plastic ( 1x24 wells ) , slide tray aluminum for 20 slides , needle 18 20 22 gauge , csf diluting fluid , semen diluting fluid , keton diastix , hemo spot test for occult blood , disposable syringe with needle10cc , disposable syringe with needle5cc , disposable syringe with needle2cc , blue tips , yello tips , tissue paper ( j.k., apple etc ) , d.i. water , glass marking pencil , black permanent marker pen , cotton , sample cup plastic , staining box glass , coplin jar , dropper plastic , disposable cap , dispo mask , cpd beg 350 ml ( polymed ) , cpd beg 100 ml ( peadiatric bag ) , formaline soul , gloves powder , suger strip ( accusure ) , blood sugar strip rapid accucheck go , blood sugar strip rapid accucheck proforma , blood sugar strip rapid accucheck sensor , blood sugar strip rapid accucheck active , blood sugar strip rapid abbot optium , blood sugar strip rapid easy touch , coomb’s test , prothrombin test ( tulip ) , hdl direct method ( arba ) , ldl direct method ( arba ) , electrolyte solution pack ( na, k, cl ) , daily rinse kit , quality control , print roll , leshmin stain , e.d.t.a. solution , gla. acitic acid , gram iodine , erba wash , printer roll ( 56mm ) , adhesive roll cloth , tonikete , slide , hb stripe, hemocue , multistix ( urine strip for multiple test ) , p.t. reagent , bulb for microscope , plain vail ( aspen ) , a / 1 antigen ( tulip / eryclone ) , vovine albumin 22% ( tulip / eryclone ) , coomb sera ( tulip / eryclone ) , anti h ( tulip / eryclone ) , anti d ( polyclonp ) , anti ab ( polyclonp ) , hcv card ( aspen / sd / merilisa ) , hbsag elisa ( aspen / sd / merilisa ) , hiv elisa ( aspen / sd / merilisa ) , hcv elisa ( aspen / sd / merilisa ) , betadine solution , phenyle solution , anti d ( polyclonp ) , anti ab ( polyclonp ) , adhesive papper , liquid paraffin , giemsa stain , chikunganya , scrub typhus card , swine flue vtm , test tube brush , plastic dropping bottle , semi auto anaiyzer p.m. kit , ayres spatula , slide fixative , oil ermersion lence ( 100x ) , edta solution ( aspen ) , sodium citrate vail ( aspen ) , anti a1 lectine ( tulip ) , anti human comb sera , anti h lactin , blood collection bag adult , blood collection bag pediatric , blood bank bandage / hansaplast , blood heamochek , esr tube , ethanol bottle , preventive and maintance kit for lab earba , hydrocloride acid , bbr graph paper...

Directorate of Local Bodies - Rajasthan

33934669 supply of medicine 1. inj ceftriaxone tazobectum 2. inj. ceftiofur sodium 3. inj amoxicillin clavenate 4. inj. enrfloxacin 5. inj. gentamycin 6. inj. dcr 7. inj bivinal plus ( vitamin bcomplex and liver extract ) 8. inj mecovet xl ( methylcobalmine 2500mg ) 9. inj hitek ( ivermactin ) 10. inj avil ( chlorpheniramin maleate ) 11. inj. dexamethasone 12. inj. prednisolone 13. inj. isofluperidone 14. inj. meloxicam 15. inj. flunixin meglumin . 16. inj. arv ( anti rabies vaccine ) 17. inj n.s. 18. inj dns 19. inj r.l. 20. inj. metronidazle 21. inj. mannitol 22. inj zackshot ( tranexamic acid ) 23. inj. adrenaline 24. inj. atropine sulphate 25. inj. rintose 26. inj. enrocarus 27. inj.oxytetracyclin 28. inj. tribevet 29. inj. rumeric ( b cmplex and amin acid ) 30. inj. diazapam 31. inj. propofol 32. inj. zoletil 50, 5m1 33. inj rantac 34. inj. raglan 35. inj. ondansetron 2mg / m1 36. tab. neomac 10mg 37. tab. amoxi slave 625mg 38. tab. praziquenta1120mg, pyrental pam 250mh and febentel 150 mg , 39. tab. metronidazole 250mg 40. lotion wokazol plus 41. dettol liquid hand wash antiseptic _refile 42. liquid detergent 43. liquid chlorhexidine gluconate and cetrimide ( savlon ) 44. liq. fipronil 45. detergent powder 46. liq calandulla ( homeopathy ) 47. powder coumaphs, propoxur and sulfanilamide ( negasunt ) 48. powder neosporin 49. surgical sprit ( 70% isopropyl alcohol ip ) 50. spray flyrepellant , antiseptic, herbal dmag, scavn, healant 51. alu spray ( neomycin, polymixin & bacitracin ) 52. n 95 face mask 53. face shield ( studds / steelbird ) 54. 3m chg ( chlorhexidine gluconate ) hand rub 55. absorbent cotton gauze than 56. absorbent cotton roll 57. absorbent cotton roll 58. microporus surgical paper tape 1 / 2 inchx5meter 59. microporus surgical paper tape 2 inchx5meter 60. microporus surgical paper tape 1 / 4 inchx5meter 61. bandage 6 inches 62. bandage 4 inches . 63. disposable surgical face mask 64. sterile surgical gloves no. 7.5 65. sterile surgical gloves no. 8 66. examination gloves 67. i / v. set, vented 68. sn set 22g 69. sn set 24g 70. digital thermometer 71. stethoscope 72. surgeon surgical blade number 10 73. surgeon surgical blade number 15 74. nipro syringe with needle 3 ml 75. nipro syringe with needle 5 ml 76. nipro syringe with needle 20 ml 77. nipro syringe with needle 50 ml 78. needle 20 g 79. vicryl suture no. 1 ( 110cm, 40mm, 1 / 2 circle round bodied ) 80. vicryl suture no. 2 0 ( 110cm, 40mm, 1 / 2 circle round bodied ) 81. prolene suture no. 1 ( 75cm, 36mm, 1 / 2 taper bodied ) 82. prolene suture no. 1 0 ( 75cm, 36mm, 1 / 2 taper bodied ) , 83. shaving blade 84. vet plasma 6% 85. inj. vitamin c 86. inj. ligncain 2% 87. inj. doramectin 88. inj. amikasin 89. kiskin lotion 90. takfa pet spray 91. epitic ear cleanser 92. pomisol ear drops 93. zipvit liquid 94. health up pro 95. tab. serratiopeptidase 10mg 96. tab. bayrocin 50mg 97. tab. dr. doxy 200mg 98. tab. vetalexin 300mg 99. tab marbomet 50mg 100 tab. melobest 101 tab. carprofen 25mg 102 tab. carprofen 100mg 103 tab. cefpet 100mg 104 adhesive tape 105 self adhesive elastic bandage 10x4 106 dermichlore spray 107 tuberculin syrige lmi...

Medical Education Department - Rajasthan

33934130 bids are invited for human anatomy set of 3 volume , anatomy and physiology for nurse , clinical anatomy , basic anatomy and physiology , handbooks of anatomy , text books of anatomy , text books of anatomy and physiology , principles of anatomy and physiology , anatomy and physiology for nurse inberbeer singh , anatomy physiology for nurse pearce , nutrition biochemistry for nurse , nursing manual of nutrition therapy , nutrition atlas if india , essentials of food and nutrition , nutrition and dietetics , manual of nutrition and dietetics , comprehensive textbook of nutrition diets , textbooks of biochemistry , essential of biochemistry , principles of biochemistry , biochemistry for gradutate nurse , essentials of biochemistry cbs publication , fundamental of nursing , new textbooks of nurses india vol 1 and 2 , scientific principle in nursing , principles and practice of nursing vol 1 sr nancy , principles and practice of nursing vol 2 sr nancy , fundamental of nursing vol 1 alphosa jacob , fundamental of nursing vol 2 alphosa jacob , fundamental of nursing procedure , clinicalnursing procedure , general textbooks of nursing , textbooks of nursing foundation , textbooks of nursingfoundation cbs publication , first aid and emergency , bandages and dressing , first aid hand book , first aidmanual accident and emergency , first aid , manual ofnursing procedure and practice , clinical nursing procedures, manipal manual of instruments , instrument and oprativesurgery , manipal traning manual of infection control , pginine clinical nursing procedures , textbook of psychology , basic psychology , psychology for nurse , understandingmedical psychology , psychology for gradation nurses , psychology for foundation nurses , textbooks ofmicrobiology , textbooks of medical microbiology , textbooks of medical microbiology for nurses , textbooks ofmicrobiology for student , textbooks of microbiology fornurses , microbiology for nurses , textbook of computer innursing , computer for nursing total quantity : 406...

Medical Education Department - Rajasthan

33933926 bids are invited for human anatomy set of 3 volume , anatomy and physiology for nurse , clinical anatomy , basic anatomy and physiology , handbooks of anatomy , text books of anatomy , text books of anatomy and physiology , principles of anatomy and physiology , anatomy and physiology for nurse inberbeer singh , anatomy physiology for nurse pearce , nutrition biochemistry for nurse , nutrition atlas if india , essentials of food and nutrition , nutrition and dietetics , manual of nutrition and dietetics , comprehensive textbook of nutrition diets , textbooks of biochemistry , essential of biochemistry , principles of biochemistry , biochemistry for gradutate nurse , essentials of biochemistry cbs publication , fundamental of nursing , new textbooks of nurses india vol 1 and 2 , scientific principle in nursing , principles and practice of nursing vol 1 sr nancy , principles and practice of nursing vol 2 sr nancy , fundamental of nursing vol 1 alphosa jacob , fundamental of nursing vol 2 alphosa jacob , fundamental of nursing procedure , clinicalnursing procedure , general textbooks of nursing , textbooks of nursing foundation , textbooks of nursingfoundation cbs publication , first aid and emergency , bandages and dressing , first aid hand book , first aidmanual accident and emergency , first aid , manual ofnursing procedure and practice , clinical nursing procedures, manipal manual of instruments , instrument and oprativesurgery , manipal traning manual of infection control , pginine clinical nursing procedures , textbook of psychology , basic psychology , psychology for nurse , understandingmedical psychology , psychology for gradation nurses , psychology for foundation nurses , textbooks ofmicrobiology , textbooks of medical microbiology , textbooks of medical microbiology for nurses , textbooks ofmicrobiology for student , textbooks of microbiology fornurses , microbiology for nurses , textbook of computer innursing , computer for nursing total quantity : 407...

Medical Education Department - Rajasthan

33932184 bids are invited for human anatomy set of 3 volume , anatomy and physiology for nurse , clinical anatomy , basic anatomy and physiology , handbooks of anatomy , text books of anatomy , text books of anatomy and physiology , principles of anatomy and physiology , anatomy and physiology for nurse inberbeer singh , anatomy physiology for nurse pearce , nutrition biochemistry for nurse , nursing manual of nutrition therapy , nutrition atlas if india , essentials of food and nutrition , nutrition and dietetics , manual of nutrition and dietetics , comprehensive textbook of nutrition diets , textbooks of biochemistry , essential of biochemistry , principles of biochemistry , biochemistry for gradutate nurse , essentials of biochemistry cbs publication , fundamental of nursing , new textbooks of nurses india vol 1 and 2 , scientific principle in nursing , principles and practice of nursing vol 1 sr nancy , principles and practice of nursing vol 2 sr nancy , fundamental of nursing vol 1 alphosa jacob , fundamental of nursing vol 2 alphosa jacob , fundamental of nursing procedure , clinicalnursing procedure , general textbooks of nursing , textbooks of nursing foundation , textbooks of nursingfoundation cbs publication , first aid and emergency , bandages and dressing , first aid hand book , first aidmanual accident and emergency , first aid , manual ofnursing procedure and practice , clinical nursing procedures, manipal manual of instruments , instrument and oprativesurgery , manipal traning manual of infection control , pginine clinical nursing procedures , textbook of psychology , basic psychology , psychology for nurse , understandingmedical psychology , psychology for gradation nurses , psychology for foundation nurses , textbooks ofmicrobiology , textbooks of medical microbiology , textbooks of medical microbiology for nurses , textbooks ofmicrobiology for student , textbooks of microbiology fornurses , microbiology for nurses , textbook of computer innursing , computer for nursing total quantity : 414...

Indian Army - Rajasthan

33920806 puchase of medicines purchase of medicines out of echs fund for fy 2022 23 , drugs , tab acitrom 4 mg ( nicoumalone ) , tab zolpidem 10 mg , tab sevelamer 400 mg , tab amlodipine 5+ atenolol 50 mg , tab allopurinol 100 mg , tab amlodipine 10 mg , tab baclofen 10 mg , tab betahistidine 8 mg , tab cinnarazine 25 mg , tab alfa ketoanlogue , tab fenofibrate 200 mg , tab febuxostate 40 mg , tab levetiracetam 500 mg , tab ketorolac 10mg , tab sodium valporate 200 mg , tab / cap heamatinic containing ferrous fumarate 350mg and above, vit b 12 1 3 mcg and above folic acid 400 600 mcg and above vit c 75 90mcg and above , tab acenocoumarole 1 mg , tab diltiazem 60 mg , tab digoxin 0.25 mg , tab olanzapine 5 mg , tab prednisolone 20 mg , tab bisoprolol 5 mg , tab cilnidipine 5 mg , tab alendronic acid 70 mg , tab nicorandil 10 mg , tab isosorbide dinitrate 10 mg , tab bisacodyl 5 mg , tab apixaban 2.5 mg , tab vildagliptin 50 mg , tab piroxicam 20 mg , tab pioglitazone hydrochloride15 mg , cap alfacalcidol vit d3 0.25 mg , anti cold ( paracetamol+ cetrizine+ chlorpheneramin ) , tab sodium bicarbonate 500 mg , tab alprazolam 0.25 mg , tab clonazepam 0.5mg , tab propranolol 40 mg , tab enalapril 5 mg , tab telmisartan 40 mg + hydrochlorothiazide 12.5 mg , tab enalapril 2.5 mg , tab enalapril maleate 10 mg , tab fluoxetine 20 mg , tab duloxetine 20 mg , tab lorazepam 1 mg , tab risperidone 2 mg , tab olanzapine 10 mg , tab phenobarbitone 30mg , tab pheniramine maleate 25 mg ( avil 25mg ) , tab venlafaxine 37.5 mg , tab vitamin e 200 mg , tab glucosamine 250 mg + chondroitin sulphate 200 mg , tab ranolazine500 mg , tab propranolol 20 mg , tab silodosin 8 mg , tab ticagrelor 90 mg , tab leflunamide 10 mg , tab levosulpride 25 mg , tab atorvastatin 10 mg + asprin 75 mg , tab carbamazepine 200 mg cr , tab etorcoxib 120 mg , tab lithium carbonate 400 mg , tab ondasterone 8mg , tab metoprolol 25 mg , tab prednisolone 5mg , tab metformin 500mg+ vildagliptin 50mg , tab chlorzoxazone 500mg+ diclofen sodium 50 mg+ paracetamol 325 mg , tab ivabradine 5mg , tab deflazacort 6 mg , inj rabies vaccine vial of 1 ml , inj anti tetanus immunoglobulin / tetanus immune globulin ( tig ) & tetanus antitoxin 250 iu , inj pantoprazole40mg , inj ferric hydroxide sucrose complex 20 mg in 5ml for injection , inj vitamin b1 ( 100mg ) b2 ( 100mg ) & b12 1000mcg with stablity , oint ketoconazole cream 2% 30 g , oint betamethasone + salicylic acid, tube of 10 gms & above , oint clindamycine phosphate 1% tropical gel tube of 10gm , oint clobetasol propionate 0.05%in tube of 10 gm with salicylic acid , lotion chlorhexidine mouth wash , pulv clotrimazole 1% bott of 75 g , ketoconazole shampoo 2% w / w bottl of 60 ml , isabgol / ispaghula husk 3.5 gm , nasal drop xylometazoline hcl 0.1% bott of 10 ml , e / d ciprofloxacin 0.3%+ dexamethasone 0.1% ) , eye drops ciprofloxacin 0.3% 3mg / ml vial of 5 ml , eye drops flurbiprofen sodiumophthalmic solution0.03%vial of 5 ml , eye drops gatifloxacin 0.3% bott of 5 ml , eye drops moxifloxacin 0.5% preservative free bott of 5ml , e / d candibiotic ( lidicaine 2%+clotrimazole 1% ) , e / d sustane ultra ( polyethylene glycol+ propyleen ) , eye drops sulphacetamide , eye drops travoprost 0.004% bott of 2.5 ml , syp sucralfate suspension bott of 200 ml , syp antacid antigas gel , syp cremaffin white each 15 mlcontaingmilk of magnesia1125 ml, liq paraffin3.75 mlbott of 170 ml , syp lactulose syp each 5ml , syrup bromhexine bottle of 100 150 ml , mdi inhaler beclomethasone dipropionate 50 mcg and levo salbutamol sulphate 50 mcg per metereddose aerosol, 200 dose ( eg aerocort ) , mdi tiotropium bromide 9 mcg, 120 metered doses / unit , mdi salmeterol 25 mcg + fluticasone 250 mcg autohaler , mdi duolin ( levo salbutamol 50+ ipratropion 20 mcg 200 dose ( , mdi inhaler formoterol 6 mcg and budesonide 400 mcg cfc free ( 120 doses ) , insulin disposable syringe 1 ml 100 iu , urine collecting bag with volume meter , gauze surgical, open wove, unmedicated: 60 cm wide , bandage crepe: 10 cm , cervical coller soft m , hydroxymethylecellulose , band aid , bandage open wove uncompressed: 6 cm x 4 metres , cotton wool, absorbent pkt of 500 gm , levo salbutamol sulphate, 2.5 ml, containing 1.25 mg, respule , knee cap size assorted size ( large, m, xl, xxl ) , budesonide 0.5 mg respules , gamma benzene hexachloride 1% w / v, cetrimide 0.1% w / v in alcoholic solution bott of 100 ml , follys catheters 16 , hand gloves, size 7 pair of , syringe dosposable, plastic sterile, 10 ml with needle , syringe disposable, plastic, sterile, 2 ml with needle , syringe disposable, plastic, sterile, 5 ml with needle , tab methylcobalamin500 mcg , tab clinidipine 10 mg , tab amlodipine 2.5 mg , tab atorvastatin 20+ecosprin 75+ clopidogrel 75mg , tab atorvastatin 20 + ecosprin 75 mg , tab allopurinol 300 mg , tab itopride 50 mg , tab sitagliptin phosphate 50 mg , tab spironolactone 50 mg , tab carvedilol 6.25 mg , tab lorazepam 2 mg , tab librium 10 mg ( chlordiazepoxide 10mg ) , tab chlordiazepoxide 5+ clidinium 2.5 mg+ dicyclomine 10 mg , tab olmisartan 20 mg , tab olmisartan 40 mg , tab sevelamer 800 mg , tab rosuvastatin 10 mg , tab rosavastation 40 mg , tab glimipride 2mg + pioglitazone 15mg +metformin 500mg , tab gliclazide 80 mg , tab etiozolam 0.25 mg , tab eplerenone 25 mg , tab escitalopram 5 mg , tab escitalopram 20 mg , tab etiozolam 0.5 mg , tab flunnarazine 10 mg , tab febuxostate 80 mg , tab escitalopram 10 mg + clonazepam 0.05 mg , tab spironolactone 50+ torasemide 5 mg , tab metformin 500 +glimepride 1 mg , tab methotrexate 7.5mg , tab metformin 500+ glimepride 2 mg , tab methtylprednisolone5 mg , tab pioglitazone 30 mg , tab pantoprozole 40 mg + domperidone 30 mg , cap rabeprazole 20 mg+ domperidone 10mg , tab montelucast 10mg , tab memantine 5 mg , tab rabeprazole 20 mg , tab nicorandil 5 mg , tab oxcarbazepine 450 , tab nicoumalone 3 mg , tab nicoumalone 2 mg , tab acebrophylline 200 mg , tab acarbose 25 mg , tab mesalamine 800 mg , tab atorvastatin 40 mg , tab gaba m ( gabapentin 300mg+ methycobalamine 500mg ) , tab itraconazole 200 mg , tab gabapentin 400mg+nortriptylinr 10mg , tab donepezil 5 mg , tab diclofenac 50 mg + paracetamol 500 mg , tab diclofenac 50+ seratio 10 mg , tab asprin 75mg + clopidogril 75mg , tab tenagliptin 20 mg , tab mesalamine 1200 mg , tab thyroxine 125 mcg , tab thyroxine 100 mcg , tab thyroxine 25 mcg , tab carvedilol 10 mg , tab hydroxyzine 25 mg , tab hydrochlorothiazide 12.5 mg , tab telmisartan 80 mg , tab torsemide 20 mg , tab torsemide 5 mg , tab toleteridine 4 mg , tab telmisartan 20 mg , tab sodium valporate 500 mg , sulphasalazine 1000 mg delayed release tab , tab sodium valporate 300 mg , tab tolperisone 150mg , tab clonazepam 0.25 mg , tab losartan 50+ hctz 12.5 mg , tab diclofenac 50 mg + paracetamol 325 mg + serratiopeptidase 10 mg , tab silodosin 8mg dutasteride 0.5mg , tab gabapentine 100 mg , tab lamotrigene 100 mg , tab ketoconazole 200 mg , tab glyceryl trinitrate cr 6.4 mg , tab trimetazidine 35 mg , tab ursodeoycholic acid 600 mg , tab ursodeoycholic acid 300 mg , tab vasograin ( caffeine100+ergotamine1+paracetamol 250+prochlorperazine 2.5 mg ) , tab risperidone 2+ trihexyphenidyl 2 mg , tab merabegrrain 50 mg , tab metoprolol 12.5 mg , tab mebeverine 200 mg , tab nitrofurantoin 100 mg , tab methyprednisolone 4 mg , tab grisofulvin 25 mg , tab rivastigmine 1.5 mg , tab trazodone 25 mg , tab omega 3 fatty acid 1000mg , tab diltiazem120 mg , tab solifenacin 10 mg , tab tramadol hcl 50 mg , tab vitamin e 400 mg , tab calcium dobesilt 500mg , tab risperidone 1mg , tab tamsulosin 0.4 mg + dutasteride 0.5 mg , tab diclofenac 100 mg sr , tab / cap lystok ( lycopene +vit c & e +copper+chromium+zinc+selenium+manganese , tab / cap rutofine d ( trypsin 48 mg+bromelain 90mg+rutoside100+diclofenac 50 mg ) , tab voglibose 0.3 mg , tab ultracet ( paracetamol+tramadol ) , tab pregabolin 75 mg+ nortriptyline 10 mg , diclofenac spray 55 gm , inj huminsulin r ( soluble insulin injection ip 40iu / ml ) 10 ml , inj deriphyllin ( etofylline 84.7+ theophylline 25.3 mg ) , oint chlorhexidine gluconate + metronidazole + lignocain hydrochloric gel , inj insulin apidra ( insulin glulisine ) pen , tannic acid + zinc chloride + cetrimide liqued gel , eye drop timolol +brimonidine ( combigen ) , syp iron with folic acid and cynocobalamine , syp aristozyme liquid pineapple ( diastase and pepsin liquid ) , syp piracetam 100 ml , syp tricholine ciotrate 0.55 gm+ sorbitrol 7.15 gm , syp disodium hydrogen citrate 100 ml , follys catheters 14 , e / d nepafenac 0.1% , e / d soliwax ( benzocaine+paradichlorobenzene+chlo ) , e / d i tone , povidone iodine gargle 2% 50 ml , heel cusion on silicon , insulin syringe 40 iu , ung lignocane jelly 2% , micro disposable insulin needle , mdi asthalin ( salbutamol 100mcg ) , lumber belt size m, l, xl, xxl , nepro hp high protian powder 400 gm , neosprin powder , n / sazelastinehcl+ fluticosone nasal spray , r / c aerocort ( levosalbutamol +beclometasone mcg ) , rotahaler , ung annovate ( phenylephrine 0.10% +beclometasone 0.025% +lidocaine 2.5 % w / w ) 20 gm , ung silver sulphadoxin , ung terbinafine 10 gm , bandage dressing 10 cm , tab alfuzocin 10 mg , tab clobazem 5 mg , creape bandage 15 cms , tab cyproheptadine 4 mg , tab efavirenz 600 mg , tab finasteride 5 mg , tab gliclazide 60 mg , tab glucosamine 500 mg + msm , inh levosalbutamol aerosal pack of 200md , inj adrenaline , inj botulinum toxin 100 iu , i v fluid ringer lactate500 ml , tab leflunamide 20 mg , tab lopramide 2 mg , tab methotrexate 5 mg , tab nebivolol 5 mg , tab ofloxacin + ornidazole , oint betamethasone , oint tacrolimus 0.3 % , tab pacitane 2 mg ( trihexyphenydyl ) , tab paroxetine 25 mg , tab sertraline 50mg , tab betahistidine 16 mg , tab bisoprolol 2.5 mg , tab carvedilol 12.50 mg , tab cilnidipine 20 mg , tab cilnidipine 10 mg , tab cinnarazine 25 mg + domperidone 10 mg , tab clonazepam 1 mg , colostomy bag inner 01972 , colostomy bag outer 01755 , cotton roll 75 gms , cotton roll 200 gms , cotton roll 500gm , daflon 500 mg , desonide cream / oint , disposable mask , eye drop normo tear , elastoplast adhesive plaster 70 mm , tab empagliflogin 25 mg + linagliptin 5 mg , tab fenofibrate 160 mg , tab tamsulosin 0.4+ finasteride 5mg , fluticasone 0.05% w / w 10 gm , gbhc lotion 100 ml , glycerine 100 ml , gum paint , insulin pen needle , inj neurobion 3 ml , inj multivitamine amp of 10ml , inj methylcobalimine , inj ondasetron , inj tetnus toxoid 0.5 ml , inj nandrolone 25 mg , inj nandrolone 50 mg , inj nandrolone 100 mg , isapgol 100 gm powder , i v fluid normal saline 0.9500 ml , knee support l, xl, xxl , tab frusemide 20 mg + spironolactone 50 mg , tab levocarnitine 500 mg , tab lorazapam 2 mg , mouth wash chlorhexidine 150 ml , micropore 2.5 cms width , n 95 mask , oint clobetasol + gentamycin + miconazole , oint fusidic acid , oint mouth ulcer gel , tab ondansetron 4 mg , tab prednisolone 10 mg , tab rosuvastatin 10 mg + asprin 75 mg , tab shampoo selinium sulphide , palv sporlac sachets , tooth paste sensodent , tab thiocolchiside 4 mg , tab torsemide 5 mg +spiranolactone 25 mg , trypsin with chymotrypsin tab , tab ursodeoycholic acid 150 mg , sodium hypochloride 5 ltr , hepa merz sacets , povidine iodine vaginal tablets , adult diapers xl, xxl 10 pcs pkt , cap cyclosporin 50 mg , tab etizolam 0.5 mg + propanolor 20 mg hcl , tab acitrom 1 mg ( nicoumalone ) , tab gabapentine 300 mg + nortryptillin 25 mg , inj iron sucrose , oint miconazole , tab olmisartan 20 mg + amlodipine 5 + hctz 12.50 , tab olmisartan 40 mg + amlodipine 5 + hctz 12.50 , tab sulphasalazine 500 mg , tab tapentadol 50 mg , tab valgancyclovir 450 mg , urine strips , erbah 360 dil ( 20 litterkit ) , eliteh 360 clean ( 50 mlkit ) , eliteh 360 lyse ( 500 mlkit ) , control for ( hematology analysererbah360 ) , tab diltiazem ( controlled delivery ) 90 mg , tab quetiapine 50mg , abdominal support , tab aceclofenac 200 mg , tab acotiamide 100 mg , acne star soap , tab alprazolam 0.5 mg , tab amitriptyline 10 mg , tab amlodipine 5mg +metoprolol 50mg , ankle brace ( m, l, xl ) , asprin 75 mg + atorvastatin 10 mg capsule , asprin 75 mg + atorvastatin 20 mg capsule , asprin 75 mg + clopidogrel 75 mg tablet , asprin 75 mg+atorvastatin10mg + clopidorel 75mg capsule , tab calcium+calcitrol+zinc , cannula 18g , cannula 22 g , cannula 24 g , tab cefixime 200mg +ofloxacin , tab cefpodxime 200mg+cefixime 200mg , ensure protein powder , tab fluoxe+alprazolam , foley cather size 16 , tab flunarazine 10mg , tab isosorbide dinitrate 5mg , dnsbott of 100 ml , dextrose 5 %bott of 100 ml , liquor chloroxylenol ( dettol ) , tab losartan 50+ amlodipine 5 mg , tab propranolol 20 mg + clonazepam 0.5mg , tab propranolol 20 mg + alprazolam 0.25mg , r / c formetrol +budesonide , r / c foracort 200 mcg , r / c levosulbutamol 100 mcg pack of 30cap , tab sildosin 8mg +dutastaride 0.5mg , spirited methylated , syp combiflam ( pcm +ibuprofeen ) , syp cough ( bromhexine hcl +ammonium chloride + dextromethorphen ) bott of 100 ml , syp cough ( phenylephrine +chloepheniramin + dextromethorphen ) bott of 100 ml , syp cough ( ambroxol 15 mg / 5 ml +guaifenesin50 mg / 5 ml +terbutaline 1.25 mg / 5 ml ) bott of 100 ml , syp febrex plus ( pcm+phenylephrine +chlorpheniramine ) 100 ml bott , milk of megnesia , tamsulosin 0.4 mg + am;lodip 5 mg +hctz 12.5 mg , tenagliptin + metformin 500 mg tablet , iv set , multi vit drops ( child ) , estimation of sgot kit of 100ml , kit for estimation of bilirubin kit of 4x 60ml , vacutainer edta tube , s . calcium kit , total protein kit ( span ) , albumin kit ( span ) , total cholesterol kit ( erba ) , glucose kit ( erba ) , rapid malaria test card , widal kit of 4 x 5 ml , dengu cards ( jmitra ) , glucose strip ( control d ) 50 strip pack , tippes yellow , blood urea erba kit , serum triglyceride kit ( erba ) , hdl cholesterol ( erba ) , serum amylase kit ( span ) , s. creatinine kit ( erba ) , alkaline phosphatase kit ( span ) , urine strip , sgpt kit , uric acid kit , hydrochloric acid n / 10 solution 500 ml , sodium citrate solution 3.8 % 500 ml , urine container small for lab test , tab alendronate sodium 70mg , tab tacrolimus 0.5mg , tab tacrolimus 1mg , surgical gloves 6.5size , surgical gloves 7.5size , syp cyproheptadine 100ml , syp multivitamine bott , tab zudovudine 300mg+lamivudine 150mg , tab ademetionine 400mg , ra factor kit , triglyceride kit , mp card , tab sofobuvir 400mg velpatavir 100mg...

Sms Medical College - Rajasthan

33902382 tender invited for supply of surgical and disposable items for zenana hospital, jaipur 1. bandage 2. bakri ballon 3. bandaid round 4. brain circuit adult 5. d ventilator tube 6. closed suction set 7. cotton 500 gm 8. delivery kit 9. sonography jelly pack size 10. dura por 1 inch 11. c s drape 12. dura pore 1 / 2 inch 13. huggies 14. gluco meter with strip 15. hiv kit 16. id band baby 17. iv dressing kit 18. naso.gastric tube no 6 ( n g tube 6 ) 19.naso.gastric tube no 8 i ( n g tube 8 ) 20. naso.gastric tube no 10 ( n g tube 10 ) 21. 1.11 apron green 22. mackintosh plastic 23. 1 mackintosh sheet regular rubber , long line no n 25. three way adapter 26. signal lock 27. shoe cover 28. tega drum hp pad 29. hysterloscoplc ( hys ) grasper 30. i hysterloscopic ( hys ) scissor 31. chital forceps 32. artery forceps 33. c pap nasal seal 34. ► nasal seal 35. silicone adhesive ( si%grip ) 36. hutnson pronge 37. hfnc pronge 38. i gauz than 39. i nebulization mask 40. octopus double lumen 41. i plastic apron 42. neocain no 26 / 43. bubble c pap tubing 44. i ambu bag child 500 ml 45. i ambu bag infant 250 ml 46. i ambu bag adult 47. ► laryngoscope 48. 1 laryngoscope blade ( 0 00 ) 49. i laryngoscope blade ( 3 ) 50. 1 laryngoscope blade ( 4 ) 51. i laryngoscope with blade ( 0 00 ) ori laryngoscope with blade ( 3 ) 53 laryngoscope with blade ( 4 ) 54. paps smeare kits 55. bain circuit 56. vtm kit 57. dressing drum 58. instrument tray 59. dressing kit 60. dissecting tooth forceps 61. plain forceps 62. foetal scope 63. hsg set 64. i v stand 65. kidney tray 66. kallys pad 67. liggasure mariiand 68. liggasure blunt 69. needle cutter drestroyer 70. rebreathing bag 71. pluse oxymeter 72. oxyzen regulator ) 73. sharp container 74. thermometer digital 75. room thermometer 76. sims speculum 77. valsullum 78. tbaby weight machine 79. weight machine 200 kg capacity 1 er 80. gyne drape 81. mersllk 1 0 82. monocrylvio 2 0 70cm 83. monocryly plus 2 0 ( 20cm ) 84. prolane no 1 85. pds plus 1 86. ultra promesh 87. absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 112 cir rb needle 30mm length 76 cm ) r 3 g absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) r 5 89. absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) r 7 g absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle40mm length 90 cm r 13 91. absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir rb needle 40mm length 90 cm ) r 17 92. non absorbable surgical suture, sterilised surgical needled suture black braided silk ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) r 22 93. non absorbable surgical suture, sterilised surgical needled suture polyamide monofilament black ( nylon ) ( 3 / 8 cir r cutting needle 40 45mm length 60 70 cm. ) it 27 94. absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm / r 68 95. absorbable surgical suture, sterilised surgical needled suture poingi.eca prone / po lyglyconate, monofilament sutures ( 1 / 2 circle oval ri3 needle 26men needle, suture length of meg! ) r 61 96. absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled suture ( braided coatedfoliglact in / polyglycolic acid 100. i . needle, suture length 90 cm r 69 97. absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) 1 / 2 circle round bodied 30mm, suture length 90 cm / r 70 98. absorbable oxidized regenerated cellulose net size 2x 3 with surgical sponge topical absorbable haemostatic bactericidal property s t 95 braided e caprolactone coated lactomer 1, 90cm gs 25, 37 40mm x circle taper point 99. 101. vicryl rapid 1 0 102. 1 vicryl rapid 2 0 103. vicryl rapid 3 0 104. vicryl rapid 5 0 105. sealing wax for 1000 capillary tubes 106. restabil standard value , 2 high and 2 low 107. i sealing wax for 100 capillary tubes sealing wax tray for 100 capillary tubes 108. soda lime....

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical College - Rajasthan

33894869 tender invited for supply of surgical and disposable items tender invited for supply of surgical and disposable items , bandage , bakri ballon , bandaid round , brain circuit adult , d ventilator tube , closed suction set , cotton 500 gm , delivery kit , sonography jelly pack size , dura por 1 inch , c s drape , dura pore ½ inch , huggies , gluco meterwith strip , hiv kit , id band baby , iv dressing kit , naso.gastric tube no 6 ( n g tube 6 ) , naso.gastric tube no 8 ( n g tube 8 ) , naso.gastric tube no 10 ( n g tube 10 ) , lr apron green , mackintosh plastic , mackintosh sheet regular rubber , long line no 22 , three way adapter , signal lock , shoe cover , tega drumhp pad , hysterioscopic ( hys ) grasper , hysterioscopic ( hys ) scissor , chital forceps , artery forceps , c pap nasalseal , nasal seal , silicone adhesive ( silgrip ) , hutnson pronge , hfnc pronge , gauz than , nebulization mask , octopus double lumen , plastic apron , neocain no 26 , bubble c pap tubing , ambu bag child 500 ml , ambu bag infant 250 ml , ambu bag adult , laryngoscope , laryngoscope blade ( 0 00 ) , laryngoscope blade ( 3 ) , laryngoscope blade ( 4 ) , laryngoscope with blade ( 0 00 ) , laryngoscope withblade ( 3 ) , laryngoscope with blade ( 4 ) , pap’s smeare kits , bain circuit , vtm kit , dressing drum , instrument tray , dressing kit , dissecting tooth forceps , plain forceps , foetal scope , hsg set , i v stand , kidney tray , kallys pad , liggasuremariland , liggasure blunt , needle cutter drestroyer , rebreathing bag , pluse oxymeter , oxyzen regulatorl , sharpcontainer , thermometer digital , room thermometer , sims speculum , valsullum , baby weight machine , weight machine 200 kg capacity . , gyne drape , mersilk 1 0 , monocrylvio 2 0 70cm , monocryly plus 2 0 ( 20cm ) , prolane no 1 , pds plus 1 , ultra promesh , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 30mm length 76 cm ) r 3 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 40mm length 76 cm ) r 5 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) r 7 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ½ cir rb needle40mm length 90 cm r 13 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir rb needle 40mm length 90 cm ) r 17 , non absorbable surgical suture, sterilised surgical needled suture black braided silk ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) r 22 , non absorbable surgical suture, sterilised surgical needled suture polyamide monofilament black ( nylon ) ( 3 / 8 cir r cutting needle 40 45mm length 60 70 cm. ) r 27 , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm / r 68 , absorbable surgical suture, sterilised surgical needled suture polyglecaprone / polyglyconate, monofilament sutures ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) r 61 , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm r 69 , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) 1 / 2 circle round bodied 30mm, suture length 90 cm / r 70 , absorbable oxidized regenerated cellulose net size 2”x 3” with surgical sponge topical absorbable haemostatic bactericidal property s 95 , braided e caprolactone coated lactomer 1, 90cm gs 25, 37 40mm ½ circle taper point , vicryl rapid 1 0 , vicryl rapid 2 0 , vicryl rapid 3 0 , vicryl rapid 5 0 , sealing wax for 1000 capillary tubes , restabil standard value , 2 high and 2 low , sealing wax for 100 capillary tubes , sealing wax tray for 100 capillary tubes , soda lime specification: • it should be medical grade sodalime • its granules should be of “d” shape • its dust content should be less than 0.25 % • it should contain sodium hydroxide 0 4% by weight and calcium hydroxide over 85% by weight • it should consistently absorb 150 litres of co2 per kg of sodalimebefore experiencing 0.5% co2 breakthrough • its hardness should be of optimum level ( 99% uspxxii ) • it should change color from white to violet • it should be iso and ce. , braided e caprolactone coated lactomer 1, 90cm gs 24 violet 40mm ½ circle reverse cutting , hmef: specification: • heat and moisture exchanger with bacteria and viral filter for adult with sampling port. • it should have filtration efficiency bacterial – 99.9999% & viral – 99.998% • it should be suitable for tidal volume of 120 – 750 ml • it should have a dead space of 30 50 ml • it should weight 15 20 gm • it should be iso and european ce. , limb o circuit specification: it should also have hmef with below • heat and moisture exchanger with bacteria and viral filter for adult with sampling port. • it should have filtration efficiency bacterial – 99.9999% & viral – 99.998% • it should be suitable for tidal volume of 120 – 750 ml • it should be iso and european ce , braided e caprolactone coated lactomer 3 0, 75cm c 14 undyed 24mm 3 / 8 circle reverse cutting , adult dual heated circuit with chamber it should with dual heated circuit with disposable auto feed chamber length of the circuit should be 5 feet it should support minimum tidal volume of 120ml it should be dehp, bhp or latex free it should have spiral wire design for reduction of condensate and to promote ideal humidity output it should be compatible with fisher & paykel mr850 heater base it can be used for upto 30 days on a single patient it should have european ce ( by notified body ) / usfda , infant dual heated circuit with chamber it should with dual heated circuit with disposable auto feed chamber length of the circuit should be 4 feet it should support maximum tidal volume of 120ml it should be dehp, bhp or latex free it should have spiral wire design for reduction of condensate and to promote ideal humidity output it should have dual swivel patient port for ease in positioning of the circuit it should be compatible with fisher & paykel mr850 heater base it can be used for upto 30 days on a single patient it should have european ce ( by notified body ) / usfda , prone position head cushion with mirror color natural dimensions height: 5.84 in ( 14.83 cm ) width: 9.50 in ( 24.13 cm ) length: 12.05 in ( 30.61 cm ) materials cushion material: polyurethane foam made without dehp product does not contain natural rubber latex. it should have european ce ( by notified body , braided e caprolactone coated lactomer 2 0, 90cm gs 21 undyed 30mm 1 / 2 circle tapper point , braided e caprolactone coated lactomer 1 90cm gs 25 undyed 37 40mm 1 / 2 circle reverse cutting , braided e caprolactone coated lactomer 0 90cm gs 24, violet40mm ½ circle taper point , braided e caprolactone coated lactomer 3 0 75cm cv 25, violet20 22mm ½ circle taper point , braided e caprolactone coated lactomer 1 090cm gs 25, undyed 40mm ½ circle reverse cutting , polyglactin 910 braided coated with antibacterial 2 / 0, 70 cm undyed with ½ circle 25 mm rb , monofilament polyglyconate1 150cm gs 25 loop, green 48mm ½ circle taper point , monofilament polyglyconate2 0, 75cm , green 26 30mm ½ circle taper point , monofilament polyglyconate3 0, 75cmgreen 20 26mm ½ circle taper point , monofilament polyglyconate4 0, 75cm green 17 20mm ½ circle taper point , monofilament glycomer 2 0, 90cm gs 21, volet 37mm ½ circcle taper point , non absorbable surgical suture, sterilized surgical needle black silk with needle ½ circle round bodided 30 mm needle, length 70 cm size 2 0 , braided polyester coated with silicon 2 0 8x75 cm 2xy 31 plgt, blue & white 16mm ½ circlr taper cutting oval pledget , braided polyester coated with silicon 2 0 10x75 cm 2xcv 305 pgt, blue & white 25mm ½ circlr taper cutting oval pledget , monofilament polypropylenewith peg additive 3 0 90cm 2xvf 20, blue 26mm ½ circle taper point , monofilament polypropylenewith peg additive 2 0 90cm 2xvf 20, blue 30mm ½ circle taper point , monofilament polypropylenewith peg additive 4 0 90cm 2xvf 23, blue 17mm ½ circle taper point , monofilament polypropylenewith peg additive 5 0 90cm 2xvf 23, blue 17mm ½ circle taper point , monofilament polypropylenewith peg additive 6 0 75cm 2xvf 22, blue 13mm ½ circle taper point , monofilament polypropylenewith peg additive 7 0 60cm 2xkv 1, blue 9mm 3 / 8 circle taper cutting , monofilament polybuetester coated with polytribiolate 6 0 75 cm 2xcv 1x36, blue 9mm 3 / 8 circle taper point , monofilament polybuetester coated with polytribiolate4 0 75 cm 2xcv 23x36, blue 17mm½circle taper point , monofilament polybuetester coated with polytribiolate 7 0 60 cm 2xmv 175 8, blue 8mm 3 / 8 circle taper point , monofilament polybuetester coated with polytribiolate 2 0 90 cm 2xv 20x36, blue 26mm ½circle taper point , monofilament polybuetester coated with polytribiolate 3 0 90 cm 2xv 20x36, blue 26mm ½circle taper point , non absorbable synthetic unidirectional dual cut angle barb with welded loop end made up with polygbeutester size 1, 37 mm, 30cm ½ circle tp , synthetic absorbable wound clouser device with dual cut barb with velded loop on end madeup polybeutester , absorbable synthetic unidirectional dual cut angle barded with walded loop end madeup polyglyconate green size 1 0, 26 30mm, 30cm ½ circle taper point , synthetic absorbable wound cloure device with dual cut barb with velded loop on end madeup polyglyconate green size 1 0, ½ circle 37mm, 30cm taper point , synthetic absorbable wound cloure device with dual cut barb with velded loop on end madeup polyglyconate green size 2 0, ½ circle 26mm, 30cm taper point , synthetic absorbable wound cloure device with dual cut barb with velded loop on end madeup polyglyconate green size 3 0, ½ circle 26mm, 30cm taper point , synthetic absorbable wound cloure device with dual cut barb with velded loop on end madeup glycomer blue green size 2 0, ½ circle 24mm, 30 45cm rc , laproscopic knotless pg pcl surgical suture self fixation device with autolock mechinsm made up of pga pcl unidirectional tp 26mm & 20cm size 2 0 , polyester ethelene terephthalate nonabsorbable surgical suture polyester suture is a nonabsorbable braided sterial surgical suture composed of poly ( ethylene terephthlate ) it is prepared from fibers of high molecular weight long chain linear polyesters ½ circle tapercut 2xv 5 double needle 26 mm 90 cm green color size 2 0 , non absorbable surgical suture black braided silk 1 0 rb ½ circle 30 mm 90 cm , non absorbable surgical suture black braided silk 1 0 rc 3 / 8 circle 45 mm 76 cm , non absorbable surgical suture black braided silk 5 0 rc 3 / 8 circle 12 mm 76 cm , non absorbable surgical suture black braided silk 5 0 rb 3 / 8 circle 16 mm 76 cm , absorbable gelatin sponge 80 x 50x 10mm , absorbent cotton wool ip 500 gm , blood administration set blood transfusion set , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 6.5 inches, powderfree ( disposable sterile surgical rubber gloves ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7 inches , powder free ( disposable sterile surgical rubber gloves ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7.5inches, powder free ( disposable sterile surgical rubber gloves ) , suction catheter, sterile. size: fg 5 , suction catheter, sterile. size: f g 6 , suction catheter, sterile. size: f g 8 , suction catheter, sterile. size: f g 10 , suction catheter, sterile. size: f g 12 , suction catheter, sterile. size: f g 14 , suction catheter, sterile. size: f g 16 , suction catheter, sterile. size: f g 18 , catheter, size 8 ( foleys balloon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 10 ( foleys balloon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 16 ( foleys balloon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 20 ( foleys balloon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , infant feeding tubesize 10fg , infant feeding tube size 8fg , infant feeding tube size 5fg , perfusion set with airway and needle, ( adult use ) sterile disposable , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable , infusion set with microdrip, ( i.v. ) sterile disposable , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 [ s14 ] , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ] , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 26g , mucus extractor sterile , nasal oxygen set, twin bore all sizes adult , nasal oxygen set, twin bore all sizes paediatrics , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape [ s18 ] , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape [ s19 ] , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape [ s20 ] , plaster of paris bandage 15cm x 2.7 mts / roll [ s21 ] , plaster of paris bandage 10cm x 2.7mts [ s22 ] , ryles tube / nasogastric tube size: 10 , ryles tube / nasogastric tube size: 12 , ryles tube / nasogastric tube size:14 , ryles tube / nasogastric tube size: 16 , ryles tube / nasogastric tube size: 18 , scalp vein set ( disposable ) size 18g , scalp vein set ( disposable ) size 20g , scalp vein set ( disposable ) size 22g , scalp vein set ( disposable ) size 24 g , syringe 2 ml / 01 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable , surgical blade sterile, size 11 , surgical blade sterile, size 22 , surgical blade sterile, size 23 , skin shaving blade , p.p.e kit , blood lancets , suture needles curved 1 / 2 circle round body assorted size 11 15 , suture needles curved 1 / 2 circle round body assorted size 1 5 , suture needles curved 1 / 2 circle round body assorted size 16 20 , suture needles curved 1 / 2 circle round body assorted size 6 10 , suture needles curved and cutting 1 / 2 circle cutting size 6 10 , suture needles curved and cutting 1 / 2 circle size , suture needles curved and cutting 1 / 2 circle size 16 20 , suture needles curved and cutting size 1 5 , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch , urine collecting bag, disposable 2000 ml , double j stent, sterile, both ends open size 4f, length 16 cm [ s41.a ] , double j stent, sterile, both ends open, size 5f, length 20 cm [ s41.b ] , double j stent, sterile, one end closed size 4f, length 16 cm [ s42.a ] , double j stent, sterile, one end closed, size 5f, length 20 cm [ s42.b ] , endotracheal tube, plain size 2.5 , endotracheal tube, plain size 3 , endotracheal tube, plain size 3.5 , endotracheal tube, plain size 4 , endotracheal tube, plain size 4.5 , endotracheal tube, plain size 5 , endotracheal tube, plain size 5.5 , endotracheal tube, plain size 6 , endotracheal tube, plain size 6.5 , endotracheal tube, plain size 7 , endotracheal tube, plain size 7.5 , endotracheal tube, plain size 8 ] , endotracheal tube, plain size 8.5 , endotracheal tube, cuffed size 4 , endotracheal tube, cuff size 4.5 , endotracheal tube, cuff size 5 , endotracheal tube, cuff size 6 , endotracheal tube, cuff size 6.5 , endotracheal tube, cuff size 7 , endotracheal tube, cuff size 7.5 , endotracheal tube, cuff size 8 , endotracheal tube, cuff size 8.5 , endotracheal tube, cuff size 9 , tracheostomy tube, plain all sizes , tracheostomy tube ( pvc ) , cuffed all sizes , abdominal drain kit ( with collection bag 2000 ml size 24 , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 , corrugated drainage sheet all sizes , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm [ s73 ] , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm [ s74 ] , sterilized umbilical cotton tape width 3 mm, length 75 cm , bone wax sterilised [ s80 ] , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm [ s81 ] , skin graft knife blade ( sterile ) , k wire, length 375 mm; 1mm , k wire, length 375 mm; 1.6mm , k wire, length 375 mm; 1.8mm , face mask, disposable , surgical cap disposable ( for surgeons ) , surgical cap, disposable ( for nurses ) , rubber examination gloves, size small , rubber examination gloves, size medium , rubber examination gloves made of natural rubber latex, non sterile, size large , pressure monitoring line / high pressure extension line , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml , umbilical catheter fornew born , size 4 , umbilical catheter fornew born , size 5 , umbilical catheter fornew born , size 6 , umbilical cord clamp , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property , sanitary napkin beltless , sanitary pads belt type , sanitary napkin beltless with wings , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 , nelaton catheter size 14 fg , ecg electrode , ecg roll , surgical blade sterile, size 23 single peel package in metal foil as per is 3319 , sterile hypodermic syringe with needle attached, 22g, single use 50 ml , urethral catheter 90 ( fg 14 ) made up of medical grade pvc , urethral catheter 91 ( fg 10 ) , made up of medical grade pvc , vaccum suction set, 2.5 meter length , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) , 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) , double valve trosic drain which remove under water seal and generate negative suction , thoracic drain 8cm , thoracic drain 25cm , thoracic drainage kit , feeding pump , breast pump , ot dress , feeding pump consumables , disposal cpap tubes , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube , nasal pronge child , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g , nebulization mask adult , nebulization mask paediatric , liposomol amphotericine injection b 50mg , nonabsorbable polypropylene light weight macroporous mesh , three dimensional mono filament polyester composite mesh with collagen with glycerol anci adhesl t barrier visceral side and stay suture in parietal side along with medial medial , three dimensional mono filament polyester composite mesh with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along v.ith medial medial , three dimensional monofilament polyester composite mesh with with collagen with glycerol anti a.dl1esive barrier visceral side and stay suture in parietal side along with medial medial , absorbable 5 mm hernia mesh fixation device 30 screw shaped with proximal wings of pgla tacks of4.l mm length along nlth flexible shaft up to 3 cm. , absorbable 5 mm hernia mesh fixation device 15 screw shaped with proximal wings of pgla tacks of 4. j mm length along with flexible shaft up to 3 cm. , non absorbable 5 mm hernia mesh fixation device with 30 helical shaped tita11ium tacks 3.96mm v, 1dtl1 and 0.61 mm , 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatrc polymer ( peek ) cap io avoid metal exposure nlth 15 fasteners , 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered nlth atraumatic polymer ( peek ) cap to avoid metal exposure with 30 fasteners , light weight monofilament polypropylene mesh, design to confinn inguinal anatomy, 3d shape , light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape , light weight monofilament polypropylene mesh, design to confinn inguinal anatomy, 3d shape , light weight monofilament polypropylene mesh, design to confinn inguinal anatomy, 3d shape , stapler 33mm with controlled tissue compression with adjustable staple height ( i _0 2_::, mm ) for controlled tissue compression, longer staple leg 5.5mm & non slip grip surface , laparoscopic cartridge for stapler 60 mm blue, 1.5 mm closed staple height vith gripping surt3ce technology and six rows compatible with all range of endoscopic linear cutter 601mn , laparoscopic cartridge for stapler 60 mm green, 2 0 mm closed staple height with gripping surface technology and six rows compatible with all range of endoscopic linear cutter 60mm , pph stapler 33mm hemorrhoidal stapler kit consists of 33mm hcmorrhoidal circular stapler ( with cr cd anvil.. adjustable closed staple height from 0.75 mm 1.5 mm, staple open leg length of 5.5 mm ) , suture threader, cucular anal dilator, purse string suture anoscope, sulure for purse string. , optically guided bladeless trocar 12mm with bilateral tissue separators, optical tip to eliminate blind e11try, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill ;eeondary seal, integrated wliversal seal that eliminates the use of reducer, 150mm length. , optically guided bladeless trocar 12 mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer length 100mm. , facial closure device cont.a.in optical bladeless trocar with facial closure device comaptible with cle::ir , .:annula have two side opening meant for uniform port closure , varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length , varied staple height reloads / cartridges for 80 mm gia instruments with tri staple technology, with the cutting knife blade incorporaled in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg lengtl1 , linear cutler with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 60 mm tristaple gia stapler. compatible with tri staple gia 60 mm open linear cutte reloads / cartridges purpule and black , eea circular stapler purple colour medium thick, triple ro, v with tristaple technology ( three row ofslaple inner to outer row 3.0, 3.5 and 4.0 mm with sloped cartridges face in one stapler ) diameter 31mm , linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 80 mm tristaple gia stapler. compatible with tri staple gia 80 mm open linear cutter reloads / cartridges purpule and black , wound protector with double ring in small 2.5 6 cm usfda approved , wound protector with double ring in medium 5 9 cm , wound protector with double ring in large in size 9 14 cm usfda approved , endo catch specimen removal kit:with continuous ring , polyurethane pouch with 34.5 cm shaft lenglh, 10mm with leak.proof and impervious material to cancer cells of0.5 microns / pretied purse string on pouch usfda approved , disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logic technology and digital display titanium clips u shaped , laparoscopic i:iner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in hoth direction. for use with cartridges in sizes of30mmcapable of loading all length cartridges on same gun only , hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, l 7cm length, 16mm curved active blade with adaptive tissue technology capable of sealing blood vessels upto and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 17 , laparoscopic shears 5mm diameter, 36cm long, 15mm curved coated blade and a clamp arm with tis;, uc pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 5mm in diameter, 360 deg.rces rotation, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation , advanced bipolar tissue sealer 25 ems, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in open surgical procedures with curved and tapered iip and uses an advanced algorithm for intelligent and efficient energy delivery_ device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation , advanced bipolar tissue sealer 37 ems, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree conlinuous shaft rotation , laparoscopic shears 5mm diameter, 36cm long, 18mm curved coated blade and a clamp arm with tissue rad, capable of cutting, seajing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter , ergonomic handle compatible with ultrasonic energy source, capable ofhand and foot activation with an integrated hand piece and transducer_ , connecting cable for ultrasonic hannonic scalpel for open energy probes compatible with focus plus shear hp blue , connecting cable for ultrasonic hannonic scalpel for lap energy probes compatible with ace plus shear hp054 , biological glue with thrombin & aprotinin 1 ml , biological glue with thrombin & aprotinin 2ml , sterile oxidized regenerated cellulose hemostating agent in netform fibrillar and in thick sheath ab pc:1· jp , laproscopic port with trocar 5mm optically guided bladclcss trocar 5mm .vith bilateral tissue separators, optical tip to eliminate bl111d entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckb1!i econdaiy seal, integrated universal seal that eliminates the use of reducer, 150mm length. , surgical gloves 6.5non latex surgical gloves synthetic polyisoprene powder free overall length 2r3rnm with p1mcture indicator technology usfda approved , surgical gloves 7 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved , surgical gloves 7.5 non latex surgical gloves synthetic polyisoprene powder free overall l ngth 2!:nmm with puncture lndicator technology usfda approved , double wall resuscitator with peep valve in adult it should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve for adult bag volume: mark iv ( 1300 ml ) weight: adult ( 415 g ) it should be us fda, ce & iso certified , single patient use sebs resuscitator ( spur 11 with peep valve in paed ) • it should be single use resuscitator made to sebs material not pvc it should have unique single shutter valve system for reliable fimctionality & swivel bero.;een valve and mask pennits 360° positioning in relation to the patient • it should have thin walled compression bag v.rith hand strip.it should have provision io attach manometer for paediatrics ambubag. • resuscitator volume: pediatric ( 635 ml ) • ( including reservoir and mask ) it should be ce / iso, us fda certified. , single patient use sebs resuscitator ( spur 11 with peep valve in neonatal ) • it should be single use resuscitator made to sebs material not pvc • it should have unique single shutter valve system for reliable functionality & swivel between valve ant.1 mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: neonatc ( 220ml ) • ( including reservoir and mask ) it should be ce / iso, us fda certified , silicone pre formed sga • itshould be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atrau.matic insertion and removal. it should be ce / iso, us fda certified size 3 , over the ear nasal cannula with star lumen, 50 tubing, must be flexible contoured lip tab provide a high level of stability and patient comfort. over the ear design for a comfortable and secure fit, crush and kink reshtant tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 5 l ok & cf: certification , pediatric nasal cannula pediatric nasal cannula softech with universal oxygen connector. 7 star lumen tubing lightweight. flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs help mct: .nnize patient comfort. individually packaged for convenience and sterility_ manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification , infant nasal cannula infant nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight lkxible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs to help maximize patient comfort individually packaged for convenience and sterility manufacturer must be us fda registered & cert1f1ed with en / eu iso 13485 & applicable 510k & ce certification. , volumetric incentive spirometer ( adult ) volumetric incentive spirometer ( adult ) 4000 rnl with handle. volmne measurement must be compact comfortable designed to accommodate large inspired volumes. must have good better best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable siok & ce certification. , infant prong cpap cannula infant prong cpap cannula nasal size o 11th designed to reduce trauma associated with delivery of infant nasal cpap must be soft siliconised, anatomically curved prongs to enhance fit luer fitting on ex piratory conneclor to allow proximal airway pressure monitoring. each set to include, soft siliconised cannula; lnspiratory & expiratory dhow connector; knit cap; two 6 in. hook and loop fastener sections; two 10 to 7.5 mm adaptors. manufachrrer must be l.1s fua registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , fhme heat and moisture exchangers with bacteria viral filters bacterial filtration efficiency> 99.99 % and viral filtration efficiency > 99.9999%. ftlter membrane should be of a hydrophobic non woven polypropylene material. should be tailored to meet the specific needs of both anaesthesia and intensive care , closed suction catheter for paediatrics number and color coded graduations for conttolled depth suctioning.separate y connectors available for different tubes in the pack.catheter ls made up of medical grade silicon material_sizes are 5fr_ , closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning_separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon :tv1aterial. sizes are 6fr , paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane_l.hickncss of cuff is 10 microns.microcuffseals at an average cuff pressure of 11 cm.h2o.burst pressure of cuff is 805cmh2o anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3mm. , paediattic endotrncheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethanej h1dcness of cuff is 10 microns.microcuffseals at an average cuff pressure of 11 cmh2o.burst pressure ofcuffis 805cmh2tl anatomically ba, ;;ed intubation depth marking with precision bands.cuff with play mode function. sizes are 3.5mm. , paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyllrethane, tliickness of cuif is io microns.microcuff seals at an average cu!t ptessure of 11 cmh2o.burst pressure of cuff is 805cmh2o , natomically based intubation depth marking with precision bands.cuff with play mode function_ sizes are 5.5mm , disposable spo2 sensor it should be base on original nellcor technology with original oximax technolo , reusable anaesthetia face mask of silicone autocalvable & pure transparent us fda approved and size should be mentioned onmask. , reusable anacsthetia face mask of silicone autocalvable & pure transparent us fda approved and size should be mentioned on mask. , neonatal single heated wire breathing system with auto fill humidification chamber in sterile pad. cmd us fda approved. should be compatible every humidifier , paed. single heated wire breathing system with auto fill humidification chamber in sterile pack ai1d us fda approved. should be compatible every humidifier. , neonatal high flow nasal cannula having 8 litre flow. should have soft tip. , cutting & coagulations device with tissue fusion ligasure technology having maryland jaw sealer anj. divider with wide jaw aperture 13mm and cut length 18.5mm with shaft rotation of 350 degrees and with one step scclling mechanism. should have the manual cutting mechanism and it should have including 7mm cutting and coag with usfda , cutting &coagulations device with tissue fusion ligature technology have small jaw tissue sealing system for open procedures vessel sealing instrument with cut length of 14.7 mm, seal length of 16 5mm_, jaw angle 28 degrees. sbould have the manual cutting mechanism.and its should have including 7mm cutting and coag with usfdj , cutting &coagulations device with tissue fusion ligature technology laparnscopic blunt tipped vessel sealer and divider 37 cm long 5mm instrument. wide jaw aperture 14.5 mm with shaft rotation of 180 degrees; multifw1ctmnal laparoscopic device for tissue fusion.a.nd its should have including 7mm cutting and coag with usfda . , cutting &coagulations device with tissue fusion ligasure technology instrument for open surgeries , ith instrument length between 18 l9cm and electrode length between 16 1?cm, having 28 degree curved jaw with contoured tip for blunt dissection and having activation both through hand activation and foot activation with a manually controlled cutting mechanism. , cuuing &coagulations device with tissue fusion ligasuretechnology have36mm jaw length, l 80 degree rotatable instrument with curved blade for large volwne tissue_ should have the manual cutting mechanism. , cutting &coagulations device with tissue fusion ligasuretechnology have vessel sealing instrument for open surgeries with reusable clamp length bet .veen l 6 18cm, with 12 14 degree jaw curve.and its should have including 7mm cutting and coag withusfda_ , et tube with yellow subglotic suction line with inverted and soft seal cuff with usfda / ! :liropean ce , apple hunt trocar : should be single use sterile trocars, have side port , two cannula & one trocar , 5 mm & 10 mm trocar with pyramidal tip, ergonomic design , fascia anchoring thread should be usfda / ce approved , see clear: should be able to attach to the side port of trocar, single use latex free, able to remove 99.99% of 0.01 micron particles, dual filter have charcoal & ulpa, max. flow rate 8.0 ltr / min., tubing have 30’’ length should be usfda / ce approved , carter thomason port closure : should be carter thomson type port closure system, have pilot guide and suture passer separately, able to use for trocar defects of 5mm 15mm, suture guide holes should be 180 degree access across each other’s, single use should be usfda / ce approved , milex silicon passeries: should be silicon pessary, latex free, pessaries to be available for pelvic organ prolapses and urinary incontinences, with ring, ring with support and ring with knob, etc., available in multiple sizes. should be usfda / ce approved , flow cannula: to be used with low / high flow humidified oxygen soft and delicate interface individually packaged single use mode of high performance tpe suitable for medical use . connection: m15mm . dimensions:4 sizes xxs, xs, s, m . class according to 93 / 42iec directive: lla general information • cannula in tpe ( suitable to medical grade ) • tube in medical pvc • it is used in newborns for niv & hhfnc with an m 15 connector • latex free • dehp free • available in the following size: prongs length outer diameter 7.5 mm 2.3 mm 8.5 mm 2.6 mm 9.5 mm 3.0 mm 10.5 mm3.5 mm , kcm gown , nasal cannula assembly: characteristics . soft and delicate interface . individually packaged . single use . mode of high performance tpe suitable for medical use . connection: m15mm . dimensions:4 sizes xxs, xs, s, m . class according to 93 / 42iec directive: lla components nasal cannula bonnet made up of 100% cotton with elasticity bubble cpap cannula holder set includes: y connector with water condensation line out white cap two expandable tubes ( upto 7ocm ?10f ) available in the following size: prongs length outer diameter 8 mm 2 mm 10mm2 mm 12 mm 3 mm 14 mm 4 mm , nasal canula for new born made of tpe with & prong size ? 2mm l 8mm <750gm ? 2mm l 10mm <750 1250 gm ? 3mm l 12mm <1250 2000gm ? 4mm l 14mm <2100 4kg , resuscitation mask for new born : 1. should be anatomical shape ( not circular ) 2. should cover both mouth and nose , heparinized glass capillary tubes , hypothermia alert device , infant nasal fixator , neonatal heated wire circuit , infant nasal cpap , infant nasal mask , high folw nasal cannula , apnea monitor , technical specificaiton of one beam ( bilirubinometer ) ? bench top point of care bilirubin meter ? direct reading photometery determining total bilirubin in serum / plasma ? auto off ? automatic calibration setting between measurements ? dual wavelength measurement: 460 nm and 550 nm ? correcting for hb at 550 nm ? measuring range: reading 4 / 30 mg / dl or 68 / 510 micromol / l ? measure precision: + / 1% ( fs+ measurement ) ? read out in mg / dl and micromol / l at the same time ? display of interfering agent ? sample volume equal to 55 micro liter ? interfering haemoglobin automatic compensation interfering agent displayed ? fast analysis time <5 sec ? oled display ? power requirements: 220 v / 50 hz ( with adapter ) device is safety certified according ce european , cytology brush and wooden spatula , endometrial biopsy curette , hsg device , tubal recannulation set , ssg devise , cyst aspiration needle , sterile vaginal probe covers , endoscopic cleaning brush , ellavi ubt , 3.8cms lenth spinal needle with stylet 22 g and 25 g for pediatrics , pur single lumen umbilical 2.5 with 40cms length , 5cms length 25 g spinal needle , 0.22 micron endotoxic 96 hrs filter , umbilical canula no 5 , umbilical canula no 6 , pur single lumen umbilical 2.5, fr with 40cms length , pur single lumen umbilical 3.5, fr with 40cms length , pur single lumen umbilical 4 fr with 40cms length , pur single lumen umbilical 5fr with 40cms length , cmg central venous cannula 45cms + 70 cms 14 / 16g , extra large 120mm 25g spinal needle , extra large 145mm 25g spinal needle , extra large 145mm 27g spinal needle , quickie bevel 22g 120mm with extra large lenth spinal needle , single valve trosic drain which remove under water seal and generate negative suction , double valve trosic drain which remove under water seal and generate negative suction , thoracic drain 8cm , thoracic drain 25cm , thoracic drainage kit , pe baby wrap double layer green house gas bed with adjustable hud, front velco and spine support for pre term baby to avoid hypothermia size small , pe baby wrap double layer green house gas bed with adjustable hud, front velco and spine support for pre term baby to avoid hypothermia size medium, large , pe colled extension line for fluid infusion us fda approved 1mm internal diameter length 100cms , pe colled extension line for fluid infusion us fda approved 1mm internal diameter length 200cms , pe pressure capacity 40 bar male to female venous infusion and pressure monitoring line with 1mm internal diameter 100cm, 200cms us fda approved , pur transparent semi periable strechable.hypoallergic sterline incision drape or dressing for proctecting catheter introduction sites ( permiable to water vapour and oxygen 300% strechable. us fda approval 45* 60 , pur transparent semi periable strechable.hypoallergic sterline incision drape or dressing for proctecting catheter introduction sites ( permiable to water vapour and oxygen 300% strechable. us fda approval 45* 90cms , pur transparent semi periable strechable.hypoallergic sterline incision drape or dressing for proctecting catheter introduction sites ( permiable to water vapour and oxygen 300% strechable. us fda approval 15cm x 20cms , pur transparent semi periable strechable.hypoallergic sterline incision drape or dressing for proctecting catheter introduction sites ( permiable to water vapour and oxygen 300% strechable. us fda approval 8*6cms , surgical scrub brushes spong 20% chlorhexidine in 15ml sol of isopropyl alcohal and water with nail cleaner , epidurial kit paed , epidirial kit adult , feeding pump consumables , et tube with secondary lumen ( surfactant lumen ) , camscope , multifuctioning medical camera whole system , fiber optic laryngoscope paediatric set should be led white light should have mat finish with slim paed handle miler blades size 00, 0, 1 in pvc box , laryngoscope paediatric set should have led white light should have mat finish with slim paed handle miler blades size 000, 00, 0, 1 in pvc box , octopus 3 way , photosensitive pm line should be sterile, pyrogen free should be non toxic latex free ce mark length 150cm , tube exachanger and oxygenating bougie ped , bousinac bougie , picc line 24g double lumen , pur hd catheter kit double lumen 6.5fr 11cm with 7fr x 10cm dialator , pur hd catheter kit double lumen 8.5fr 11cm with 9fr x 10cm dialator , pur hd catheter kit double lumen 11.5fr 13cm with 9fr x 10cm dialator , silicon long term hemodialysis catheter , needleless 2 way connector with 10cm extension , burette ivset measured volume fluid administration set with bacteria retentive air inlet , triple pressure monitoring kit with option of closed loop blood sampling kit including needleless sampling site , pur central venous catheter triple lumen 7fr , 13cm & 16cm lengthand nitonel guidewire with anti blood flow connector on introducer needle. , pur central venous catheter four lumen 8.5fr , 13cm length and nitonel guidewire with anti blood flow connector on introducer needle. , central venous catheter setsingle lumen 24g with nitonel guidewire , adult under pad , baby care kit , bed protection sheet 100x150 cm , bed protection sheet 120x210 cm , baby clothing set for new born babies , b.p cuff complete set , adult diaper medium , adult diaper large , adult diaper xl , disposable full gown , heating pad , hot water bottle , plastic jar , polythene gloves , crepe bandage , knee cap , cannula fixator , n 95 mask , operation kit , rubber kellys pad , baby wipes 40 pcs pack , bed paan , urine pot , vaporizor , disposable bed sheet , hemostatic matrix with thrombin 5 ml ( floseal 5ml ) , hemostatic matrix with thrombin 10 ml ( floseal 10ml ) , neocain no 24 , kit actimpartus , kit actimprom , iui kits , iui catheter iui 11 cms. ( straight opening ) iui 11 cms. ( lateral opening ) iui 11 cms. ( lateral opening ) iui ( curve ) 17 cms. ( straight opening ) , makler counting chamber , sperm counting chamber hawksley , micro pipettes , syringe 1 ml hypodermic with needle attached 24g, sterile, single use disposable , uterine balloon tamponade...

Government Medical College - Rajasthan

33881454 supply of gauze and bandage supply of gauze and bandage as per attached document , gauze unmedicated warp: 24s,weft: 24s,reed: 20 (80/dm),pick: 14 (56/dm),size: 120cm x 9 mt,net weight: 325 gms (as per attached technical specification) , gauze unmedicated warp: 24s,weft: 24s,reed: 20(80/dm),pick: 14(56/dm),size: 60cm x 18 mt,net weight: 325 gms (as per attached technical specification) , ordinary bandage warp: 24s,weft: 24s,reed: 38(152/dm),pick: 22(88/dm),size: 15cm x 5mt.,net weight: 515gms (as per attached technical specification) , ordinary bandage warp: 24s,weft: 24s,reed: 38(152/dm),pick: 22(88/dm),size: 15cm x 4mt.,net weight: 412gms (as per attached technical specification) , ordinary bandage warp: 24s,weft: 24s,reed: 38(152/dm),pick: 22(88/dm),size: 10cm x 4mt.,net weight: 275gms (as per attached technical specification) , ordinary bandage warp: 24s,weft: 24s,reed: 38(152/dm),pick: 22(88/dm),size: 7.5cm x 4mt.,net weight: 200gms (as per attached technical specification) , ordinary bandage warp: 24s,weft: 24s,reed: 38(152/dm),pick: 22(88/dm),size: 5cm x 4mt.,net weight: 137gms (as per attached technical specification) , ordinary bandage warp: 24s,weft: 24s,reed: 38(152/dm),pick: 22(88/dm),size: 2.5cm x 4mt.,net weight: 88gms (as per attached technical specification)...

National Institute Of Ayurveda - Rajasthan

33785908 rate contract for hospital consumables , injection : , inj.n.s. 100ml , inj.n.s. 500ml , inj. dns 500 ml , inj.d5% 500ml , inj. d 10% 500 ml , inj. d 25% 100 ml , inj.rl 500ml , inj dexa , inj genta , inj piloearpine , inj adrenaline (1 ml) (1x50 ampuls) , inj.xylocaine2%withadrenaline , inj.xylocaine2%(lox) , inj. anawin heavy(bupivacaine) , inj. lox heavy(lignocaine) , inj atropine (1x50 ampuls) , inj. dexona(dexamethasone) , inj.avil(pheniraminemaleate) , inj.thiopentone(thiopentalsodium) 0.5gm , inj.succinylcholine(sueol) , inj.perinorn2m(metoclopramide) , inj.emeset2ml(ondansetron) , inj.rantac2ml(ranitidine) , inj.ketamine5ml , inj.t.t.5ml (inj. tetanus toxide 0.5ml) , inj.neostigmine 1ml , inj.atracuriumbesylate 10ml , inj.midazolam 10ml.10mg , inj.dynapar 1ml/(diclofenec) , inj.gentamycin 2ml 80 mg , inj.maczone plus 1.5gms/(ceftrixone + salbectam) , inj.tramadol2ml , inj. vit. k , inj. deriphyllin , inj. hydrocort/(hydrocortisone) , inj. lasix 2ml (furosemide) , inj. paracetamol (150 mg) , inj. buscopan (hyoscine) , inj. tranexa 5ml (tranexamic) , inj. magnesium sulphate 50% 2ml , inj. hydrocortison , inj. metrogyl 100ml , inj. ketamin/ aneket vial , inj. haemaccel 500 ml , inj. labetatol , inj. carbetocin , inj. perinorm/metoclopramide 2ml , inj. epidosin , inj. drotin , inj. phenargan , inj. carboprost , inj. fevastin/neomol , inj. betnesol , inj. amikacin 2ml 500 mg , inj. dexomethosne , inj. kaplin 10mg , inj. botropase , inj. iron sucrose , sterile water 10ml , sterile water 5ml , sepguard 100ml , halothane liquid 250ml , mannitol 100ml , povidine iodine 7.5% (500ml) , povidine iodine 10% (100ml) , povidine iodine 5% (100ml) , solution asthalin 15ml , omnipaque dye 50ml , abgel foam , betadine ointment 250gm , inj. methergin , xylocaine jelly 2% 50gm , pc enema 100ml , justin suppository 25mg , betadine 5% 1 ltr , xylocaine jelly 2% 50gm , tablet : , tab. paracetamol (500 mg) , tab. ranitidine (150 mg) , tab. meftal spas (1x10) , tab. sorbitrat , cap. nicardia 5mg , tab. formaline (100 pcs) , items(suture) : , barbours thread surgical linen no. 20 , barbours thread surgical linen no. 40 , chromic catgut 1.1 (110cm45mm needle) 2crb , chromic catgut 1.1 (40mm needle) 2crb , chromic catgut 0.0 (zero) 2crb , chromic catgut 1.0 (110cm45mm needle) 1/2crb , chromic catgut 2.0 1/2crb , chromic catgut 3.01/2crb , vicryl no. 0.0 (zero) , vicryl no. 1.0 (110cm45mmneedle) , vicryl no. 1.1 (110cm45mmneedle) , vicryl no. 1 0/2crb , vicryl no. 1 1/2crb , vicryl 2.0 round body 1/2 crb , vicryl 3.0 1/2 crb , monocryl suture 3 0 with needle , prolene no. 1 , prolene no. 1 , prolene no. 1.0 , prolene 2.0 , monoglyde 3.0 , ethilono 1 3/8 cce , ethilono 1.0 3/8 cce , ethilono 2.0 3/8 cce , ethilono 3.0 3/8 cce , surgical sature 4.0 , surgical sature 5.0 , surgical sature 8.0 , surgical sature 10.0 , surgical items : , n 95 , surgical masks 3 layers , clinical surgical spirit 5 ltr , hand sanitizer 5 ltr , surgical gloves (sterile+ packed) 6 no. , surgical gloves (sterile+ packed) 6.5 no. , surgical gloves (sterile+ packed) 7 no. , surgical gloves (sterile+ packed) 7.5 no. , examination gloves (latex) small size , examination gloves (latex) medium size , examination gloves (latex) large size , surgical gowns ( green cloth) , patient ot gown (disposable) (size standard) , surgical caps , surgical absorbant cotton (500gm) , cotton roll 500gms , cotton roll bandages 15cmx3mtr. (deluxe) , cotton roll bandages 10cmx3mtr. (deluxe) , cotton roll bandages 5cmx3mtr. (deluxe) , soft roll 15cmx3mtr , soft rolll 10cm x 3 mtr , surgical gauze cloth (than) 90cmx180mtr. (deluxe) , surgical gauze piece 10cmx10cmx8ply , surgical gauze piece 2inchx2inch , pop bandages 15cmx2.7 mtr , pop bandages 10cmx2.7 mtr , disposable syringes with hypodermic needles 1ml , disposable syringes with hypodermic needles 2ml , disposable syringes with hypodermic needles 5ml , disposable syringes with hypodermic needles 10ml , disposable syringes with hypodermic needles 50ml , disposable hypodermic needles 18no. , disposable hypodermic needles 20no. , disposable hypodermic needles 22no. , disposable hypodermic needles 24no. , disposable hypodermic needles 25 no. , disposable hypodermic needles 26no. , iv cannula 20 no. , iv cannula 22 no. , iv cannula 18 no. , iv cannula three way 20 no. , iv sets , uro bags standard , folleys catheter 18 , folleys catheter 16 , folleys adaptors (standard size) , ultrasound jelly , paper tape 2.5 cm x 9 mtr , paper tape 5 cm x 9 mtr , paper tape 7.5 cm x 9 mtr , paper tape 10 cm x 9 mtr , ampule cutter , disposable needle cutter (electric) , elastic band tourniques adjustable free size , k 90 size f.c. 14 (urethral catheter) , surgical blade no. 24 , surgical blade no.15 , surgical blade no.11 , surgical needles cutting edge 1/2 circle no. 10 , surgical needles cutting edge 1/2 circle no. 08 , surgical needles cutting edge 1/2 circle no. 06 , surgical needles round body 1/2 circle no. 08 , plastic box 8x10 , plastic containers 500gm , disposable suction tube with tip , abdominal drainage kit no. 12 , ryles tube 16 no. , infant feeding tubes 6 no. , infant feeding tubes 8 no. , endotracheal tube (disposable) 3mm , endotracheal tube (disposable) 3.5mm , endotracheal tube (disposable) 6mm , endotracheal tube (disposable) 6.5mm , endotracheal tube (disposable) 7mm , spinal needle 25 no. , mops sponge cotton 25x25x12 ply (with x ray) , mops sponge cotton 30x30x12 ply (with x ray) , macintosh sheet(1 roll=20mtr.) , plastic aprons standard , hernia kit with polypropylene mesh suze 4x6 with polypropylene sutures 1 0, polypropylene sutures 2 0, polygalectin 1 0, sounds closure suture material preferred monoglide or nylon. , surgical cautery pencil unipolar , blood transfusion set (bt set) adult , blood transfusion set (bt set) paediatric , iv cannula 20g triway pink , eye drap sheet 100 cm x 120 cm , trolley sheet 100 cm x 200 cm (preferably green & blue) , pocket mask adult , pocket mask child , ecg jelly 5ltr , ecg paper (cardiart 9108 d) , miscellaneous items : , lyzol solution for pharmacy grade , formaline liquid 5ltr , hydrogen peroxide 400 ml , anticeptic liquid 1 ltr , hypochlorite solution 5% 5 ltr , anticeptic handwash 5 ltr , anticeptic soaps 125 gm , anticeptic liquid 1 ltr , slipper (ot m/f)...

Government Medical College - Rajasthan

33780704 supply of medicine and surgical items in bangur hospital pali for the year 2022 23 , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) , 3rd generation recombinant f viii 1000 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm , absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) , absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) , absorbent cotton wool ip 500 gm , acebrophylline tablet / capsule 100 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , acetazolamide tab ip 250mg , acetylcystine solution usp ( injection ) 200 mg / ml , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir cream 5% , acyclovir eye ointment ip 3% w / w 5gm size , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , adenosine injection ip 6 mg / 2ml , adrenaline injection ip 1mg / ml im / iv use , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , alendronate sodium tablets usp / bp 35 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , allopurinol tablets ip 100 mg , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , amino acid 10% injection 100ml size , aminophylline inj ip 25 mg / ml , amiodarone hydrochloride inj 50 mg / ml , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amitriptyline tab ip 25mg film coated , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , amphotericin b inj ip 50 mg , ampicillin cap ip 500mg , ampicillin injection ip 500 mg , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , ascorbic acid tab ip 500 mg , asepto syringe with transparent bulb sterile, 60 ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , aspirin tablet ip ( gastro resistant ) 150 mg , atenolol tab ip 25 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , atorvastatin tablets ip 40 mg , atracurium inj 10 mg / ml , atropine eye ointment ip 1% , atropine sulphate injection 0.6mg / ml , atropine sulphate ophthalmic solution usp 1% , azathioprine tab ip 50 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tab ip 500 mg , azithromycin tablets ip 250mg , aztreonam injection 1gm , aztreonam injection usp 500 mg , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) , b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , beclomethasone inhalation ip 200 mcg / dose , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , bendamustine injection 100 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , betahistine tab ip 16 mg , betahistine tab ip 8 mg , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , betamethasone sod phos inj ip 4mg / ml , betamethasone tab ip 0.5mg , betaxolol eye drops 0.5 o / o , bevacizumab injection 100 mg , bevacizumab injection 400 mg , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bisacodyl tab ip 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , blood administration set blood transfusion set ( details in rc ) , bone cement , bone wax sterilised , bortezomib injection 2mg , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , bromocriptine tablets ip 2.5 mg , budesonide nebulizer suspension 0.25mg / ml , budesonide powder for inhalation 200 mcg , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , butorphanol tartrate injection usp 1mg / ml 1ml size , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , calamine lotion ip 100ml , calcitriol capsules ip 0.25 mcg , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , calcium gluconate inj ip 10% ( iv use ) , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , carbamazepine oral suspension usp 100 mg / 5ml , carbamazepine tab ip 100 mg , carbamazepine tab ip 200 mg ( film coated ) , carbimazole tabs ip 5 mg ( film coated ) , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , carboxymethylcellulose eye drops ip 0.5% , carvedilol tablet 3.125 mg , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , cefpodoxime dispersible tab 50 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone 1 gm + tazobactum 125 mg injection , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cefuroxime axetil tab ip 250 mg , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , cephalexin tablets 125 mg ( dispersible tablets ) , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , cetirizine syrup ip 5mg / 5 ml , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetrimide cream ip 15 gm , chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) , chemotherapy port and non coring needles ( adult ) ( detail in rc ) , chlorambucil tab ip 5 mg , chloramphenicol 1% w / w eye ointment ip, 3gm size , chloramphenicol eye drops ip 0.5 0 / 0 , chlordiazepoxide tablets ip 10mg , chlorhexidine gluconate solution 5% 250 ml , chlorhexidine mouthwash ip 0.2 o / o , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate suspension ip 50 mg / 5ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chlorpheniramine maleate tab ip 4mg , chlorpromazine inj. ip 25mg / ml , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , cholecalciferol granules 60, 000 iu / gm , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) , cinnarizine tablet ip 75 mg , cinnarizine tablets ip 25 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin ophthalmic ointment usp 0.3% , ciprofloxacin tablet ip 500 mg film coated , ciprofloxacin tablets ip 250 mg film coated , cis atracurium besylate injection 2 mg / ml in 5 ml vial , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , clindamycin phosphate gel usp 1 o / o , clindamycin phosphate injection ip 300 mg , clobazam tablet / capsule 10 mg , clobazam tablet / capsule 5 mg , clobetasol propionate cream ip 0.05 o / o , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , clonazepam tablet 0.5 mg , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , clopidogrel tab ip 75 mg , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , clotrimazole cream ip 2% w / w , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , clotrimazole vaginal tab ip 500mg , cloxacillin sodium inj ip 500mg , coal tar 6% & salicylic acid 3% ointment , colistimethate injection ip 1m iu powder for solution , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , compound benzoin tincture ip , compound sodium lactate inj. ip , conc haemodialysis fluid b.p acetate concentrate 10 litre can , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , conjugated estrogen tabs usp 0.625 mg. , corrugated drainage sheet all sizes ( details in rc ) , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cough syrup / expectorant ( 50 ) ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , cyclosporin capsule usp / ip 50 mg , cytarabine injection bp 500mg , dacarbazine injection 500 mg usp / bp , danazol cap ip 50 mg , dasatinib tab 100 mg , daunorubicin inj ip 20 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , dextromethorphan hbr syrup ip 13.5mg / 5ml , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofence prolonged release tablet ip 100 mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine hydrochloride oral solution ip 10mg / 5ml , dicyclomine inj ip 10 mg / ml , dicyclomine tab ip 10 mg , diethylcarbamazine tab ip 100 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , diphtheria antitoxin 10000 iu , disposable sterile surgical rubber gloves size 8 inches, powder free , disposable sterile surgical rubber gloves size 8 inches, powdered , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , domperidone oral drops 10mg / ml ( 10ml ) , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , dopamine hydrochloride inj ip 40 mg / ml , double j stent, sterile, both ends open size 4f, length 16 cm , double j stent, sterile, both ends open, size 5f, length 20 cm , double j stent, sterile, one end closed size 4f, length 16 cm , double j stent, sterile, one end closed, size 5f, length 20 cm , doxorubicin inj ip 50 mg / 25 ml , doxycycline cap ip 100 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , drotaverine hydrochloride inj 40 mg / 2 ml , drotaverine tab ip 40 mg , dutasteride tablet 0.5 mg , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , ecg electrode ( detail in rc ) , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) , enalapril maleate tab ip 2.5mg , enalapril maleate tab ip 5mg , enalapril maleate tablets ip 10 mg , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, plain size 2.5 ( details in rc ) , endotracheal tube, plain size 3 ( details in rc ) , endotracheal tube, plain size 3.5 ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 7 ( details in rc ) , endotracheal tube, plain size 7.5 ( details in rc ) , endotracheal tube, plain size 8 ( details in rc ) , endotracheal tube, plain size 8.5 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , enoxaparin sodium inj ip 60 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) , escitalopram tab ip 10 mg , esmolol hydrochloride injection 10mg / ml 10ml size , ethamsylate inj 250 mg / 2ml ( im / iv ) , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , ethinyloestradiol tabs ip 50 mcg , etoposide inj ip 100 mg , etoricoxib tab ip 120mg , etoricoxib tablet 90 mg , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , face mask, disposable ( details in rc ) , factor ix concentrate ( purified ) ip 600 i.u. ( human coagulation factor ix ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , fenofibrate capsules / tab ip 200 mg , fentanyl citrate injection 50mcg / ml , fentanyl citrate injection ip 2 ml , feracrylum 1% w / v sterile solution 100 ml , ferric carboxymaltose injection 50 mg / ml 10 ml size , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , finasteride tablets ip 5 mg , flavoxate tablets ip 200 mg ( coated tablet ) , fluconazole eye drops 0.3% , fluconazole tablets ip 150mg , flunarizine tab 5 mg , fluorouracil inj ip 250 mg / 5ml , fluoxetine cap ip 20 mg , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 , foldable intra ocular lense with injector ( details in rc ) 18 to 24 , foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 , foleys catheter no. 14 ( detail in rc ) , folic acid tab ip 5 mg , formaldehyde solution ( 34.5 per. 38 per. ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , framycetin sulphate cream 1 o / o 100 gm pack , framycetin sulphate cream 1 o / o 30gm pack , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , fusidic acid cream ip 2% , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , gadodiamide inj. 0.5mml / ml vial , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , gentamycin injection ip 80mg / 2ml ( im / iv use ) , gentian violet topical solution usp 1o / o , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , glibenclamide tab ip 5 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , gliclazide tab ip 40 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glipizide tab ip 5mg , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , glucagon for injection usp 1 mg / ml , gluteraldehyde solution 2% , glycerin ip 100 ml , glycerin ip 400 gm , glyceryl trinitrate tablets 2.6 mg controlled release tablets , glycopyrrolate inj ip 0.2 mg / ml , griseofulvin tab ip 125 mg , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , halothane bp , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis b immunologlobin injection ip 200 i.u , homatropine eye drops ip 2% , human albumin solution ip 20% , human anti d immunoglobulin 150 mcg , human anti d immunoglobulin injection 300mcg ( im use ) , human chorionic gonadotropin injection ip 5000 i.u. , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , human rabies immunoglobulin inj 150 iu / ml , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrochlorthiazide tab ip 12.5 mg , hydrochlorthiazide tab ip 25mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , hydroxychloroquine sulphate tablets 200mg , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , hydroxyprogesterone inj ip 250mg / ml , hydroxypropylmethyl cellulose solution 20 mg / ml , hydroxyzine tab ip 25 mg , hyoscine butyl bromide tablets ip 10mg , hyoscine butylbromide inj ip 20 mg / ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , indomethacin cap ip 25 mg , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , intravenous fat emulsion 20% w / v 250ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , ipratropium bromide nebulizer solution 250 mcg / ml , ipratropium powder for inhalation ip 40 mcg , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , isoflurane usp , isophane insulin inj ip 40 iu / ml , isoprenaline injection ip 2mg / ml , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , itraconazole cap 100 mg , k wire, length 375 mm; 1.6mm ( details in rc ) , k wire, length 375 mm; 1.8mm ( details in rc ) , k wire, length 375 mm; 1mm ( details in rc ) , ketamine inj ip 50 mg / ml , ketoconazole cream 2% , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , labetalol hcl inj ip 20mg / 4ml , labetalol tab ip 100mg , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , l asparaginase inj 10000 iu , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , levetiracetam injection 500mg / 5ml , levetiracetam oral solution / suspension 100mg / ml , levetiracetam tablet ip 500 mg , levoceitrizine tablet 5mg , levodopa and carbidopa tab 250 mg+ 25 mg , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , levofloxacin tablets ip 250 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lidocaine hcl topical solution usp 4% , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , lignocaine ointment 5 o / o , linezolid inj 200mg / 100ml , linezolid tablets ip 600 mg , liposomol amphotericine injection b 50mg , liquid medical oxygen ( lmo ) , liquid paraffin ip 100 ml , liquid paraffin ip 400 ml , lisinopril tab ip 2.5 mg , lisinopril tab ip 5 mg , lisinopril tablets ip 10 mg , lithium carbonate tab ip 300 mg , lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) , loperamide tab ip 2 mg , lorazepam inj ip 2 mg / ml , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , mannitol inj ip 20% w / v , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , mecobalamin inj 500 mcg / ml , medroxyprogesterone acetate tablets ip 10 mg , mefenamic acid tablets bp 500 mg , mefloquine tablets ip 250 mg , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , meropenem inj ip 500 mg , meropenem inj. ip 1gm , meropenem injection ip 250 mg , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin tab ip 500 mg ( film coated ) , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , methotrexate tablets ip 10 mg , methyl cobalmine tablet 1500mcg , methyl cobalmine tablet 500mcg , methyl prednisolone sodium succinate for injection usp 500 mg , methyldopa tab ip 250mg film coated , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , metoclopramide hydrochloride syrup ip 5 mg / 5ml , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , metoprolol succinate extended release tablets ip 50 mg , metoprolol tablets ip 25 mg , metronidazole 1% and chlorhexidine gluconade 0.25% gel , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole inj ip 500 mg / 100ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , miconazole nitrate cream ip 2% , midazolam inj ip 1 mg / ml , mifepristone tab ip 200mg , misoprostol tab ip 200 mcg , mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , morphine sulphate inj ip 10mg / ml , mucus extractor sterile ( details in rc ) , multi vitamin syrup , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , multistix test strip , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , naloxone inj ip 0.4mg / ml , naproxen tablet ip 250mg , naproxen tablet ip 500mg , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , nebulization mask adult ( detail in rc ) , nebulization mask paediatric ( detail in rc ) , nelaton catheter size 14 fg ( detail in rc ) , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , neostigmine inj ip 0.5 mg / ml , neostigmine injection ip 2.5mg / 5ml , neostigmine tab ip 15 mg , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitrofurantoin tab ip 100mg , nitroglycerin inj 5 mg / ml , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , noradrenaline injection ip 2 mg / ml , norethisterone tab ip 5 mg , norfloxacin tab ip 400mg film coated , normal human intravenous immunoglobulin 5g / 100ml , octreotide injection 50 mcg / ml , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , ofloxacin oral suspension ip 50mg / 5ml , ofloxacin tab ip 200 mg , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , oitment mupirocin ip 2% , olanzapine tab ip 5 mg , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ondansetron orally disintegrating tablets ip 4mg , ors powder ip , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oxaliplatin injection usp 50 mg , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , oxygen mask ( adult ) , oxygen mask ( pediatric ) , oxytocin inj ip 5 iu / ml , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol infusion ip 1% w / v 100ml size , paracetamol inj. 150 mg / ml , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , pentazocine inj ip 30mg / ml ( im / iv use ) , pentoprazole inj 40 mg , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) , peritonial dialysis solution ip , permethrin cream 5% , permethrin lotion 5% , phenazopyridine tablet 5 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone inj ip 200mg / ml , phenobarbitone tab ip 30 mg , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , pioglitazone tab ip 15 mg , piperacillin + tazobactum for injection ip 4gm+500mg , piperacillin injection 2 gm + tazobactom 250mg ip , plaster of paris bandage 10cm x 2.7mts , plaster of paris bandage 15cm x 2.7 mts / roll , polygeline 3.5% solution with electrolytes for i.v. infusion , polymixin sulphate b injection usp 5 lac i.u. , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , povidone iodine ointment 5% 15 gm , povidone iodine ointment usp 250 gm , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , povidone iodine solution ip 10 % , povidone iodine solution ip 5 % 500 ml , povidone iodine solution ip 5% 100ml bottle , powder clotrimazole 1% w / w 30 gm , pralidoxime chloride injection ip 25 mg / ml / 500 mg , prazosin tablets ( extended release ) 2.5 mg , prednisolone tab ip 20 mg , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , pregabalin cap ip 75 mg , pressure monitoring line / high pressure extension line ( details in rc ) , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , prochlorperazine mesylate injection 12.5mg / ml 5ml size , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , promethazine syrup ip 5 mg / 5ml , promethazine tab ip 25 mg , propofol inj ip 10 mg / ml , propranolol tab ip 40 mg , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , quetiapine tablet ip 25mg , quetiapine tablet ip 50mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , ramipril tablets ip 2.5 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , rh erythropoetin inj 4000 iu , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , ringer acetate infusion 500 ml , risperidone tab 1 mg , risperidone tab 2mg , rosuvastatin tablet 10 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) , rubber examination gloves, non sterile, extra small ( details in rc ) , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves, size small ( details in rc ) , ryles tube / nasogastric tube size: 10 ( details in rc ) , ryles tube / nasogastric tube size: 12 ( details in rc ) , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , ryles tube / nasogastric tube size:14 ( details in rc ) , sacubitril 24 mg and valsartan 26 mg tablet , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol syrup ip 2mg / 5ml , salbutamol tab ip 2 mg , salbutamol tablet ip 4 mg , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , sanitary napkin beltless with wings ( details in rc ) , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , scalp vein set ( disposable ) size 18g ( details in rc ) , scalp vein set ( disposable ) size 20g ( details in rc ) , scalp vein set ( disposable ) size 22g ( details in rc ) , scalp vein set ( disposable ) size 24 g ( details in rc ) , sertraline tab ip 50 mg , sevoflurane , silver sulphadiazine cream ip 1% 500 gm jar , silver sulphadiazine cream ip 1% 50gm tube , skin graft knife blade ( sterile ) ( details in rc ) , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , sodium bicarbonate inj ip 7.5% w / v , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , sodium chloride 0.45% w / v polypack 500 ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium nitroprusside injection 25mg / ml 2ml size , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , sodium valproate gastro resistant tablets ip 200 mg , sodium valproate inj 100 mg / ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , standard pama intra ocular lenses ( details in rc ) 11 to 17.5 , standard pama intra ocular lenses ( details in rc ) 18 to 24 , standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , streptokinase injection 15 lac units ip , succinylcholine inj. ip 50 mg / ml ( iv use ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , surgical spirit ip ( 100 ml ) , surgical spirit ip ( 500 ml ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , tamoxifen tab ip 10 mg , tamsulosin hcl tablets / capsule 0.4 mg , telmisartan tablets ip 40 mg , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm , tenaligliptin tablet ip 20mg , terbinafine cream 1%w / w ( 10 gm tube ) , terbinafine hydrochloride tablet 250 mg , terbutaline tablets ip 2.5 mg , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , thiamine tablets ip 100 mg , thiopentone inj ip 0.5 g , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , timolol eye drops ip 0.5 o / o w / v , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , torsemide inj 10 mg / ml , torsemide tab 10 ip mg , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , tracheostomy tube, plain all sizes ( details in rc ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , tranexamic acid injection ip 100mg / ml 5ml size , tranexamic acid tablets ip 500 mg , travoprost eye drops ip 0.004 o / o , tretenoin cream usp 0.025% , trifluperazine tab ip 5 mg coated , trihexyphenidyl hcl tab ip 2 mg , tropicamide eye drop ip 1o / o , t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) , urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , urokinase injection 5 lac unit ( lyophilized ) , ursodeoxycholic acid tablets ip 300 mg , vaccum suction set, 2.5 meter length ( detail in rc ) , valethamate bromide inj 8mg / ml , valganciclovir tablet 450 mg , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vdrl antigen ( with + ve and ve control ) / rpr slide kit , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil tab ip 40 mg film coated , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin d3 oral solution 60000 iu , vitamin e capsule 400 mg , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , voriconazole injection 200mg / vial , warfarin sodium. tab ip 5mg , water for inj ip , xylometazoline nasal drops ip 0.1% , zinc sulphate dispersible tablets ip elemental zinc 10 mg , zoledronic acid injection ip 4mg vial , zolpidem tablet 5 mg , amino acid drop , amino acid inj. ( astamin ) , aminorich drop / astymen c / amenovik , amoxycillin and potassium clavulanate drop , ampilox 250 ml inj. , aquasop inj. , arichitol inj. , arodesin solution , augpen 150 mg ( amoxycilline + pot. clavulanate ) inj. , augpen 300 mg ( amoxycilline + pot. clavulanate ) inj. , auto clave tape ( stera tape ) , b.p. instument with mercuary , b.p. instument with mercuary standing , b.p. instument without mercuary , bains circuit adult , bains circuit pediatric , betnisol inj. , biotax 125 mg ( ceftoxyn ) inj. , cabergolin 0.25 mg tab. , candid lotion , citric acid , dettol 100 ml , disposable baby kit , disposable needle no 16 11 / 2inch , disposable razor , dressing drum all sizes , drop sodabicarb , erofer l drops 15 ml , evion drop , ezithromycin 15ml sy , formalin 1 ltr , formalin 5 ltr , glucometer strip , gluco one strip ( dr. morepen ) , hand sanitizer , inj. citicholin , inj. hepamerz , inj. nootrophil , inj. strocit , intralipid inj. , k 90 catheter , lactodex lbw with micronutrients , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small , lilan thread 40 , lilan thread 60 , mackintosh , mucus sucker set , multivitamin with zinc syp. , multizec trop 15 ml , neasphine oint. , needle no. 211 / 2 , needle order , neosprin eye oint. , netromycine 10 mg. inj. ( netromax 10 mg inj. ) , nuclovate cream 15 gm , oxygen double stage ragulator , pedia set 100 ml , pepericilline + tezobactum 1.125 mg inj. , pressure monitoring line / high pressure extension line ( pmo line ) length 150 cm, prime volume 1.40 ml , prochlorpertine tab. , re breathing bag adult , re breathing bag pediatric , rubber face mask 0 5 , sevlon lotion 100 ml. , simyl mct powder , star plast ( adhesive plaster ) , caffeine citrate 20 mg / ml injection 2 ml vial , vit. a syp. , vit. c drop , vit. c syp. , vit. c tab. , zinc 200 ml syp , zinc 60 ml / 100 ml sy. , zincovit syp. , zincula drop , mouth airway ( all size ) , inj. n.s.500 m.l. ( in glass bottle ) , inj. n.s.100 m.l. ( in glass bottle ) , cidex 5 ltr , blanisol plus , alcohal based hand rub , surgical hand & skin disinfactent , antiseptic surgical hand rub , povidine iodine 5% & 10% , high level instrument disinfactent , multi eyzymetic instrument cleaner , surgical instrument rust, spot & stain remover , rejuventate dialysis reprocessing , disinfectent & decalcification of haemodialysis machine , d 125 disinfectent 1 ltr. , 5 fu 500 mg , capcetabin 500 mg , carboplatin 150 mg , carboplatin 450 mg , cisplatin 10 mg , codon iv set , cyclophosphamide 500mg , danazole 50 mg cap. , docetaxel 120 mg , docetaxel 80 mg , doxorubicine 10 mg , doxorubicine 50 mg , epirubicine 50 mg , filgrastin 300 mg , inj. gemcitabin 1 gm , inj. gemcitabin 2 mg , ieucovorin 50 mg , tab. imatinib 400 mg , inj. mesna 100 mg , inj. botrezumib , inj. bleomycin , oxaliplatin 50 mg , pacletaxel 260 mg , tamoxifen 10 mg , zolidronic acid 4 mg , inj. vetneuren 2 ml , inj. vanomycin , inj. surfactant , human hepatitis b immunoglobulin 100 i.u. injection ( 100 i.u. / 0.5 ml ) , three way adopter , inj. milriuon , inj. decarbazine ( dtic ) ...

Medical And Health Services - Rajasthan

33776214 supply of medicine and surgical items in bangur hospital pali for the year 2022 23 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) each piece 2 s122 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) each piece 3 s120 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) each piece 4 s123 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) each piece 5 s121 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) each piece 6 750 3rd generation recombinant f viii 1000 iu with diluent vial with diluent 7 749 3rd generation recombinant f viii 250 iu with diluent vial with diluent 8 742 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) each piece 9 s47.a abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) each piece 10 s124 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) each piece 11 s125 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) each piece 12 s47.b abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) each piece 13 s47.c abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) each piece 14 731 abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) bottle of 30 tablets 15 s1 absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) piece 16 s95 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) each pcs. 17 r2 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 1x12 foils 18 r4 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 1x12 foils mndy tender list 2022 19 r3 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 20 r5 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 1x12 foils 21 r7 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 1x12 foils 22 r6 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 23 r1 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 1x12 foils 24 r8 absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) 1x12 foils 25 r72 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm 1x12 foils 26 r70 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm 1x12 foils 27 r71 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm 1x12 foils 28 r73 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm 1x12 foils 29 r10 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size2 / 0 1 / 2 cir rb needle 30mm length 90 cm 1x12 foils 30 r16 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size2 / 0 1 / 2 cir rb needle 40mm l 90cm 1x12 foils 31 r65 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) 1x12 foils 32 r67 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) 1x12 foils 33 r66 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) 1x36 foils 34 r11 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm 1x12 foils 35 r9 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm 1x12 foils 36 r13 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm 1x12 foils 37 r17 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) 1x12 foils 38 r15 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) 1x12 foils 39 r18 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm 1x12 foils 40 r74 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm 1x12 foils 41 r12 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide col lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm 1x12 foils 42 r68 absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 43 r69 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 44 r14 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed 1x12 foils 45 r19 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm 1x12 foils 46 r62 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) 1x12 foils 47 r64 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) 1x12 foils 48 r63 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) 1x12 foils 49 r61 absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) 1x12 foils 50 s2 absorbent cotton wool ip 500 gm each pcs. 51 780 acebrophylline tablet / capsule 100 mg 10x10 tablets 52 492 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg each pcs. 53 163 acenocoumarol tab ip / nicoumalone tab ip 2 mg 10x10 tab strip 54 253 acetazolamide tab ip 250mg 10x10 tab blister 55 500 acetylcystine solution usp ( injection ) 200 mg / ml each pcs. 56 647 act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) one combi blister pack 57 648 act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) one combi blister pack 58 645 act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) one combi blister pack 59 646 act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) one combi blister pack 60 213 acyclovir cream 5% each pcs. 61 769 acyclovir eye ointment ip 3% w / w 5gm size 5 gm tube 62 502 acyclovir intravenous infusion ip 250mg each pcs. 63 503 acyclovir intravenous infusion ip 500mg vial 64 62 acyclovir oral suspension ip 400mg / 5ml 60 ml bottle ( with measuring cap ) 65 63 acyclovir tab ip 200 mg 10x10 tab blister 66 64 acyclovir tab ip 800 mg 10x10 tab strip 67 547 adenosine injection ip 6 mg / 2ml each pcs. 68 34 adrenaline injection ip 1mg / ml im / iv use 1ml amp ( ambercolor ) 25 amp 69 65 albendazole oral suspension ip 400 mg / 10ml 10 ml bottle 70 66a albendazole tablets ip 400 mg ( detail in rc ) each pcs. 71 631 alendronate sodium tablets usp / bp 35 mg 4 tablets ( 20 *4tablet ) 72 788 alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) 1 73 598 allopurinol tablets ip 100 mg 10x10 tablets 74 525 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit each pcs. 75 339 alprazolam tab ip 0.25 mg each pcs. 76 340 alprazolam tab ip 0.5mg 10x10 tab blister 77 67 amikacin inj ip 100 mg 2 ml vial 78 504 amikacin inj ip 250 mg vial 79 68 amikacin inj ip 500 mg 2 ml vial 80 794 amino acid 10% injection 100ml size 100 ml bottle 81 365 aminophylline inj ip 25 mg / ml 10 ml amp 25 ampoules 82 183 amiodarone hydrochloride inj 50 mg / ml 3 ml amp ( 10 amp ) 83 181 amiodarone tab ip 100 mg 10x10 tablets 84 182 amiodarone tab ip 200 mg 10x10 tab strip 85 341 amitriptyline tab ip 25mg film coated 10x10 tab strip 86 461 amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) 10x10 tab blister 87 457 amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) 10x10 tab strip 88 460 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg 10x10 tab strip / blister 89 184 amlodipine tab ip 2.5 mg each pcs. 90 185 amlodipine tablets ip 5 mg 10x10 tab blister 91 506 amoxicillin and potassium clavulanate inj ip 1.2gm vial 92 505 amoxicillin and potassium clavulanic ip inj 600mg each pcs. 93 69 amoxycillin and cloxacillin cap 250 + 250 mg 10x10 cap strip 94 70 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg each pcs. 95 507 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) each pcs. 96 71 amoxycillin cap ip 250mg 10x10 cap strip / blister 97 72 amoxycillin cap ip 500mg 10x10 cap strip / blister 98 73 amoxycillin dispersible tablets ip 125 mg 10x10 tab strip 99 473 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml each pcs. 100 706 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 10x10 tablets 101 74 amphotericin b inj ip 50 mg vial 102 412 ampicillin cap ip 500mg 10x10 cap blister 103 75 ampicillin injection ip 500 mg vial 104 261a antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 60 ml bottle ( with measuring cap ) 105 260a antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 10x10 tab blister 106 225 anti a blood grouping serum ip ( anti a monoclonal serum ) each pcs. 107 226 anti b blood grouping serum ip ( anti b mono clonal serum ) each pcs. 108 227 anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip each pcs. 109 407 anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) each pcs. 110 497 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg each pcs. 111 686 artemether and leumefantrine tablet ( 40 mg and 240 mg ) 1x6 tablet blister 112 651 artemether and leumefantrine tablet ( 80 mg and 480 mg ) 1x6 tablet blister 113 508a artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) each combo pack in a unit carton 114 387 ascorbic acid tab ip 500 mg 10x10 tab strip 115 s3 asepto syringe with transparent bulb sterile, 60 ml each pcs. 116 444 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 117 679 aspirin tablet ip ( gastro resistant ) 150 mg 14x10 tablet 118 462 atenolol tab ip 25 mg each pcs. 119 186 atenolol tab ip 50 mg each pcs. 120 187 atorvastatin tab ip 10mg each pcs. 121 548 atorvastatin tablets ip 40 mg each pcs. 122 311 atracurium inj 10 mg / ml 2.5 ml amp ( 10 ampoules ) 123 319 atropine eye ointment ip 1% each pcs. 124 654 atropine sulphate injection 0.6mg / ml each pcs. 125 320 atropine sulphate ophthalmic solution usp 1% 5 ml. vial with sterilized dropper, or squeeze vial 126 133 azathioprine tab ip 50 mg 10x10 tab strip 127 78a azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 128 80a azithromycin tab ip 500 mg 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 129 79a azithromycin tablets ip 250mg 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 130 683 aztreonam injection 1gm vial 131 509 aztreonam injection usp 500 mg vial 132 r79 b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) 1x12 foils 133 r78 b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) 1x12 foils 134 698 baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) 10x10 tablets 135 366 beclomethasone inhalation ip 200 mcg / dose each pcs. 136 445 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) each pcs. 137 726 bendamustine injection 100 mg vial 138 81 benzathine benzylpenicillin inj ip 12 lac units vial 139 82 benzathine benzylpenicillin inj ip 6 lac units vial 140 542 betahistine tab ip 16 mg 10x10 tablets 141 541 betahistine tab ip 8 mg 10x10 tablets 142 558 betamethasone dipropionate cream ip 0.05% 15gm tube in a unit carton 143 559 betamethasone lotion ip 0.05 o / o each pcs. 144 418 betamethasone sod phos inj ip 4mg / ml each pcs. 145 35 betamethasone tab ip 0.5mg each pcs. 146 612 betaxolol eye drops 0.5 o / o each pcs. 147 735 bevacizumab injection 100 mg vial 148 734 bevacizumab injection 400 mg vial 149 741 bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) 10x10 tablets 150 279 biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) each pcs. 151 262 bisacodyl tab ip 5 mg 10x10 tab strip 152 398 black disinfectant fluid ( phenyl ) as per schedule o grade iii 5 ltrs can 153 134 bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) each pcs. 154 s4 blood administration set blood transfusion set ( details in rc ) unit 155 s98 bone cement each pcs. 156 s80 bone wax sterilised 2.5 gram / packet 157 730 bortezomib injection 2mg vial 158 487 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% each pcs. 159 540 bromocriptine tablets ip 2.5 mg 10x10 tab strip 160 367 budesonide nebulizer suspension 0.25mg / ml each pcs. 161 617 budesonide powder for inhalation 200 mcg 30 capsules 162 2 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 4ml amp ( 10 ampoules ) 163 4 bupivacaine inj ip 0.5% each pcs. 164 694 butorphanol tartrate injection usp 1mg / ml 1ml size each pcs. 165 773 cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 10x10 tablets 166 793 caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 3ml vial 167 671 calamine lotion ip 100ml 100 ml bottle 168 630 calcitriol capsules ip 0.25 mcg 10x10 cap strip / blister 169 441 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 100 ml bottle ( with measuring cap ) 170 388 calcium gluconate inj ip 10% ( iv use ) 10 ml amp 25 ampoules 171 622 calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) each pcs. 172 727 capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) 10x10 tablets 173 474 carbamazepine oral suspension usp 100 mg / 5ml 100 ml bottle ( with measuring cap ) 174 54 carbamazepine tab ip 100 mg 10x10 tab strip / blister 175 53 carbamazepine tab ip 200 mg ( film coated ) each pcs. 176 280 carbimazole tabs ip 5 mg ( film coated ) each pcs. 177 526 carboplatin injection ip 150 mg 15 ml vial 178 527 carboplatin injection ip 450 mg 45 ml vial 179 281 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 1 ml amp / vials ( 25 ampoule / vial ) 180 613 carboxymethylcellulose eye drops ip 0.5% each pcs. 181 755 carvedilol tablet 3.125 mg 10x10 tablets 182 s9.b catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 183 s9.c catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 184 s9.d catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 185 s9.e catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 186 s9.f catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 187 s9.g catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 188 s9.a catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 189 709 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) 10x10 tablets 190 710 cefadroxil tablet 500 mg 10x10 tablets 191 510 cefepime injection ip 500 mg vial 192 511 cefixime oral suspension ip 25mg / ml ( paediatric drops ) each pcs. 193 84 cefixime tab ip 100 mg 10x10 tab strip 194 85 cefixime tab ip 200 mg each pcs. 195 86 cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) vial 196 88 cefotaxime inj ip 250 mg each pcs. 197 87 cefotaxime injection ip 1 g each pcs. 198 475 cefpodoxime dispersible tab 50 mg each pcs. 199 89 ceftazidime inj ip 1g vial 200 90 ceftazidime inj ip 250 mg each pcs. 201 91 ceftazidime inj ip 500 mg each pcs. 202 708 ceftriaxone 1 gm + tazobactum 125 mg injection each pcs. 203 93 ceftriaxone inj ip 1g / vial vial ( packed in monocarton ) 204 94 ceftriaxone inj ip 250 mg / vial each pcs. 205 95 ceftriaxone inj ip 500mg / vial vial ( packed in monocarton ) 206 512 cefuroxime axetil tab ip 250 mg 10x10 tab strip 207 96 cephalexin cap ip 250 mg 10x10 cap blister 208 97 cephalexin cap ip 500 mg 10x10 cap blister 209 427 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 30 ml bottle with measuring cap 210 476 cephalexin tablets 125 mg ( dispersible tablets ) each pcs. 211 589 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 212 499 cetirizine syrup ip 5mg / 5 ml each pcs. 213 498 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab 10x10 tablets 214 215a cetrimide cream ip 15 gm 15gm tube in a unit carton 215 s137 chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) each piece 216 s136 chemotherapy port and non coring needles ( adult ) ( detail in rc ) each piece 217 136 chlorambucil tab ip 5 mg each pcs. 218 771 chloramphenicol 1% w / w eye ointment ip, 3gm size 3 gm tube 219 321 chloramphenicol eye drops ip 0.5 0 / 0 each pcs. 220 342 chlordiazepoxide tablets ip 10mg 10x10 tab strip 221 447 chlorhexidine gluconate solution 5% 250 ml 250 ml bottle 222 580 chlorhexidine mouthwash ip 0.2 o / o each pcs. 223 98 chloroquine phosphate inj ip 40 mg / ml 5 ml amp ( 25 amp ) 224 100a chloroquine phosphate suspension ip 50 mg / 5ml 60 ml bottle ( with measuring cap ) 225 99 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 10x10 tab strip / blister 226 37 chlorpheniramine maleate tab ip 4mg each pcs. 227 346 chlorpromazine inj. ip 25mg / ml each pcs. 228 343 chlorpromazine tablets ip 100 mg ( coated tablet ) 10x10 tab strip 229 344 chlorpromazine tablets ip 25 mg ( sugar coated ) 10x10 tab strip 230 345 chlorpromazine tablets ip 50 mg ( coated tablets ) 10x10 tab strip 231 610 chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) each pcs. 232 623 cholecalciferol granules 60, 000 iu / gm each pcs. 233 r77 chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) each pcs. 234 r80 chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) 1x12 foils 235 r76 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) 1x12 foils 236 544 cinnarizine tablet ip 75 mg 10x10 tab blister 237 543 cinnarizine tablets ip 25 mg 10x10 tab blister 238 585 ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp 5 ml. vial with sterilized dropper, or squeeze vial 239 322 ciprofloxacin eye drops ip 0.3 o / o w / v 5 ml squeeze vial 240 101 ciprofloxacin injection ip 200mg / 100ml 100 ml ffs / bfs bottle 241 323 ciprofloxacin ophthalmic ointment usp 0.3% 5 gm tube in unit carton 242 103 ciprofloxacin tablet ip 500 mg film coated each pcs. 243 102 ciprofloxacin tablets ip 250 mg film coated each pcs. 244 768 cis atracurium besylate injection 2 mg / ml in 5 ml vial 5 ml vial 245 528 cisplatin inj ip 10 mg / 10 ml each pcs. 246 137 cisplatin inj ip 50 mg / 50 ml each pcs. 247 513 clindamycin capsule ip 150mg each pcs. 248 514 clindamycin capsule ip 300 mg each pcs. 249 560 clindamycin phosphate gel usp 1 o / o 20gm tube in mono carton 250 714 clindamycin phosphate injection ip 300 mg vial / ampoules 251 663 clobazam tablet / capsule 10 mg 10x10 tablet / capsule blister 252 662 clobazam tablet / capsule 5 mg 10x10 tablet / capsule blister 253 561 clobetasol propionate cream ip 0.05 o / o each pcs. 254 282 clomifene tab ip 25 mg 10x10 tab strip 255 283 clomiphene tab ip 50 mg each pcs. 256 678 clonazepam tablet 0.5 mg each pcs. 257 751 clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) each pcs. 258 549 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg each pcs. 259 188 clopidogrel tab ip 75 mg 10x10 tab strip 260 s96.a close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) each piece 261 s96.b close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) each piece 262 586 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 5 ml ear drops 263 104 clotrimazole cream ip 2% w / w 15gm tube in a unit carton 264 443 clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) each pcs. 265 105 clotrimazole vaginal tab ip 500mg single tablet ( 10 tabs with an applicator ) 266 417 cloxacillin sodium inj ip 500mg vial 267 670 coal tar 6% & salicylic acid 3% ointment 20gm 268 718 colistimethate injection ip 1m iu powder for solution vial 269 106 compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o 15gm tube in mono carton 270 244 compound benzoin tincture ip 500 ml bottle 271 377 compound sodium lactate inj. ip 500 ml ffs / bfs bottle 272 399 conc haemodialysis fluid b.p acetate concentrate 10 litre can each pcs. 273 687 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans each pcs. 274 284 conjugated estrogen tabs usp 0.625 mg. each pcs. 275 s48 corrugated drainage sheet all sizes ( details in rc ) each pcs. 276 107 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 50 ml bottle ( with measuring cap ) 277 669 co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) each pcs. 278 108 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 10x10 tab blister 279 368 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. 50 ml bottle ( with measuring cap ) 280 692 cough syrup / expectorant ( 50 ) ml 50 ml bottle ( with measuring cap ) 281 138 cyclophosphamide inj ip 200 mg 10 ml glass vial 282 139 cyclophosphamide inj ip 500 mg 25ml glass vial 283 736 cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) each pcs. 284 677 cyclosporin capsule usp / ip 50 mg 50 caps pack 285 141 cytarabine injection bp 500mg each pcs. 286 529 dacarbazine injection 500 mg usp / bp each pcs. 287 142 danazol cap ip 50 mg 10x10 cap blister 288 797 dasatinib tab 100 mg each pcs. 289 143 daunorubicin inj ip 20 mg 10 ml glass vial 290 165 deferasirox tab 100 mg each pcs. 291 166 deferasirox tab 500 mg 30 tablets 292 167 deferiprone cap 250 mg 50 caps 293 168 deferiprone cap 500 mg 50 caps 294 581 dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) 295 169 desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) vial 296 39 dexamethasone inj ip 8mg / 2ml 2 ml vial ( usp type i vial ) 297 40 dexamethasone tab ip 0.5 mg 10x10 tab strip 298 700 dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) 10x10 tablets 299 440 dextromethorphan hbr syrup ip 13.5mg / 5ml 30 ml. bottle 300 379 dextrose inj ip 10% 500 ml ffs / bfs bottle 301 378 dextrose inj ip 25% w / v 100 ml ffs / bfs bottle 302 380 dextrose inj ip 5% 500 ml ffs / bfs bottle 303 232 diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) 20 ml vial / ampoule 304 233 diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) 20 ml ampoule 305 349 diazepam inj ip 10mg / 2ml ( 1m / iv use ) 2 ml amp 25 ampoules 306 350 diazepam tab ip 5 mg 10x10 tab strip / blister 307 20 diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) each pcs. 308 493 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 20 gm tube in unit carton 309 483 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg each pcs. 310 695 diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use 1 ml. ampoule 311 19 diclofenac sodium inj ip 25 mg / ml ( im / iv use ) 3 ml amp ( 10 amp ) 312 437 diclofence prolonged release tablet ip 100 mg 10x10 tab strip 313 439a dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 10x10 tab blister 314 438 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 315 265 dicyclomine hydrochloride oral solution ip 10mg / 5ml 30 ml bottle with measuring cap 316 264 dicyclomine inj ip 10 mg / ml 2 ml amp 25 ampoules 317 263 dicyclomine tab ip 10 mg each pcs. 318 110 diethylcarbamazine tab ip 100 mg 10x10 tab blister 319 189 digoxin inj ip 0.25 mg / ml each pcs. 320 190 digoxin tab ip 0.25 mg. 10x10 tab strip 321 191 diltiazem tabs ip 30 mg film coated each pcs. 322 285 dinoprostone cream / gel 0.5 mg dinoprostone in syringe syringe 323 480 diphtheria antitoxin 10000 iu vial 324 s89.b disposable sterile surgical rubber gloves size 8 inches, powder free pair 325 s89.a disposable sterile surgical rubber gloves size 8 inches, powdered pair 326 702 divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) 10x10 tablets 327 192 dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) each pcs. 328 590 domperidone oral drops 10mg / ml ( 10ml ) 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 329 266 domperidone suspension ip 5mg / 5ml each pcs. 330 267 domperidone tab ip 10 mg each pcs. 331 193 dopamine hydrochloride inj ip 40 mg / ml 5 ml amp ( amber colour ) 25 ampo 332 s41.a double j stent, sterile, both ends open size 4f, length 16 cm each pcs. 333 s41.b double j stent, sterile, both ends open, size 5f, length 20 cm each pcs. 334 s42.a double j stent, sterile, one end closed size 4f, length 16 cm each pcs. 335 s42.b double j stent, sterile, one end closed, size 5f, length 20 cm each pcs. 336 144 doxorubicin inj ip 50 mg / 25 ml each pcs. 337 111 doxycycline cap ip 100 mg 10x10 cap strip / blister 338 763 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 10x10 tablets 339 689 dried factor viii fraction ip ( iv use ) 1000 iu / vial vial with diluent 340 688 dried factor viii fraction ip ( iv use ) 500 iu / vial each pcs. 341 171 dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) each pcs. 342 591 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 10x10 tablets 343 5 drotaverine hydrochloride inj 40 mg / 2 ml 2 ml amp 10 ampoules 344 415 drotaverine tab ip 40 mg each pcs. 345 787 dutasteride tablet 0.5 mg 10x10 tablets 346 649 each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg one combi blister pack 347 s104 ecg electrode ( detail in rc ) each piece 348 s127 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) each piece 349 195 enalapril maleate tab ip 2.5mg 10x10 tab strip 350 194 enalapril maleate tab ip 5mg 10x10 tab strip 351 463 enalapril maleate tablets ip 10 mg 10x10 tab strip 352 s44.b endotracheal tube, cuff size 4.5 ( details in rc ) each piece 353 s44.c endotracheal tube, cuff size 5 details in rc each piece 354 s44.d endotracheal tube, cuff size 6 ( details in rc ) each piece 355 s44.f endotracheal tube, cuff size 7 ( details in rc ) each piece 356 s44.g endotracheal tube, cuff size 7.5 ( details in rc ) each piece 357 s44.h endotracheal tube, cuff size 8 ( details in rc ) each piece 358 s44.i endotracheal tube, cuff size 8.5 ( details in rc ) each piece 359 s44.j endotracheal tube, cuff size 9 ( details in rc ) each piece 360 s44.e endotracheal tube, cuff size 6.5 ( details in rc ) each piece 361 s44.a endotracheal tube, cuffed size 4 ( details in rc ) each piece 362 s43.a endotracheal tube, plain size 2.5 ( details in rc ) each piece 363 s43.b endotracheal tube, plain size 3 ( details in rc ) each piece 364 s43.c endotracheal tube, plain size 3.5 ( details in rc ) each piece 365 s43.d endotracheal tube, plain size 4 ( details in rc ) each piece 366 s43.e endotracheal tube, plain size 4.5 ( details in rc ) each piece 367 s43.f endotracheal tube, plain size 5 ( details in rc ) each piece 368 s43.g endotracheal tube, plain size 5.5 ( details in rc ) each piece 369 s43.h endotracheal tube, plain size 6 ( details in rc ) each piece 370 s43.j endotracheal tube, plain size 7 ( details in rc ) each piece 371 s43.k endotracheal tube, plain size 7.5 ( details in rc ) each piece 372 s43.l endotracheal tube, plain size 8 ( details in rc ) each pcs. 373 s43.m endotracheal tube, plain size 8.5 ( details in rc ) each piece 374 s43.i endotracheal tube, plain size 6.5 ( details in rc ) each piece 375 172 enoxaparin sodium inj ip 60 mg each pcs. 376 723 entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) 10x10 tablets 377 s110 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) each piece 378 351 escitalopram tab ip 10 mg 10x10 tab strip / blister 379 753 esmolol hydrochloride injection 10mg / ml 10ml size 10 ml vial 380 173 ethamsylate inj 250 mg / 2ml ( im / iv ) each pcs. 381 745 ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) 10x10 tablets 382 286 ethinyloestradiol tabs ip 50 mcg 10x10 tab strip 383 146 etoposide inj ip 100 mg 5 ml glass vial 384 495 etoricoxib tab ip 120mg 10x10 tab blister 385 658 etoricoxib tablet 90 mg 10x10 tablets 386 770 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size 5 ml. vial with sterilized dropper, or squeeze vial 387 s85 face mask, disposable ( details in rc ) piece 388 406 factor ix concentrate ( purified ) ip 600 i.u. ( human coagulation factor ix ) each pcs. 389 713 faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) 10x10 tablets 390 550 fenofibrate capsules / tab ip 200 mg each pcs. 391 655 fentanyl citrate injection 50mcg / ml 10ml vial / amp 392 21 fentanyl citrate injection ip 2 ml 2 ml amp 10 ampoules 393 746 feracrylum 1% w / v sterile solution 100 ml 100ml 394 789 ferric carboxymaltose injection 50 mg / ml 10 ml size 10 ml vial 395 391 ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 10x10 tab strip / blister 396 390 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg each pcs. 397 530 filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg each pcs. 398 575 finasteride tablets ip 5 mg 10x10 tab strip / blister 399 579 flavoxate tablets ip 200 mg ( coated tablet ) each pcs. 400 425 fluconazole eye drops 0.3% 5 ml. vial with sterilized dropper, or squeeze vial 401 114a fluconazole tablets ip 150mg strip of 1 tablet ( 10x10x1 tab ) 402 147 flunarizine tab 5 mg each pcs. 403 148 fluorouracil inj ip 250 mg / 5ml 5 ml ampoule 404 352 fluoxetine cap ip 20 mg 10x10 cap strip / blister 405 421 flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v 5 ml squeeze vial 406 s87.a foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 each piece 407 s87.b foldable intra ocular lense with injector ( details in rc ) 18 to 24 each piece 408 s87.c foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 each piece 409 s102 foleys catheter no. 14 ( detail in rc ) each piece 410 392 folic acid tab ip 5 mg each pcs. 411 245 formaldehyde solution ( 34.5 per. 38 per. ) each pcs. 412 616 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 30 capsules 413 685 framycetin sulphate cream 1 o / o 100 gm pack 100gm pack 414 684 framycetin sulphate cream 1 o / o 30gm pack 30gm pack 415 254 frusemide tab ip 40 mg 10x10 tab strip 416 255 furosemide injection ip 10mg / ml ( im and iv use ) 2 ml ampoule 417 216a fusidic acid cream ip 2% 10gm tube in mono carton 418 667 gabapentine tablet / capsule 100mg 10x10 tablet / capsule blister / strip 419 668 gabapentine tablet / capsule 300mg 10x10 tablet / capsule blister / strip 420 235 gadodiamide inj. 0.5mml / ml vial 10 ml vial 421 446 gamma benzene hexachloride lotion 1% ( lindane lotion usp ) 100 ml bottle 422 724 ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) vial 423 737 gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) 10x10 tablets 424 531 gemcitabine for injection 200 mg vial 425 532 gemcitabine for injection ip 1gm vial 426 116 gentamycin injection ip 80mg / 2ml ( im / iv use ) 2 ml amp 50 ampoules 427 246 gentian violet topical solution usp 1o / o 200 ml bottle 428 453 glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) each pcs. 429 287 glibenclamide tab ip 5 mg 10x10 tab strip / blister 430 603 gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) 10x10 tablets 431 288 gliclazide tab ip 40 mg 10x10 tab strip / blister 432 290 glimepiride tab ip 1mg 10x10 tab strip / blister 433 289 glimepiride tab ip 2 mg each pcs. 434 456 glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 10x10 tab blister 435 452 glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) 10x10 tab blister 436 291 glipizide tab ip 5mg 10x10 tab blister 437 s5.b gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 438 s5.a gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 439 s7.b gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) pair 440 s6.b gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 441 s6.a gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 442 s7.a gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 443 604 glucagon for injection usp 1 mg / ml vial 444 247 gluteraldehyde solution 2% each pcs. 445 564 glycerin ip 100 ml each pcs. 446 217 glycerin ip 400 gm each pcs. 447 650 glyceryl trinitrate tablets 2.6 mg controlled release tablets 30 tab bottles 448 312 glycopyrrolate inj ip 0.2 mg / ml 1 ml 10 ampoules 449 117 griseofulvin tab ip 125 mg each pcs. 450 583 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 15 ml squeeze vial 451 353 haloperidol inj ip 5 mg / ml 1 ml 10 ampoules 452 354 haloperidol tab ip 1.5 mg 10x10 tab strip 453 355 haloperidol tab ip 5 mg 10x10 tab strip 454 6 halothane bp 250 ml in amber colour bottle 455 174 heparin sodium inj ip 5000 iu / ml ( im / iv use ) each pcs. 456 767 hepatitis b immunologlobin injection ip 200 i.u each pcs. 457 485 homatropine eye drops ip 2% 5 ml squeeze vial 458 175 human albumin solution ip 20% 100 ml bottle / flexible closed system bag 20o / o 100 ml 459 304 human anti d immunoglobulin 150 mcg pre filled syringe / vial 460 303 human anti d immunoglobulin injection 300mcg ( im use ) human chorionic gonadotropin injection ip 5000 i.u. vial 462 798 human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) 10ml vial ( 0.5gm ) 463 305 human rabies immunoglobulin inj 150 iu / ml each pcs. 464 423 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. vial 465 256 hydrochlorthiazide tab ip 12.5 mg 10x10 tab strip 466 464 hydrochlorthiazide tab ip 25mg 10x10 tab strip 467 42 hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) vial 468 248 hydrogen peroxide solution ip 6 o / o ( 20 vol ) each pcs. 469 599 hydroxychloroquine sulphate tablets 200mg 10x10 tablets 470 416 hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 500 ml plastic bottle / 500 ml free flex 471 293 hydroxyprogesterone inj ip 250mg / ml 1ml amp 25 ampoules 472 324 hydroxypropylmethyl cellulose solution 20 mg / ml 2ml glass syringe ( with cannula ) 473 43 hydroxyzine tab ip 25 mg 10x10 tab strip / blister 474 414 hyoscine butyl bromide tablets ip 10mg 10x10 tab blister 475 268 hyoscine butylbromide inj ip 20 mg / ml each pcs. 476 22 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 10x10 tab blister 477 477 ibuprofen oral suspension bp / usp 100 mg / 5 ml 60 ml bottle ( with measuring cap ) 478 23 ibuprofen tab ip 200 mg ( coated ) 10x10 tab blister 479 24 ibuprofen tab ip 400 mg ( coated ) each pcs. 480 533 ifosfamide injection ip / bp / usp 1gm vial 481 534 imatinib tab ip 400mg each pcs. 482 715 imipenem + cilastatin injection 500mg / 500mg ip powder for solution vial 483 356 imipramine tab ip 25 mg ( coated tab ) 10x10 tab blister 484 357 imipramine tab ip 75 mg ( coated ) 10x10 tab blister 485 436 indomethacin cap ip 25 mg 10x10 cap strip 486 s10.a infant feeding tube size 10fg ( details in rc ) each piece 487 s10.c infant feeding tube size 5fg ( details in rc ) each piece 488 s10.b infant feeding tube size 8fg ( details in rc ) each piece 489 s13 infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) unit 490 796 inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) 1.5ml vial 491 693 insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle 10 ml vial 492 680 insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges 3ml vial 493 300 insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) 10 ml vial 494 s14 insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 unit 495 791 intravenous fat emulsion 20% w / v 250ml 250 ml bottle 496 482 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 20 ml pack 497 672 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. 50ml 498 369 ipratropium bromide nebulizer solution 250 mcg / ml 15 ml glass bottle 499 618 ipratropium powder for inhalation ip 40 mcg each pcs. 500 448 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 100 ml bottle in a unit carton with a separate dropper ( details in rc ) 501 488 iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 5 ml ampoule ( amber colour ) 502 7 isoflurane usp each pcs. 503 294 isophane insulin inj ip 40 iu / ml 10 ml vial 504 551 isoprenaline injection ip 2mg / ml each pcs. 505 197 isosorbide dinitrate tab ip 5 mg 10x10 tab blister 506 198 isosorbide mononitrate tabs ip 20 mg 10x10 tab strip 507 333 isoxsuprine inj ip 5 mg / ml 2 ml amp 10 ampoules 508 334 isoxsuprine tab ip 20 mg 10x10 tab strip 509 118 itraconazole cap 100 mg 10x4 cap strip 510 s84.b k wire, length 375 mm; 1.6mm ( details in rc ) each pcs. 511 s84.c k wire, length 375 mm; 1.8mm ( details in rc ) each pcs. 512 s84.a k wire, length 375 mm; 1mm ( details in rc ) each pcs. 513 8 ketamine inj ip 50 mg / ml 10 ml vial 514 565 ketoconazole cream 2% 15gm tube in mono carton 515 697 ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) 10x10 tablets 516 411 labetalol hcl inj ip 20mg / 4ml 4 ml ampules 517 410 labetalol tab ip 100mg each pcs. 518 704 lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) each pcs. 519 592 lactic acid bacillus tab 60 million spores 10x10 tablets 520 593 lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml each pcs. 521 701 lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) 10x10 tablets 522 149 l asparaginase inj 10000 iu vial 523 600 leflunomide tablets ip 10mg ( film coated ) 10x10 tablets 524 601 leflunomide tablets ip / usp 20mg ( film coated ) 10x10 tablets 525 728 letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) 10x10 tablets 526 150 leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml each pcs. 527 776 leurprolide acetate depot 11.25 mg vial 528 775 leurprolide acetate depot 3.75 mg vial 529 785 levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) 10x10 tablets 530 666 levetiracetam injection 500mg / 5ml vial 531 665 levetiracetam oral solution / suspension 100mg / ml 100ml 532 664 levetiracetam tablet ip 500 mg 10x10 tab blister 533 659 levoceitrizine tablet 5mg 10x10 tablets 534 161 levodopa and carbidopa tab 250 mg+ 25 mg 10x10 tab strip 535 160 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg each pcs. 536 712 levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 10x10 tablets 537 515 levofloxacin tablets ip 250 mg each pcs. 538 777 levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) 10x10 tablets 539 424 lidocaine hcl topical solution usp 4% each pcs. 540 10 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 30 ml vial 541 11 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg each pcs. 542 12 lignocaine gel ip 2% 30gm tube in a unit carton 543 13 lignocaine inj ip 2 o / o 30 ml vial 544 9 lignocaine ointment 5 o / o 10 gm tube in unit carton 545 517 linezolid inj 200mg / 100ml each pcs. 546 516 linezolid tablets ip 600 mg 10x10 tablets 547 800 liposomol amphotericine injection b 50mg vial 548 799 liquid medical oxygen ( lmo ) each pcs. 549 594 liquid paraffin ip 100 ml each pcs. 550 218 liquid paraffin ip 400 ml each pcs. 551 466 lisinopril tab ip 2.5 mg 10x10 tab strip / blister 552 199 lisinopril tab ip 5 mg each pcs. 553 465 lisinopril tablets ip 10 mg 10x10 tab strip / blister 554 358 lithium carbonate tab ip 300 mg 10x10 tab strip 555 732 lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) each pcs. 556 269 loperamide tab ip 2 mg 10x10 tab strip 557 359 lorazepam inj ip 2 mg / ml each pcs. 558 778 lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) 10x10 tablets 559 458 losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) 10x10 tab strip / blister 560 459 losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) 10x10 tab blister 561 467 losartan tab ip 25 mg 10x10 tab blister 562 200 losartan tab ip 50 mg each pcs. 563 249 lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) 5 ltrs can 564 201 magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) 2 ml amp 25 ampoules 565 257a mannitol inj ip 20% w / v each pcs. 566 632 mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml ffs / bfs bottle 567 624 mecobalamin inj 500 mcg / ml 1 ml. ampoule 568 605 medroxyprogesterone acetate tablets ip 10 mg 10x10 tablets 569 496 mefenamic acid tablets bp 500 mg each pcs. 570 518 mefloquine tablets ip 250 mg each pcs. 571 151 melphalan tab ip 5 mg 25 tab bottle 572 152 mercaptopurine tab ip 50 mg 10x10 tab strip 573 119 meropenem inj ip 500 mg each pcs. 574 481 meropenem inj. ip 1gm each pcs. 575 717 meropenem injection ip 250 mg vial 576 766 mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) 10x10 tablets 577 454 metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg each pcs. 578 455 metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) 10x10 tab blister 579 451 metformin hydrochloride ( sustained release tablets ip 1000 mg each pcs. 580 295 metformin tab ip 500 mg ( film coated ) 10x10 tab blister 581 153 methotrexate inj ip 50 mg / 2 ml each pcs. 582 154 methotrexate tab ip 2.5 mg each pcs. 583 536 methotrexate tablets ip 10 mg 10x10 tab strip 584 653 methyl cobalmine tablet 1500mcg 10x10 tab strip / blister 585 652 methyl cobalmine tablet 500mcg 10x10 tab strip / blister 586 44 methyl prednisolone sodium succinate for injection usp 500 mg vial 587 202 methyldopa tab ip 250mg film coated each pcs. 588 335 methylergometrine inj ip 0.2 mg / ml 1ml amp ( ambercolor ) 25 amp 589 336 methylergometrine tab ip 0.125 mg 10x10 tab strip 590 478 metoclopramide hydrochloride syrup ip 5 mg / 5ml 30 ml bottle ( with a seperate dropper which should be able to screw & cap the bottle ) in unit carton 591 270 metoclopramide inj ip 10mg / 2ml 2 ml amp ( amber colour ) ( 25 ampoules ) 592 271 metoclopramide tab ip 10 mg 10x10 tab blister 593 553 metoprolol succinate extended release tablets ip 50 mg 10x10 tablets 594 552 metoprolol tablets ip 25 mg 10x10 tablets 595 584 metronidazole 1% and chlorhexidine gluconade 0.25% gel 10 gm tube in unit carton 596 121 metronidazole benzoate oral suspension ip 100 mg of base / 5ml 60 ml bottle ( amber colour ) with measuring cap 597 120 metronidazole inj ip 500 mg / 100ml 100 ml ffs / bfs bottle 598 122 metronidazole tablets ip 200 mg ( film coated ) each pcs. 599 123 metronidazole tablets ip 400 mg ( film coated ) each pcs. 600 220 miconazole nitrate cream ip 2% 15gm tube in a unit carton 601 313 midazolam inj ip 1 mg / ml 5 ml vial 602 615 mifepristone tab ip 200mg each pcs. 603 337 misoprostol tab ip 200 mcg each pcs. 604 537 mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg each pcs. 605 660 montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 10x10 tablet blister / strip / alu alu pack 606 25 morphine sulphate inj ip 10mg / ml 1 ml 10 ampoules 607 s16 mucus extractor sterile ( details in rc ) unit 608 790 multi vitamin syrup each pcs. 609 381 multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) 500 ml ffs / bfs bottle 610 382 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 500 ml ffs / bfs bottle 611 801 multistix test strip each pcs. 612 393 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 613 394 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vitb2 2 mg niacinamide 25mg folic acid 0.2 mg 10x10 tab strip / blister 614 738 mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) 10x10 caps / tab 615 740 mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) each pcs. 616 744 n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size each pcs. 617 51 naloxone inj ip 0.4mg / ml 1 ml 10 ampoules 618 657 naproxen tablet ip 250mg 10x10 tab blister 619 656 naproxen tablet ip 500mg 10x10 tab blister 620 s17.a nasal oxygen set, twin bore all sizes adult ( details in rc ) each piece 621 s17.b nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) each piece 622 s126 nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) each piece 623 772 natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 10x10 tablet / capsule blister / strip 624 s134 nebulization mask adult ( detail in rc ) each piece 625 s135 nebulization mask paediatric ( detail in rc ) each piece 626 s103 nelaton catheter size 14 fg ( detail in rc ) each piece 627 223 neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) 10 gm plastic bottle with nozzle to sprinkle powder 628 588 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 5 ml vial / bottle with a seperate dropper 629 314 neostigmine inj ip 0.5 mg / ml 1 ml 10 ampoules 630 638 neostigmine injection ip 2.5mg / 5ml 5 ml amp ( 10 ampoules ) 631 316 neostigmine tab ip 15 mg each pcs. 632 203 nifedipine cap ip 5mg 10x10 cap strip 633 204 nifedipine tablets ip 10 mg ( sustained release ) 10x10 tab blister 634 413 nitrofurantoin tab ip 100mg each pcs. 635 205 nitroglycerin inj 5 mg / ml 5 ml amp ( 10 ampoules ) 636 s131 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) each piece 637 s129 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) each piece 638 s132 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) each piece 639 s130 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) each piece 640 s133 niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) each piece 641 r55 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 642 r56 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 643 r22 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) 1x12 foils 644 r20 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) 1x12 foils 645 r21 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) 1x12 foils 646 r57 non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm 1x12 foils 647 r45 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) 1x12 foils 648 r46 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) 1x12 foils 649 r34 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) 1x12 foils 650 r33 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) 1x12 foils 651 r38 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) 1x12 foils 652 r50 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm 1x12 foils 653 r40 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm 1x12 foils 654 r37 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm 1x12 foils 655 r51 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm 1x12 foils 656 r44 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) 1x12 foils 657 r36 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) 1x12 foils 658 r48 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) 1x12 foils 659 r29 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm 1x12 foils 660 r35 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) 1x12 foils 661 r32 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) 1x12 foils 662 r42 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm 1x12 foils 663 r75 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 1x12 foils 664 r23 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) 1x12 foils 665 r28 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 666 r27 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 667 r24 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) 1x12 foils 668 r25 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) 1x12 foils 669 r53 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 1x12 foils 670 r52 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) each pcs. 671 r54 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) 1x12 foils 672 r30 non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 1x12 foils 673 r39 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm 1x12 foils 674 r43 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) 1x12 foils 675 r49 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm 1x12 foils 676 r41 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) 1x12 foils 677 r31 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) 1x12 foils 678 r47 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) 1x12 foils 679 r26 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) 1x12 foils 680 554 noradrenaline injection ip 2 mg / ml each pcs. 681 296 norethisterone tab ip 5 mg each pcs. 682 124 norfloxacin tab ip 400mg film coated 10x10 tab blister 683 633 normal human intravenous immunoglobulin 5g / 100ml 100 ml vial 684 608 octreotide injection 50 mcg / ml 1 ml. ampoule 685 520 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 10x10 tab blister 686 521 ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) each pcs. 687 711 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size 30 ml. bottle 688 428 ofloxacin oral suspension ip 50mg / 5ml 30 ml. bottle 689 125 ofloxacin tab ip 200 mg 10x10 tab blister 690 219 ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o each pcs. 691 762 oitment mupirocin ip 2% 5 gm tube 692 360 olanzapine tab ip 5 mg each pcs. 693 761 olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size 5ml bottle 694 272 omeprazole cap ip 20 mg each pcs. 695 273 ondansetron inj ip 2mg / ml 2 ml amp 10 ampoules 696 595 ondansetron orally disintegrating tablets ip 4mg 10x10 tab strip 697 274 ors powder ip each pcs. 698 641 oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) each pcs. 699 640 oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) strip / blister of 10 capsule 700 639 oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) strip / blister of 10 capsule 701 642 oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) 75 ml bottle with measuring cap 702 642a oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) each pcs. 703 538 oxaliplatin injection usp 50 mg 25 ml vial 704 703 oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) 10x10 tablets 705 s100 oxygen mask ( adult ) 706 s101 oxygen mask ( pediatric ) unit 707 338 oxytocin inj ip 5 iu / ml each pcs. 708 156 paclitaxel inj ip 100 mg 16.7 ml vial 709 155 paclitaxel inj ip 260 mg each pcs. 710 596 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets each pcs. 711 s18 paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 712 s19 paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 713 s20 paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 714 26 paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 715 696 paracetamol infusion ip 1% w / v 100ml size 100 ml bottle 716 29 paracetamol inj. 150 mg / ml 2 ml amp 50 ampoules 717 27 paracetamol syrup ip 125 mg / 5ml ( detail in rc ) 60 ml bottle ( with measuring cap ) 718 28 paracetamol tab ip 500 mg 10x10 tab blister 719 30 pentazocine inj ip 30mg / ml ( im / iv use ) 1ml amp 25 ampoules 720 275 pentoprazole inj 40 mg each pcs. 721 s12 perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) unit 722 s11 perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) unit 723 401 peritonial dialysis solution ip 1000 ml ffs / bfs pack 724 569 permethrin cream 5% 30gm tube in a unit carton 725 568 permethrin lotion 5% 30 ml 726 786 phenazopyridine tablet 5 mg each pcs. 727 45 pheniramine inj ip 22.75mg / ml 2 ml amp 25 ampoules 728 420 phenobarbitone inj ip 200mg / ml each pcs. 729 56 phenobarbitone tab ip 30 mg 10x10 tab strip 730 614 phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% each pcs. 731 57 phenytoin injection bp 50mg / ml 2 ml amp ( amber colour ) ( 25 ampoules ) 732 58 phenytoin oral suspension ip 25mg / ml 100 ml glass bottle with measuring cap 733 59 phenytoin tab ip 100 mg ( film coated ) each pcs. 734 297 pioglitazone tab ip 15 mg 10x10 tab blister 735 468 piperacillin + tazobactum for injection ip 4gm+500mg vial 736 707 piperacillin injection 2 gm + tazobactom 250mg ip vial 737 s22 plaster of paris bandage 10cm x 2.7mts unit 738 s21 plaster of paris bandage 15cm x 2.7 mts / roll unit 739 405 polygeline 3.5% solution with electrolytes for i.v. infusion each pcs. 740 716 polymixin sulphate b injection usp 5 lac i.u. vial 741 s74 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm piece 742 s73 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm piece 743 383 potassium chloride inj. 0.15 gm / ml 10 ml amp 10 ampoules 744 384 potassium chloride oral solution u.s.p 500mg / 5ml 200ml bottle ( amber color ) 745 221 povidone iodine ointment 5% 15 gm each pcs. 746 571 povidone iodine ointment usp 250 gm 250 gm pack 747 250 povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 500 ml bottle 748 572 povidone iodine solution ip 10 % 100 ml bottle 749 222 povidone iodine solution ip 5 % 500 ml 500 ml bottle 750 450 povidone iodine solution ip 5% 100ml bottle each pcs. 751 759 powder clotrimazole 1% w / w 30 gm 30 gm bottle 752 52 pralidoxime chloride injection ip 25 mg / ml / 500 mg vial 753 555 prazosin tablets ( extended release ) 2.5 mg 10x15 tablet strip / blister 754 470 prednisolone tab ip 20 mg 10x10 tab strip / blister 755 47 prednisolone tab ip 5 mg 10x10 tab strip / blister 756 469 prednisolone tablet ip 10 mg 10x10 tab strip / blister 757 634 pregabalin cap ip 75 mg 10 x 10 capsule 758 s91 pressure monitoring line / high pressure extension line ( details in rc ) each piece in blister pack 759 128 primaquine tab ip 2.5 mg 10x10 tab strip / blister 760 129 primaquine tab ip 7.5 mg 10x10 tab strip / blister 761 765 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) 1 gm each sachet 762 725 procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) each pcs. 763 764 prochlorperazine mesylate injection 12.5mg / ml 5ml size each pcs. 764 298 progesterone inj 200 mg / 2ml 2 ml amp 10 ampoules 765 49 promethazine inj ip 25mg / ml 2 ml amp ( amber color ) ( 10 ampoules ) 766 48 promethazine syrup ip 5 mg / 5ml 60 ml bottle ( with measuring cap ) 767 50 promethazine tab ip 25 mg 10x10 tab strip 768 14 propofol inj ip 10 mg / ml each pcs. 769 207 propranolol tab ip 40 mg each pcs. 770 792 pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) 10x10 tablets 771 626 pyridoxine tablet ip 10 mg each pcs. 772 627 pyridoxine tablet ip 40mg 10x10 tab strip 773 675 quetiapine tablet ip 25mg 10x10 tab blister 774 674 quetiapine tablet ip 50mg 10x10 tab blister 775 131 quinine dihydrochloride inj ip 300 mg / ml each pcs. 776 132 quinine sulphate tablets ip 300 mg ( film coated ) 10x10 tab blister 777 408 rabies antiserum ip ( equine ) 300 units per ml contains equine antirabies immunoglobulin fragments ( i.m. / sc use ) 5 ml vial 778 306 rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu 1 ml vial with 1.0 ml diluent 779 307 rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose single dose vial with diluent and syringe with needle 780 636 ramipril tablets ip 2.5 mg 10x10 tablets 781 276 ranitidine hcl injection ip 50mg / 2ml each pcs. 782 277 ranitidine tab ip 150mg film coated each pcs. 783 433 ranitidine tab ip 300mg film coated each pcs. 784 690 recombinant coagulation factor viia 1mg vial 785 691 recombinant coagulation factor viia 2mg each pcs. 786 748 recombinant f ix 500 iu with diluent vial with diluent 787 179 rh erythropoetin inj 4000 iu vial / pfs 788 176 rh erythropoetin inj ip 10000 iu vial / pfs 789 177 rh erythropoetin inj ip 2000iu vial / pfs 790 781 ringer acetate infusion 500 ml 500 ml bottle 791 362 risperidone tab 1 mg 10x10 tab strip / blister 792 361 risperidone tab 2mg each pcs. 793 757 rosuvastatin tablet 10 mg 10x10 tablets 794 756 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 10x10 tablets 795 s90.d rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) dispenser box of100 gloves 796 s90.a rubber examination gloves, non sterile, extra small ( details in rc ) dispenser box of100 gloves 797 s90.c rubber examination gloves, size medium ( details in rc ) dispenser box of100 gloves 798 s90.b rubber examination gloves, size small ( details in rc ) dispenser box of100 gloves 799 s23.a ryles tube / nasogastric tube size: 10 ( details in rc ) each piece 800 s23.b ryles tube / nasogastric tube size: 12 ( details in rc ) each piece 801 s24.b ryles tube / nasogastric tube size: 16 ( details in rc ) each piece 802 s24.c ryles tube / nasogastric tube size: 18 ( details in rc ) each piece 803 s24.a ryles tube / nasogastric tube size:14 ( details in rc ) each piece 804 758 sacubitril 24 mg and valsartan 26 mg tablet 14x2 tablets 805 371 salbutamol inhalation 100 mcg / dose 200metered dose container 806 372 salbutamol nebuliser solution bp 5 mg / ml 10 ml vial 807 432 salbutamol syrup ip 2mg / 5ml 100 ml bottle ( with measuring cap ) 808 373 salbutamol tab ip 2 mg 10x10 tab strip / blister 809 370 salbutamol tablet ip 4 mg each pcs. 810 442 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) each pcs. 811 s99.p sanitary napkin beltless with wings ( details in rc ) each pcs. 812 s99.a sanitary napkin beltless ( details in rc ) 6 napkin / pack 813 s99.b sanitary pads belt type ( details in rc ) 6 napkin / pack 814 783 savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) 10x10 tablets 815 s25.a scalp vein set ( disposable ) size 18g ( details in rc ) each piece 816 s25.b scalp vein set ( disposable ) size 20g ( details in rc ) each piece 817 s25.c scalp vein set ( disposable ) size 22g ( details in rc ) each piece 818 s25.d scalp vein set ( disposable ) size 24 g ( details in rc ) each piece 819 363 sertraline tab ip 50 mg each pcs. 820 491 sevoflurane each pcs. 821 573 silver sulphadiazine cream ip 1% 500 gm jar 500 gm jar 822 224 silver sulphadiazine cream ip 1% 50gm tube each pcs. 823 s82 skin graft knife blade ( sterile ) ( details in rc ) one pack each 824 308 snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) vial 825 402 sodium bicarbonate inj ip 7.5% w / v 10 ml amp 25 ampoules 826 784 sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) 10x10 tablets 827 782 sodium chloride 0.45% w / v polypack 500 ml 500 ml bottle 828 385 sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 500 ml ffs / bfs bottle 829 386 sodium chloride inj ip 500 ml 500 ml ffs / bfs bottle 830 621 sodium chloride injection ip 100 ml each pcs. 831 754 sodium nitroprusside injection 25mg / ml 2ml size 2ml vial / ampoule 832 278 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o 100 ml polypropylene pack 833 61 sodium valproate gastro resistant tablets ip 200 mg 10x10 tab strip 834 60 sodium valproate inj 100 mg / ml each pcs. 835 479 sodium valproate oral solution ip 200 mg / 5 ml 100 ml bottle ( with measuring cap ) 836 661 sodium valproate tablet ( gastro resistant ) ip 500mg 10x10 tab strip 837 752 sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) 10x10 tablets 838 258 spironolactone tab ip 25mg each pcs. 839 574 spironolactone tablets ip 50 mg each pcs. 840 s88.a standard pama intra ocular lenses ( details in rc ) 11 to 17.5 each piece 841 s88.b standard pama intra ocular lenses ( details in rc ) 18 to 24 each piece 842 s88.c standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 each piece 843 s128 sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) each pcs. 844 s15.e sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) each piece 845 s15.a sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) each piece 846 s15.c sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) each piece 847 s15.d sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) each piece 848 s15.b sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) each piece 849 s39.a sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) each piece 850 s39.b sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) each piece 851 s106 sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) each piece 852 s79 sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) each piece 853 209 streptokinase injection 15 lac units ip vial 854 317 succinylcholine inj. ip 50 mg / ml ( iv use ) 10 ml vial 855 s8.d suction catheter, sterile. size: f g 10 ( details in rc ) each piece 856 s8.e suction catheter, sterile. size: f g 12 ( details in rc ) each piece 857 s8.f suction catheter, sterile. size: f g 14 ( details in rc ) each piece 858 s8.g suction catheter, sterile. size: f g 16 ( details in rc ) each piece 859 s8.h suction catheter, sterile. size: f g 18 ( details in rc ) each piece 860 s8.i suction catheter, sterile. size: f g 20 ( details in rc ) each piece 861 s8.j suction catheter, sterile. size: f g 22 ( details in rc ) each piece 862 s8.b suction catheter, sterile. size: f g 6 ( details in rc ) each piece 863 s8.c suction catheter, sterile. size: f g 8 ( details in rc ) each piece 864 s8.a suction catheter, sterile.size: fg 5 ( details in rc ) each piece 865 602 sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg 10x10 tablets 866 635 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 4ml vial 867 s30.a surgical blade sterile, size 11 ( details in rc ) 100 blades / packet 868 s30.b surgical blade sterile, size 15 ( details in rc ) 100 blades / packet 869 s30.c surgical blade sterile, size 22 ( details in rc ) 100 blades / packet 870 s105 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) each piece 871 s86.a surgical cap disposable ( for surgeons ) ( details in rc ) piece 872 s86.b surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) piece 873 449 surgical spirit ip ( 100 ml ) 100ml opaque white bottle with inner cap 874 252 surgical spirit ip ( 500 ml ) 500 ml opaque white bottle with inner cap 875 s31 suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) each pcs. 876 s32 suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) each pcs. 877 s33 suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) each pcs. 878 s34 suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) each pcs. 879 s35 suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) each pcs. 880 s36 suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) each pcs. 881 s37 suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) each pcs. 882 s38 suture needles curved and cutting size 1 5 ( details in rc ) each pcs. 883 s28 syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 884 s26 syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 885 s29 syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 886 s27 syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 887 739 tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) 10 x 10 capsule 888 157 tamoxifen tab ip 10 mg each pcs. 889 576 tamsulosin hcl tablets / capsule 0.4 mg each pcs. 890 556 telmisartan tablets ip 40 mg 10x10 tablets 891 729 temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) strip of 5 cap / bottele of 5 cap 892 s81 temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm each pcs. 893 682 tenaligliptin tablet ip 20mg 10x10 tablet blister / alu alu pack 894 760 terbinafine cream 1%w / w ( 10 gm tube ) 10 gm tube 895 721 terbinafine hydrochloride tablet 250 mg 10x10 tablets 896 619 terbutaline tablets ip 2.5 mg 10x10 tablets 897 309 tetanus immunoglobulin ip 250 iu / vial vial / ampoules 898 310 tetanus vaccine ( adsorbed ) ip 5 ml vial each pcs. 899 733 thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) each pcs. 900 374 theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 2 ml amp 25 ampoules 901 375 theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) 902 376 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 10x10 tab blister 903 629 thiamine tablets ip 100 mg 10x10 tab strip 904 15 thiopentone inj ip 0.5 g each pcs. 905 301 thyroxine sodium tablets ip 100mcg 100 tablet in a bottle 906 607 thyroxine tablets ip 50 mcg 100 tablet in a bottle or 10x10 tablet 907 484 timolol eye drops ip 0.5 o / o w / v 5 ml squeeze vial 908 430 tinidazole tab ip 300 mg ( film coated ) 10x10 tab blister 909 431 tinidazole tab ip 500 mg ( film coated ) 10x10 tab blister 910 699 tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) 10x10 tablets 911 330 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o each pcs. 912 331 tobramycin eye drops 0.3% [ 331 ] 5 ml. vial with sterilized dropper, or squeeze vial 913 332 tobramycin ophthalmic ointment usp 0.3% each pcs. 914 582 tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) 50 gm tube in unit carton 915 705 topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) each pcs. 916 471 torsemide inj 10 mg / ml each pcs. 917 259 torsemide tab 10 ip mg 10x10 tab strip / blister 918 s46 tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) each piece 919 s45 tracheostomy tube, plain all sizes ( details in rc ) each piece 920 32 tramadol cap ip 50 mg each pcs. 921 33 tramadol inj 50 mg / ml each pcs. 922 747 tranexamic acid injection ip 100mg / ml 5ml size 5ml vial / amp 923 545 tranexamic acid tablets ip 500 mg 10x6 tablet blister 924 486 travoprost eye drops ip 0.004 o / o 3 ml squeeze vial 925 570 tretenoin cream usp 0.025% 20 gm tube in unit carton 926 364 trifluperazine tab ip 5 mg coated 10x10 tab strip / blister 927 162 trihexyphenidyl hcl tab ip 2 mg 10x10 tab blister 928 241 tropicamide eye drop ip 1o / o 5 ml. vial with sterilized dropper, or squeeze vial 929 s97 t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) each pcs. 930 s93 umbilical catheter for new born, all sizes ( details in rc ) each piece 931 s94 umbilical cord clamp ( details in rc ) each piece 932 s107 urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) each piece 933 s108 urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) each piece 934 s92 urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) each piece 935 s40 urine collecting bag, disposable 2000 ml ( details in rc ) unit 936 557 urokinase injection 5 lac unit ( lyophilized ) vial 937 597 ursodeoxycholic acid tablets ip 300 mg each pcs. 938 s109 vaccum suction set, 2.5 meter length ( detail in rc ) each piece 939 318 valethamate bromide inj 8mg / ml each pcs. 940 722 valganciclovir tablet 450 mg 10x10 tablets 941 524 vancomycin for intravenous infusion ip 1 gm vial 942 523 vancomycin for intravenous infusion ip 500 mg each pcs. 943 s115 vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 944 s111 vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) each pcs. 945 s112 vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 946 s116 vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 947 s113 vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 948 s117 vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 949 s114 vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 950 s118 vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 951 242 vdrl antigen ( with + ve and ve control ) / rpr slide kit 100 test kits 952 419 vecuronium bromide for injection 4mg ( freeze dried ) each pcs. 953 211 verapamil tab ip 40 mg film coated 10x10 tab strip 954 158 vinblastine inj ip 10mg / 10ml vial 955 159 vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) vial / ampoules 956 409 vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu 100 ml bottle and spoon with marking 1 ml / 2ml in unit carton 957 395 vitamin b complex inj nfi 10 ml vial 958 397 vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) 10x10 tab strip / blister 959 676 vitamin d3 oral solution 60000 iu 5ml glass bottle in unit carton 960 795 vitamin e capsule 400 mg 10x10 tablets 961 180 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 1ml amp ( ambercolor ) 25 amp 962 644 vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) each pcs. 963 720 voriconazole injection 200mg / vial vial 964 546 warfarin sodium. tab ip 5mg 10x10 tablets 965 404 water for inj ip 10 ml ampoule 50 ampoules 966 620 xylometazoline nasal drops ip 0.1% each pcs. 967 472 zinc sulphate dispersible tablets ip elemental zinc 10 mg 10x10 tab strip / blister 968 743 zoledronic acid injection ip 4mg vial each pcs. 969 779 zolpidem tablet 5 mg 10x10 tablets 970 amino acid drop each piece 971 amino acid inj. ( astamin ) each piece 972 aminorich drop / astymen c / amenovik each piece 973 amoxycillin and potassium clavulanate drop each piece 974 ampilox 250 ml inj. each piece 975 aquasop inj. 1000 ml 976 arichitol inj. one 977 arodesin solution one 978 augpen 150 mg ( amoxycilline + pot. clavulanate ) inj. 979 augpen 300 mg ( amoxycilline + pot. clavulanate ) inj. 1 piece 980 auto clave tape ( stera tape ) 1 piece 981 b.p. instument with mercuary 1 piece 982 b.p. instument with mercuary standing 983 b.p. instument without mercuary 984 bains circuit adult each 985 bains circuit pediatric each piece 986 betnisol inj. 02 tab strip / blister 987 biotax 125 mg ( ceftoxyn ) inj. each piece 988 cabergolin 0.25 mg tab. 5 ltr. 989 candid lotion each piece 990 citric acid 1 piece 991 dettol 100 ml each piece 992 disposable baby kit each piece 993 disposable needle no 16 11 / 2 inch each piece 994 disposable razor each piece 995 dressing drum all sizes each piece 996 drop sodabicarb each piece 997 erofer l drops 15 ml each piece 998 evion drop 999 ezithromycin 15ml sy 1000 formalin 1 ltr each piece 1001 formalin 5 ltr each piece 1002 glucometer strip each piece 1003 gluco one strip ( dr. morepen ) 1004 hand sanitizer 1005 inj. citicholin 1006 inj. hepamerz 1007 inj. nootrophil each piece 1008 inj. strocit each piece 1009 intralipid inj. 1 tin ( 400 gm ) 1010 k 90 catheter dispenser box of 100 gloves 1011 lactodex lbw with micronutrients dispenser box of 100 gloves 1012 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small dispenser box of 100 gloves 1013 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large dispenser box of 100 gloves 1014 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium 1015 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small 1016 lilan thread 40 3 x 4.5 feet 1017 lilan thread 60 each piece 1018 mackintosh each piece 1019 mucus sucker set each piece 1020 multivitamin with zinc syp. each piece 1021 multizec trop 15 ml each piece 1022 neasphine oint. 1023 needle no. 211 / 2 1024 needle order each piece 1025 neosprin eye oint. each piece 1026 netromycine 10 mg. inj. ( netromax 10 mg inj. ) 1027 nuclovate cream 15 gm 1028 oxygen double stage ragulator each 1029 pedia set 100 ml piece 1030 pepericilline + tezobactum 1.125 mg inj. each piece 1031 pressure monitoring line / high pressure extension line ( pmo line ) length 150 cm, prime volume 1.40 ml 1032 prochlorpertine tab. 1033 re breathing bag adult 1034 re breathing bag pediatric 1035 rubber face mask 0 5 1 tin ( 400 gm ) 1036 sevlon lotion 100 ml. 1037 simyl mct powder each piece 1038 star plast ( adhesive plaster ) 100 ml bottle 1039 caffeine citrate 20 mg / ml injection 2 ml vial 1040 vit. a syp. 1041 vit. c drop 1042 vit. c syp. 1 bottle 1043 vit. c tab. 1044 zinc 200 ml syp each piece 1045 zinc 60 ml / 100 ml sy. 1 bottle 1046 zincovit syp. 1047 zincula drop 1 bottle 1048 mouth airway ( all size ) 1 bottle 1049 inj. n.s.500 m.l. ( in glass bottle ) 01 tin 1050 inj. n.s.100 m.l. ( in glass bottle ) 01 bottle 1051 cidex 5 ltr 01 pcs. 1052 blanisol plus 01 pcs. 1053 alcohal based hand rub 01 pcs. 1054 surgical hand & skin disinfactent 01 pcs. 1055 antiseptic surgical hand rub 01 pcs. 1056 povidine iodine 5% & 10% 01 pcs. 1057 high level instrument disinfactent 01 pcs. 1058 multi eyzymetic instrument cleaner 01 pcs. 1059 surgical instrument rust, spot & stain remover 01 pcs. 1060 rejuventate dialysis reprocessing 01 pcs. 1061 disinfectent & decalcification of haemodialysis machine 01 pcs. 1062 d 125 disinfectent 1 ltr. 01 pcs. 1063 5 fu 500 mg 01 pcs. 1064 capcetabin 500 mg 01 pcs. 1065 carboplatin 150 mg 01 pcs. 1066 carboplatin 450 mg 01 pcs. 1067 cisplatin 10 mg 01 pcs. 1068 codon iv set 01 pcs. 1069 cyclophosphamide 500mg 01 pcs. 1070 danazole 50 mg cap. 01 pcs. 1071 docetaxel 120 mg 01 pcs. 1072 docetaxel 80 mg 01 pcs. 1073 doxorubicine 10 mg 01 pcs. 1074 doxorubicine 50 mg 01 pcs. 1075 epirubicine 50 mg 01 pcs. 1076 filgrastin 300 mg 01 pcs. 1077 inj. gemcitabin 1 gm 01 pcs. 1078 inj. gemcitabin 2 mg 01 pcs. 1079 ieucovorin 50 mg 01 pcs. 1080 tab. imatinib 400 mg 01 pcs. 1081 inj. mesna 100 mg 01 nos. 1082 inj. botrezumib 01 pcs. 1083 inj. bleomycin 01 pcs. 1084 oxaliplatin 50 mg 01 pcs. 1085 pacletaxel 260 mg 01 pcs. 1086 tamoxifen 10 mg 01 nos. 1087 zolidronic acid 4 mg 01 nos. 1088 inj. vetneuren 2 ml 01 nos. 1089 inj. vanomycin 01 nos. 1090 inj. surfactant 01 nos. 1091 human hepatitis b immunoglobulin 100 i.u. injection ( 100 i.u. / 0.5 ml ) 01 nos. 1092 three way adopter 01 nos. 1093 inj. milriuon 01 nos. 1094 inj. decarbazine ( dtic ) etc...

Indian Army - Rajasthan

33770550 procurement of drugs and pharmaceuticals products colostomy bag 55 mm , tab losartan h , tab piracetam 800 mg , vaccutainer sterile , lot g b h c 100 ml , film x ray 10 x 08 , tab divalprox sodium 250 mg , tab citrizine 5 mg , kit crp test , syp tixlix 60 ml ( cough linctus paediatric ) , tab thyroxine 75 mg , eye drop flurbiprofen sodium 0.3%, 5 ml , glucometer gluco onebg 03 , colostomy flenz , kit sgot , eye droop gatifiloxacine , tab bisoprolol 5 mg , cap hydroxyurea 500 mg , syringe dispasable 10 ml , tab leflunamide 20 mg , tab planep + torsemide , tab tolperisone 100 mg , tab clonazepam 0.5 mg , cap indomethocine 75 mg , framycetin sulphate gauze box of 10 , tab ibandronic acid 150 mg , tab osteofas 70mg , kit danguens , tab levodopa + carbidopa 125 mg , tab tiniligliptin 20 mg , disp gloves size 6 1 / 2 , tab alprazolam 0.25 mg , kit uric acid , tab zidovudine 300 mg , cover slip gm , kit alkaline phosphate , tab frusemide 40 mg , tab cough lozenges , tab betahistine ( vertin ) 16 mg , serum cholestrol , mouth ulcer gel ( dologel ) 10 ml , colostomy base plate no 50 , colostomy base plate no 70 , pulv sporalac sahet , film x ray developer for auto film processor , colostomy base plate no 1779 , tab amlodipin 2.5 mg , eye drop latanoprost + timolol, 2.5 ml , tab cudofort , iv fluid 5% dextrose 500 ml , kit cholesteral hdl , film x ray 10’’x12’’ , tab digoxin 0.25 mg , tab divalprox sodium 500 mg , tab tacrolimus 0.5 mg , tab trimetazidine 35 mg , tab oxcarbazepine 150 mg , eye drop ciprofloxacin 0.3% 5 ml , tab alendronate sod 10 mg , pulv neosporin , ecgprinter paper bpl , tab carvedilol 6.25 mg , inj iron sucrose , tab thyroxine 25 mcg , liquid glycerine , eye drop ketrolac tromethamine 0.4% , filmx ray17’’x14’’ , oint tacrolimus , tab neomarcazole 10 mg , solution ipravent rspiratroy 15 ml , tab leflunomide 10 mg , tab mefenanic acid + paracetamal , kit erba wash , tab ramipril 2.5 + hydrochlorthizide 12.5 mg , tab mefnamic acid 500 mg , tab entacapone 200 mg , tab tizanidine 2 mg + ibuprofen 400 mg , tab prednisolone 10 mg , tab donepezil 10 mg , escitalopram + clonazepam , tab clobazam 10 mg , tab vasograin , ear drop candibiotic , kit widal , eye drop prednisolone , tab piroxicam 20 mg , tab unienzyme , kit amylase , tab carbimazole 5 mg , cap hydroxy urea 500mg , tab sumatriptan 50 mg , oint benzoyl peroxide 2.5% 20 gm , tab acenocoumarol ( acitrom ) 2 mg , tab hydroxazine 25 mg ( atarax ) , eye drop winolap ( olaptadine ) , eye drop sulphacetamide 20% , tab amlodipine 10 mg , tab enalapril malete 2.5 mg , tab cilastazole 50 mg , tab bisacodyl 5 mg , tab duloxetin 20 mg , film x ray 10 x 08 , tab sexagliptin 5 mg , inj ketrolac 2ml , tab isosorbide 5 mononitrate 20 mg , tab atenolol 25 mg , tab mycofinolate sod. 500 mg , iv set , eye drop gentamycin , tab clonazepam 1 mg , eye drop andre , lot calamine , plaster elastoplast , kit serum bilirubin , tab sulphasalazine 500 mg , tab cinnarizine 25 mg , tab alpha ketonologune , eye drop timolol maleate 0.5%, 5 ml , inj amoxy + cloxacillin ( ampicolax ) , tab enalapril malete 10 mg , tab povidone iodine veginal pessary , tab dilitiazem 60 mg , disp arm pouch , kit albumin , tab indapamide 2.5 mg , bandage roller6 cm , syp sodium valporate, 100 ml , cap fluoxetine hcl 20 mg , syp potassium chloride , inj amoxycillin + clavuanic acid 1.2 gm , tab nimesulide 100 mg , tab pentoxifylline ( trental ) 400 mg , tab finofibrate 145 mg , inj enoxaparin 60 mg / 0.6 ml , tab levosulpharide , tab febuxostate 40 mg , micropore 2 box of 12 , blood group sera a, b, ab, d , cap primosa oil 500 mg , tab bromocryptin 2.5 mg , tab amitriptyllin 10 mg , tab donapezil 5 mg , tab nicorandil5 mg , tab syndopa plus 110 mg , tab thalidomide 50 mg , inh salmetrol 50 mcg + fluticasone 250 mcg , colostomy bag no 70 , colostomy bag no 50 / 60 , tab propranolol 10 mg , tab amisulperide 200 mg , tab levosulperide 25 mg , oint hydroquinone 2%, 50 gm , tab diltiazem 120 mg , tab a k t 4 , oint metronidazole + lignocaine , foleys catheter silicon 18 , counter ts 100 strip bott , tab pioglitazone 15 , uristix ( bottof 100 strip ) , liq chloroxylenol solution ( dettol ) , kit total protien , tab clonazepam 2 mg , tab zidovudine 300 mg + lamivudine 150 mg , tab gatifloxacin 200mg , tab ginkobilovas , tab5 aminosalicylic acid ( mesacol ) 400 mg , tab rivaroxaban 20 mg ( xarelto ) , tab levonorgestrel+ ethinylestradiol ( pack of 21 tab ) , tab amisulpride 50 mg , inj cefuroxim 500 mg , tab ondensetron 8 mg , tab hydrochlrothiazide 12.5 mg , tab rasagiline 0.5 mg , 3 ply face mask , tab olmisartan 40 mg + hydrochlorthizide 12.5 mg , inj vit b1, b6 & b12 ( neurobion ) , tab letrozole 2.5 mg , tab bisoprolol 2.5 mg , microscopic glass slide , foleys catheter silicon 20 , foleys catheter silicon size 22 , eye drop flogel , tab sodium valporate 300 mg cr , tab alfuzocin 10 mg , tab enalapril 5 mg , tab amitriptyline 25 mg , tab nebivolol 2.5 mg , tab finasteride 5 mg , kit electrolyte , kit aso ( aslo ) , tab methotrexate 2.5 mg , tab premipexol 0.5 mg , oint acyclovir skin , oint terbinfine , oint acyclovir ophth , tab quitapine 50 mg , tab dilitiazem 30 mg , cap minocycline 50 mg , tab gliclazide 40 mg , tab drotaverin 40 mg , inj tetanus toxid 1 ml , disp face mask , ppe kit , tab efavirenz 600 mg , inj b12 ( methylcoblamine ) , tab zolpiderm 5 mg , tab olanzapine 25 mg , tab sertaline 50 mcg , tab syndopa cr 250 mg , tab gliclazide 80 mg , tab ivermectin 12 mg , syp amoxycillin + clavulanic acid 30 ml , kit ra factor , tab cilinidipine 10mg , disp wrist cap , tab isosorbide dinitrate 10 mg , ecg printer paper50mm*20 met ca108 , tab dothipin 75 mg , inj tarmadol hcl 50 mg / ml, 1 ml , oint dinoprostone gel 0.05 mg, 30 ml , kit prothrombin time , tab ivermectin 6 mg , tab mabeverine hcl 135 mg , inj etophyllin + theophyllin ( driphyllin ) 2 ml , cap vitamin a , tab isosorbide dinitrate 10 mg , tab natural micronised progesterone 100 mg , lot savlon ( antiseptic ) , kit hiv test , tab ropinerol 2 mg , eye drop phenylephrine hcl 10% with chlorbutol 0.5% , tab desogestrel & ethinyl estradiol ( femilon ) , tab alfuzocin + dutasteride , tab baclofen 10 mg , cap tamozolamide 100 mg , povidone iodine gargle , tab pheniramine maleate 25 mg , tab chlordiazepoxide ( librium ) 10 mg , inj metronidazole for iv use 100 ml , syp combiflame ( ibuprofen + paracetamol ) 60 ml , tab acyclovir 200 mg , eye drop norfloxacin , tab solifenacin 10 mg , tab ethinyl estradiol & cyproterne ( genitt 35 ) , tab lamivudine + stavudine + nevibrine , kit creatinine test , tab doxipin 75 mg , tab ebastatin 10 mg , inj hyoscine bromide 20 mg / ml, 1 ml , tab chloroquine 500 mg , surgical gauze size 18 mtr , tab ubedicanrenone ( ranoque ) , tab ariprazole 15 mg , tab allopurinol 100 mg , tab lamotrigine 25 mg , kit bilrubin , liq peraffin 100 ml , tab sulphadoxine 500 mg & pyrimethamine 25 mg , inj progestrone 200 mg , tab acetazolamide 250 mg , urine collection bag , tab desvenlafexine er 50 mg , tab repaglinide 0.5 mg , tab cyclosporine 100 mg , desensitising mouth wash , tab trimetazidine 20 mg , tab metolazone 2.5 mg , solution salbutamol respiratroy 15 ml , tab pyridoxin 40 mg , deionised water 10 ml , tab fluoxetine 20 mg , tab nifedipine 20 mg , tab anastrazole 2.5 mg , tab thalidomide 100 mg , syp salbutamol , tab zolpidem 10 mg , kit hcv , tab medroxy progesterone 10 mg , tab lorazepam 2mg , tab ethamsylate 500 mg , liquid hydrogen peroxide , tab trihexyphenidyl hcl 2 mg , drabkins soln , tab lamotrigene 50 mg , tab lomotrigine 100 mg , tab halloperidol 5 mg , tab cilastazole 50 mg , lot desonide , inj dicyclomine hcl 20 mg , tab methyldopa 250 mg , tab cyproheptadine ( periactin ) 4 mg , inj piroxicam , tab colchicine 0.25 mg , cap doxepin 25 mg , tab mitrazepin 7.5 mg , tab lorazepam1mg , cap clofazimine 100 mg , disp test tube , tab misopriston 200 mg , solution sodium hypochlorite 10% , cap danazole 100 mg , inj ondensetron 8 mg , inj haydrocortisone sodium 100 mg , oint cipofloxacine eye , eye dropbetnesol n , tab olanzepine 5 mg , tab ropinerol 1 mg , disp surgical cap , band aid , kit ckmb , tab flunnarzine 10 mg , tab promethazine hcl 25 mg , eye drop pilocarpine nitrate 2%, 5 ml , ketostik , tab dexamethasone 0.5 mg , tab moxonidine 0.2 mg , tab glipizide 5 mg , kit occulat blood , tab ethamsylate 250 mg , tab diazepam 10mg , inj betamethasone 2 ml , tab olenzapine 10 mg , tab sporolac , disp gloves size 8 , tab lisinopril5 mg , syp nasal decongestant ( triminic ) , tab mitrazepin 15 mg , kit hbsag test , disposal intra cath20 , disposal intra cath22 , disposal intra cath 16 , tab artemether + lumefantrine , pulv polyethylene glycol , disp needle size 24 , tab resperidone 2 mg , tab diazepam 5mg , eye drop natamycin , syp antispasmodic 30 ml , micro tips 5 200 , eye drop chromal ( chromoglycate ) , kit pregnency test card , syp norgyl ( norflox + tinidazole ) , kit vdri , disposal intra cath 18 , tab glibenclimide 5 mg , tab ethambutol 200 mg , syp ibuprofen 50 ml , micro tips 500 1000 , tab prochlorperazine ( stemtil ) , tab phenobarbitone 90 mg , tab metaclopramide 10 mg , inj metoclopramide , tab phostate 667 mg , inj legnocaine 2% with adrenaline 30 ml , tab venalafaxine 37.5 mg , tab premipexol 0.25 mg , disp lancet ( pack of 100 ) , tab phenobarbitone 30 mg , eye oint itraconazole , tab verpamil ( isoptin ) 40 mg , syp m / vit drop paediatric , kit pttk , tab trifluperazin 5 mg ( eskazine ) , eye drop homatraptin , disp needle size 22 , glass ionomer cement ( restorative ) gc , syp ofloxacim+ ornidazole , syp multivitamin drop, 15 ml , blade surgical no 20 , tab dothiapin 25 mg , tab tamoxifen citrate 20 mg , tab loratidine , tab lisinopril 2.5 mg , micro tips small ( 2 200 ul ) , sol enema sodium phosphate ml 6% , inj nitroglycerine , sol hydrogen peroxide , blade surgical no 22 , tab clozapin 50 mg , tab loperamide 2 mg , inj dopamine hcl 40 mg / ml, 5 ml , inj triamicinolone acetate ( kenocort ) 10 mg , inj paracetamol , tab isotritenoin 20 mg , inj ethamsylate , tab diethylcarbamazipine 50 mg ( hetrazan ) , inj adrenaline tartrate 1 ml , inj atropine sulphate 0.6 mg, 1 ml , cell laryngescope small ( pencil cell ) , syp azithromycin 30 ml , tab sulphamethoxazole 400 mg + trimethoprim 80 mg , tab labetalol hcl 100 mg , leishman stain , inj promethazine ( phenrgan ) , inj insulin lispro 100%, 100 iu / ml...

Rajasthan Rajya Bunkar Sahkari Sangh Ltd - Rajasthan

33756361 supply of ordinary bandage ( l5cmx5m ) ordinary bandage ( 1ocmx4m ) gauze unmediated ( 120 cm.x9m ) ordinary bandage ( 10cmx4m ) gauze unmediated ( 120 cm.x9m ) parda cloth ( green ) l22cmxlmt. curtain...

Medical Health And Family Welfare - Rajasthan

33724693 supply of s mndy_durgandmedicen mndy_durgandmedicen pmosuj , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , atropine sulphate injection 0.6mg / ml , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , fentanyl citrate injection ip 2 ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , cefixime tab ip 100 mg / cefixime dispersible tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , itraconazole cap 100 mg , meropenem inj ip 500 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , piperacillin + tazobactum for injection ip 4gm+500mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , meropenem inj. ip 1gm , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , linezolid tablets ip 600 mg , linezolid inj 200mg / 100ml , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , trihexyphenidyl hcl tab ip 2 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , human albumin solution ip 20% , rh erythropoetin inj ip 2000iu , rh erythropoetin inj 4000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , tranexamic acid injection ip 100mg / ml 5ml size , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , losartan tab ip 25 mg , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , telmisartan tablets ip 40 mg , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , fusidic acid cream ip 2% , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , silver sulphadiazine cream ip 1% 50gm tube , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , multistix test strip , povidone iodine solution ip 5 % 500 ml , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , spironolactone tablets ip 50 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , hydroxyprogesterone inj ip 250mg / ml , metformin tab ip 500 mg , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , human anti d immunoglobulin injection 300mcg ( im use ) , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , tropicamide eye drop ip 1o / o , atropine sulphate ophthalmic solution usp 1% , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , carboxymethylcellulose eye drops ip 0.5% , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , imipramine tab ip 25 mg ( coated tab ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , clonazepam tablet 0.5 mg , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , aminophylline inj ip 25 mg / ml , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , cough syrup / expectorant ( 50 ) ml , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , black disinfectant fluid ( phenyl ) as per schedule o grade iii , pregabalin cap ip 75 mg , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , flurbiprofen & hydroxypropylmethyl cellulose eye drops , pilocarpine 0.5 % inj , hyaluronidase inj , tab prednisolone 40 mg , moxifloxacin+prednisolone eye drop ( bak free ) , tropicamide and phenylephrine eye drop , sodium chloride ophthalmic solutionl 5% eye drop , pilocarpine 2 % eye drop , inj.compound sodium lactate 500 ml in glass bottle , lignocaine 4% drop vial , bupivacaine hcl and epinephrine inj. 0.5 % , inj. mannitol 350 ml , balance salt solution bottle , sanatiser , ammonia bottle , disposable sterile niddle 26 g , disposable sterile niddle 23 g , keratone operation use 2.8 mm angeled bewel up , crecents operation use 2.5 mm angeled bewel up , dark black goggles , spectacles ( after ref. / with numbers ) , ofloxacin eye ointment 0.3 % , monofilament vicryl suture 5 0 [ nylon non abs ] , monofilament vicryl suture 6 0 [ nylon non abs ] , monofilament vicryl suture 8 0 [ nylon non abs ] , monofilament vicryl suture 10 0 [ nylon non abs ] , liquid hand wash ( dettol / savlon ) , low voltage halogen lamp ( for eye operating microscope ) projection lamp type 24 / 250 v , side port 15 degree operation use knife , proparacaine hydrochloride opthalmic solution 0.5 % , ear buds , trypan blue dye ophthalmic solution for cataract surgery , urine sugar test strips , standard pmma intra ocular lenses ( size + 11 d to +17.5 d ) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 11 d to +17.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 18 d to + 24 d ) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 18 d to + 24 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 24.5 d to + 28.5 d ) 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, bioconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 24.5 d to + 28.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , foldable intra ocular lense with injector ( size + 11 d to +17.5 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics ( 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 11 d to +17.5 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , foldable intra ocular lense with injector ( size + 18 d to + 24 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 18 d to + 24 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 24.5 d to + 28.5 d ) 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, bioconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 24.5 d to + 28.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , disposable sterilesurgicalo tgown ( noonwoven ) , sterile noonwoven disposable eye drape , eye shield ( plastic ) , 3 piece rigid ( pamma ) iol +17 to +25 d , rapid multi enzyme cleaner 500ml , sf6 gas 30 ml for eye surgery , bacillocid extra surface and equipment disinfectant 500 ml , tropicamide 0.2 mg / ml and phenylephrine hcl 3.1 mg / ml and lidocaine hcl 10 mg / mlinjection ( 1 ml ampule intracameral injection ) , d 125 microgen fogging disinfectant 01 ltr , blood administration set blood transfusion set ( details in rc ) , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powdered, , without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 7½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper , disposable sterile surgical rubber gloves size 7 ½ inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) , infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , plaster of paris bandage 15cm x 2.7 mts / roll , plaster of paris bandage 10cm x 2.7mts , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , face mask, disposable ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , foldable intra ocular lense with injector ( details in rc ) 18 to 24 , foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 , standard pama intra ocular lenses ( details in rc ) 18 to 24 , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) , umbilical cord clamp ( details in rc ) , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 ( detail in rc ) , biodegradable biomedical plastic bags with tie string 25 ltr. capacity ( colour black / blue / green / red / yellow ) , sharp container 6 ltr. ( blue / white ) , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm...

Rajasthan University Of Health Science - Rajasthan

33718300 suppy medicine and surgical items supply medicine and surgical items , oral and topical , 2% glutarldehyde lotion , abiphyline sr 200mg , acebrofline 100 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , aceclover+ thiocolside , acetazolamide tab ip 250mg , acetylcestine600mg tab , activated charcol , acyclovir 200mg , acyclovir cream 5.5% , acyclovir eye ointment , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole suspension 10 ml , albendazole tablets ip 400 mg , alkaliser syp , allopurinol tablets ip 100 mg , alovera+vit.e cream , alpha methyl dopa250mg , alprazolam 0.25mg , alprazolam 0.50mg , aluminium chlorohydrate solution , ambroxol 75 / 90 mg , amiodarane 100mg , amiodarane 200mg , amisulphiride 50mg , amitriptyline tab ip 25mg film coated , amitryptyline 10mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , amlodipine tab ip 2.5 mg , amlodipine tab ip 5 mg , amoxy+clave 375 tab , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg + 28.5 ml / 5 ml ( 30ml bottle ) , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mgg , amphotericin b tab , ampicillin cap ip 500mg , anastrozole 1mg , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint , anticolddrop , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , antioxidant , apixapan tab 2.5 mg , aripiprazole 10mg , artemether+lumefantrine 20mgdt, 40mgdt 60mgdt , artesal seath 6f, 5f , aspirin delayed release tablet / aspirin gastroresistant tab ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , atenolol tab ip 25 mg , atenolol tab ip 50 mg , atorvastatin tablets ip 40 mg , azathioprine tab ip 50 mg , azithromycin syp , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tab ip 500 mg , beclomethasone inhalation ip 200mg / dose , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , benzocaine20%+chlorhexidine gel ( for oral ulcer ) , benzyl peroxide 2.5%gel , betahistine tab ip 16 mg , betahistine tab ip 8 mg , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , betamethasone tab ip 0.5mg , betaxolol eye drops 0.5 o / o , biotin+minerals , biotin+pantothenic acid , bisacodyl tab ip 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , blu dye , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , bromofenac .09%eye drop , buprenorphine patch 10, 20 , bupropion 250mg tab , cabergolin 50 mg , calamine lotion ip ( 50 ml ) , calcitriol capsules ip 0.25 mcg , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , calcium calictrol + zinc , calcium carbonate and vitamin d3 tablets elemental calcium 500 mg, vitamin d3 250 iu calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp , capecitabin 500mg , capecitabine 500 mg tab , carbamazapine 200mg , carboxymethylcellulose sodium lubricant eye drops 0.5.5% , carvidilol 3.125mg , cefadroxil 125mg dt , cefadroxil 250mg dt , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefpodoxime dispersible tab 50 mg , cefpodoxime+clav acid 250 tab , cefpodoxime+clav acid 500 tab , cefuroxime 500 mg tab , cefuroxime axetil tab ip 250 mg , cefuroxime+clav acid tab , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , cephalexin tablets 125 mg ( dispersible tablets ) , cepodoxime +clavunic acid , cepodoxime 100mg , cepodoxime 200mg , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , cetirizine syrup ip 5mg / 5 ml , cetirizine tab ip 10mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cevverix ( cervical canccs ) , chiken pox ( varilix / biovac v ) , chloramphenicol+dexamethasoinbe eye ointment , chlordiazepoxide tablets ip 10mg , chlorhexidine gluconate solution 5% , chlorhexidine mouthwash ip / bp 0.2 o / o , chloroquine phosphate suspension ip 50 mg / 5ml , chloroquine phosphate tab. ip 250mg ( eq to 155 mg of chloroquine base ) ( film coated ) , chlorpheniramine maleate tab ip 4mg , chlorprocaine 50mg , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , cholecalciferol granules 60, 000 iu / gm , cinnarizine tablet ip 75 mg , cinnarizine tablets ip 25 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , ciprofloxacin eye drops 0.3 o / o w / v , ciprofloxacin opthalimic ointment 0.3% , ciprofloxacin tablet ip 500 mg film coated , ciprofloxacin tablets ip 250 mg film coated , clindamycin capsule ip 300 mg , clindamycin phosphate gel usp 1 o / o , clindamycin+adaplane cream , clinidine 10 mg , clobazam 5mg , clobetasol propionate cream 0.05 o / o , clomifene citrate 50 mg , clonazepam 0.5mg , clonazepam tab ip 1 mg , clonazepam tab ip 1 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , clopidogrel tab ip 75 mg , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab 500mg , coaltar 45+ketaconazole 2% shampoo , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , coug syp dextrometharphen , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cream eberconazole , cream itraconazole 1% , cream vit e+sea butter oil , critanitone+hydrocortisone 1% cream , crotamitone lotion , cyclopentolate eye drop , danzol 50mg , deflazacort 6mg , dental gel choline salicylate+benzalkonium+lignocaine , desmide gel , desvenlafaxin 50mg , dexamethasone tab ip 0.5 mg , dha drops , diclo+para+serra , diclo+serra , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5.5% , diclofenac sod + paracetamol tablets diclofenac sod 50 mg + paracetamol 325 mg , diclofenac sodium tab ip 50 mg ( enteric coated ) , diclofenc supposter , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , dicyclomine hydrochloride and activatd dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activatd dimethicone 40mg , dicyclomine oral solution , dicyclomine tab ip 10 mg , diethylcarbamazapine tab , digoxin tab ip 0.25 mg. , diltiazem gel , diltiazem tabs ip 30 mg film coated , dinoprostone vaginal pessasary 10mg , domperidone oral drops 10mg / ml ( 10ml ) , domperidone suspension 5mg / 5ml , domperidone tab ip 10 mg , dorazolamide eye drop , doxycycline cap ip 100 mg , doxylamine plus tab , drop anticold , drop iron folic 2mg / ml , drop mefenemic acid , drop vit d , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , drotaverine tab 40 mg , dulcolex suppository , dulexitine 20 mg , duolin respules , ear drop oflox+clotrimazole+beclomethasone , enalapril maleate tab 10 mg , enalapril maleate tab ip 2.5mg , enalapril maleate tab ip 5mg , erlotinib 150mg , escitalopram tab ip 10 mg , esmoprazole tab , etizolam 0.5mg , etoricoxib 90 mg tab , etoricoxib tab ip 120mg , etoricoxib tab ip 60mg , etoricoxib+thiocolchicoside 4mg , famotidine tab ip 20 mg , famotidine tab ip 40 mg , febustate 80mg , femitral plus budesonide 200 / 400 rotacap / inhaler , femitral plus fluticasone250 / 500 rotacap / inhaler , fenofibrate capsules ip 200 mg , fentanyl patch 25, 50mg , fenticonazole cream , ferrous sulphate with folic acid tab ( paediatric ) each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , ferrous sulphate with folic acid tab.each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , flavoxate tablets 200 mg , fluconazole 200mg , fluconazole 50mg dt , fluconazole eye drops 0.3% , fluconazole tablets / capsules ip 150mg , fluoxetine cap ip 20 mg , flupenthixol 1 mg , flurbiprofen sodium ophthalmic solution usp 0.03 o / o w / v , fluromethasone+neomycin eye drop , fluticalone furoate nasal spray , fluvoxamine 50mg , folic acid tab ip 5 mg , foracort 12 mg fort respules , foracort 400 respules , formaldehyde solution ( 34.5 per. 38 per. ) , formalin tab , framycetin 1%cream , frusemide 40 +ameloride 10mg , frusemide tab ip 40 mg. , fusidic acid cream ip 2% , gabapantin 100mg , gabapantin 300mg , gabapantin 300mg+mecobalamin , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , geftinib250mg , gemcitabine for injection 200 mg , gingikobiloba , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg , glibenclamide tab ip 5 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , gliclazide tab ip 40 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) , glipizide tab ip 5mg , glucosamine+diacerin , glycerin ip , glycerin supplostery , glycopyronium 50mg rotacops , griseofulvin 250mg , gum paint ( tannic acid+cetrimide+zinc chloride ) , hmf sachet ( human milk fortifier ) , homatropine eye drop , hpmc eye ointment , hydrochlorthiazide tab ip 12.5 mg , hydrocortisone 1% cream , hydroquinone 2% cream , hydroquinone2%+tretinoin+fluticasonre oint. , hydroxychloroquine sulphate tablets 200mg , hydroxyurea 500mg cap , hydroxyzine tab ip 25 mg , hyoscine butylbromide tab 10mg , ibu+para suspension , ibuprofen and paracetamol tablets ibuprofen 400 mg+paracetamol 325 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , imatinib 400mg , imipramine 75 mg tab , indomethacine cap 25mg , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , ismn 30, 60mg , isoflurane usp , isosorbide mononitrate tabs ip 20 mg , isotretinoin 10mg , isotretinoin 20 mg , isoxsuprine tab ip 20 mg , itraconazole 200mg cap , itraconazole 400mg , itraconazole cap 100 mg , itraconazole+terbinafine , iver mectin 12 mg , ivermectin 4% cream , ivermectin 6 mg , ivermectin shampoo , ivermectin soap , ketaconazole 200mg , ketoconazole cream 2% , ketoconazole soap , kojic acid+vit.c cream , l arginine sachet , labetalol tab ip 100mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , lancets , laxative supppository , leflunomide tablets 10mg ( film coated ) , leflunomide tablets 20mg ( film coated ) , letrozole 2.5 mg , levetiracetam 500 , levodopa and carbidopa tab 100 mg and 10 mg , levofloxacin 500mg tab , levofloxacin tablets ip 250 mg , levosalbutamol+ipratropium bromide respirator solution , lignocaine gel ip 2% , lignocaine+zinc oxide+steroid gel , linezolid tablets ip 600 mg , liquid parrafin ip , lisinopril tab 2.5 mg , lisinopril tab ip 5 mg , livamisole 150mg , loperamide tab ip 2 mg , lorazepam tab , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , loteprednolol eye drop , lotion permethrin , loxicard spray , lsolyte p 10% , lulicaonazole cream 10 gm , luliconazole cream , luliconazole lotion , lycopene plus cap , medroxyprogesterone acetate tablets ip 10 mg , mefloquine tablets ip 250 mg , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin tab ip 500 mg ( film coated ) , methotrexate tab ip 2.5 mg , methyl prednisolone 8 mg , methylcobalamine 1500mg tab , methylcobalamine 500mg tab , methyldopa tab ip 250mg film coated , methylergometrine tab ip 0.125 mg , metoclopramide tab ip 10 mg , metoprolol succinate extended release tablets usp 50 mg , metoprolol tablets ip 25 mg , metronidazole and norfloxacin suspension 100 mg + 100 mg per 5ml , metronidazole tablets ip 400 mg , miconazole nitrate cream 2% , micronized progestrone orall / veginal / rectul 200mg , minoxidil 10% , misoprost 600mg , misoprostol tab 200 mcg , moisturising soap , momentasone cream , momentasone nasal spray , montelukast +fexofenadine , montelukast+levocetrizine tab , moxifloxacin eye drop , multivitamin cap , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , mupirocaine 2% cream , nabivilol , naproxen 500mg , nasal drop botroclot , neomycine ointment , neomycine powder , neomycine+bacitracin ointment , neosporin powder , neosporin+sulphacetamide oint. , nephazoline+hpmc+cpm eye drop , netamycine eye drop , nicotex patch 7 / 14 / 21 mg , nifedipine gel , nikorandil 5mg , nitrofurantoin tab ip 100mg , norethisterone tab ip 5 mg , norfloxacin tab ip 400mg film coated , ntg 2.6 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin suspension , ofloxacin tab ip 200 mg , ofloxacin+betamethasone eye drop , oint. soframycine , oint.clobetasol+salicylic acid , oint.traimciclolone , olanzapine tab ip 5 mg , olanzipine 5mg , olapatadine +ketorolac eye drop , olmesartan 25mg , olmesartan 50mg , omega 3 fatty acid , omeprazole cap ip 20 mg , omocroptine 1mg , ondansetron orally disintegrating tablets ip 4mg , opipramol 50mg , ormeloxifene 60mg , ors powder ip , pantoprazole 40mg and domperidone 30mg sr cap pantoprazole as enteric coated pellets and domperidone as sr pellets , paracetamol 625 tab , paracetamol drops ( paracetamol syrup ip ) ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracine eye drop , pazopanib 400mg , pcm suppostery , penicilin g , perindoprine , permethrin cream 1% , permethrin cream 5% , permethrin lotion 1% , permethrin soap , phenytoin 100mg , pilocarpine eye drop , pioglitazone tab ip 15 mg , podophylin 20% resin solution , povidine iodine 5% 100 ml , povidone iodine 10% / 100ml sol , povidone iodine gargle , povidone iodine ointment 5% , powder clotrimazole , powder fluconazole , powder ketaconazole , powder terbinafine , ppd 5 tu , prednisolone 20 / 40 / 60mg , prednisolone acetate eye drop , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , pregabalin cap ip 75 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , progestron 100 mg , progestron 300 mg , promethazine tab ip 25 mg , propracaine eye drop , propranolol 10mg , propranolol tab ip 40 mg , protion powder 200gm , pyridoxime , ramipril 5+metoprolol 50 mg xl , ramipril tablets ip 2.5 mg , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , ranolazine 500mg , resperidone 2mg , revaroxabain 10 mg , roflimulast 500mg , rosuvastatin 10mg , rosuvastatin 20mg , rosuvastatin 40mg , salbutamol inhaler , salbutamol nebulizer sol. 5mg / .ml , salbutamol syrup ip 2mg / 5ml , salbutamol tablet ip 4 mg , salicylic acid 12% cream , salicylic acid 17.3%+lactic acid 17.3% cream , salicylic acid 3% cream , salicylic acid 6% cream , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , seerrratiopeptidase 20mg tab , serratiopeptidase 10mg tab , sertaconazole cream 1% , sertraline tab 50 mg , shampoo ketaconazole+zpto , sildinafil 20 mg tab , silversulphadiazine cream , sitagliptin , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , sodium valporate 500mg , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet 200 mg ( enteric coated ) , solution minoxidil 2% , solution minoxidil 5% , sorafenib200mg , spironolactone 50 mg tab , sunscreen lotion , surgical spirit 100ml , syp ambroxol+terbutaline+levosalbutamol , syp artemether+lumefantrine , syp azithromycin 100mg , syp cefixime 50mg , syp cepodoxime 100mg , syp cepodoxime 50mg / ml , syp cpm+dextro+phenylephrine , syp diclomine + pcm , syp digoxin , syp erythromycin 125mg / 5ml , syp levosalbutamol 1mg / sml , syp mct oil ( mediw chain triglycenide ) , syp mefenamic acid 100mg / 5ml , syp mefenamic acid+pcm , syp mom plus , syp nevirapin , syp ofloxacin , syp ofloxacin oz , syp phenobarbitone 20mg / 500ml , syp promethazine+pcm , syp sucralfate , tacrolimus 0.03%cream , tacrolimus 0.1% cream , tacrolimus lotion 0.1% , tamoxifen 10mg , tamsulosin hcl tablets 0.4 mg , telmisartan tablets ip 40 mg , temozolovide 100mg , teneligliptin 20mg , tenozolomide 200mg , terbinafine 250mg , terbinafine 500mg , terbinafine cream 1 % , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline ip 77 mg ) , thiamine 100mg , thiocolchicodide 4mg , thiocolciside 8 mg , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , timolol eye drop 0.5% , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , tiotropium 9 / 18 mg rotacaps , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycine eye ointment 0.3% , tofisopam 50mg , tooth gel sodium monoflurophosphate+pottasium nitrate , torsemide tab 10 mg , tramadol cap 50 mg , tramadol+pcm , tranexamic acid tablets 500 mg , travoprost eye drop , tretinoin .025%% cream , triamcinololone acetomide oral paste , triamcinololone acetonide 10mg tab , triamcinololone acetonide 40mg tab , trichloroacetic acid 30% , trihexiphenidyl 2mg , tropica plus eye drop ( tropicamide+phenerimine ) , trypan blue soluation .06% , trypsin + cymo trypsin tab , trypsin + rutotoside , urea lactic acid cream , ursodeoxycholic acid tablets 300 mg , vallsartan 100mg , valsartan 50mg , velcyclorver 1 gm , vericonazol , vilazodone 40mg , vit c , vit e 400 mg , vit.a 25000 iu , vit.d+e , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , white soft parrafin liquid parrafin , xylometazoline nasal drops ip 0.1% , zinc sulphate 50mg , zoledronic acid 4 mg inj. , syp caffeine citrate , glycerine suppositiry , fluconazole 200mg tab , syp sildenafil , savlon 100ml , paracain eye drop , cyclopentolate eye drop , prazoxamide eye drop , syp hydroxyzine , syp prednisolone , syp montas l , syp phenobarbitone 20mg / 500ml , syp azee 200ml , diazepam rectal , diazepam oral syp , pretermmilk formula , erythromycine drop , dha syp , fexofenadine syp , fexofenadine tablet , griseofulvin 125mg tab , syp sodium picosulphate , tab telma +amlo , tab telma h , tab atorva+fenofibrate , tab apixaben2.5mg , tab apixaben5mg , tab rivaroxaben10mg , tab febusrate 40mg , tab voglibose 0.3mg , tab voglibose 0.2mg , tab carbimazole 10mg , tab sitagliptin 50mg , tab sitagliptin+metformn , tab vidagliptin+metformin , tab escitalopram+propranolol , tab propranolol+alprazolam , tab nilazoxamide200mg , pulvis isapgol husk , tab triflurazine 1mg , tab rifaximine 400mg , tab n acetylcestine 600mg , tab acebrophyline + nac600 , tab methylprednisolone 8mg , tab methylprednisolone 16mg , tab clinidium+chlordiazepoxide , tab triflurazine+chlordiazepoxide , syp pcm , syp diclo , diclo suppository , valcyclovir tab 1gm , tab aripiprazole 5mg , tab vilazodone 20mg , tab propranolol+etizolam0.5mg , tab posaconazole 100mg , fluticasone +azilastin nasal spray , cap lycopene+mv , syp sodium picosulphate+liq.parrafin+mom , glycerine nitrate ointment , alkaline nasal wash solution , inj sodium valporate 500mg , tab thiocolchicoside 8mg , tab calcium+l carnitine , drop dicyclomine , drop mv , surgical item and others , adhesive tapee 1 / 2 ( durapore ) , 26 g cannula , abdominal belt alll sizes , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdomonal belt , absorable hemostates ( surgicel ) , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size3 / 0 1 / 2 rb 20mm, suture lenth 70mm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid / glycolid co lactide ) size2 / 0 1 / 2rb 20mm, suture lenth 70mm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbent cotton wool ip 500 gm , accepto syringe , adhesive tape 1 ( durapore ) , adhesive tape 2 ( durapore ) , adult diaper , ankle binder , arm pouch sling , b p cuff , baby diaper s, m, l , bain circuuit , bandage 10cm , bandage 15cm , bandaid , barbur thred , bed pan , biopsy container 1 kg , biopsy container 1 / 2 kg, 1 kg , bipap mask , bipap tubing / hose pipe , black google , blood administration set blood transfusion set ( details in rc ) , blood sugar glucometer withstrip ( sd code free ) , blood sugar strip ( 64765 ) free style optium h , blue dye , bone wax sterilised , bongic , bougie singal use , breast pump , buprenophine patch 10mg , buprenophine patch 5mg , c arm cover , cannula fixer , catheter for urinary drainage size 8 to 16 , cautry plate , cental line double lumen , central linetriple lumen , central line single lumen , chest tube with trachor , ciling drape , clavical brace s, m, l , clear sole inj ( rl glass bottle ) , clostomy bag / ileostomy bag , combined spinal epidural kit , comet spinal needle no. 18 / 16 , condom catheter , corrugated drainage sheet all sizes ( details in rc ) , corrugated rubber drain ( crd ) , cp geel , crepe bandage 2 , crepe bandage 4 , crepe bandage 6 , cresant eye blade , cutting burr , cvp manometer , delivery safety aprin , derma film , diagnostic sticks for urine sugar , diamond burr 0 , diamond burr 2 , diamond burr 4 , diamond burr 6 , diamond burr 8 , digital thermameter , dispo needle 16 , dispo needle 18 , dispo needle 22 , dispo needle no. 24 , dispo needle no. 26 1 / 2 , dispo razor blade , disposable o drape , disposable u drape , disposable aprin , disposable cautry plates , disposable cpap circuits , disposable drepping , disposable gown , disposable sheet , disposable sterile surgical rubber gloves size 6.5 inches ( details in rc ) , disposable sterile surgical rubber gloves size 7 inches ( details in rc ) , disposable sterile surgical rubber gloves size 7.5 inches ( details in rc ) , disposable sterile surgical rubber gloves size 8 inches ( details in rc ) , disposable syringes 1 ml , disposable syringes 10 ml , disposable syringes 2 ml , disposable syringes 20 ml , disposable syringes 5 ml , dispovan 50ml romsons , dj stent with guide wire , double lumen octopus with 2 binectons&clamps , durapore 1 , dyanoplast 4 ( inch ) , ecg electrode new born baby , ecg electrods , eliostomy beg , endo gi stappler with cartridge , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, plain size 2.5 ( details in rc ) , endotracheal tube, plain size 3 ( details in rc ) , endotracheal tube, plain size 3.5 ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 7 ( details in rc ) , endotracheal tube, plain size 7.5 ( details in rc ) , endotracheal tube, plain size 8 ( details in rc ) , endotracheal tube, plain size 8.5 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , enlarger blade 5.1 mm eye blade , epicath picc line 28fr , epidural kit , eusol solution , eye drape sheet , eye hand blade , eye incison blade , face mask, disposable ( details in rc ) , face shild , feeding tube no.6 , fibrin ( ear ) glue ( torseal ) , finger cot split , flatus tube , flexometalic et tube , flow regulator , fogarty catheter , foldable intra ocular lense with injector , foley catheter 12, 14, 16 , follops ring , g dress20 , g dress 10 , g dress 15 , g dress 20 , g dress 25 , g dress 30 , g dress 5 , gauze than 400gm , gel foam , gigli saw , glucometer optium h , green theraband , grommets of all sizes , guedel airways , halothane bp , hand sanitizer 500ml , hfnc catheters , hi flow mask , high concentration mask , high flow nasal canula all colours , hip u drape , hiv / hbsag safe delivery kit , hme filter , hot water bottle , i gel all sizes , i v canula 26 no. , i v set. , identification tag of neonatal size , incise drape iodine impregated different size , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infant feeding tube size: 1ofg, 8fg, 5fg ( details in rc ) , infrared thermometer , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , ioben 6640 , ioben betadine , iv cannula 26 g , j r circuit pedia , jelonet , johnson buds 30s , k 90 cathetor , ketone strip , knee brace , knee brase , knee cap , knee cap xl , koratome 2.1 mm eye blade , koratome 2.8 mm eye blade , lab pad , laproscopic hernia tracker , leader flex ( lorg dive ) 22g 2fr 4cm , liga clip 200 , liga clip 300 , liga clip 400 , lma all sizes , long taper diamond barr , longline axillony 45cm , longline femoral 75cm , loprescope mesh 15 x15 , makintosh rubber sheet , malecote catheter 28, 30, 32 , maro cel , mayo vein strippe , medicath 18 / 20 / 22 , metallic tracheostomy tube 30, 32, 34 , micropore , miph gun , moxi flozenie ( vigamox ) , mucus extractor sterile , nasal cannula adult , nasal dressing pack , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , nasal packing 4.5cms 400409 , nasal packing 8 cms 400402 , nasal packing 8cms airway 400405 , nasal prong , nebulization kit , nebulization mask , nebulizer machine , neck line , neonatal urine collectting bag , neonataldisposable ventilator circuits with dispos.humidifier chamber , neotamic enema , niv mask , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , ns 2 ltr glass bottle , orthoroll 50gm , oxygen hood , oxygen mask ( adult ) , oxygen mask ( pdeatric ) , oxygen recovery kit , oxygen regulator , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , pencil cautry , perfusion set ( infusion set ) with airway and needle ( paediatric use ) ( details in rc ) , perifencal catheter ( pediatrics ) l 20cm, 12fr , picc line 24, 26, 28 fr , plain sheet large , plain sheet small , plaster of paris bandage 10cm x 2.7mts , plaster of paris bandage 15cm x 2.7 mts / roll , plastic transparent sheet , plater of paris powder 50 kg , pmo line , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , pouch arm sling , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , ppe kit , premicath picc line 28fr , premicath picc line no.26 and 28 , pressure monitoring line / high pressure extension line ( details in rc ) , provox , puls oxymeter , red rubber catheter size 8.10, 12 , reservoir bag adult 1 lt. , reservoir bag adult 1.5 lt. , reservoir bag adult 2 lt. , respirpometer , romovac set 14 / 16 n0. , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves, size small ( details in rc ) , rubber shoes cover , ryles tube / nasogastric tube size: 10 ( details in rc ) , ryles tube / nasogastric tube size: 12 ( details in rc ) , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , ryles tube / nasogastric tube size:14 ( details in rc ) , s.s.g knife ( dawn blade ) , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , sanitizer 100 ml , savlon 100 ml , scalp vein set ( disposable ) size 18g ( details in rc ) , scalp vein set ( disposable ) size 20g ( details in rc ) , scalp vein set ( disposable ) size 22g ( details in rc ) , scalp vein set ( disposable ) size 24 g ( details in rc ) , shoulder immobilizer , side port eye blade , silk suture 40&30 with cutter , silling dress , skin graft knife blade ( sterile ) & handle ( details in rc ) , skin stapler , skin traction set , slow diclofenac tablets bp / diclofenac sodium extended release tablets usp 100 mg ( sustained release ) / diclofenac prolonged release tablet ip 100mg , sono jelly , spinal needle all sizes , stapes piston size 0.6mm ( teflon ) , stayfree pad , sterile catheter for urinary drainage ( foley balloon catheter ) , 2 way, size 10 ( details in rc ) , sterile catheter for urinary drainage ( foley balloon catheter ) , 2 way, size 18 ( details in rc ) , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size16 ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable infusion set with microdrip ( i.v. ) ( details in rc ) , sterile disposable perfusion set with airway and needle ( adult use ) ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , sterile gauze , sterile hypodermic syringe with needle attached, 22g, single use 10 ml ( details in rc ) , sterile hypodermic syringe with needle attached, 22g, single use 20 ml ( details in rc ) , sterile hypodermic syringe with needle attached, 24g, single use 2 ml ( details in rc ) , sterile hypodermic syringe with needle attached, 24g, single use 5 ml ( details in rc ) , sterile swab , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , sterllium 500 ml , stokinet 1.5m*8 , stokinet 1m*6cm , streptokinase injection 15 lac units , stylet , succinylcholine inj. ip 50 mg / ml ( iv use ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , suction catheter, sterile. size: f g 24 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , suction connector , suction tip , sugar strip caresons , surfactant for ( pre term babies ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , surgical mask , suti pan , suture 10 0 ( ethylene ) , suture 8 0 ( ethylene ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , swine flu mask n 95 , t piece , t tube 10 no. , t tube 12 no. , t tube 14 no. , tegaderm , three way adaptor , thumb spica , thumb support , torp porpseptoplast ( splints ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , tracheostomy tube ( portex with cuff 7, 7.5, 8 ) , tracheostomy tube, plain all sizes ( details in rc ) , trop t kit , tungeston burrr 0 to 8 , turp set , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , umblical catheter all size , underwater seal drain , universal sholder immulizer , upt kit , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , urine container sterile , urine ketone test strip , urine pot , uroflow meter , vaccume sucction tube , vaporizer machine , vein o line 10 cm , vein 0 line 150 cm , ventilator circuit , zommed grommet , octopus three way , octopus two way , dettol 200ml soap liquid handwash , leaderflex long line , bionectar , ventilator circuit pedia with heat wire , c pap bubble circuit , humedified high flow nasal cannula circuit , hhfnc optiflow red , hhfnc optiflow yellow , hhfnc optiflow blue , ecg electrode infant pedia , suction connection tube , iol foldable all powers 3000 , iol pmma , ac iol all powers , foley catheter 10 no. , cannula ptef 26no. , picc line 4fr , picc line5fr , cvc 4 fr , cvc 4.5 fr , cvc 5 fr , nasal prong pedia , nasal prong adult , nrbm pedia ( non rebreathing mask ) , oropharyngeal airway , hme filter bacterial , hme filter viral , kangaro care sling bag , soflene adhesive tape , intercostal drainage tube 24no. , intercostal drainage tube 28no. , intercostal drainage bag , cannula fixator , flexometalic et tube 6 to 7.5 cuffed , mls et tube 5, 5.5 cuffed , maggile forcap , neb t kit , close suction set , north pole et tube 6 to8.5 cuffed , south pole et tube 6 to 8.5 cuffed , proceal lma 3.0 , proceal lma4.0 , proceal lma5.0 , classic lma 1 to 5 no , pop bandage 6inch , pop bandage 4 inch , synthetic cast bandage 4 inch , synthetic cast bandage 5 inch , synthetic cast bandage 3 inch , softroll 4 inch , sofftroll 6 inch , compressed cotton rolll for plaster 4 inch , compressed cotton rolll for plaster 6 inch , iodine impregnated incise drape small around 15*10 , iodine impregnated incise drape medium around 20*20 , iodine imppregnatedincise drape large 20*30 , iodine impregnate incise drapearound 30*40 , skin traction set adults , skin traction kit kid , skin traction kit dunlop , skeletal traction kit , ssg knife blade , u drape , o drape , ls belt all size , silicon cusgioned heel , tennis elbow all size , long knee brace all size , cervical collar , linarand circular stapler with cartridge , glucometer dr morepen , glucometer dr morepen strip , glucometer caresens , glucometer caresens strip , glucometer accu sure , glucometer accu sure strip , bp instrument , laproscope warsher 10mm, 5mm ports , miph stapler , ipom mesh , nitrpous regulator , eto gas regulatorr , eto packing roll 10cm , eto packing roll 20cm , eto packing roll 30cm , amino acid bagfor parentral nutrition ( parentral nutrition ) , vein striper for varicose vein , urobag with flowmeter , forgaty catheter , enseal probe laproscopic compatable for eticon device , 24 hormonic probe ( compatable foreticon device 5mm laproscopic , debridder blades ( straight / rad 40 / rad 60 ) , coblator wands ( pro max ) , ear suction cannula , nasal suction , injectable , 5 fluorouracil inj 250mg / 5ml , acetylcystine solution usp ( injection ) 200 mg / ml , actrpid , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , adenosine 6mg / 2ml inj. , adrenaline injection ip 1mg / ml im / iv use , alamine inj , albumi 20% , albumin 10% , alpha beta artether inj , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , aminophylline inj ip 25 mg / ml , aminovain 100ml , aminovein 250 ml , amiodarone hydrochloride inj 50 mg / ml , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amphoteriricin b 50mg , ampicillin injection ip 500 mg , aq.diclofenac sodium inj ( dynapar aq ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , artracil 2.5 ml inj , arv , atropine sulphate injection ip 0.6 mg / ml ( sc / im / iv use ) , betamethasone sod phos inj ip 4mg / ml , bhcg 10000 iu inj. , bhcg 2000 iu inj. , b hcg 5000 iu inj. , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bleomycin 15 unit inj. , botroclot inj , botrophase inj. , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , butadol 1 ml inj. , caffeine citrate inj , calcium gluconate inj ip 10% ( iv use ) , carbolic acid 500ml bottle , carboplatin 150mg , carboplatin 450mg , carboplatin injection 150 mg , carboplatin injection 450 mg , carboprost tromethamine injection each ml contains carboprost 0.25 mg / ml , carpinol inj , cefipime 250mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , ceftrixone + sulbactam 1.5 gm inj. , chiken px ( varilix / biovac v ) , chlor procaine , chloroquine phosphate inj ip 40 mg / ml , ciprofloxacin injection ip 200mg / 100ml , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clonidine inj. , colistin , collin sulphate 10 miuinj vit d 3l / 6l , compound sodium lactate inj. ip , corbolic acid 500 ml bottle , crystalline penicilline , cyclophosphomide 200mg , cyclophosphomide 500mg , cytarabine inj ip 100mg / ml , dd 50 inj ( nandrololone ) ) , decarbazine 500mg , depomedrol 1ml , dexamethasone inj ip 8mg / 2ml , dexmedetomidine 100 mcg inj , dexmedetomidine 200 mcg inj , dextomid 1 ml inj , dextrose 5% 500ml ( d 5 ) , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% isotonic , diclofenac aq. , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , dicyclomine inj ip 10 mg / ml , digoxin inj ip 0.25 mg / ml , diltiazem , dobutamine inj 50mg / ml , dopamine hydrochloride inj 40 mg / ml , doxorubicin 50 mg inj. , drotaverine hydrochloride inj 40 mg / 2 ml , elderviit , enoxaparin sodium inj ip 60 mg ( lmwh ) , epirubicin 10mg , esmolol , et co2 samle lime , ethamsylate inj 250 mg / 2ml ( im / iv ) , etomidate 10 ml inj , etomidate inj 10mg , etoposide 100mg inj , fentanyl , fentanyl patch , fluconazole 100ml bottle , furosemide injection ip 10mg / ml ( im and iv use ) , gcsf 300 ug , gemcitabine 1gm , gemcitabine 200mg , gemcitabine for injection 1gm , gentamycin injection ip 80mg / 2ml ( im / iv use ) , glargin , gluteraldehyde solution 2% , glycopyrrolate + neostrogemin inj usp 0.2 mg / ml , glycopyrrolate inj usp 0.2 mg / ml , haloperidol , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis a ( havarix / biovac a ) , hepatitis b 1ml , hepatitis b immunoglotonlis 100 iu , hepatitis b ( hbig ) , heplock , human albumin inj 100ml , human anti d immunoglobulin injection 300mcg ( im use ) , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyprogesterone inj ip 250mg / ml , hyoscine inj ( buscopan ) , ifosfamide injection usp / bp 1gm , imunoglobulin 10gm , imunoglobulin 5gm , indomethacin , inj bevacizumab 100mg , insulin inj ip 40 iu / ml , ipv ( imovax / polio vac / polproket ) , iron ferric carboxymaltose 100mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , irrigation solution 500ml , iso p forte 10% , isolyte p 10% , isolyte p 500 glass bottle , isoprenaline injection ip 2mg / ml , kcl , ketamine inj ip 50 mg / ml , labetalol hcl inj ip 20mg / 4ml , lantus insulin , l asparaginase inj 10000 iu , leucovarin 15mg , levitiracetams , levo bupivacaine , levofloxacin 100ml , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% inj. , linazolid 300ml , linezolid inj 200mg / 100ml , lorazepalm , lorazepam inj 2mg , lox +adr inj , lox 4 % topical , lox spray , loxicard 2 % inj , loxicard 2% 50 ml , lsolyte p 10% , magnesium sulphate inj 50mg / ml ( 50% w / v ) , mannitol inj ip 20% w / v 100 ml , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml , mecobalamin inj 1000 mcg / ml , meropenem inj ip 500 mg , meropenem inj. ip 1gm , methotrexate 50mg , methotrexate inj ip 50 mg / 2 ml , methyl prednisolone sodium succinate for injection usp 500 mg , methyl prednisolone sodium succinate inj 80 mg , methylergometrine inj ip 0.2 mg / ml , metoclopramide inj ip 10mg / 2ml , metronidazole inj ip 500 mg / 100ml , milrinol , mitomycin 10mg , mixtard , mizolam 10 ml inj. , mmr ( tersivac ) , morphine , mucus extractor sterile ( details in rc ) , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , mvi inj , myoril ( thiocolchicoside ) , n.s 0.45% 500ml , naloxone , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , ns 100ml , ns 3 ltr , code free gluco strips , ns 3% 100ml , octreotide injection 50 mcg / ml , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin suspension 50mg / 5ml , omnidase inj , omnipaque , omniscan , ondansetron inj ip 2mg / ml , oxaliplatin 50 mg inj. , oxytocin inj ip 5 iu / ml , paclitaxel 260mg , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , palanosetron inj , pantazocin inj 30mg / ml , paracetamil inj 100ml , pemetrexed 100mg , pemetrexed 500mg , penidura la , pentoprazole inj 40 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone , phenytoin injection 50mg / ml , pilocarpine inj. , piperacillin + tazobactum for injection usp 4gm+500mg , pneumococcal ( synflorix / prevnav ) , polidoconol , potassium chloride inj. 0.15 gm / ml , pralidoxime chloride injection ip 25 mg / ml , prochlorperazone 5mg , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , propofol inj ip 10 mg / ml , quinine dihydrochloride inj 300 mg / ml , r l 500 ml glass , rabies vaccine human ip 2.5 iu , ranitidine hcl injection ip 50mg / 2ml , ringer acetate inj. 500 ml ( glass bottle ) , ringer lactate 500ml ( rl ) , rituximab 100mg inj , rituximab 500mg , ropivacaine 0.75 % 20 ml , rotavirus ( rotarix / rotateg ) , sensocaine inj , sevflurane / isoflurane , sevoflurane , sildinafil inj , soda lime medical grade , sodium bicarbonate inj ip 7.5% w / v , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium valproate inj 100 mg / ml , streptokinase 15 lac unit inj , succinylcholine 50mg / ml inj , taxim 500 inj , termin 10 ml inj. , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetrahes / voluven ( starch ) , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , thiocolchicoside 4mg , torsemide , trace elements ( celecil ) , tramadol inj 50 mg / ml , trastuzumab 440mg , trenaximic acid inj. , triamcinololone acetonide 10mg inj , triamcinololone acetonide 40mg inj , typhoid ( pcv typh bar / typhim vi ) , vancomycin 250mg , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , varicella zoster ( vzig ) , vassopressin , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil2.5 mg inj , vinblastine 10mg / 10ml inj , vincristine inj1mg / ml , vitamin a 40000 / ml , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) 1mg / 0.5ml injection ( detail in rc ) , vitcofol , vitcofol c , water for inj ip , zoledronic acid 4mg inj , distill water 5 ltr , inj terlipressin , mannitol 350ml , anti snake venom , anti scorpion venom , inj penidura la 6lac u , inj hbig 200iu , aminovain inj 10% , indamethasone inj , inj nac 600 , inj lorthinine +l asparginase , inj benzathine penicilin g 2.4lac , inj rocuronium , inj ropin 0.2% , inj nalbuphine10mg , pcm inj 150mg , pcm inj30mg , inj.polidoconal , inj d 125 , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , suction catheter, sterile. size: f g 24 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , suction connector , suction tip , sugar strip caresons , surfactant for ( pre term babies ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , surgical mask , suti pan , suture 10 0 ( ethylene ) , suture 8 0 ( ethylene ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , swine flu mask n 95 , t piece , t tube 10 no. , t tube 12 no. , t tube 14 no. , tegaderm , three way adaptor , thumb spica , thumb support , torp porpseptoplast ( splints ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , tracheostomy tube ( portex with cuff 7, 7.5, 8 ) , tracheostomy tube, plain all sizes ( details in rc ) , trop t kit , tungeston burrr 0 to 8 , turp set , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , umblical catheter all size , underwater seal drain , universal sholder immulizer , upt kit , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , urine container sterile , urine ketone test strip , urine pot , uroflow meter , vaccume sucction tube , vaporizer machine , vein o line 10 cm , vein 0 line 150 cm , ventilator circuit , zommed grommet , octopus three way , octopus two way , dettol 200ml soap liquid handwash , leaderflex long line , bionectar , ventilator circuit pedia with heat wire , c pap bubble circuit , humedified high flow nasal cannula circuit , hhfnc optiflow red , hhfnc optiflow yellow , hhfnc optiflow blue , ecg electrode infant pedia , suction connection tube , iol foldable all powers 3000 , iol pmma , ac iol all powers , foley catheter 10 no. , cannula ptef 26no. , picc line 4fr , picc line5fr , cvc 4 fr , cvc 4.5 fr , cvc 5 fr , nasal prong pedia , nasal prong adult , nrbm pedia ( non rebreathing mask ) , oropharyngeal airway , hme filter bacterial , hme filter viral , kangaro care sling bag , soflene adhesive tape , intercostal drainage tube 24no. , intercostal drainage tube 28no. , intercostal drainage bag , cannula fixator , flexometalic et tube 6 to 7.5 cuffed , mls et tube 5, 5.5 cuffed , maggile forcap , neb t kit , close suction set , north pole et tube 6 to8.5 cuffed , south pole et tube 6 to 8.5 cuffed , proceal lma 3.0 , proceal lma4.0 , proceal lma5.0 , classic lma 1 to 5 no , pop bandage 6inch , pop bandage 4 inch , synthetic cast bandage 4 inch , synthetic cast bandage 5 inch , synthetic cast bandage 3 inch , softroll 4 inch , sofftroll 6 inch , compressed cotton rolll for plaster 4 inch , compressed cotton rolll for plaster 6 inch , iodine impregnated incise drape small around 15*10 , iodine impregnated incise drape medium around 20*20 , iodine imppregnatedincise drape large 20*30 , iodine impregnate incise drapearound 30*40 , skin traction set adults , skin traction kit kid , skin traction kit dunlop , skeletal traction kit , ssg knife blade , u drape , o drape , ls belt all size , silicon cusgioned heel , tennis elbow all size , long knee brace all size , cervical collar , linarand circular stapler with cartridge , glucometer dr morepen , glucometer dr morepen strip , glucometer caresens , glucometer caresens strip , glucometer accu sure , glucometer accu sure strip , bp instrument , laproscope warsher 10mm, 5mm ports , miph stapler , ipom mesh , nitrpous regulator , eto gas regulatorr , eto packing roll 10cm , eto packing roll 20cm , eto packing roll 30cm , amino acid bagfor parentral nutrition ( parentral nutrition ) , vein striper for varicose vein , urobag with flowmeter , forgaty catheter , enseal probe laproscopic compatable for eticon device , 24 hormonic probe ( compatable foreticon device 5mm laproscopic , debridder blades ( straight / rad 40 / rad 60 ) , coblator wands ( pro max ) , ear suction cannula , nasal suction , injectable , 5 fluorouracil inj 250mg / 5ml , acetylcystine solution usp ( injection ) 200 mg / ml , actrpid , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , adenosine 6mg / 2ml inj. , adrenaline injection ip 1mg / ml im / iv use , alamine inj , albumi 20% , albumin 10% , alpha beta artether inj , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , aminophylline inj ip 25 mg / ml , aminovain 100ml , aminovein 250 ml , amiodarone hydrochloride inj 50 mg / ml , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amphoteriricin b 50mg , ampicillin injection ip 500 mg , aq.diclofenac sodium inj ( dynapar aq ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , artracil 2.5 ml inj , arv , atropine sulphate injection ip 0.6 mg / ml ( sc / im / iv use ) , betamethasone sod phos inj ip 4mg / ml , bhcg 10000 iu inj. , bhcg 2000 iu inj. , b hcg 5000 iu inj. , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bleomycin 15 unit inj. , botroclot inj , botrophase inj. , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , butadol 1 ml inj. , caffeine citrate inj , calcium gluconate inj ip 10% ( iv use ) , carbolic acid 500ml bottle , carboplatin 150mg , carboplatin 450mg , carboplatin injection 150 mg , carboplatin injection 450 mg , carboprost tromethamine injection each ml contains carboprost 0.25 mg / ml , carpinol inj , cefipime 250mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , ceftrixone + sulbactam 1.5 gm inj. , chiken px ( varilix / biovac v ) , chlor procaine , chloroquine phosphate inj ip 40 mg / ml , ciprofloxacin injection ip 200mg / 100ml , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clonidine inj. , colistin , collin sulphate 10 miuinj vit d 3l / 6l , compound sodium lactate inj. ip , corbolic acid 500 ml bottle , crystalline penicilline , cyclophosphomide 200mg , cyclophosphomide 500mg , cytarabine inj ip 100mg / ml , dd 50 inj ( nandrololone ) ) , decarbazine 500mg , depomedrol 1ml , dexamethasone inj ip 8mg / 2ml , dexmedetomidine 100 mcg inj , dexmedetomidine 200 mcg inj , dextomid 1 ml inj , dextrose 5% 500ml ( d 5 ) , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% isotonic , diclofenac aq. , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , dicyclomine inj ip 10 mg / ml , digoxin inj ip 0.25 mg / ml , diltiazem , dobutamine inj 50mg / ml , dopamine hydrochloride inj 40 mg / ml , doxorubicin 50 mg inj. , drotaverine hydrochloride inj 40 mg / 2 ml , elderviit , enoxaparin sodium inj ip 60 mg ( lmwh ) , epirubicin 10mg , esmolol , et co2 samle lime , ethamsylate inj 250 mg / 2ml ( im / iv ) , etomidate 10 ml inj , etomidate inj 10mg , etoposide 100mg inj , fentanyl , fentanyl patch , fluconazole 100ml bottle , furosemide injection ip 10mg / ml ( im and iv use ) , gcsf 300 ug , gemcitabine 1gm , gemcitabine 200mg , gemcitabine for injection 1gm , gentamycin injection ip 80mg / 2ml ( im / iv use ) , glargin , gluteraldehyde solution 2% , glycopyrrolate + neostrogemin inj usp 0.2 mg / ml , glycopyrrolate inj usp 0.2 mg / ml , haloperidol , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis a ( havarix / biovac a ) , hepatitis b 1ml , hepatitis b immunoglotonlis 100 iu , hepatitis b ( hbig ) , heplock , human albumin inj 100ml , human anti d immunoglobulin injection 300mcg ( im use ) , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyprogesterone inj ip 250mg / ml , hyoscine inj ( buscopan ) , ifosfamide injection usp / bp 1gm , imunoglobulin 10gm , imunoglobulin 5gm , indomethacin , inj bevacizumab 100mg , insulin inj ip 40 iu / ml , ipv ( imovax / polio vac / polproket ) , iron ferric carboxymaltose 100mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , irrigation solution 500ml , iso p forte 10% , isolyte p 10% , isolyte p 500 glass bottle , isoprenaline injection ip 2mg / ml , kcl , ketamine inj ip 50 mg / ml , labetalol hcl inj ip 20mg / 4ml , lantus insulin , l asparaginase inj 10000 iu , leucovarin 15mg , levitiracetams , levo bupivacaine , levofloxacin 100ml , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% inj. , linazolid 300ml , linezolid inj 200mg / 100ml , lorazepalm , lorazepam inj 2mg , lox +adr inj , lox 4 % topical , lox spray , loxicard 2 % inj , loxicard 2% 50 ml , lsolyte p 10% , magnesium sulphate inj 50mg / ml ( 50% w / v ) , mannitol inj ip 20% w / v 100 ml , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml , mecobalamin inj 1000 mcg / ml , meropenem inj ip 500 mg , meropenem inj. ip 1gm , methotrexate 50mg , methotrexate inj ip 50 mg / 2 ml , methyl prednisolone sodium succinate for injection usp 500 mg , methyl prednisolone sodium succinate inj 80 mg , methylergometrine inj ip 0.2 mg / ml , metoclopramide inj ip 10mg / 2ml , metronidazole inj ip 500 mg / 100ml , milrinol , mitomycin 10mg , mixtard , mizolam 10 ml inj. , mmr ( tersivac ) , morphine , mucus extractor sterile ( details in rc ) , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , mvi inj , myoril ( thiocolchicoside ) , n.s 0.45% 500ml , naloxone , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , ns 100ml , ns 3 ltr , ns 3% 100ml , octreotide injection 50 mcg / ml , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin suspension 50mg / 5ml , omnidase inj , omnipaque , omniscan , ondansetron inj ip 2mg / ml , oxaliplatin 50 mg inj. , oxytocin inj ip 5 iu / ml , paclitaxel 260mg , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , palanosetron inj , pantazocin inj 30mg / ml , paracetamil inj 100ml , pemetrexed 100mg , pemetrexed 500mg , penidura la , pentoprazole inj 40 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone , phenytoin injection 50mg / ml , pilocarpine inj. , piperacillin + tazobactum for injection usp 4gm+500mg , pneumococcal ( synflorix / prevnav ) , polidoconol , potassium chloride inj. 0.15 gm / ml , pralidoxime chloride injection ip 25 mg / ml , prochlorperazone 5mg , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , propofol inj ip 10 mg / ml , quinine dihydrochloride inj 300 mg / ml , r l 500 ml glass , rabies vaccine human ip 2.5 iu , ranitidine hcl injection ip 50mg / 2ml , ringer acetate inj. 500 ml ( glass bottle ) , ringer lactate 500ml ( rl ) , rituximab 100mg inj , rituximab 500mg , ropivacaine 0.75 % 20 ml , rotavirus ( rotarix / rotateg ) , sensocaine inj , sevflurane / isoflurane , sevoflurane , sildinafil inj , soda lime medical grade , sodium bicarbonate inj ip 7.5% w / v , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium valproate inj 100 mg / ml , streptokinase 15 lac unit inj , succinylcholine 50mg / ml inj , taxim 500 inj , termin 10 ml inj. , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetrahes / voluven ( starch ) , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , thiocolchicoside 4mg , torsemide , trace elements ( celecil ) , tramadol inj 50 mg / ml , trastuzumab 440mg , trenaximic acid inj. , triamcinololone acetonide 10mg inj , triamcinololone acetonide 40mg inj , typhoid ( pcv typh bar / typhim vi ) , vancomycin 250mg , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , varicella zoster ( vzig ) , vassopressin , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil2.5 mg inj , vinblastine 10mg / 10ml inj , vincristine inj1mg / ml , vitamin a 40000 / ml , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) 1mg / 0.5ml injection ( detail in rc ) , vitcofol , vitcofol c , water for inj ip , zoledronic acid 4mg inj , distill water 5 ltr , inj terlipressin , mannitol 350ml , anti snake venom , anti scorpion venom , inj penidura la 6lac u , inj hbig 200iu , aminovain inj 10% , indamethasone inj , inj nac 600 , inj lorthinine +l asparginase , inj benzathine penicilin g 2.4lac , inj rocuronium , inj ropin 0.2% , inj nalbuphine10mg , pcm inj 150mg , pcm inj30mg , inj.polidoconal , inj d 125 , diltiazen ointment , kehr t tube no.14 , amino acid ( for parentiral nutrition ) 10% , lipid ( for parentral nutrition ) 20% , albumin 20% , colostomy bag , gigli saw urire , liga clip lt 200 , lt 300 , lt 400 , suprapubic catheter with tocar kit , hemoclip , c arm cover , crape bandage 4” , stainless steel burr 1 mm , 2 mm , 3 mm , 4 mm , 5 mm , 6 mm , tungston carbide burr1 mm , 2 mm , 3 mm , 4 mm , 5 mm , 6 mm , debrider blade40, 60 , merocele nasal blade , lignocaine 10% spray , h2o2 solution , lignocaine aderniline vial , surgical shaw , surgical fibrillar , crescent knife ( eye ) , keratone knife ( eye ) , side port knife ( eye ) , ethibond no.5 , elastic adhesive bandage 6 inches , crepe bandage 2, 4, 6 inches , skin traction adhesive , skin traction dunlop’s , shoulder immobilizer , knee cap splint , thumb spice splint , stockinette 3, 6, 9 cm*15m roll , skin stapler , 1938cotton roll 4 inch. pressed cotton for plaster 50 gm , cotton roll 6 inch. pressed cotton for plaster 50 gm , sterile adhesive dressing size. pad size 5x5cm , ( primapore / g dress type ) , sterile adhesive dressing size. pad size 5x10cm , ( primapore / g dress type ) , sterile adhesive dressing size. pad size 5x15cm , ( primapore / g dress type ) , sterile adhesive dressing size. pad size 5x25cm , ( primapore / g dress type ) , iodine impregnated incised drape ( ioban type ) approx. size 15x15cm , iodine impregnated incised drape ( ioban type ) approx. size 25x25cm , iodine impregnated incised drape ( ioban type ) approx. size 30x40cm , arm pouch sling , clavicle brace , long knee brace , finger cot different sizes , tennis elbow belt , silicon heel pad , ankle brace , lumbosacral belt , hip u drape , knee o drape , circular stapler for endto end amastomois , ( various sizes ) – 28 6 , 31 6 , polypropylene mask 6*11cm , 7.5*15cm , hernia tacper ( 5mm ) with 30 tacps ( nonabsorbable ) , hernia tacper ( 5mm ) with 30 tacps ( absorbable ) , composit mask12cm circular , 15cm circular , 20cm circular , 15*10cm , 20*15cm , thoracis trocarcatheter 12f, 20f, 28f , underwater seal beg , multifire luiner cutter without blade dual firing knob, push realize button , 60cm, , 80cm , luiner cutter reload 75mm cartridage , catridage for luiner cutter knif 60mm , inj. etomidate 2mg / ml 10ml , inj. rocurinium 10mg / ml 5ml , inj dexamedetomidine 1% 1ml , inj. xylocard 2% vial 50ml ( inj ligocaine iv ) , inj ropivicane 0.75% 20ml , inj ropivicaine 0.2% 20 ml , inj ropivicaine heavy 0.75% 4ml , inj. chlorprocaine 1% spinal use 5ml , inj. nalbuphine 10mg / ml 1ml , lignocaine spray 10% 50ml , paracetamol suppositories 100mg , diclofenac suppositories50mg , inj. lignocaine heavy 5% spinal use 2ml , i.v. cannula fixator , flexometallic et tube no.6 , flexometallic et tube no.6.5 , flexometallic et tube no 7 , flexometallic et tube no 7.5 , microlaryngel surgery ( mls ) et tube no. 5 , microlaryngel surgery ( mls ) et tube no. 5.5 , flexible bougie , magill forcep , ventilator –t nebulisation kit ( neb t kit ) , north pole et tube no.6 , north pole et tube no.6.5 , north pole et tube no.7 , north pole et tube no.7.5 , south pole et tube no. 6 , south pole et tube no. 6.5 , south pole et tube no. 7 , south pole et tube no. 7.5 , laryngoscope mac intosh ( adult ) , laryngoscope magill ( pediatri ) , laryngoscope mac coy ( adult ) , arterial bp cannula ( jelco ) , etco2 sampli line , inj. palanossetron 0.25mg 5ml , spinocaine 27g ( lumber puncture needle ) , glucometer caresens , glucometer caresensstripes , inj. levobupivicaine heavy .5% , inj. phenylephrine 50mcg / ml 10ml , inj metoprolol 1mg / ml 5ml , inj mephentermine 10ml vial , plasticcountenar , code free strips , disinfectant for surface & environment chemical , requirements active ingredients : , n alkyl ( 60% c14%, 30% c16, 5% c12, 5% c18 ) , dimethyl benzyl ammonium chloride 2.37% , n alkyl ( 68% c12, 32% c14 ) , dimethyl ethylbenzyl ammonium chloride 2.37% , inert ingredients 95.26% , it should be effective against hiv, hcv, h1n1, h5n1 and certificate should be enclosed supporting the claim with contact time not more than 10min. and with proven claim efficacy either from epa or niv or nicd. , macro porus partiall absorbable mesh made up of approximately equal part ofpolypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with poresize 2.7mm &weight of 39g / m2 and containing blue orientation strips of polypropylene. 10*15cm / european ce approved , 2point fixation deviced for open hernia repairs with a curved cannula &strap positioning tip having a forward – tited handle & metric ruler. inserted length of straps should be 6 7 mm total no of straps 20 usfda / europen ce approved , triple layer ( polydioxanone / polypropylene / polydioxanone ) tissued separation mesh with orc layer ofr ventral hernia repair. 15*15cm, squar usfda / europen ce approved , 5mm absorbable mesh fixarion device for hernia repair, with 2 point secure fixation, withmultiangle firing inserted length of straps should be 6.7 mmno of straps 12 usfda / europen ce approved , softpolypropylene mesh construced of knitted filaments of extrudedpolypropylene identical in composition to that ised in polypropylene suture, the mesh should affords excellent strength, durability and surgical adaptability, with sufficient porosssity for necessaty tissued ingrowth, blue polypropylene monofilaments incorporated to produce contrast striping in the mesh. size 15*15cmusfda / europen ce approved...

Medical And Health Services - Rajasthan

33713916 supply of mndy generic medicine, surgical, sutures, eye camp medicine iol bupivacaine hydochloride in dextrose lnjection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 4mlamp 2 4 bupivacaine lnj lp 0.5% 20 mlvial 3 b ketamine lnj lp 50 mg/ml l0 mlvial 4 9 lignocaine ointment 5 o/o 10 gm tube in unit carton lignocaine and adrenaline lnj lp each ml. contains lignocaine hydrochloride lp 20 mg adrenaline ip 0.01 mg 5 10 30 mlvial 6 12 lignocaine gel lp 2% 30gm tube in a unit carton 7 1_3 lignocaine lnj lp 2 o/o 30 mlvial 8 1,4 propofol lnj lp 10 mg/ml 20 ml vial / ampoule 9 15 thiopentone lnj lp 0.5 g vial 10 654 atropine sulphate lnjection 0.6mg/ml lmlamp 25 ampoules 11 19 diclofenac sodium lnj lp 25 mg/ ml (lm/lv use) 3 ml amp 12 20 diclofenac gastro resistant tablet lp 50 mg(enteric coated) 10x10 ta b strip/blister 13 2l fentanyl citrate lnjection lp 2 ml 2 mlamp 1,4 22 10x10 tab blister lbuprofen and paracetamol tablets lp lbupiofen 400 mg+paracetamol 325 mg 15 23 ibuprofen tab lp 200 rng (coated) 10x10 tab blister i6 24 ibuprofen tab lp 400 mg (coated) 10x10 tab blister .il fy ;? ffiuyry, fifuersrdr 6r qrsl i ffi/d 15 ml bottle (with dropper which should be able to screw and cap the bottle) in t7 26 paracetamol drops paediatric paracetamol oral suspension lp(each ml contains paracetamol 150mg) * /.*j ./ (ctr; 60 ml bottle (with measuring cap) paracetamolsyrup lp 125 mg/sml (detail in rc) 18 27 10x10 tab blister 19 28 paracetamoltab lp 500 mg 29 paracetamol lnj. 150 mg/ml 2 ml amp 20 21 30 pentazocine lnj lp 3omg/ml (lm/lv use) lmlamp 10x10 cap strip/blister 22 32 tramadol cap lp 50 mg 23 33 tramadol lnj 50 mg/ml 2 mlamp 10x10 tab strip 24 437 diclofence prolonged release tablet lp 100 mg 60 ml bottle (with measuring cap) lbuprofen oral suspension bp /usp 100 mg/ 5 ml 25 477 10x10 tab blister 26 483 i diclofenac sod + paracetamol tablets lp diclofenac sod 50 mg + paracetamol 325 mg 10x10 tab blister aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 21 492 20 gm tube in unit carton diclofenac gel: diclofenac diethylamine l.liyo, methyl salicylate 10%, linseed oil 3%, menthol5% 28 493 etoricoxib tab 10x10 tab blister 29 495 lp 120mg fentanyl citrate lnjection 50mcg/ml l0mlvial/amp 30 6s5 10x10 tab blister 31 656 naproxen tablet lp 500mg naproxen tablet 10x10 tab blister 32 657 lp 250mg etoricoxib tablet lp 90 mg 10x10 tablets 33 658 14x10 tablet aspirin tablet lp (gastro resistant) 150 mg 34 679 1ml. ampoule diclofenac sodium aqueous lnjection 75mg/ml 1ml size, lv & lm use 35 695 100 ml bottle paracetamol infusion lp 1o/owlv 100m1 size 36 696 37 34 adrenaline lnjection lp 1mg/ml lm/lv use 1ml amp(ambercolor) 35 betamethasone tab lp 0.5mg 10x10 tab blister 38 chlorpheniramine maleate tab lp 4mg 10x10 ta b strip/blister 39 37 2 ml vial (usp type i vial) 40 39 dexamethasone lnj lp 8mg/2ml dexamethasone tab lp 0.5 mg 10x10 tab strip 41, 40 vial hydrocortisone sodium succinate lnjection lp 100 mg base / vial (lm/lv use) 42 42 43 hydroxyzine tab lp 25 mg methyl prednisolone sodium succinate for lnjection usp 500 mg vial 45 45 pheniramine lnj lp 22.75mg /ml 2 mlampxrr%wr/x 10x10 rab strip/blnekfr */a ) 46 47 prednisolone tab lp 5 mg , ..a)t // tlrav.,4 47 49 promethazine lnj lp 25mg/ml 2 ml amp (amber colo$ 48 50 promethazine tab lp 25 mg 10x10 tab strip 49 418 betamethasone sod phos lnj lp 4mg/ml 1 mlampoule/vial 50 469 prednisolone tablet lp 10 mg 10x10 ta b strip/blister 51 470 prednisolone tab lp 20 mg 10x10 tab strip/blister 52 497 30 ml bottle anticold syrup each 5 mlcontains phenylephrine hydrochloride 2.5mg, chlorpheniramine maleate 1 mg, and paracetamol 125 mg 53 498 10x10 tablets cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg,phenylephrine 10 mg & paracetamol 325 mg tab 54 499 cetirizine syrup lp 5mg/5 ml 30 ml bottle with measuring 55 659 levoceitrizine tablet 5mg 10x10 tablets montelucast( 10mg) + levocetrizine tablet (5mg) 10x10 tablet bl ister/strip/al u al u pack 56 660 57 700 10x10 tablets dexamethasone tablet lp 4 mg (each u ncoated tablet contains dexamethasone lp 4 mg) 58 53 carbamazepine tab lp 200 mg 10x10 tab strip/blister 59 54 carbamazepine tab lp 100 mg 10x10 tab strip/blister 60 56 phenobarbitone tab lp 30 mg 10x10 tab strip 61 57 phenytoin lnjection bp 50mg/ml 2 ml amp(amber colour) 100 ml bottle(with measuring cap) 62 58 phenytoin oral suspension lp 2lmglml 59 phenytoin tab lp 100 mg (film coated) 10x10 tab strip 61 10x10 tab strip sodium valproate gastro resistant tablets lp 200 mg 64 65 420 phenobarbitone lnj lp 200mg/ml 1 mlampoule/vial 100 ml bottle(with measuring cap) 66 474 carbamazepine oral suspension usp 100 mg/5ml 100 ml bottle(with measuring cap) 67 479 sodium valproate oralsolution lp 200 mg/5ml 661 10x10 tab strip sodium valproate tablet(gastro resistant) lp 500mg 68 10x10 tablet/ca psule blister 69 662 clobazam tablet/capsule 5 mg 663 clobazam tablet/capsule 10 mg 10x10 tablet/capsule blister 70 10x10 tab blister 71. 664 levetiracetam tablet lp 500 mg g*p , :* 7 /lxl s d 63 t 72 66s levetiracetam oral solution/suspension 100mg/ml 100m1 lt ffip iil , /b,rl fri t,, , . . t7/ wl / .} / 73 667 gabapentine tablet/capsule 100mg 10x10 tablet/capsule blister/strip 74 668 gabapentine tablet/capsule 300mg 10x10 tablet/capsule blister/strip 75 63 acyclovir tab lp 200 mg 10x10 tab blister 76 64 acyclovir tab lp 800 mg 10x10 tab strip 77 65 10 ml bottle albendazole oral suspension lp 400 mg/10m1 78 66a albendazole tablets lp 400 mg(detail in rc) 10* 10* 1 ta blet strip/blister 79 67 amikacin lnj lp l00 mg 2 mlvial 80 68 amikacin lnj lp 500 mg 2 mlvial amoxycillin and potassium clavulanate tabs lp 500 mg + 125 mg 81 70 10x10 82 71. amoxycillin cap lp 250mg 10x10 cap strip/blister 83 72 amoxycillin cap lp 500mg 10x10 84 73 amoxycillin dispersible tablets lp 125 mg 1 0x10 tab strip azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 10x3x3 tab strip/blister(strip/blister of 3 tab) 85 78a 86 794 azithromycin tablets lp 250mg 10x3x3 tab strip/blister(strip/blister of 3 tab) 87 80a azithromycin tab lp 500 mg 1x3 tab 88 84 10x10 tab strip cefixime tab lp l00 mg/cefixime dispersible tab lp 100 mg 89 85 cefixime tab lp 200 mg 10x10 tab strip 90 86 vial cefoperazone and sulbactum for lnj (cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gmxlm/lv use) 91 87 cefotaxime lnjection lp 1 g vial 92 88 cefotaxime lnj lp 250 mg vial 93 93 ceftriaxone lnj lp 1g /vial vial 94 94 ceftriaxone lnj lp 250 mg/vial vial 95 95 ceftriaxone lnj lp 500mg/vial vial 96 96 cephalexin cap lp 250 mg 10x10 cap blister 97 97 cephalexin cap lp 500 mg 1x10 98 98 chloroquine phosphate lnj lp 40 mg/ ml 5 ml amp 99 10x10 tab strip/blister chloroquine phosphate tab. lp 250mg eq to 155 mg of chloroquine base film coated 99 100 101 ciprofloxacin lnjection lp 200m9/100m1 100 ml ffs / bfs bottle 101 702 10x10 tab blister ciprofloxacin tablets lp 250 mg film coated h r71 u)/ >z r <=r 1,61 187 atorvastatin tab lp 10mg 10x10 tab strip/blister 1,62 188 clopidogrel tab lp 75 mg 10x10 tab strip 163 189 digoxin lnj lp 0.25 mg/ml 10x10 1.64 190 digoxin tab lp 0.25 mg 10x10 tab strip 165 191, diltiazem tabs lp 30 mg film coated 10x10 tab blister 166 192 dobutamine lnj lp 50mg/ml/250mg (vial/)dobutamine lnj lp 250 me/sml(amp) 5 ml vial/amp 1,67 193 dopamine hydrochloride lnj lp 40 mg/ml 5 mlamp(amber colour) 168 194 enalapril maleate tab lp 5mg 10x10 tab strip 169 195 enalapril maleate tab lp 2.5mg 10x10 tab strip 170 197 lsosorbide dinitrate tab lp 5 mg 10x10 tab blister 177 198 lsosorbide mononitrate tabs lp 20 mg 10x10 tab strip 172 199 lisinopril tab lp 5 mg 10x10 tab strip 173 200 losartan tab lp 50 mg 10x10 tab strip 174 201 magnesium sulphate lnj. lp 500mg/ml (so%w/v) 2 ml amp 175 202 methyldopa tab lp 250mg film coated 10x10 176 203 nifedipine cap lp 5mg 10x10 cap strip 177 204 nifedipine tablets lp 10 mg (sustained release) 10x10 tab blister 178 20s nitroglycerin lnj 5 mg/ ml 5 ml amp 179 207 propranololtab lp 40 mg 10x10 ta b strip/blister 180 209 streptokinase lnjection 15 lac units lp vial 181 410 labetaloltab lp 100mg 10x10 tab blister 182 4tt labetalol hci lnj lp 20mg/4ml 4 mlampules 183 444 aspirin delayed release tablet / aspirin gastroresistant tab lp (each enteric coated tablet contains acetyl salicylic acid 75 mg) 10x14 tab strips 184 458 losartan potassium and amlodipine tablets lp (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5me) 10x10 tab strip/blister 185 459 losartan potassium and hydrochlorothiazide tablets lp(losartan potassium 50 mg, hydochlorothiazide 12.5 mg) 10x10 tab blister 186 461 amlodipine and atenolol tablet (amlodipine besilate equivalent to amlodipine 5mg,atenolol 50mg) 10x10 tab blister 187 462 atenololtab lp 25 mg 10x14 tab blister 4*9 r * s: li ,y lili r l>li i, i 188 467 losartan tab lp 25 mg 10x10 tab blister i ft 189 548 atorvastatin tablets ip 40 mg 10x10 tablets tr l,bn lfw i 190 549 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 10x10 tab strip ll , /*/ 191 550 fenofibrate capsules/ tab lp 200 mg 10 x 10 capsule 3+rr,ffip1 192 552 metoprolol tablets lp 25 mg 10x10 tablets *n# 193 553 metoprolol succinate extended release tablets lp 50 mg 10x10 tablets 194 554 noradrenaline lnjection lp 2 mg/ml 2ml vial/ ampoule 195 556 telmisartan tablets lp 40 mg 10x10 tablets 196 636 ramipriltablets lp 2.5 mg 10x10 tablets 197 650 glyceryl trinitrate tablets 2.6 mg control led release tablets 30 tab bottles 198 580 chlorhexidine mouthwash lp 0.2 o/o 50 ml bottle 199 581 dental gel choline salicylate 8.7 of o, benzalkonium chloride 0.01, o/o, lignocaine hcl2 olo (flavoured gel base) 10 gm tube 200 582 tooth gel sodium monofluorophosphate a.7 o/o and potassium nitrate 5 o/o (in flavoured base) 50 gm tube in unit carton 201, 583 gum paint containing tannic acid 2%, cetrimide 0.7yo,zinc chloride l% 15 ml squeeze vial 202 276a fusidic acid cream lp 2% 10gm tube in mono carton 203 218 liquid paraffin lp 400 ml 400 ml bottle 204 220 miconazole nitrate cream lp 2% 15gm tube in a unit carton 205 221, povidone lodine ointment 5% 15 gm 15gm tube in a unit carton 206 224 silver sulphadiazine cream lp 1% 50gm tube 50 gm tube 207 445 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1%) 10 gm tube in unit carton 208 446 gamma benzene hexachloride lotion 1%(lindane lotion usp) 100 ml bottle 209 558 betamethasone dipropionate cream lp o.05% 15gm tube in a unit carton 210 559 betamethasone lotion lp 0.05 o/o 50ml 2il s60 clindamycin phosphate gel usp 1o/o 20gm tube in mono carton 212 561 clobetasol propionate cream lp 0.05 o/o 20 gm tube 213 564 glycerin lp 100 ml 100 ml bottle 21.4 565 ketoconazole cream 2%o 15gm tube in mono carton qr* 42+ t *sz v] ffi t./ n 215 568 permethrin lotion 5% 30 ml 216 s69 permethrin cream 5% 30gm tube in a unit carton 217 570 tretenoin cream usp 0.025% 20 gm tube in unit carton 218 670 coal tar 6% & salicylic acid 3% ointment 20gm 219 671 calamine lotion lp 100m1 100 ml bottle 220 801 multistix test strip 100 strip pkt 221, 222 povidone lodine solution lp 5 % 500 ml 500 ml bottle 222 245 formaldehyde solution (34.5 per. 38 per.) 500 ml bottle 223 247 gluteraldehyde solution 2% 5 ltrs can 224 248 hydrogen peroxide solution lp 6 o/o (20 vol) 400 ml bottle 225 249 lysol (cresol with soap solution) lp (cresol 50 o/o + soap 50 o/o) 5 ltrs can 226 250 povidone lodine scrub solution / cleansing solution 7.5 o/o w/v povidone lodine (suitable for hand wash) 500 ml bottle 227 252 surgical spirit lp (500 ml) 500 ml opaque white bottle with lnner cap 228 2s3 acetazolamide tab lp 250mg 10x10 tab blister 229 254 frusemide tab lp 40 mg 10x10 tab strip 230 255 furosemide lnjection lp 10mg/ml (lm and lv use) 2 mlampoule 231, 256 hydrochlorthiazide tab lp 12.5 mg 10x10 tab strip 232 257a mannitol lnjlp 20%w/v 100 ml ffs / bfs bottle 233 258 spironolactone tab lp 25mg 10x10 tab blister 234 259 torsemide tab l0 lp mg 10x10 ta b strip/bl ister 23s 464 hydrochlorthiazide tab lp 25mg 10x10 tab strip 236 574 spironolactone tablets lp 50 mg 10x10 tablets 237 585 ciprofloxacin 0.3 o/o and dexamethasone 0.l o/o ear drops ciprofloxacin and dexamethasone otic suspension usp 5 ml. vialwith sterilized dropper,or squeeze via i 238 589 ceruminolytic drops (wax dissolving ear drops) paradichlorobenzene 2 of o, benzocaine 2.7 o/o, chlorbutol 5 olo, turpentine oil l5 o/o 10ml bottle/vial(with a seperate dropper which should be able to screw&cap the bottle)in unit carton 239 5 drotaverine hydrochloride lnj 40 mg/2 ml 2 ml amp 240 219 ointment containing lidocaine lp 3 o/o zinc oxide ip 5 o/o , hydrocortisone lp offin lpo5o/o 15gm tube in a unit carton .* y i ! 241 260a 10x10 tab blister antacitl ta blets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 242 261,4 antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 60 ml bottle (with measuring cap) 243 262 bisacodyltab lp 5 mg 10x10 tab strip 244 263 dicyclomine tab lp 10 mg 10x10 tab strip/blister 245 264 dicyclomine lnj lp 10 mg/ml 2 ml amp 246 265 dicyclomine hydrochloride oral solution lp 10mg /5ml 30 ml bottle with measuring cap 247 266 domperidone suspension lp 5mg/5ml 30 ml bottle with measuring cap 248 267 domperidone tab lp 10 mg 10x10 tab blister 249 , 268 hyoscine butylbromide lnj lp 20 mg/ ml lmlamp 250 270 metoclopramide lnj lp 10me/2ml 2 ml amp 251. 271. metoclopramide tab lp 10 mg 10x10 tab blister 252 272 omeprazole cap lp 20 mg 10x10 cap strip/blister 253 273 ondansetron lnj lp 2mg/ml 2 ml amp 254 274 ors powder lp pouches 20.5 gms 255 275 pentoprazole lnj 40 mg vial 256 276 ranitidine hcl lnjection lp 50mg/2ml 2 ml amp 257 277 ranitidine tab lp 150mg film coated 10x10 258 278 sodium phosphates enema bp each 100m1 contains sodium dihydrogen phosphate dihydrate lo o/o disodium hydrogen phosphate dodecahydrate 8 o/o 100 ml polypropylene pack 259 41.4 hyoscine butyl bromide tablets lp 10mg 10x10 tab blister 260 415 drotaverine tab lp 40 mg 10x10 tab blister 261. 439a dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 10x10 tab blister 262 478 metoclopramide hydrochloride syrup lp 5 mg/ 5ml 30 ml bottle (with a seperate dropper which should be able to screw & cap the bottle) in unit carton ffi 263 i oral drops 10mg/ ml (10m1) .domperidone l0 ml bottle (with dropper which should be able to screw and cap the bottle) in a unit carton 4t. ru s< u,, c .ya 264 591 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 10x10 tablets llxt i {lc& rr,.r:+ l f t rcj.{,rt, ./ il.tj*el tj f*,i! r.*{d i * w,:#v ! { ,,w if* t/ , . /.*. 265 592 lactic acid bacillus tab 60 million spores 10x10 tablets 65ro jfiq 266 593 lactulose solution usp/bp 10gm/15m1 or 3.35 sm/5ml 100 ml bottle(with measuring cap) q y:/ 267 595 ondansetron orally disintegrating tablets lp 4mg 10x10 tab strip 268 596 pantoprazole 40mg and domperidone 30mg sr cap lp pantoprazole as enteric coated pellets and domperidone as sr pellets 10x10 cap strip 269 597 ursodeoxycholic acid tablets lp 300 mg 10x10 tab strip/blister 270 763 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride lp 20 mg ) 10x10 tablets 271 76s probiotic sachets 1gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 1 gm each sachet 272 598 allopurinoltablets lp 100 mg 10x10 tablets 273 599 hydroxychloroquine sulphate tablets 200mg 10x10 tablets 274 279 biphasic lsophane lnsulin lnj lp (30 % soluble insulin and 70 % isophane insulin) inj. 40 lu/ml(r dna origin) 10 mlvial 275 280 carbimazole tabs lp 5 mg (film coated) 10x10 tab blister 276 281, carboprost tromethamine lnjection lp each ml contains carboprost 0.25 mg/ml l mlamp/vials 277 285 dinoprostone cream/ gel 0.5 mg dinoprostone in syringe single syringe 278 289 glimepiride tab lp 2 mg 10x10 ta b strip/blister 279 290 glimepiride tab lp lmg 10x10 tab strip/blister 280 293 hydroxyprogesterone lnj lp 250mg /ml lmlamp 281 295 metformin tab lp 500 mg 10x10 tab blister 282 296 norethisterone tab lp 5 mg 10x10 tab strip 283 297 pioglitazone tab lp 15 mg 10x10 tab blister 284 298 progesterone lnj 200 mg/2ml 2 ml amp . w^) y4va7: r j _/r * t1! ,, 285 300 lnsulin lnjection lp (soluble i nsulin/neutral lnsulin lnjection)40 lu/ml(r.dna origin) 10 mlvial ffi0wffi 286 301 thyroxine sodium tablets lp 100mcg 100 tablet in a bottle trj 1w/ 287 451, metformi n hydrochloride(sustained release tablets lp 1000 mg 10x10 tab blister x 97 288 454 metformin hcl (sustained release) and glimepiride tab metformin hcl (sustained release) 500mg,glimepiride 1mg 10x10 tab blister 289 455 metformin hydrochloride (sustained release) and glimepiride tablets lp (metformin hydrochloride(sustained release) 500 mg, glimipiride 2mg) 10x10 tab blister 290 456 glimepiride, pioglitazone and metformin hydrochloride (sustained release) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride (sustained release) 500 mg 10x10 tab blister 291. 603 gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 500 mg) 10x10 tablets 292 605 medroxyprogesterone acetate tablets lp 10 mg 10x10 tablets 293 607 thyroxine tablets lp 50 mcg 100 tablet in a bottle or 10x10 tablet 294 680 lnsulin glargine 3ml (1001u/ml) with 15 lnsulin syringes and needles/cartridge 3ml (1001u/ml)with 15 needles and 1 pen per 20 cartridges 3mlvial 295 682 tenaligliptin tablet lp 20mg 10x10 ta blet blister/alu alu pack 296 693 lnsulin glargine 10 mlvial (100 lu/ml) with 30 lnsuline syringes with needle l0 mlvial 297 303 human anti d lmmunoglobulin lnjection 300mcg (lm use) pre filled syringe/via i 298 305 human rabies lmmunoglobulin lnj 150 lu/ ml single dose vial 299 306 rabies vaccine human (cell culture) lp (lntradermal)2.5 lu 1 mlvial with 1.0 ml diluent 300 307 rabies vaccine human (cell culture) lp (lntramuscular) 2.5 lu/ dose single dose vial n*, f* * s 1, i: 301 308 snake venum anti serum lp ( lyophilized) polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.l ml of serum neutralizes 0.6 mg of cobra venum,0.45 mg of common kraite( bungaras)venum(details in rc) vial 302 309 tetanus lmmunoglobulin lp 250 lu/ vial vial/ampoules 303 310 tetanus vaccine (adsorbed) lp 5 mlvial 5 mlvial 304 408 rabies antiserum lp (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (1.m./sc use) 5 mlvial 305 311 atracurium lnj 10 mg/ml 2.5 mlamp 306 312 glycopyrrolate lnj lp 0.2 mg/ml l ml amp 307 313 midazolam lnj lp 1mg/ml 5 mlvial 308 317 succinylcholine lnj. lp 50 mg/ml (lv use) 10 mlvial 309 318 valethamate bromide lnj smg / ml l mlamp 310 610 chlorzoxazone, diclofenac sodium & paracetamol tablets (chlorzoxazone 250mg, diclofenac sodium 50mg paracetamol325 mg) 10x10 tablets 311 638 neostigmine injection i p 2.5mg/5ml 5 ml amp 3t2 241, tropicamide eye drop lp to/o 5 ml. vialwith sterilized dropper,or squeeze via i 313 320 atropine sulphate ophthalmic solution usp 1% 5 ml. vialwith sterilized dropper,or squeeze vial 314 322 ciprofloxacin eye drops lp 0.3 o/o w/v 5 ml squeeze vial 315 323 ciprofloxacin ophthalmic ointment usp o.3o/o 5 gm tube in unit carton 316 324 hydroxypropylmethyl cellulose solution 20 mg/ ml 2 ml pfs 317 330 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o/o +0.! olo 5ml vial with sterilized dropper packed in seperate polythene pack 318 331 tobramycin eye drops 0.3% [331] 5 ml. vialwith sterilized dropper,or squeeze vial 319 421, flurbiprofen sodium ophthalmic solution lp 0.03 olowlv 5 ml squeeze vial 320 423 hyaluronidase lnjection lp each vial contains hyaluronidase lp 1500 l.u. vial 32r 425 fluconazole eye drops 0.3% 5 ml. vialwith sterilized dropper,or squeeze vial 322 484 timolol eye drops lp 0.5 o/o w/v 5 ml squeeze vial 323 485 homatropine eye drops lp 2% 5 ml squeeze vial b4 r *:? t. fi, p 324 486 travoprost eye drops lp 0.004 o/o 3ml ueeze vial f ,if # [*l # flfi ,, 325 487 5 ml squeeze vial brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% rffi 10 ml squeeze vial carboxymethylcellulose eye drops i p o.s% 326 613 ;v .h 5 ml. vial with sterilized dropper,or squeeze vial eye drop moxifloxacin 0.5%wlv ophthalmic solution lp 5ml size 327 770 328 33s methylergometrine lnj lp 0.2 mg/ml lmlamp 329 336 methylergometrine tab lp 0.125 mg 10x10 tab strip 330 337 misoprostoltab lp 200 mcg 10x10 tablets l mlampoule (single unit in blister pack) 331 338 oxytocin lnj lp 5 lu/ml 332 615 mifepristone tab lp 200mg single tablet 10x10 tablet/capsule blister/strip natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron lp 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron lp 200 mg) 333 772 334 339 alprazolam tab lp 0.25 mg 10x10 ta b strip/blister 33s 340 alprazolam tab lp 0.5mg 10x10 tab strip/blister 336 341, amitriptyline tab lp 25mg film coated 10x10 tab strip 337 342 chlordiazepoxide tablets lp 10mg 10x10 tab strip 338 344 10x10 tab strip chlorpromazine tablets lp 25 mg (sugar coated) chlorpromazine tablets lp 50 mg (coated tablets) 339 345 10x10 tab strip 340 349 diazepam lnj lp 10mg/2ml (lm/lv use) 2 ml amp 341, 350 diazepam tab lp 5 mg 10x10 ta b strip/bl ister 342 351 escitalopram tab lp 10 mg 10x10 tab strip/blister 343 3s2 fluoxetine cap lp 20 mg 10x10 cap strip/blister 344 3s6 lmipramine tab lp 25 mg (coated tab) 10x10 tab blister 345 358 lithium carbonate tab lp 300 mg 10x10 tab strip 346 359 lorazepam lnj lp 2 mg/ml 2 ml amp 347 360 olanzapine tab lp 5 mg 10x10 tab strip 348 361 risperidone tab 2mg 10x10 ta b stri p/blister 34s 362 risperidone tab 1 mg 10x10 tab strip/blister 3s0 363 sertraline tab lp 50 mg 10x10 ta b stri p/blister 351 678 clonazepam tablet 0.5 mg 352 778 10x10 tablets lorazepam tablet lp 2 mg (each uncoated tablet contains lorazepam lp 2 ms) 353 365 aminophylline lnj lp 25 mg/ml 10 mlamp 354 367 2 ml amp budesonide nebulizer suspension 0.25mglml 1)* / , {rrr ..*:,..€gtltr 356 370 salbutamoltablet lp 4 mg 10x10 tab strip/blister g* 357 371 salbutamol lnhalation 100 mcg /dose 200metered dose container 358 372 salbutamol nebuliser solution bp 5 ms/ml l0 mlvial 359 374 theophylline and etofylline lnjection (anhydrous theophylline 50.6mg + etofylline 169.4 mg) 2 ml amp 360 375 theophylline a nd etofylline ta blets (theophylline lp 23mg + etofylline 77 mg) 10x10 361 432 salbutamol syrup lp 2mel 5ml 100 ml bottle(with measuring cap) 362 440 dextromethorphan hbr syrup lp 13.5mg / 5ml 30 ml. bottle 363 616 formoterol fumerate & budesonide powder for lnhalation lp 6 mcg + 200 mcg 30 capsules 364 617 budesonide powder for lnhalation 200 mcg 30 capsule (rota caps) 36s 692 cough syrup/expectorant(50) ml 50 ml bottle (with measuring cap) 366 377 compound sodium lactate lnj. lp 500 ml ffs/bfs bottle 367 3tb dextrose lnjlp 25%w/v 100 ml ffs / bfs bottle 368 379 dextrose lnj lp 10% 500 ml ffs/bfs bottle 369 380 dextrose lnj lp 5% 500 ml ffs/bfs bottle 370 381 multiple electrolytes and dextrose lnjection type i lp (electrolyte p lnjection ) 500 ml ffs/bfs bottle 37l 382 multiple electrolytes and dextrose injection type lll lp electroylte m lnjection ( l.v. ) 500 ml ffs/bfs bottle 372 383 potassium chloride lnj. 0.15 gm/ml 10 mlamp 373 384 potassium chloride oral solution u.s.p 500mg/ 5ml 200m1 bottle(amber color) 374 38s sodium chloride and dextrose lnjection lp 0.9 o/o + 5 o/o 500 ml ffs/bfs bottle 375 386 sodium chloride lnj lp 500 ml 500 ml ffs/bfs bottle 376 62l sodium chloride lnjection lp 100 ml 100 ml bottle 377 576 tamsulosin hci tablets/capsule 0.4 mg 10x10 tablet/cap strip 378 579 flavoxate tablets lp 200 mg (coated tablet) 10x10 tablets 379 788 alkylizer syrup 1.4 em/5 ml( 100 ml )(disodium hydrogen citrate) 100 ml syp 380 541. betahistine tab lp 8 mg 10x10 tablets ./4 .<44 381 542 betahistine tab lp 16 mg 10x10 rablets iti fi tvffif if 382 543 cinnarizine tablets lp 25 mg 10x10 tab blister h,b ffid$, i fp)if*, 383 544 cinnarizine tablet lp 75 mg 10x10 tab blister b ediqffil 384 387 ascorbic acid tab lp 500 mg 10x10 tab strip &k 38s 388 calcium gluconate lnj lp 10% (lv use) 10 mlamp w 386 390 ferrous sulphate with folic acid tab lp each film coated tab. containing dried ferrous sulphate lp equiv 100 mg elemental lron and folic acid lp 0.5 mg 10x10 ta b stri p/blister 387 392 folic acid tab lp 5 mg 10x10 tab blister 388 393 multivitamin drops each ml contains vit a 3000 tu, vit d3 300 tu, vit 8l 1mg, riboflavine phosphate sodium 2mg, dpanthenol 2.5mg, niacinamide l0mg, pyridoxine hcl 1mg, cyanocobalamin lmcg, lysine hcl 10mg 15 ml bottle (with dropper which should be able to screw and cap the bottle) in a unit carton 389 394 multivitamin tablets nfi formula sugar coated vit a 2500 lu vit b1 2mg vit b6 0.5mg vit c somg calcium pantothenate1mg vit d3 2001u vit b2 2 mg niacinamide 25mg folic acid o.2 mg 10x10 tab strip/blister 390 395 vitamin b complex lnj nfi 10 mlvial 391 397 vitamin b complex tablet nfi (prophylactic) 812mg b2 2mg b5 0.5mg niacinamide 25mg calcium pantothenate 1mg (with appropriate overages) 10x10 ta b strip/blister 392 441 calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 lu ) 100 ml bottle(with measuring cap) 393 448 lron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 394 472 zinc sulphate dispersible tablets tp elemental zinc l0 10x10 tab strip/blister 395 488 lron sucrose lnjection usp/bp 2ome/ml (for lv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental lron 20 mg 5 mlampoule (amber colour) 396 622 calcium with vitamin d tablets usp /ca lcium and colecalciferol tablets bp/calcium and vitamin d3 tablets lp(elemental calcium 500 mg, vitamin d3. 250 lu) (non chewable) 10x10 tablets 397 652 methyl cobalmine tablet 500mcg 10x10 tab strip/blister i fl2.^ . | / /i:t 4,z, 401 634 pregabalin cap lp 75 mg l0 x 10 capsule n. :iy;z 402 639 oseltamivir capsule lp 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) strip/blister of 10 capsule 403 640 oseltamivir capsule lp 45 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg) strip/blister of l0 capsule 404 641, oseltamivir capsule lp 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) strip/blister of 10 capsule 405 642 oseltamivir phosphate for oral suspension lp 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 75 ml bottle with measuring cap list of eye camp medicine406 fl urbiprofen & hydroxypropylmethyl cellulose eye drops 5 mlvial 407 pilocarpine 0.5 % inj 1ml 408 hyaluronidase inj 1500 iu 409 tab prednisolone 40 mg 10 tab 410 moxifloxacin+prednisolone eye drop (bak free) 5 mlvial 411. tropicamide and phenylephrine eye drop 5ml 412 sodium chloride ophthalmic solutionl 5% eye drop 5ml 413 pilocarpine 2% eye drop 5ml 414 lnj.compound sodium lactate 500 ml in glass bottle 500 ml glass bottle 4ts lignocaine 4% drop vial 30 mlvial 41.6 bupivacaine hcl and epinephrine inj.0.5 % 30 mlvial 417 lnj. mannitol 350 ml 350 ml 41.8 balance salt solution bottle 500 ml 419 sa natiser 500 ml 420 ammonia bottle 500 ml 421, disposable sterile niddle 26 g piece 422 disposable sterile niddle 23 g piece 423 keratone operation use 2.8 mm angeled bewel up piece 424 crecents operation use 2.5 mm angeled bewel up piece 425 dark black goggles piece 4t tzf , vt. , 450 sf6 gas 30 ml for eye surgery each piece ll h: 451, bacillocid extra surface and equipment disinfectant 500 ml each piece ((;r( ffi l.: r 1. ,?}{ (gr each piece yy*,,, f:)/ 452 tropicamide 0.2 mg/ml and phenylephrine hcl 3.1 mg/ml and lidocaine hcl 10 mglml injection (1 n{l ampule intracameral injection) 453 d 125 microgen fogging disinfectant 01 ltr each piece list of surgicals454 s4 u nit blood administration set blood transfusion set (details in rc) 455 s s (a) disposable sterile surgical rubber gloves size 6 % lnches o made of natural rubber latex, powdered, without tear, properly folded in a paper 456 s s (b) disposable sterile surgical rubber gloves size 5 % lnches . made of natural rubber latex, powder free (polymer /silicon coated), without tear, properly folded in a paper pair 457 s 6(a) disposable sterile surgical rubber gloves size 7 lnches . made of natural rubber latex, powdered,,without tear, properly folded in a paper pair 4s8 s 6 (b) disposable sterile surgical rubber gloves size 7 lnches r made of natural rubber latex, powder free (polymer /silicon coated), without tear, properly folded in a paper pair 459 s 7 (a) disposable sterile surgical rubber gloves sizet% lnches . made of natural rubber latex, powdered, without tear, properly folded in a paper pair 460 s 7 (b) disposable sterile surgical rubber gloves sizet % lnches . made of natural rubber latex, powder free (polymer /silicon coated), without tear, properly folded in a paper pair 461, 58.c suction catheter, sterile. size: f g 8 (details in rc) each piece 462 s8.d suction catheter, sterile. size: f g 10 (details in rc) each piece tj **f /^ )u yl 6i$tr pair t, 463 s8.e suction catheter, sterile. size: f g 12 (details in rc) each piece j illt ilffi rtl . e a+t #,, v 464 s8.f suction catheter, sterile. size: f g 14 (details in rc) each piece t#fu,.#.ll 465 s8.g suction catheter, sterile. size: f g 16 (details in rc) each piece t,lr*: ffir1a ,6^/ 466 s8.h suction catheter, sterile. size: f g 18 (details in rc) each piece 467 s8.i suction catheter, sterile. size: f g 20 (details in rc) each piece 468 59.c catheter,size 16(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 469 s9.d catheter,size 18(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 470 s10.a lnfant feeding tube size 10fg(details in rc) each piece 471. s10.b lnfant feeding tube size 8fg(details in rc) each piece 472 s10.c lnfant feeding tube size 5fg(details in rc) each piece 473 s11 perfusion set with airway and needle,(adult use) sterile disposable(details in rc) unit 474 s12 perfusion set (lnfusion set)with airway and needle (paediatric use)sterile disposable(details in rc) unit 475 s13 lnfusion set with microdrip,(1.v.)sterile disposable(details in rc) unit 476 s14 lnsulin syringe (40 units)with (fixed) 30 g needle shall conforn to ls 12227 unit 477 s15.c sterile disposable (single use) teflon/ptfe l.v. cannula with integrated 3 way stop cock.size 20 g (details in rc) each piece 478. s15.d sterile disposable (single use) teflon/ptfe l.v. cannula with integrated 3 way stop cock.size 22g (details in rc) each piece 479 sl5.e sterile disposable (single use) teflon/ ptfe l.v. cannula without port size 24g (details in rc) each piece 480 s17.a nasal oxygen set, twin bore all sizes adult (details in rc) each piece 481 s17.b nasal oxygen set, twin bore all sizes paediatrics (details in rc) each piece e* t. ri 482 s18 paper adhesive plaster 1 inch x 9.0 mts (with cutter) non woven adhesive tape u nit f( ffi ffih,)#) 483 s19 paper adhesive plaster 2 inch x 9.0 mts (with cutter) non woven adhesive tape unit 484 s20 paper adhesive plaster 3 inch x 9.0 mts (with cutter) non woven adhesive tape unit 485 s21 plaster of paris bandage t5cmx2.7 mts/roll unit 486 s22 plaster of paris bandage locm x 2.7mts unit 487 s24.b ryles tube / nasogastric tube size: 16 (details in rc) each piece 488 s24.c ryles tube / nasogastric tube size: 18 (details in rc) each piece 489 s26 syringe 2 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) unit 490 s27 syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) unit 491 s28 syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) unit 492 s30.a surgical blade sterile, size 11(details in rc) 100 blades/packet 493 s30.c surgical blade sterile, size 22(details in rc) 100 blades/packet 494 s39.b sterile disposable spinal needle for single use. 25g x31,/2 inch (details in rc) each piece 495 s40 urine collecting bag, disposable 2000 ml(details in rc) unit 496 s43.d endotracheal tube, plain size 4 (details in rc) each piece 497 s43.e endotracheal tube, plain size 4.5 (details in rc) each piece 498 s43.f endotracheal tube, plain size 5 (details in rc) each piece 499 s43.g endotracheal tube, plain size 5.5 (details in rc) each piece 500 s43.h endotracheal tube, plain size 6 (details in rc) each piece 501 s43.i endotracheal tube, plain size 5.5 (details in rc) each piece 502 s44.f endotracheal tube, cuff size 7 (details in rc) each piece s03 s44.g endotracheal tube, cuff size 7.5 (details in rc) each piece s* 4, ^5 h & sllol .15// r azls (tu: oot qfual )_4/ ** s? alpaan gu rll 7/1)crurorq3 / arnlns palpaan asn/ae (rn8tel a1ua15) ajntns ;ecrt:ng alqeqrosqv zu ezs slroj zixi o/i azts (uc az qfual urrug, alpaan bu r!f, 7/1)rruuorq3 alnlns palpaan dsn/de (rn8re:r alr:a15) arntns ;ecr8rn5 alqeqrosqv su zzs slrol zixi o/t azls (ruc gt qfual urx o, alpaan gu rll g/e)oruorq3 arntns palpaan dsn/dg (ln8rel a1ria15) arnlns leorbrn5 alqeqrosqv iu iz9 stunrns jo rsi i acard :ad (a1rqm/anlq) rtt g raureluoc dreqg ozs e4 rad (mo1 gaa/par/uaar3/an 1ql1:e;q r no;o:) futcede3 t11 97 3utt1s alt ql!/irr s8eq rrlse;d le)rpauorg a;qeper8aporg 6ts alard qles (39 ur ;re1a6) ut otrt ralaqlej saa;o1 zois 8rs 1!un (rrrlerpa6) 1sey1 uaeax6 tois lts 1!un (ttnpv)1se4 ua8axg oois 9is alard qlel (39 ur s;re1a6) duel: prol lelrlrqujn ,6s sie sano;3 00tlo xoq rasuadsr6 (39 ur s;re1a6) able 1 azr5a1ua15 uo11xa1e; jaqqnr lejnleu jo apeu sano;e uorleuruexf jaqqnu p06s vt9 sano;3 ooijo xoq rasuadsr6 (39 ur sgrela6) urnrpala azrssano;3 uorleuruexl jaqqnu r06s tts alard qlel ,z or gi (39 ur s;re1a6) sasual jelnlo ejlulvl^lvd pjepuels q88s zts alard lllel s82 o1srz (lu ur s;re1a6) lolrafu; q]!m asual jelnro er]ul alqeplol ].285 iis alard q3el ,z ol8i (39 ur slrelaq) rolcalul qtr!/v asual relnlo erlul alqeploj q18s 0rs alard (39 ur s;rela6xlu ul s;re1a6) (sasrnry io3) alqesodsr6 de3 ;ecr8rn5 q985 60s 1!un (39 ur s1re1a6)(suoa8rn5 :o1) a;qesodsrq de3 ;eor8rn5 e98s b0s alard (3y ur s;re1a6)alqesodsr6 isenl ale1 s8s l0s alard q3el [uus 90s (cu ut s;re1a6) 6 azrs jjnj aqnf leaqlerlopul !tts s0s (lu ut sl!erag) s8 azts jjnf aqnl leaqlellopul a3ard q3el qrts ,os (cu ut s1re1a6) 8 azrs gn3aqn1 leaqlejlopul alard qlel * 524 r13 1x12 foils absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1 u2 cn rb needle4omm length 90 cm r21 non absorbable surgical suture, sterilised needled black braided silk size 3/0(3/8cir reverse cutting needle 26mm, length 76 cm) 1x12 foils s26 r22 non absorbable surgical suture, sterilised needled black braided siik size 210(3/8cir reverse cutting needle 45mm, length 76 cm) 1x12 foils 527 r27 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 2/0 (3/8 cir r cutting needle 45mm length 70 cm.) 1x12 foils 528 r68 absorbable surgical sutu re(synthetic)antibacterial coated sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1 l/2circle ct round bodied 4omm,gs needle,suture length 90 cm 1x12 foils 529 r69 absorbable surgical suture(synthetic)antibacterial with sterilised needled( braided coated polyglactin/polyglycolic acid violet)size ua uz circle ct round bodied 40mm,gs needle,suture length 90 cm lx12 foils 530 r71 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1,1/2 circle reverse cutting,os 40mm, suture length 90 cm 1x12 foils 531 r74 absorbable surgical suture (synthetic)antibacteria i with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 3/o3/8 circle r cutting, ps 1, suture length 70 cm etc ...

Medical Health And Family Welfare - Rajasthan

33688505 rate contract for supply of drug injection tablet syrup capsule bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 2 bupivacaine inj ip 0.5% 3 halothane bp 4 isoflurane usp 5 ketamine inj ip 50 mg/ml 6 lignocaine ointment 5 o/o 7 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 8 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg 9 lignocaine gel ip 2% 10 lignocaine inj ip 2 o/o 11 propofol inj ip 10 mg/ml 12 thiopentone inj ip 0.5 g 13 sevoflurane 14 atropine sulphate injection 0.6mg/ml 15 liquid medical oxygen (lmo) 16 diclofenac sodium inj ip 25 mg/ ml (im/iv use) 17 diclofenac gastro resistant tablet ip 50 mg(enteric coated) 18 fentanyl citrate injection ip 2 ml 19 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 20 ibuprofen tab ip 200 mg (coated) 21 ibuprofen tab ip 400 mg (coated) 22 morphine sulphate inj ip 10mg/ml 23 paracetamol drops paediatric paracetamol oral suspension ip(each ml contains paracetamol 150mg) 24 paracetamol syrup ip 125 mg/5ml (detail in rc) 25 paracetamol tab ip 500 mg 26 paracetamol inj. 150 mg/ml 27 pentazocine inj ip 30mg/ml (im/iv use) 28 tramadol cap ip 50 mg 29 tramadol inj 50 mg/ml 30 indomethacin cap ip 25 mg 31 diclofence prolonged release tablet ip 100 mg 32 ibuprofen oral suspension bp /usp 100 mg/ 5 ml 33 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 34 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 35 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 36 etoricoxib tab ip 120mg 37 mefenamic acid tablets bp 500 mg 38 fentanyl citrate injection 50mcg/ml 39 naproxen tablet ip 500mg 40 naproxen tablet ip 250mg 41 etoricoxib tablet ip 90 mg 42 aspirin tablet ip (gastro resistant) 150 mg 43 butorphanol tartrate injection usp 1mg/ml 1ml size 44 diclofenac sodium aqueous injection 75mg/ml 1ml size, iv & im use 45 paracetamol infusion ip 1% w/v 100ml size 46 ketorolac tromethamine dispersible tablet 10 mg(each uncoated dispersible tablet contains ketorolac tromethamine 10 mg) 47 baclofen tablet ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) 48 tizanidine hydrochloride tablet ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg) 49 adrenaline injection ip 1mg/ml im/iv use 50 betamethasone tab ip 0.5mg 51 chlorpheniramine maleate tab ip 4mg 52 dexamethasone inj ip 8mg/2ml 53 dexamethasone tab ip 0.5 mg 54 hydrocortisone sodium succinate injection ip 100 mg base / vial (im/iv use) 55 hydroxyzine tab ip 25 mg 56 methyl prednisolone sodium succinate for injection usp 500 mg 57 pheniramine inj ip 22.75mg /ml 58 prednisolone tab ip 5 mg 59 promethazine syrup ip 5 mg/5ml 60 promethazine inj ip 25mg/ml 61 promethazine tab ip 25 mg 62 betamethasone sod phos inj ip 4mg/ml 63 prednisolone tablet ip 10 mg 64 prednisolone tab ip 20 mg 65 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg 66 cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg,phenylephrine 10 mg & paracetamol 325 mg tab 67 cetirizine syrup ip 5mg/5 ml 68 levoceitrizine tablet 5mg 69 montelucast(10mg) + levocetrizine tablet (5mg) 70 dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) 71 naloxone inj ip 0.4mg/ ml 72 pralidoxime chloride injection ip 25 mg/ml / 500 mg 73 acetylcystine solution usp (injection) 200 mg/ml 74 carbamazepine tab ip 200 mg 75 carbamazepine tab ip 100 mg 76 phenobarbitone tab ip 30 mg 77 phenytoin injection bp 50mg/ml 78 phenytoin oral suspension ip 25mg/ml 79 phenytoin tab ip 100 mg (film coated) 80 sodium valproate inj 100 mg/ ml 81 sodium valproate gastro resistant tablets ip 200 mg 82 phenobarbitone inj ip 200mg/ml 83 carbamazepine oral suspension usp 100 mg/5ml 84 sodium valproate oral solution ip 200 mg / 5 ml 85 sodium valproate tablet(gastro resistant) ip 500mg 86 clobazam tablet/capsule 5 mg 87 clobazam tablet/capsule 10 mg 88 levetiracetam tablet ip 500 mg 89 levetiracetam oral solution/suspension 100mg/ml 90 levetiracetam injection 500mg/5ml 91 gabapentine tablet/capsule 100mg 92 gabapentine tablet/capsule 300mg 93 lamotrigine tablet ip 50 mg (each sustained releasetablet contains lamotrigine ip 50 mg) 94 divalproex extended release tablet ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) 95 oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) 96 lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100 mg) 97 topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) 98 acyclovir oral suspension ip 400mg/5ml 99 acyclovir tab ip 200 mg 100 acyclovir tab ip 800 mg 101 albendazole oral suspension ip 400 mg/10ml 102 albendazole tablets ip 400 mg(detail in rc) 103 amikacin inj ip 100 mg 104 amikacin inj ip 500 mg 105 amoxycillin and cloxacillin cap 250 + 250 mg 106 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg 107 amoxycillin cap ip 250mg 108 amoxycillin cap ip 500mg 109 amoxycillin dispersible tablets ip 125 mg 110 amphotericin b inj ip 50 mg 111 ampicillin injection ip 500 mg 112 azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 113 azithromycin tablets ip 250mg 114 azithromycin tab ip 500 mg 115 benzathine benzylpenicillin inj ip 12 lac units 116 benzathine benzylpenicillin inj ip 6 lac units 117 cefixime tab ip 100 mg 118 cefixime tab ip 200 mg 119 cefoperazone and sulbactum for inj (cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm)(im/iv use) 120 cefotaxime injection ip 1 g 121 cefotaxime inj ip 250 mg 122 ceftazidime inj ip 1g 123 ceftazidime inj ip 250 mg 124 ceftazidime inj ip 500 mg 125 ceftriaxone inj ip 1g /vial 126 ceftriaxone inj ip 250 mg/vial 127 ceftriaxone inj ip 500mg/vial 128 cephalexin cap ip 250 mg 129 cephalexin cap ip 500 mg 130 chloroquine phosphate inj ip 40 mg/ ml 131 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 132 chloroquine phosphate suspension ip 50 mg/5ml 133 ciprofloxacin injection ip 200mg/100ml 134 ciprofloxacin tablets ip 250 mg film coated 135 ciprofloxacin tablet ip 500 mg film coated 136 clotrimazole cream ip 2% w/w 137 clotrimazole vaginal tab ip 500mg 138 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 139 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 140 diethylcarbamazine tab ip 100 mg 141 doxycycline cap ip 100 mg 142 fluconazole tablets ip 150mg 143 gentamycin injection ip 80mg/2ml (im/ iv use) 144 griseofulvin tab ip 125 mg 145 itraconazole cap 100 mg 146 meropenem inj ip 500 mg 147 metronidazole inj ip 500 mg/100ml 148 metronidazole benzoate oral suspension ip 100 mg of base/5ml 149 metronidazole tablets ip 200 mg (film coated) 150 metronidazole tablets ip 400 mg (film coated) 151 norfloxacin tab ip 400mg film coated 152 ofloxacin tab ip 200 mg 153 primaquine tab ip 2.5 mg 154 primaquine tab ip 7.5 mg 155 quinine dihydrochloride inj ip 300 mg/ml 156 quinine sulphate tablets ip 300 mg (film coated) 157 ampicillin cap ip 500mg 158 nitrofurantoin tab ip 100mg 159 cloxacillin sodium inj ip 500mg 160 cephalexin oral suspension ip (cephalexin dry syrup ip) 125mg/ 5 ml 161 ofloxacin oral suspension ip 50mg/ 5ml 162 tinidazole tab ip 300 mg (film coated) 163 tinidazole tab ip 500 mg (film coated) 164 piperacillin + tazobactum for injection ip 4gm+500mg 165 amoxycillin oral suspension ip (dry syrup) 125 mg/5ml 166 cefpodoxime dispersible tab 50 mg 167 cephalexin tablets 125 mg (dispersible tablets) 168 meropenem inj. ip 1gm 169 acyclovir intravenous infusion ip 250mg 170 acyclovir intravenous infusion ip 500mg 171 amikacin inj ip 250 mg 172 amoxicillin and potassium clavulanic ip inj 600mg 173 amoxicillin and potassium clavulanate inj ip 1.2gm 174 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg/5 ml (30ml bottle) 175 artesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o/o w/v (1ml ampoule),sodium chloride injection ip 0.9o/o w/v (5ml ampoule) 176 aztreonam injection usp 500 mg 177 cefepime injection ip 500 mg 178 cefixime oral suspension ip 25mg/ml (paediatric drops) 179 cefuroxime axetil tab ip 250 mg 180 clindamycin capsule ip 150mg 181 clindamycin capsule ip 300 mg 182 levofloxacin tablets ip 250 mg 183 linezolid tablets ip 600 mg 184 linezolid inj 200mg/100ml 185 mefloquine tablets ip 250 mg 186 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 187 ofloxacin infusion ip 200mg / 100 ml(in nacl inj) 188 vancomycin for intravenous infusion ip 500 mg 189 vancomycin for intravenous infusion ip 1 gm 190 artemether and leumefantrine tablet (80 mg and 480 mg) 191 co trimoxazole tablet ip (trimethoprim 160mg+sulphamethoxazole 800mg) 192 aztreonam injection 1gm 193 framycetin sulphate cream 1 o/o 30gm pack 194 framycetin sulphate cream 1 o/o 100 gm pack 195 artemether and leumefantrine tablet (40 mg and 240 mg) 196 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 197 piperacillin injection 2 gm + tazobactom 250mg ip 198 ceftriaxone 1 gm + tazobactum 125 mg injection 199 cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) 200 cefadroxil tablet 500 mg 201 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size 202 levofloxacin tablet ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) 203 faropenem tablet sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) 204 clindamycin phosphate injection ip 300 mg 205 imipenem + cilastatin injection 500mg/500mg ip powder for solution 206 polymixin sulphate b injection usp 5 lac i.u. 207 meropenem injection ip 250 mg 208 colistimethate injection ip 1m iu powder for solution 209 voriconazole injection 200mg/vial 210 terbinafine hydrochloride tablet 250 mg 211 valganciclovir tablet 450 mg 212 entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) 213 ganciclovir sodium injection 500mg (lyophilized powder for reconstitution) 214 azathioprine tab ip 50 mg 215 bleomycin injection ip 15mg (bleomycin sulphate injection 15 units) 216 chlorambucil tab ip 5 mg 217 cisplatin inj ip 50 mg/ 50 ml 218 cyclophosphamide inj ip 200 mg 219 cyclophosphamide inj ip 500 mg 220 cytarabine injection bp 500mg 221 danazol cap ip 50 mg 222 daunorubicin inj ip 20 mg 223 doxorubicin inj ip 50 mg/ 25 ml 224 etoposide inj ip 100 mg 225 fluorouracil inj ip 250 mg/ 5ml 226 l asparaginase inj 10000 iu 227 leucovorin calcium inj ip / calcium folinate inj ip 10 mg /ml 228 melphalan tab ip 5 mg 229 mercaptopurine tab ip 50 mg 230 methotrexate inj ip 50 mg/2 ml 231 methotrexate tab ip 2.5 mg 232 paclitaxel inj ip 260 mg 233 paclitaxel inj ip 100 mg 234 tamoxifen tab ip 10 mg 235 vinblastine inj ip 10mg/ 10ml 236 vincristine inj ip 1mg(vial)/vincristin injection usp 1mg/ml (amp) 237 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit 238 carboplatin injection ip 150 mg 239 carboplatin injection ip 450 mg 240 cisplatin inj ip 10 mg/10 ml 241 dacarbazine injection 500 mg usp/ bp 242 filgrastim injection ip (granulocyte colony stimulating factor) (sc/iv use) 300 mcg 243 gemcitabine for injection 200 mg 244 gemcitabine for injection ip 1gm 245 ifosfamide injection ip/bp/usp 1gm 246 imatinib tab ip 400mg 247 methotrexate tablets ip 10 mg 248 mitomycine injection ip 10 mg/mitomycine for injection usp 10 mg 249 oxaliplatin injection usp 50 mg 250 cyclosporin capsule usp/ip 50 mg 251 procarbazine hydrochloride capsule usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) 252 bendamustine injection 100 mg 253 capecitabine tablet ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) 254 letrozole tablet ip 2.5 mg (each film coated tablet contains letrozole ip 2.5 mg) 255 temozolomide capsule ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) 256 bortezomib injection 2mg 257 abiraterone acetate tablet ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) 258 lomustine capsule ip 40 mg (each capsule contains lomustine ip 40 mg) 259 thalidomide capsule usp 100 mg (each hard gelatin capsule contains thalidomide usp 100 mg) 260 bevacizumab injection 400 mg 261 bevacizumab injection 100 mg 262 cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) 263 gefitinib tablet ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) 264 mycophenolate mofetil capsule/tablets ip 250 mg (each capsule/tablets conatin mycophenolate mofetil ip 250 mg) 265 tacrolimus capsule ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) 266 mycophenolate sodium tablet 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) 267 bicalutamide tablet ip 50 mg (each film tablet contains bicalutamide ip 50 mg) 268 6 thioguanine tablet usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) 269 zoledronic acid injection ip 4mg vial 270 dasatinib tab 100 mg 271 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg 272 levodopa and carbidopa tab 250 mg+ 25 mg 273 trihexyphenidyl hcl tab ip 2 mg 274 bromocriptine tablets ip 2.5 mg 275 acenocoumarol tab ip/ nicoumalone tab ip 2 mg 276 deferasirox tab 100 mg 277 deferasirox tab 500 mg 278 deferiprone cap 250 mg 279 deferiprone cap 500 mg 280 desferrioxamine injection ip 500 mg / vial (for i.m. inj and i.v s.c. infusion) 281 dried human anti haemophlic fraction ip (dried factor viii fraction ip) 250 iu/ vial (iv use) 282 enoxaparin sodium inj ip 60 mg 283 ethamsylate inj 250 mg/ 2ml (im/iv) 284 heparin sodium inj ip 5000 iu/ml (im/iv use) 285 human albumin solution ip 20% 286 rh erythropoetin inj ip 10000 iu 287 rh erythropoetin inj ip 2000iu 288 rh erythropoetin inj 4000 iu 289 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. (aqueous solution) 290 polygeline 3.5% solution with electrolytes for i.v. infusion 291 factor ix concentrate (purified) ip 500 600 i.u.(human coagulation factor ix) 292 anti inhibitor coagulation complex (human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial) 293 hydroxyethyl starch (130/0.4) 6 o/o w/v with sodium chloride 0.9 o/o w/v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 294 tranexamic acid tablets ip 500 mg 295 warfarin sodium. tab ip 5mg 296 vitamin k 1 (phytomenadione) ip 1mg/0.5ml injection (detail in rc) 297 dried factor viii fraction ip (iv use) 500 iu/vial 298 dried factor viii fraction ip (iv use) 1000 iu/vial 299 recombinant coagulation factor viia 1mg 300 recombinant coagulation factor viia 2mg 301 n butyl alcohol injection 0.26mg/5ml, citric acid 2.5mg/5ml and sod. chloride solution 5 ml size 302 ethamsylate tablet 500 mg (each uncoated coated tablet contains ethamsylate 500 mg) 303 feracrylum 1% w/v sterile solution 100 ml 304 tranexamic acid injection ip 100mg/ml 5ml size 305 recombinant f ix 500 iu with diluent 306 3rd generation recombinant f viii 250 iu with diluent 307 3rd generation recombinant f viii 1000 iu with diluent 308 amiodarone tab ip 100 mg 309 amiodarone tab ip 200 mg 310 amiodarone hydrochloride inj 50 mg/ml 311 amlodipine tab ip 2.5 mg 312 amlodipine tablets ip 5 mg 313 atenolol tab ip 50 mg 314 atorvastatin tab ip 10mg 315 clopidogrel tab ip 75 mg 316 digoxin inj ip 0.25 mg/ml 317 digoxin tab ip 0.25 mg. 318 diltiazem tabs ip 30 mg film coated 319 dobutamine inj ip 50mg/ml/250mg (vial/)dobutamine inj ip 250 mg/5ml(amp) 320 dopamine hydrochloride inj ip 40 mg/ml 321 enalapril maleate tab ip 5mg 322 enalapril maleate tab ip 2.5mg 323 isosorbide dinitrate tab ip 5 mg 324 isosorbide mononitrate tabs ip 20 mg 325 lisinopril tab ip 5 mg 326 losartan tab ip 50 mg 327 magnesium sulphate inj. ip 500mg/ml (50%w/v) 328 methyldopa tab ip 250mg film coated 329 nifedipine cap ip 5mg 330 nifedipine tablets ip 10 mg (sustained release) 331 nitroglycerin inj 5 mg/ ml 332 propranolol tab ip 40 mg 333 streptokinase injection 15 lac units ip 334 verapamil tab ip 40 mg film coated 335 labetalol tab ip 100mg 336 labetalol hcl inj ip 20mg/4ml 337 aspirin delayed release tablet / aspirin gastroresistant tab ip (each enteric coated tablet contains acetyl salicylic acid 75 mg) 338 amlodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) 339 losartan potassium and amlodipine tablets ip (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) 340 losartan potassium and hydrochlorothiazide tablets ip(losartan potassium 50 mg, hydochlorothiazide 12.5 mg) 341 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg 342 amlodipine and atenolol tablet (amlodipine besilate equivalent to amlodipine 5mg,atenolol 50mg) 343 atenolol tab ip 25 mg 344 enalapril maleate tablets ip 10 mg 345 lisinopril tablets ip 10 mg 346 lisinopril tab ip 2.5 mg 347 losartan tab ip 25 mg 348 adenosine injection ip 6 mg/2ml 349 atorvastatin tablets ip 40 mg 350 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 351 fenofibrate capsules/ tab ip 200 mg 352 isoprenaline injection ip 2mg / ml 353 metoprolol tablets ip 25 mg 354 metoprolol succinate extended release tablets ip 50 mg 355 noradrenaline injection ip 2 mg/ml 356 prazosin tablets (extended release) 2.5 mg 357 telmisartan tablets ip 40 mg 358 urokinase injection 5 lac unit (lyophilized) 359 ramipril tablets ip 2.5 mg 360 glyceryl trinitrate tablets 2.6 mg controlled release tablets 361 clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) 362 sotalol hydrochloride tablet usp/bp 40mg (each film coated tablet contains sotalol hydrochloride usp/bp 40mg) 363 esmolol hydrochloride injection 10mg/ml 10ml size 364 sodium nitroprusside injection 25mg/ml 2ml size 365 carvedilol tablet 3.125 mg 366 rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) 367 rosuvastatin tablet 10 mg 368 sacubitril 24 mg and valsartan 26 mg tablet 369 chlorhexidine mouthwash ip 0.2 o/o 370 dental gel choline salicylate 8.7 o/o, benzalkonium chloride 0.01 o/o, lignocaine hcl 2 o/o (flavoured gel base) 371 tooth gel sodium monofluorophosphate 0.7 o/o and potassium nitrate 5 o/o (in flavoured base) 372 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 373 metronidazole 1% and chlorhexidine gluconade 0.25% gel 374 compound benzoic acid ointment ip benzoic acid 6 o/o + salicylic acid 3 o/o 375 acyclovir cream 5% 376 cetrimide cream ip 15 gm 377 fusidic acid cream ip 2% 378 glycerin ip 400 gm 379 liquid paraffin ip 400 ml 380 miconazole nitrate cream ip 2% 381 povidone iodine ointment 5% 15 gm 382 neomycin bacitracin and sulphacetamide powder (neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg) 383 silver sulphadiazine cream ip 1% 50gm tube 384 gentian violet topical solution usp 1o/o 385 clotrimazole mouth paint (clotrimazole 1 o/o w/v) 386 beclomethasone, neomycin and clotrimazole cream (beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 %) 387 gamma benzene hexachloride lotion 1%(lindane lotion usp) 388 betamethasone dipropionate cream ip 0.05% 389 betamethasone lotion ip 0.05 o/o 390 clindamycin phosphate gel usp 1 o/o 391 clobetasol propionate cream ip 0.05 o/o 392 glycerin ip 100 ml 393 ketoconazole cream 2% 394 permethrin lotion 5% 395 permethrin cream 5% 396 tretenoin cream usp 0.025% 397 coal tar 6% & salicylic acid 3% ointment 398 calamine lotion ip 100ml 399 powder clotrimazole 1% w/w 30 gm 400 terbinafine cream 1%w/w (10 gm tube) 401 olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size 402 oitment mupirocin ip 2% 403 anti a blood grouping serum ip(anti a monoclonal serum) 404 anti b blood grouping serum ip(anti b mono clonal serum) 405 anti d(rh) blood grouping serum ip/anti d blood grouping serum ip 406 diatrizoate meglumine & diatrizoate sodium inj usp 60% (iodine conc.= 292 mg/ml) 407 diatrizoate meglumine and diat sod inj usp 76%w/v (iodine = 370 mg/ml) 408 gadodiamide inj. 0.5mml/ml vial 409 vdrl antigen (with + ve and ve control) / rpr slide kit 410 iohexol usp (solution for injection) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml 411 iohexol usp(solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. 412 multistix test strip 413 povidone iodine solution ip 5 % 500 ml 414 compound benzoin tincture ip 415 formaldehyde solution (34.5 per. 38 per.) 416 gluteraldehyde solution 2% 417 hydrogen peroxide solution ip 6 o/o (20 vol) 418 lysol (cresol with soap solution) ip (cresol 50 o/o + soap 50 o/o) 419 povidone iodine scrub solution / cleansing solution 7.5 o/o w/v povidone iodine (suitable for hand wash) 420 surgical spirit ip (500 ml) 421 chlorhexidine gluconate solution 5% 250 ml 422 surgical spirit ip (100 ml) 423 povidone iodine solution ip 5% 100ml bottle 424 povidone iodine ointment usp 250 gm 425 povidone iodine solution ip 10 % 426 silver sulphadiazine cream ip 1% 500 gm jar 427 acetazolamide tab ip 250mg 428 frusemide tab ip 40 mg 429 furosemide injection ip 10mg/ml (im and iv use) 430 hydrochlorthiazide tab ip 12.5 mg 431 mannitol inj ip 20% w/v 432 spironolactone tab ip 25mg 433 torsemide tab 10 ip mg 434 hydrochlorthiazide tab ip 25mg 435 torsemide inj 10 mg/ml 436 spironolactone tablets ip 50 mg 437 ciprofloxacin 0.3 o/o and dexamethasone 0.1 o/o ear drops ciprofloxacin and dexamethasone otic suspension usp 438 clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops 439 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 440 ceruminolytic drops (wax dissolving ear drops) paradichlorobenzene 2 o/o , benzocaine 2.7 o/o , chlorbutol 5 o/o, turpentine oil 15 o/o 441 drotaverine hydrochloride inj 40 mg/2 ml 442 ointment containing lidocaine ip 3 o/o zinc oxide ip 5 o/o , hydrocortisone ip 0.25 o/o, allantoin ip 0.5 o/o 443 antacid tablets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 444 antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 445 bisacodyl tab ip 5 mg 446 dicyclomine tab ip 10 mg 447 dicyclomine inj ip 10 mg /ml 448 dicyclomine hydrochloride oral solution ip 10mg /5ml 449 domperidone suspension ip 5mg/5ml 450 domperidone tab ip 10 mg 451 hyoscine butylbromide inj ip 20 mg/ ml 452 loperamide tab ip 2 mg 453 metoclopramide inj ip 10mg/2ml 454 metoclopramide tab ip 10 mg 455 omeprazole cap ip 20 mg 456 ondansetron inj ip 2mg/ml 457 ors powder ip 458 pentoprazole inj 40 mg 459 ranitidine hcl injection ip 50mg/2ml 460 ranitidine tab ip 150mg film coated 461 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o/o disodium hydrogen phosphate dodecahydrate 8 o/o 462 hyoscine butyl bromide tablets ip 10mg 463 drotaverine tab ip 40 mg 464 ranitidine tab ip 300mg film coated 465 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 466 dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 467 metoclopramide hydrochloride syrup ip 5 mg/ 5ml 468 domperidone oral drops 10mg/ ml (10ml) 469 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 470 lactic acid bacillus tab 60 million spores 471 lactulose solution usp/bp 10gm/15ml or 3.35 gm/5ml 472 liquid paraffin ip 100 ml 473 ondansetron orally disintegrating tablets ip 4mg 474 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 475 ursodeoxycholic acid tablets ip 300 mg 476 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 477 prochlorperazine mesylate injection 12.5mg/ml 5ml size 478 probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 479 mesalamine tablet usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) 480 allopurinol tablets ip 100 mg 481 hydroxychloroquine sulphate tablets 200mg 482 leflunomide tablets ip 10mg(film coated) 483 leflunomide tablets ip/usp 20mg (film coated) 484 sulfasalazine gastroresistant tablets ip 500 mg ip 485 biphasic isophane insulin inj ip (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) 486 carbimazole tabs ip 5 mg (film coated) 487 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg/ml 488 clomifene tab ip 25 mg 489 clomiphene tab ip 50 mg 490 conjugated estrogen tabs usp 0.625 mg. 491 dinoprostone cream/ gel 0.5 mg dinoprostone in syringe 492 ethinyloestradiol tabs ip 50 mcg 493 glibenclamide tab ip 5 mg 494 gliclazide tab ip 40 mg 495 glimepiride tab ip 2 mg 496 glimepiride tab ip 1mg 497 glipizide tab ip 5mg 498 hydroxyprogesterone inj ip 250mg /ml 499 isophane insulin inj ip 40 iu /ml 500 metformin tab ip 500 mg(film coated) 501 norethisterone tab ip 5 mg 502 pioglitazone tab ip 15 mg 503 progesterone inj 200 mg/ 2ml 504 insulin injection ip (soluble insulin/neutral insulin injection)40 iu/ml(r.dna origin) 505 thyroxine sodium tablets ip 100mcg 506 metformin hydrochloride(sustained release tablets ip 1000 mg 507 glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) 508 glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg (sustained release) 509 metformin hcl (sustained release) and glimepiride tab metformin hcl (sustained release) 500mg ,glimepiride 1mg 510 metformin hydrochloride (sustained release) and glimepiride tablets ip (metformin hydrochloride(sustained release) 500 mg, glimipiride 2mg) 511 glimepiride, pioglitazone and metformin hydrochloride (sustained release) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride (sustained release) 500 mg 512 gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 500 mg) 513 glucagon for injection usp 1 mg/ml 514 medroxyprogesterone acetate tablets ip 10 mg 515 thyroxine tablets ip 50 mcg 516 octreotide injection 50 mcg/ml 517 insulin glargine 3ml (100iu/ml) with 15 insulin syringes and needles/cartridge 3ml (100iu/ml) with 15 needles and 1 pen per 20 cartridges 518 tenaligliptin tablet ip 20mg 519 insulin glargine 10 ml vial (100 iu/ml) with 30 insuline syringes with needle 520 human anti d immunoglobulin injection 300mcg (im use) 521 human anti d immunoglobulin 150 mcg 522 human rabies immunoglobulin inj 150 iu/ ml 523 rabies vaccine human (cell culture) ip (intradermal) 2.5 iu 524 rabies vaccine human (cell culture) ip (intramuscular) 2.5 iu/ dose 525 snake venum anti serum ip (lyophilized)polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum,0.45 mg of common kraite(bungaras)venum(details in rc) 526 tetanus immunoglobulin ip 250 iu/ vial 527 tetanus vaccine (adsorbed) ip 5 ml vial 528 rabies antiserum ip (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (i.m./sc use) 529 diphtheria antitoxin 10000 iu 530 hepatitis b immunologlobin injection ip 200 i.u 531 human immunoglobulin inj with 12%igm,12%iga,76%igg in pack of 10ml(0.5gm) 532 atracurium inj 10 mg/ml 533 glycopyrrolate inj ip 0.2 mg/ml 534 midazolam inj ip 1 mg/ml 535 neostigmine inj ip 0.5 mg/ml 536 neostigmine tab ip 15 mg 537 succinylcholine inj. ip 50 mg/ml (iv use) 538 valethamate bromide inj 8mg / ml 539 vecuronium bromide for injection 4mg (freeze dried) 540 chlorzoxazone , diclofenac sodium & paracetamol tablets (chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg) 541 neostigmine injection ip 2.5mg/5ml 542 cis atracurium besylate injection 2 mg/ml in 5 ml vial 543 tropicamide eye drop ip 1o/o 544 atropine eye ointment ip 1% 545 atropine sulphate ophthalmic solution usp 1% 546 chloramphenicol eye drops ip 0.5 0/0 547 ciprofloxacin eye drops ip 0.3 o/o w/v 548 ciprofloxacin ophthalmic ointment usp 0.3% 549 hydroxypropylmethyl cellulose solution 20 mg/ ml 550 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o/o +0.1 o/o 551 tobramycin eye drops 0.3% [331] 552 tobramycin ophthalmic ointment usp 0.3% 553 flurbiprofen sodium ophthalmic solution ip 0.03 o/o w/v 554 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. 555 lidocaine hcl topical solution usp 4% 556 fluconazole eye drops 0.3% 557 timolol eye drops ip 0.5 o/o w/v 558 homatropine eye drops ip 2% 559 travoprost eye drops ip 0.004 o/o 560 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 561 betaxolol eye drops 0.5 o/o 562 carboxymethylcellulose eye drops ip 0.5% 563 phenylephrine hydrochloride opthalmic solution usp/phenylephrine eye drops bp 5% 564 acyclovir eye ointment ip 3% w/w 5gm size 565 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size 566 chloramphenicol 1% w/w eye ointment ip, 3gm size 567 isoxsuprine inj ip 5 mg/ml 568 isoxsuprine tab ip 20 mg 569 methylergometrine inj ip 0.2 mg/ml 570 methylergometrine tab ip 0.125 mg 571 misoprostol tab ip 200 mcg 572 oxytocin inj ip 5 iu/ml 573 mifepristone tab ip 200mg 574 natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron ip 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron ip 200 mg) 575 cabergoline tablet ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) 576 human chorionic gonadotropin injection ip 5000 i.u. 577 leurprolide acetate depot 3.75 mg 578 leurprolide acetate depot 11.25 mg 579 alprazolam tab ip 0.25 mg 580 alprazolam tab ip 0.5mg 581 amitriptyline tab ip 25mg film coated 582 chlordiazepoxide tablets ip 10mg 583 chlorpromazine tablets ip 100 mg (coated tablet) 584 chlorpromazine tablets ip 25 mg (sugar coated) 585 chlorpromazine tablets ip 50 mg (coated tablets) 586 chlorpromazine inj. ip 25mg/ml 587 diazepam inj ip 10mg/2ml (1m/iv use) 588 diazepam tab ip 5 mg 589 escitalopram tab ip 10 mg 590 fluoxetine cap ip 20 mg 591 haloperidol inj ip 5 mg/ml 592 haloperidol tab ip 1.5 mg 593 haloperidol tab ip 5 mg 594 imipramine tab ip 25 mg (coated tab) 595 imipramine tab ip 75 mg (coated) 596 lithium carbonate tab ip 300 mg 597 lorazepam inj ip 2 mg/ml 598 olanzapine tab ip 5 mg 599 risperidone tab 2mg 600 risperidone tab 1 mg 601 sertraline tab ip 50 mg 602 trifluperazine tab ip 5 mg coated 603 quetiapine tablet ip 50mg 604 quetiapine tablet ip 25mg 605 clonazepam tablet 0.5 mg 606 levosulpiride tablet 25 mg (each uncoated tablet contains levosulpiride 25 mg) 607 lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) 608 zolpidem tablet 5 mg 609 aminophylline inj ip 25 mg/ml 610 beclomethasone inhalation ip 200 mcg/dose 611 budesonide nebulizer suspension 0.25mg/ml 612 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg,ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup q.s. 613 ipratropium bromide nebulizer solution 250 mcg/ ml 614 salbutamol tablet ip 4 mg 615 salbutamol inhalation 100 mcg /dose 616 salbutamol nebuliser solution bp 5 mg/ml 617 salbutamol tab ip 2 mg 618 theophylline and etofylline injection (anhydrous theophylline 50.6mg + etofylline 169.4 mg) 619 theophylline and etofylline tablets (theophylline ip 23mg + etofylline 77 mg) 620 theophylline tablet 400mg sustained release/ controlled release (theophylline prolonged released tablet ip) 621 salbutamol syrup ip 2mg/ 5ml 622 dextromethorphan hbr syrup ip 13.5mg / 5ml 623 saline nasal solution (drops) (sodium chloride 0.65 o/o) 624 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 625 budesonide powder for inhalation 200 mcg 626 ipratropium powder for inhalation ip 40 mcg 627 terbutaline tablets ip 2.5 mg 628 xylometazoline nasal drops ip 0.1% 629 cough syrup/expectorant(50) ml 630 acebrophylline tablet/capsule 100 mg 631 compound sodium lactate inj. ip 632 dextrose inj ip 25% w/v 633 dextrose inj ip 10% 634 dextrose inj ip 5% 635 multiple electrolytes and dextrose injection type i ip (electrolyte p injection ) 636 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 637 potassium chloride inj. 0.15 gm/ml 638 potassium chloride oral solution u.s.p 500mg/ 5ml 639 sodium chloride and dextrose injection ip 0.9 o/o + 5 o/o 640 sodium chloride inj ip 500 ml 641 sodium chloride injection ip 100 ml 642 ringer acetate infusion 500 ml 643 sodium chloride 0.45% w/v polypack 500 ml 644 finasteride tablets ip 5 mg 645 tamsulosin hcl tablets/capsule 0.4 mg 646 flavoxate tablets ip 200 mg (coated tablet) 647 savelamer carbonate tablet 400 mg (each film coated tablet contains savelamer carbonate 400 mg) 648 sodium bicarbonate tablet usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) 649 levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatin levamisol hydrochloride ip 50 mg) 650 phenazopyridine tablet 5 mg 651 dutasteride tablet 0.5 mg 652 alkylizer syrup 1.4 gm/5 ml( 100 ml )(disodium hydrogen citrate) 653 betahistine tab ip 8 mg 654 betahistine tab ip 16 mg 655 cinnarizine tablets ip 25 mg 656 cinnarizine tablet ip 75 mg 657 ascorbic acid tab ip 500 mg 658 calcium gluconate inj ip 10% (iv use) 659 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 660 ferrous sulphate with folic acid tab (paediatric) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 661 folic acid tab ip 5 mg 662 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 663 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 664 vitamin b complex inj nfi 665 vitamin b complex tablet nfi (prophylactic) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg (with appropriate overages) 666 vitamin a paediatric oral solution ip(vitamin a concentrate oil ip)each ml contains vitamin a 100000 iu 667 calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 668 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 669 zinc sulphate dispersible tablets ip elemental zinc 10 mg 670 iron sucrose injection usp/bp 20mg/ml (for iv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 671 calcium with vitamin d tablets usp /calcium and colecalciferol tablets bp/calcium and vitamin d3 tablets ip(elemental calcium 500 mg, vitamin d3 250 iu) (non chewable) 672 cholecalciferol granules 60,000 iu /gm 673 mecobalamin inj 500 mcg/ml 674 pyridoxine tablet ip 10 mg 675 pyridoxine tablet ip 40mg 676 thiamine tablets ip 100 mg 677 calcitriol capsules ip 0.25 mcg 678 methyl cobalmine tablet 500mcg 679 methyl cobalmine tablet 1500mcg 680 vitamin d3 oral solution 60000 iu 681 ferric carboxymaltose injection 50 mg/ml 10 ml size 682 multi vitamin syrup 683 flunarizine tab 5 mg 684 black disinfectant fluid (phenyl) as per schedule o grade iii 685 conc haemodialysis fluid b.p acetate concentrate 10 litre can 686 peritonial dialysis solution ip 687 sodium bicarbonate inj ip 7.5% w/v 688 water for inj ip 689 alendronate sodium tablets usp / bp 35 mg 690 mannitol with glycerin injection 10 o/o + 10 o/o w/v (for intravenous infusion) 691 normal human intravenous immunoglobulin 5g/100ml 692 pregabalin cap ip 75 mg 693 surfactant for intratrecheal instillation (natural bovine lung surfactant) 694 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans 695 intravenous fat emulsion 20% w/v 250ml 696 pyridostigmine tablet ip 60 mg (each tablet contains pyridostigmine ip 60 mg ) 697 caffeine citrate usp injection 20mg/ml (equivalent to 10 mg caffeine base/ml) 3ml size 698 amino acid 10% injection 100ml size 699 vitamin e capsule 400 mg 700 inj poractant alpha 80 mg/ml in pack of 1.5 ml (detail in rc) 701 oseltamivir capsule ip 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) 702 oseltamivir capsule ip 45 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg) 703 oseltamivir capsule ip 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) 704 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 705 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 706 act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and pyrimethamine(250mg+12.5mg) 707 act kit containing 3 tablets of artesunate(50 mg each) and 1 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 708 act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of sulphadoxine and pyrimethamine(750mg+37.5mg) 709 act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 710 each combi bliste pack: containing 3 tablets of artesunate(200 mg each) and 2 tablet of sulphadoxine pyrimethamine(750mg+37.5mg)each or 3 tablets of sulphadoxine pyrimethamine(500+25)mg 711 liposomol amphotericine injection b 50mg 712 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 40 mm length 76 cm) size 1/0 713 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 20 mm length 76 cm) size 3/0 714 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 2/0 715 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 1/0 716 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 40mm length 76 cm) size 1/0 717 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 30 mm length 76 cm) size 2/0 718 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 45 mm length 100 cm) size 1 719 absorbable surgical suture (sterile catgut), needled suture chromic size 3/0 (3/8 cir rcutting needle 26mm, length 76 cm) 720 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 3/0 1/2cir rb needle 20mm length 70 cm 721 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 30mm length 90 cm 722 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)1/2 cir rb needle size 1/0 30mm length 90 cm 723 absorbable surgical suture (synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 1 1/2 cir tapercut needle (heavy) 40mm length 90 cm 724 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1 1/2 cir rb needle40mm length 90 cm 725 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0(1/2 cir conventional 25mm length 90 cm)undyed 726 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 4/0 (1/2 cir rb needle 20mm length 70 cm) 727 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 40mm l 90cm 728 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1/0(1/2 cir rb needle 40mm length 90 cm) 729 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0 3/8 circle cutting needle 22mm length 45 cm 730 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 4/0 3/8 circle cutting 16mm needle,suture length 70cm 731 chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm) size 5/0 (details in rc) 732 chromic catgut suture(3/8 cir cutting needle 8 mm, suture length 35 cm) size 6/0 (details in rc) 733 chromic catgut suture(3/8 cir r cutting needle 19 mm needle, suture length 76 cm) size 4/0 (details in rc) 734 non absorbable surgical suture, sterilised needled black braided silk size 3/0(1/2 cir rb needle 20mm, length 76 cm) 735 non absorbable surgical suture, sterilised needled black braided silk size 3/0(3/8cir reverse cutting needle 26mm, length 76 cm) 736 non absorbable surgical suture, sterilised needled black braided silk size 2/0(3/8cir reverse cutting needle 45mm, length 76 cm) 737 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 8/0 (3/8 cir micropoint round body ,6mm length 38 cm) 738 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 3/0 (3/8 conventional cutting needle 16mm length 70 cm) 739 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 4/0 (3/8 conventional cutting needle 19mm length 60 cm.) 740 non absorbable surgical suture,sterilised needled polyamide monofilament black (nylon)size 5/0(3/8 cir slim blade cutting needle 15mm length 70 cm) 741 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 2/0 (3/8 cir r cutting needle 45mm length 70 cm.) 742 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 1/0 (3/8 cir r cutting needle 45mm length 70 cm.) 743 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb 13 mm needle,length 75cm) double arm 744 non absorbable surgical suture,sterilised needled monofilament polypropylene blue (3/8cir rb 16 mm needle,length 90 cm)size 6/0 745 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 7/0 (3/8cir rb double 8mm needle, length 60 cm) 746 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(3/8cir rb 16 mm needle, length 70 cm) 747 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1/0(1/2 cir rb needle 30mm length 90 cm) 748 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1(1/2 cir rb heavy needle 45mm length 90 cm) 749 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb double needle 17mm length 90 cm)(detail in rc) 750 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 cir tapercut double needle 17mm length 70 cm)(detail in rc) 751 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, length 90 cm) double arm 752 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 cir rb needle 30mm, length 90 cm) 753 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir tapercut needle 17mm length 75 cm) double arm 754 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0(1/2 cir tapercut needle,25 mm length 90 cm) double arm 755 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 6/0(3/8 cir conventional cutting pc 3needle 15mm length 60cm) 756 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6/0(3/8 cir rb 13mm needle, length 90 cm double arm 757 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 4/0(1/2 cir rb needle 16 mm length 70 cm) 758 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0(3/8 cir cutting needle 25mm length 45 cm) 759 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir rb heavy 40mm, length 90 cm) 760 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir reverse cutting, 45 mm needle length 100 cm) 761 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 8/0 (3/8 cir rb , 8mm double needle, suture length of 70cm) 762 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 circle tapercut 13mm double needle 70cm) 763 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 5/0 (1/2 circle cc 13mm needle, suture length of 70cm) double arm 764 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 circle tapercut needle 17mm suture length of 90cm) double arm 765 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, suture length of 75cm) double arm 766 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/ blue size 4/0(1/2 cir tapercut ,17 mm double needle, length 75 cm) 767 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2/0 (1/2 cir tapercut ,17 mm double needle, length 90 cm) 768 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/blue size 2/0(1/2 cir tapercut ,17 mm double needle, length 90 cm)(detail in rc) 769 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2/0 1/2 circle taper cut,17mm double armed needle,suture length of 90cm with pledgets size 6 x 3 x 1.5mm 770 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2 0 1/2 circle taper cut,25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 771 non absorbable surgical suture, sterilised needled coated polyster braided, green/white or blue/white coated polyster braided (green / blue) with size 3/0 1/2 circle tapercut double needle 25mm,suture length 90 cm 772 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 10/0 (3/8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 773 b.b silk suture (3/8 cir rb needle 20mm, length 76 cm size 4/0 (details in rc) 774 b.b silk suture (3/8 cir rb needle 16mm, length 76 cm size 5/0 (details in rc) 775 absorbable surgical sutures,sterilised needled polyglecaprone/polyglyconate,monofilament sutures size 2/0 (1/2 circle oval rb needle 26mm needle,suture length of 70cm) 776 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate,size 3/0 (1/2 circle ovalrb contrast needle 26mm, suture length 70cm) 777 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 4/0 (1/2 circle cutting 16mm needle,suture length 70cm) 778 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 3/0 (3/8 circle cutting 25mm needle, suture length of 70cm) 779 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1 (1/2 circle reverse cutting 50 mm length 90cm) 780 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 2/0 (1/2 circle rb 31mm needle, length 70cm) 781 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1/0(1/2 circle rb 30mm needle,length 70cm) 782 absorbable surgical suture(synthetic)antibacterial coated sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 783 absorbable surgical suture(synthetic)antibacterial with sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1/0 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 784 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 2/0 1/2 circle round bodied 30mm, suture length 90 cm 785 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1 1/2 circle reverse cutting,os 40mm, suture length 90 cm 786 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 1/0 1/2 circle reverse cutting 36mm, os needle, suture length 90 cm 787 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture(braided coated polyglactin/polyglycolic acid violet)size 3/0 1/2 circle round bodied 20mm, suture length 70 cm 788 absorbable surgical suture (synthetic)antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 3/0 3/8 circle r cutting, ps 1,24mm, suture length 70 cm 789 absorbable gelatin sponge 80 x 50x 10mm(details in rc) 790 no item 791 asepto syringe with transparent bulb sterile, 60 ml 792 blood administration set blood transfusion set (details in rc) 793 gloves size 6.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 794 gloves size 6.5 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) 795 gloves size 7 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 796 gloves size 7 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) 797 gloves size 7.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 798 gloves size 7 .5inches,powder free (disposablesterile surgical rubber gloves)(details in rc) 799 suction catheter, sterile.size: fg 5 (details in rc) 800 suction catheter, sterile. size: f g 6 (details in rc) 801 suction catheter, sterile. size: f g 8 (details in rc) 802 suction catheter, sterile. size: f g 10 (details in rc) 803 suction catheter, sterile. size: f g 12 (details in rc) 804 suction catheter, sterile. size: f g 14 (details in rc) 805 suction catheter, sterile. size: f g 16 (details in rc) 806 suction catheter, sterile. size: f g 18 (details in rc) 807 suction catheter, sterile. size: f g 20 (details in rc) 808 suction catheter, sterile. size: f g 22 (details in rc) 809 catheter,size 8(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 810 catheter,size 10(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 811 catheter,size 16(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 812 catheter,size 18(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 813 catheter,size 20(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 814 catheter,size 22(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 815 catheter,size 24(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 816 infant feeding tube size 10fg(details in rc) 817 infant feeding tube size 8fg(details in rc) 818 infant feeding tube size 5fg(details in rc) 819 perfusion set with airway and needle,(adult use) sterile disposable(details in rc) 820 perfusion set (infusion set) with airway and needle (paediatric use)sterile disposable(details in rc) 821 infusion set with microdrip,(i.v.)sterile disposable(details in rc) 822 insulin syringe ( 40 units) with (fixed) 30 g needle shall conforn to is 12227 823 sterile disposable (single use) teflon/ptfe i.v cannula with integrated 3 way stop cock size 16g (details in rc) 824 sterile disposable (single useteflon / ptfe i.v. cannula with integrated 3 way stop cock.) size 18g (details in rc) 825 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 20 g (details in rc) 826 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 22g (details in rc) 827 sterile disposable (single use) teflon/ ptfe i.v. cannula without port size 24g (details in rc) 828 mucus extractor sterile(details in rc) 829 nasal oxygen set, twin bore all sizes adult (details in rc) 830 nasal oxygen set, twin bore all sizes paediatrics (details in rc) 831 paper adhesive plaster 1 inch x 9.0 mts (with cutter) non woven adhesive tape 832 paper adhesive plaster 2 inch x 9.0 mts (with cutter) non woven adhesive tape 833 paper adhesive plaster 3 inch x 9.0 mts (with cutter) non woven adhesive tape 834 plaster of paris bandage 15cm x 2.7 mts/roll 835 plaster of paris bandage 10cm x 2.7mts 836 ryles tube / nasogastric tube size: 10(details in rc) 837 ryles tube / nasogastric tube size: 12(details in rc) 838 ryles tube / nasogastric tube size:14 (details in rc) 839 ryles tube / nasogastric tube size: 16 (details in rc) 840 ryles tube / nasogastric tube size: 18 (details in rc) 841 scalp vein set (disposable) size 18g (details in rc) 842 scalp vein set (disposable) size 20g (details in rc) 843 scalp vein set (disposable) size 22g (details in rc) 844 scalp vein set (disposable) size 24 g (details in rc) 845 syringe 2 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 846 syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 847 syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 848 syringe 20 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 849 surgical blade sterile, size 11(details in rc) 850 surgical blade sterile, size 15(details in rc) 851 surgical blade sterile, size 22(details in rc) 852 suture needles curved 1/2 circle round body assorted size 11 15(details in rc) 853 suture needles curved 1/2 circle round body assorted size 1 5(details in rc) 854 suture needles curved 1/2 circle round body assorted size 16 20(details in rc) 855 suture needles curved 1/2 circle round body assorted size 6 10(details in rc) 856 suture needles curved and cutting 1/2 circle cutting size 6 10(details in rc) 857 suture needles curved and cutting 1/2 circle size 11 15(details in rc) 858 suture needles curved and cutting 1/2 circle size 16 20(details in rc) 859 suture needles curved and cutting size 1 5(details in rc) 860 sterile disposable spinal needle for single use. 22g x 3 1/2 inch (details in rc) 861 sterile disposable spinal needle for single use. 25g x 3 1/2 inch (details in rc) 862 urine collecting bag, disposable 2000 ml(details in rc) 863 double j stent, sterile, both ends open size 4f, length 16 cm 864 double j stent, sterile, both ends open, size 5f, length 20 cm 865 double j stent, sterile, one end closed size 4f, length 16 cm 866 double j stent, sterile, one end closed, size 5f, length 20 cm 867 endotracheal tube, plain size 2.5 (details in rc) 868 endotracheal tube, plain size 3 (details in rc) 869 endotracheal tube, plain size 3.5 (details in rc) 870 endotracheal tube, plain size 4 (details in rc) 871 endotracheal tube, plain size 4.5 (details in rc) 872 endotracheal tube, plain size 5 (details in rc) 873 endotracheal tube, plain size 5.5 (details in rc) 874 endotracheal tube, plain size 6 (details in rc) 875 endotracheal tube, plain size 6.5 (details in rc) 876 endotracheal tube, plain size 7 (details in rc) 877 endotracheal tube, plain size 7.5 (details in rc) 878 endotracheal tube, plain size 8 (details in rc) 879 endotracheal tube, plain size 8.5 (details in rc) 880 endotracheal tube, cuffed size 4 (details in rc) 881 endotracheal tube, cuff size 4.5 (details in rc) 882 endotracheal tube, cuff size 5 details in rc 883 endotracheal tube, cuff size 6 (details in rc) 884 endotracheal tube, cuff size 6.5 (details in rc) 885 endotracheal tube, cuff size 7 (details in rc) 886 endotracheal tube, cuff size 7.5 (details in rc) 887 endotracheal tube, cuff size 8 (details in rc) 888 endotracheal tube, cuff size 8.5 (details in rc) 889 endotracheal tube, cuff size 9 (details in rc) 890 tracheostomy tube, plain all sizes(details in rc) 891 tracheostomy tube (pvc), cuffed all sizes(details in rc) 892 abdominal drain kit (with collection bag 2000 ml size 24 (details in rc) 893 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) size 28 (details in rc) 894 abdominal drain kit,sterile,having drainage cather and collection bag(2000) ml size 32 (details in rc) 895 corrugated drainage sheet all sizes(details in rc) 896 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm 897 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm 898 sterilized umbilical cotton tape width 3 mm, length 75 cm(details in rc) 899 bone wax sterilised 900 temporary cardiac pacing wire (electrode) sterile â½ cir, tapercut, 26 mm; reverse cutting 60 mm 901 skin graft knife blade (sterile)(details in rc) 902 k wire, length 375 mm; 1mm(details in rc) 903 k wire, length 375 mm; 1.6mm(details in rc) 904 k wire, length 375 mm; 1.8mm(details in rc) 905 face mask, disposable(details in rc) 906 surgical cap disposable (for surgeons)(details in rc) 907 surgical cap, disposable (for nurses) (details in rc)(details in rc) 908 foldable intra ocular lense with injector (details in rc) 11 to 17.5 909 foldable intra ocular lense with injector (details in rc) 18 to 24 910 foldable intra ocular lense with injector (details in rc) 24.5 to 28.5 911 standard pama intra ocular lenses (details in rc) 11 to 17.5 912 standard pama intra ocular lenses (details in rc) 18 to 24 913 standard pama intra ocular lenses (details in rc) 24.5 to 28.5 914 disposable sterile surgical rubber gloves size 8 inches,powdered 915 disposable sterile surgical rubber gloves size 8 inches,powder free 916 rubber examination gloves, non sterile, extra small(details in rc) 917 rubber examination gloves,size small (details in rc) 918 rubber examination gloves,size medium (details in rc) 919 rubber examination gloves made of natural rubber latex, non sterile, size large (details in rc) 920 pressure monitoring line / high pressure extension line (details in rc) 921 urine collecting bag for new born /paediatric urine collection bag, capacity 100ml (details in rc) 922 umbilical catheter for new born, all sizes (details in rc) 923 umbilical cord clamp (details in rc) 924 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property(details in rc) 925 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 16 (details in rc) 926 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 18 (details in rc) 927 t tube for common bile duct drainage, length 20x60 cm, size (details in rc) 928 bone cement 929 sanitary napkin beltless(details in rc) 930 sanitary pads belt type(details in rc) 931 sanitary napkin beltless with wings (details in rc) 932 oxygen mask (adult) 933 oxygen mask (pediatric) 934 foleys catheter no. 14 (detail in rc) 935 nelaton catheter size 14 fg(detail in rc) 936 ecg electrode (detail in rc) 937 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 (detail in rc) 938 sterile hypodermic syringe with needle attached, 22g, single use 50 ml (detail in rc) 939 urethral catheter 90 (fg 14) made up of medical grade pvc (detail in rc) 940 urethral catheter 91 (fg 10), made up of medical grade pvc (detail in rc) 941 vaccum suction set, 2.5 meter length (detail in rc) 942 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile (detail in rc) 943 vascular catheter with metal guide no. 16, double lumen size 30 cm (longline iv) (detail in rc) 944 vascular catheter with metal guide no. 18 double lumen size 30 cm (longline iv) (detail in rc) 945 vascular catheter with metal guide no. 20 double lumen size 30 cm (longline iv) (detail in rc) 946 vascular catheter with metal guide no. 22 double lumen size 30 cm (longline iv) (detail in rc) 947 vascular catheter with metal guide no. 16 double lumen size 45 cm (longline iv) (detail in rc) 948 vascular catheter with metal guide no. 18 double lumen size 45 cm (longline iv) (detail in rc) 949 vascular catheter with metal guide no. 20 double lumen size 45 cm (longline iv) (detail in rc) 950 vascular catheter with metal guide no. 22 double lumen size 45 cm (longline iv) (detail in rc) 951 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements (detail in rc) 952 3 way stop cock with extension tube (vein o extension line) size 10cm (non pyrogenic & single use) (detail in rc) 953 3 way stop cock with extension tube (vein o extension line) size 50cm (non pyrogenic & single use) (detail in rc) 954 3 way stop cock with extension tube (vein o extension line) size 100cm (non pyrogenic & single use) (detail in rc) 955 3 way stop cock with extension tube (vein o extension line) size 150cm (non pyrogenic & single use) (detail in rc) 956 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 16) (detail in rc) 957 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) (detail in rc) 958 nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube (detail in rc) 959 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property (detail in rc) 960 sterile disposable (single use teflon/ptfe i.v cannula with integrated 3 way stop cock size 26g (detail in rc) 961 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for ventilator without vent (detail in rc) 962 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for ventilator without vent (detail in rc) 963 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for bipap with vent (detail in rc) 964 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for bipap with vent (detail in rc) 965 niv mask (noninvasive ventilation mask) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support (detail in rc) 966 nebulization mask adult (detail in rc) 967 nebulization mask paediatric (detail in rc) 968 chemotherapy port and non coring needles(adult) (detail in rc) 969 chemotherapy port & non coring needles(pediatric) (detail in rc) ...

Indian Army - Rajasthan

33687721 procurement of drugs and pharmaceuticals products cap progesterone 200 mg , cap tamsulosin + dutasteride , tab pregabaline 75 mg + mecobalamine 1500 mg , tab eptus 25 mg , nasal sprayazelastin , tab telmisartan 40 mg + amlodipine 2.5 mg , r / c formetrol + fluticasone 250 mcg , tab clarithromycin 250 mg , cap vitamin e 400 mg , syp alkaline mixture ( disodium citrate ) 100 ml , tab vildagliptin 50 mg + metformin 500 mg , tab common cold , tab ferrous ascorbate , syp bromhexin 100 ml , tab curcumine 10%+piperine5%+lycopane 10% ( nutricor ) , rotocap salmetrol + fluticasone 100 mcg , husk isapgol / ispaghula 3.5 gm , tab ledipasvir 90 mg + sofosbuvir 400 mg , tab apixaban 5 mg , rotocap duolin 100 ( levosalbutamol + ipratropium ) , tab sevelmer 400 mg , tab linezolid 600 mg , tab olmisartan 40 mg , liq sterilium 500 ml , cap vitamin e 200 mg , disp stockinett , tab leviteracetam 500 mg , tab diclofenac s r 100 mg , tab etoricoxib + paracetamol , inj insulin natural 40iu / ml, 10 ml ( insulin plane ) , disp heel cushion , oint estriol cream 15 gm ( evalon ) , nasal spray momentasone , disp chest belt ( rib belt ) , tab carbamazepine c r 300 mg , tab trenexamic acid + mefnamic acid , tab ranolazine 500 mg , tab etoricoxib 120 mg , eye drop carboxymethyl cellulose 0.5% , colostomy barrier cream no 4720 , tab rosuvastatin 10 mg , tab fexofenadine 180 mg , tab moxifloxacin 400 mg , respules ipravent ( ipratropium ) , colostomy powder no 1907 , eye drop i tone , tab methylcobalamine 500 mcg , cap pre & probiotic , tab ibuprofen 200 mg , tab dabogaline 110 mg , taba k t 4 , tab navibilol 5 mg , lotion povidone iodine 100 ml , inh fluticasone propionate 50 mcg / dose , tab mefenamic acid + dicyclomine , eye drop dorzolamide + timolol ( drozox t ) , syringe disposable insulin 1 ml , tab nitrofuradentin 100 mg , lot ketoconazole 2%, 75 ml , tab ascorbic acid 500 mg , tab apixaban 2.5 mg , tab acarbose 25 mg , disp gloves size 7 1 / 2 , oint hydroquinone and octinoxate 30 gm , disp humapen needle , sol hydrocortisone enema 10% w / v , cotton wool absorbent pkt of 50 gm , tab diacerin 50 mg , tab methyl prednisolone8 mg , tab chymoral forte , tab glucosamine 500 mg , eye drop dorzolamide , cap silodosine 8 mg , oint betamethasone + gentamycin , eye drop phenyl ephrine + nephazoline + camphor+ menthol ( occurest ) , kit cholestrole des , tab amlodipine 5 mg + atenolol 50 mg , tab vildagliptin 50 mg , oint soframycin 30 gm , tab spironolactone ( aldactone ) 50 mg , tab lansprazole 30 mg , resp ipratropium bromide respirator sol 500 mcg / 2 ml , tab torsemide 20 mg plus , tab doxyphylline , tab mesalamine 1200 mg , rotacap beclomethasone + salbutamol ( aerocort ) , tab telmisartan 20 mg , tab n acetylcystin 600mg , eye drop travoprost , oint betamethasone ( betnovate ) 20 gm , tab dabigatran 150 mg , pulv glucose 500 gm , inj ceftriaxone 1 gm + salbactum 500 mg , tab methyl prednisolone 16 mg , tab fexofenadine 120 mg , tab dydrogesterone 10 mg , tab glucosamine 750 mg + diacerin 50 mg + methyl sulfony methane 250 mg ( cartigen dn ) , oint beclomethasone + neomycin 30 gm ( betenovate n ) , tab tramadol hcl 50 mg , rotocap levosalbutamol + ipratropium 200 mcg ( duolin ) , oint anti phlebitis 20 gm ( heparin ) , tab isoniazid 100 mg with pyridoxine 5 mg , tab rosuvastatine 5 mg , valsartan tab 100 mg , eye drop navanac , pulv clotrimazole 1% , 75 gm , disp crutch adjustable , tab secnidazole 1 gm , colostomy bag no 1756 , eye drop timolol 5 mg + brimonidine 2 mg ( combigen ) , oint fluticasone 10 gm , tab olmisartan 20 mg , tab cepcitabine 500mg , kit triglyceride , tab terbinafine 200 mg , eye drop hydroxypropyl cellulose ( genteal ) , tab antioxident , tab acceclofenac + paracetamol + thiocolsicoside , cap progesterone 100 mg , kit glucose test , oint betamethasone + neomycin + clotrimazole 20 gm , oint clobetasole, gentamycin and miconazole ( clobetosol gm ) , tab metoprolol25 mg , vaccutainer sod. citrate , rotacap salbutamol ( asthalin ) , rotocap ipratropium bromide ( ipravent ) , eye drop ciprofloxacin 0.3% + dexamethasone 0.1% , 5 ml , rotocap tiova 9 mcg ( tiotropium bromide ) , disp cervical collar soft , cap heamatinic , cap rifampicin 450 mg + isoniazide 300 mg , tab rifaximin 400 mg , tab oxcarbazepine 300 mg , oint neosporin 5 gm , oint miconazole 15 gm , iv fluid normal saline 500 ml , tab deflazocort 6 mg , cap ubiquinone 200 mg , eye drop nephazoline , colostomy paste , tab tacrolimus 1mg , tab ketrolac dt , eye drop tobramycin + fluromethalone , tab citicoline + piracitam , eye drop latenoprost , tab tramadol , tab resiflow trio , tab indomethsone 25 mg , colostomy belt , oint hydroquinone 2% + octinoxate 9% + benzophenone , kit dangue test card , tab divalporex 500 mg sr , tab olaptadine , eye drop moxifloxacin , syringe dispasable 5 ml , eye drop fluromethalone ( fml ) , tab s adenosyl methionine 400 mg , cap tacrolimus 0.5 mg , film x ray fixer for auto film processor , film x ray 15x12 , eye drop bimatoprost 3 ml , rotocap tiova 18 mcg ( tiotropium bromide ) , n95 mask , filmx ray17’’x14’’ , disp crutch elbow , tab nitrocontin 6.4 mg , eye drop ketorolac 0.4% + olopatadine 0.1% , ear drop antiwax ( waxole ) , eye drop brimonidine tartrate , tab ascorbic acid 100 mg , tab asprin soluble 350 mg , oint fourderm , tab metoprolol xl 12.5 mg , tab carvidilol 3.125 mg , vaccutainer edta , kit urea , microscopic coverslip , film x ray 15’’x12 , tab iveabeat 7.5 mg , disp gloves size 7 , oint lignocaine jelly 2% with plastic nozzle , 30 gm , tab nitrocontin 2.6 mg , distilled water , syringe dispasable 2 ml , oint calicum dobesylate , tab escitalopram 10 mg , inj hyaluronic ( hyline g f ) , tab anastrazole 1 mg , vaccutainer sodium fluoride ( sugar ) , kit sgpt , film x ray 10 x 12 , oint soft peraffin moisturizing agent , tab fluvoxamine 100 mg , adhesive plaster 7.5 cm , foleys catheter silicon 16 , kit calcium , tab sodium valporate 500 cr , tab s adeno mentnionin , bandage roller10 cm , tab escitalopram 20 mg , inj nandrolone deconole 50 mg , kit malaria antigen...

Medical And Health Services - Rajasthan

33682675 supply of implants item for surgical item 1 shell lacetabular cup non cemented ( metal ) ) 2 screw lacetabular cup screw ( metal ) ] liner ( acetabular liner polyethlenej stem [ femoral stem non cemented ( metal ) ) . 5 head ( remoral head ( metal ) ) 6 hip u drape 7 loban 8 . sterile plastic sheet sterile disposable viral protective gown 10 ethibond suture no. 2 11 vacume suction set 12 romovac drain set 8oo ml 13 stapler suture 14 elastic adhesive bandage...

Indo Tibetan Border Police - Rajasthan

33657954 bids are invited for supply of medical test kits =1 erba serum sgot 2 erba serum sgpt 3 erba serum uric acid 4 erba serum blood area 5 erba serum cholesterol 6 erba serum triglyceride 7 erba serum bilirubin direct 8 erba serum glucose kit 9 dengue card 10 hbs ag card 11 hiv ( try dot ) card 12 trop t card 13 distilled water 14 urine mutistick 15 edta test tube 16 fluoride test tube 17 clot test tube 18 accu check instant s glucostrip 19 urine container 20 pregnancy test kit 21 micropore ( surgical tape ) 3cm 22 roller bandage 10cm 23 i.v. set 24 surgical sprit 500ml 25 savlon solution 500ml 26 i.v. cannula 20 no 27 s.v. set 28 crepe bandage 10cm 29 hydrogen peroxide 100ml 30 surgical blade 31 surgical mask ( three layer ) total quantity : 6516...

Indian Army - Rajasthan

33653327 procurement of drugs and pharmaceuticals products drugs and consumables , inhaler forocort ( formeterol & budesonide ) 200 mcg , inhaler seroflow 125 mcg ( salmetrol + fluticasone ) , inj insulin glargine , tab pentaprazole 40 mg + domperidone 10 mg , inhaler trihale , tab torsemide 10 mg ( dytor ) plus , glucometre accucheck machine , inhaler budesonide ( budecort ) 200 mg , inh beclomethasone + levosalbutamol ( aerocort ) , tab methylcobalamine + pregaboline , eye drop brinzolamide , cap gabapentin m , kit hiv tridot ( 100 test ) , tab clopid 75 mg + aspirin 150 mg , tab citicholine 500 mg , oint capsacain gel 20 gm , tab levocetrizine 5 mg + monlelukast 10 mg , inj insulin premixed biphasic 40 iu 30 / 70, 10 ml , bandage crape 15 cm , cap silodol fas + d , tab ursodeoxycholic acid 300 mg , tab rabeprazole 20 mg + domperidone 10 mg , cap tamsulosin + finasteride , cap acarbophyllin 100 mg , syp cremaffin 170 ml , syp antacid 170 ml , kit typhy dot pack of 50 test , rotocap foracort 200 ( formetrol + budesonide ) , disp knee cap , inhaler iprevent ( ipratropium bromide ) , tab eterocoxib 120 mg , inj cell culture rabbies vaccine ( rabipur ) , oint betamethasone and clioqinol 30 gm ( betnovate c ) , inj novarapid ( novomix ) , tab rosuvastatin 20 mg , cap gabapentin 300 mg , syp multivitamin 200 ml , inhaler tiova ( tiotropium bromide ) , glucometer gluco onebg 03 strip , tab empigliflogine 25 mg ( jardinace ) , bandage crape 10 cm , cotton wool absorbent pkt of 500 gm , tab deriphylline 300 mg , cap q10 , tab rabeprazole 20 mg , syp cyproheptadine 200 ml , tab simvasatatin 20 mg , tab mesalamine 1.2 gm , tab glimipride pm2 , tab eterocoxib 60 mg , tab diclofenac + paracetamol + chlorzoxone ( cipzox ) , pulv protein supplement formula for renal patient , rotocap forocort 400 mcg ( formetrol + budesonide ) , inj ertythropoeitin2000 iu , tab glucosamin + condroitin sulphate , oint desensitising paste , tab naproxen 500 mg , nasal spray budesonide , tab glimipride1 mg + metformin 500 mg , eye drop carboxy methyl cellulose 0.1% ( refresh tear ) , tab lanthnum carbonate 500 mg , tab diclofenac + pcm + saritopeptidise , tab montelukast 10 mg , tab prasugel 10 mg...

Medical College - Rajasthan

33642465 orthopaedic implants and surgical item orthopaedic implants and surgical item , distal femoral locking plates ( dflcp ) titanium , 1.right and left side plates , 2. cortical locking screws , 3. cortical non locking screws , 4. cancellous locking screws , proximal tibia lateral locking platetitanium , 1.right and left side plates , 2. cortical locking screws , 3. cortical non locking screws , 4. cancellous locking screws , proximal tibia medial side locking platetitanium , 1.right and left side plates , 2. cortical locking screws , 3. cortical non locking screws , 4. cancellous locking screws , posteromedial plate of proximal tibiatitanium , 1.right and left side plates , 2. cortical locking screws , 3. cortical non locking screws , 4. cancellous locking screws , distal tibia anterolateral plate titanium , 1.right and left side plates , 2. locking cotical screws , 3. cortical non locking screws , 4. cancellous locking screws , distal tibia medial locking platetitanium , 1.right and left side plates , 2. locking cotical screws , 3. cortical non locking screws , 4. cancellous locking screws , anatomical clavicle medial platestitanium , 1.right and left side plates , 2. locking cotical screws , 3. cortical non locking screws , anatomical clavicle lateral platestitanium , 1.right and left side plates , 2. locking cotical screws , 3. cortical non locking screws , 4. cancellous locking screws , clavicle hook platetitanium , 1.right and left side plates , 2. locking screws , 3. cortical non locking screws , philos platetitanium , 1.right and left side plates , 2. cortical locking screws , 3. cortical non locking screws , 4. cancellous locking screws , dynamic compression plate ( dcp ) broadtitanium , 1. cortical locking screws , 2. cortical non locking screws , low contact dynamic compression plate ( lcdcp ) broadtitanium , 1. cortical locking screws , 2. cortical non locking screws , reconstruction plate ( 3.5mm ) broad titanium , 1. cortical locking screws , 2. cortical non locking screws , anatomical olecranon plates titanium , 1. cortical locking screws , 2. cortical non locking screws , 3. cancellous locking screws , volar locking distal end radius plate anatomicaltitanium , 1. cortical locking screws , 2. cortical non locking screws , 3. cancellous locking screws , distal fibula anatomical plate titanium , 1.right and left side plates , 2. locking screws , 3. cortical non locking screws , 4. cancellous locking screws , distal humerus extra articular platestitanium , 1.right and left side plates both medial and lateral , 2. locking screws , 3. cortical non locking screws , 4. cancellous locking screws , dynamic compression screw ( dcs ) titanium , 1. cortical locking screws , 2. cortical non locking screws , 3.short and long barrel side plates , 4. 55 120mm lag screw , taylor spatial external fixator system , 1.frames , 2.pins / wires , 3. clamps , pedicle screws system ( open techniques ) titanium , 1. pedicle screws uni axial , 2. pedicle screws poly axial , 3. connecting rods , tibia interlocking nail titanium , 1.right and left side nails , 2. locking bolts , *expert tibia nail titanium , 1.right and left side nails , 2. locking bolts , humerus nailtitanium , 1.right and left side nails , 2. locking bolts , total hip replacement ( thr ) cemented , 1.polished metallic stem standard size , 2. polished metallic long stem , 3. polyethylene acetabular cup , 4. metallic femoral head , 5.pmma bone cement , total hip replacement ( thr ) un cemented , 1. coated metallic stem standard length , 2.long metallic stem coated , 3. coated metallic acetabular shell standard , 4. polyethylene acetabular liner , 5. polished metal head , 6. coated metallic multihole acetabular shell , 7. ceramic acetabular liner , 8. ceramic femoral head , hemi replacement hip arthroplasty ( hra ) un cemented , 1. coated metallic stem , 2. moduler head , total shoulder replacement , 1. polyethylene glenoid component , 2. polished metalic humeral head , 3. metallic humeral stem , 4. bone cement , reverse shoulder arthroplasty , 1.glenoid fixation dome , 2. glenoid sphere , 3. polyethylene spacer , 4. humeral stem , hemi shoulder replacement , 1. metallic humeral stem , 2. humeral head , 3. bone cement antibiotic impregnated , knee arthroscopy arthroscopyshaver blade , knee arthroscopy arthroscopyshaver blade , composit biodegradable screws , composit biodegradable screws , composit biodegradable screws , composit biodegradable screws , suture button , suture disc , suspension loop , suture anchor , suture anchor , fiber tape , fiber wire , orthopedics ot instruments : , screw driver , screw driver , screw driver , screw driver , hohman bone lever blunt tip , hohman bone lever blunt tip , hohman bone elevator blunt tip , hohman bone elevator blunt tip , esmarch bandage , esmarch bandage , jumbo cutter stainless steel , straight osteotome , straight osteotome , curved osteotome , curved osteotome , double ended curette straight , double endedcurette curved , condyle reduction clamp , thandle , periosteal elevator , lead apron handle , pointed reduction clamp , bone holding forceps , bone holding forceps , bone holding forceps , plate holding forceps , bone nibbler , wire plier , wire cutter , universal plate bender , hammer / mallet , universal interlocking nail extractor set , mipo wire passer , mipo wire passer , mipo wire passer , wire twister , self retaining retractors staright , self retaining retractors staright , self retaining retractors hinged , self retaining retractors hinged , fossa finder , jr circuit , langenbeck retractor , bone awl , bone awl , bone hook , adjustable knee position , jumbo cutter steel , towel clip , dura forcep , dandy artery , shunt introducer / tunnelar , shunt trocar , hudson brace hand drill , perforator , burr , head ring , kerrison rongeur , tumor biopsy forceps , screw driver for carnio plasty , brain needle , penfield tissue dissector , dura cutting scisser , laryngoscope with miller blade blade no 00, 0, 1 , laryngoscopes with 3 adult blades...

Medical College - Rajasthan

33642212 supply of ophthalmology surgical items iris hook ctr ( capsular tens on ring ) 13.5 mm iris claw lenses capsular hook punctum plugs mini drape ( 100xso ) incise cut with drain bag intra ocular magnet of foreign body silicon tube for dcr bcl ( bandage contact lens ) , biznanual aspiration hand piece disposable bimmmanuai irrigation hand piece disposable lacrimal canula disposable lewicky lens manipilatar disposable blunt phaco chopper disposable sodium hyaluronate 3% + chondroitin sulphate 4% imi ( preservative free ) sodium hyaluronate 0.8% 05ml...

Rajasthan University Of Health Science - Rajasthan

33627667 annual rate contract for supply of drug and medicines and surgical items under mndy at ruhs hospital of medical sciences, jaipur hospital of medical sciences, jaipur , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg [2] , bupivacaine inj ip 0.5% [4] , halothane bp [6] , isoflurane usp [7] , ketamine inj ip 50 mg/ ml [8] , lignocaineointment 5o/o [9] , lignocaine and adrenaline inj ipeach ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg [10] , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg [11] , lignocaine gel ip 2% [ 12] , lignocaine inj ip 2 o/o [ 13] , sevoflurane [491] , atropine sulphate injection 0.6mg/ml [654] , diclofenac sodium inj ip 25 mg/ ml (im/iv use) [19] , diclofenac gastro resistant tablet ip 50 mg(enteric coated) [20] , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+ paracetamol25 mg [22] , ibuprofen tab ip 200 mg (coated) [23] , ibuprofen tab ip 400 mg (coated) [24] , morphine sulphate inj ip10mg/ml [25] , paracetamol drops paediatric paracetamol oral suspension ip (each ml contains paracetamol 150mg) [26] , paracetamol syrup ip 125 mg/5ml (detail in rc) [27] , paracetamoltab ip 500 mg [28] , paracetamol inj. 150 mg/ml [29] , tramadol cap ip 50 mg [32] , tramadol inj50 mg/ml [33] , indomethacin cap ip 25 mg [436] , diclofence prolonged release tablet ip 100 mg [437] , ibuprofen oral suspension bp /usp 100 mg/ 5 ml [477] , diclofenac sod + paracetamol tablets ip diclofenac sod50 mg + paracetamol 325 mg [483] , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg [ 492] , diclofenac gel: diclofenac diethylamine 1.16%, methylsalicylate 10%, linseed oil 3%, menthol 5% [493] , etoricoxib tab ip 120mg [495] , mefenamic acid tablets bp 500 mg [496] , fentanyl citrate injection 50mcg/ml [655] , naproxen tablet ip 500mg [656] , naproxen tablet ip 250mg [657] , etoricoxib tablet 90 mg [658] , aspirin tablet ip ( gastro resistant) 150 mg [679] , butorphanol tartrate injection usp 1mg/ml 1ml size[694] , diclofenac sodium aqueous injection 75mg/ ml1ml size, iv & im use [695] , paracetamol infusion ip 1% w/v 100ml size [696] , baclofen tablet ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) [698] , chlorpheniramine maleate tab ip 4mg [37] , dexamethasone tab ip 0.5 mg [40] , hydroxyzine tab ip 25 mg [43] , methyl prednisolone sodium succinate for injection usp 500 mg [ 44] , pheniramine inj ip 22.75mg /ml [45] , prednisolone tab ip 5 mg [47] , promethazine tabip 25 mg [50] , betamethasone sod phos inj ip 4mg/ml [418] , prednisolone tablet ip 10 mg [469] , prednisolone tab ip 20 mg [470] , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg [ 497] , cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab [498] , cetirizine syrup ip 5mg/ 5 ml [499] , levoceitrizine tablet 5mg [659] , montelucast(10mg) + levocetrizine tablet ( 5mg) [660] , dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) [700] , naloxone inj ip 0.4mg/ ml [51] , pralidoxime chloride injection ip 25 mg/ml / 500 mg[52] , carbamazepine tab ip 200 mg (film coated) [ 53] , phenobarbitone tab ip 30 mg [56] , phenytoin injection bp 50mg/ml [57] , phenytoin tab ip 100 , sodium valproateinj 100 mg/ ml [60] , carbamazepine oral suspensionusp 100 mg/5ml [474] , sodium valproate tablet(gastro resistant) ip 500mg [661] , clobazam tablet/ capsule 5 mg [662] , clobazam tablet/ capsule 10 mg [663] , levetiracetam tablet ip 500 mg [664] , levetiracetam oral solution/suspension 100mg/ml [665] , levetiracetam injection 500mg/5ml [666] , gabapentine tablet/ capsule 100mg [667] , gabapentine tablet/ capsule 300mg [668] , divalproex extended release tablet ip 250mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) [702] , oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip150 mg) [703] , lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100 mg) [ 704] , topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) [ 705] , acyclovir oral suspension ip 400mg/ 5ml [62] , acyclovir tabip 200 mg [63] , acyclovir tab ip 800 mg [64] , albendazole oral suspension ip 400 mg/ 10ml [65] , albendazole tablets ip 400 mg(detail in rc) [ 66a] , amikacininj ip 500 mg [68] , amoxycillin and cloxacillin cap 250 +250 mg [69] , amoxycillin and potassium clavulanate tabs ip 500 mg + 125mg [70] , amoxycillin cap ip 250mg [71] , amoxycillin cap ip 500mg [72] , azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) [78a] , azithromycin tablets ip 250mg [79a] , azithromycin tab ip 500 mg [80a] , benzathine benzylpenicillin inj ip 12 lac units [81] , benzathine benzylpenicillin inj ip 6 lac units [82] , cefixime tab ip 100 mg [84] , cefixime tab ip 200 mg [85] , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm) (im/iv use) [86] , ceftazidime inj ip 1g [ 89] , ceftazidime inj ip250 mg [90] , ceftazidime inj ip500 mg [91] , ceftriaxone inj ip1g / vial [93] , ceftriaxone inj ip250 mg/vial [94] , cephalexin cap ip 250 mg [96] , cephalexin cap ip 500 mg [97] , chloroquine phosphate inj ip 40 mg/ ml [98] , ciprofloxacin injection ip200mg/100ml [101] , ciprofloxacin tablets ip 250 mgfilm coated [ 102] , ciprofloxacin tablet ip 500 mg film coated [ 103] , clotrimazole creamip2% w/w [104] , clotrimazole vaginal tab ip500mg [105] , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200mg [107] , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg[108] , diethylcarbamazine tab ip 100 mg [110] , doxycycline cap ip 100 mg [111] , fluconazole tablets ip 150mg [114a] , griseofulvin tabip 125 mg [117] , itraconazole cap 100 mg [118] , meropenem inj ip 500 mg [119] , metronidazoleinjip 500 mg/100ml [120] , metronidazole tablets ip 400 mg (film coated) [123] , norfloxacin tab ip 400mg film coated [ 124] , ofloxacin tab ip 200 mg [125] , primaquine tab ip 2.5 mg [128] , primaquine tab ip 7.5 mg [129] , quinine sulphate tablets ip 300 mg (film coated) [132] , nitrofurantoin tab ip 100mg [413] , cloxacillin sodium inj ip 500mg [417] , cephalexin oral suspension ip ( cephalexin dry syrup ip) 125mg/ 5 ml [427] , ofloxacin oral suspension ip 50mg/ 5ml [428] , tinidazole tab ip 500 mg (film coated) [431] , piperacillin + tazobactum for injection ip 4gm+500mg [468] , amoxycillin oral suspension ip (dry syrup) 125 mg/5ml[473] , cefpodoxime dispersible tab 50 mg [ 475] , meropenem inj. ip 1gm [481] , acyclovir intravenous infusion ip 250mg [502] , amikacin inj ip 250 mg [504] , amoxicillinand potassium clavulanic ip inj 600mg [505] , amoxicillinand potassium clavulanate inj ip 1.2gm [506] , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg/5 ml ( 30ml bottle) [507] , artesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mg vial, sodium bicarbonate injection ip 5 o/o w/v (1ml ampoule),sodium chloride injection ip 0.9o/o w/v (5ml ampoule) [508a] , aztreonam injection usp500 mg [509] , cefixime oral suspension ip 25mg/ml (paediatric drops) [511] , cefuroxime axetil tab ip 250 mg [512] , clindamycin capsule ip 150mg [513] , clindamycin capsule ip 300 mg [514] , levofloxacin tablets ip 250 mg [515] , linezolid tablets ip 600 mg [516] , linezolid inj200mg/ 100ml [517] , mefloquine tablets ip 250 mg [518] , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg [520] , ofloxacin infusion ip 200mg / 100 ml(in nacl inj) [521] , vancomycin for intravenous infusion ip 500 mg [523] , vancomycin for intravenous infusion ip 1 gm [524] , artemether and leumefantrine tablet ( 80 mg and 480 mg) [651] , co trimoxazole tablet ip (trimethoprim 160mg+ sulphamethoxazole800mg) [669] , framycetin sulphate cream 1 o/o 30gm pack [684] , framycetin sulphate cream 1 o/o 100 gm pack [685] , artemether and leumefantrine tablet ( 40 mg and 240 mg) [686] , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg& potassium clavulanate ip 125 mg [706] , piperacillin injection 2 gm + tazobactom 250mg ip [707] , ceftriaxone 1 gm + tazobactum 125 mg injection [708] , cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) [709] , cefadroxil tablet 500mg [710] , ofloxacin oral suspension ip(each 5ml contains ofloxacin ip 100 mg) 30 ml size [711] , levofloxacin tablet ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) [712] , faropenem tablet sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) [713] , clindamycin phosphate injection ip 300 mg [714] , imipenem + cilastatin injection 500mg/500mg ip powder for solution [715] , meropenem injection ip 250 mg [717] , voriconazoleinjection 200mg/vial [720] , terbinafine hydrochloride tablet 250 mg [721] , valganciclovir tablet 450 mg [722] , entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) [ 723] , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution) [724] , azathioprine tab ip 50 mg [133] , cyclophosphamide inj ip 200 mg [138] , danazol cap ip50 mg [ 142] , methotrexate tab ip2.5 mg [154] , imatinib tab ip 400mg [ 534] , methotrexate tablets ip 10 mg [536] , cyclosporin capsule usp/ip 50 mg [677] , cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50mg) [736] , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg [160] , levodopa and carbidopa tab 250 mg+ 25 mg [161] , trihexyphenidyl hcl tab ip 2 mg [162] , bromocriptine tablets ip2.5 mg [540] , acenocoumarol tab ip/ nicoumalone tab ip 2 mg [163] , ethamsylate inj 250 mg/ 2ml (im/iv) [173] , heparin sodium inj ip 5000 iu/ml (im/iv use) [174] , humanalbumin solution ip 20% [175] , rh erythropoetininj ip 10000 iu [176] , rh erythropoetininj ip 2000iu [177] , rh erythropoetininj 4000 iu [179] , vitamin k injection each ml contains menadione sodium bisulphite10mg equivalent to 5.2 mg of menadione. (aqueous solution) [180] , tranexamic acid tablets ip 500 mg [545] , warfarin sodium. tab ip 5mg [546] , ethamsylate tablet 500 mg (each uncoated coated tablet contains ethamsylate 500 mg) [ 745] , tranexamic acid injection ip 100mg/ml 5ml size [747] , amiodaronetab ip 100 mg [181] , amiodarone tab ip 200 mg [182] , amlodipine tabip 2.5 mg [184] , amlodipine tabletsip 5 mg [185] , atenolol tab ip 50 mg [ 186] , atorvastatin tab ip 10mg [187] , clopidogrel tab ip 75 mg [188] , digoxin tab ip 0.25 mg. [190] , diltiazem tabs ip 30 mg film coated [191] , dobutamine inj ip 50mg/ml/250mg (vial/) dobutamine inj ip 250 mg/5ml(amp) [192] , dopamine hydrochloride injip 40 mg/ml [193] , enalapril maleate tab ip 5mg [194] , enalapril maleate tab ip 2.5mg [195] , isosorbide dinitrate tab ip 5 mg [197] , isosorbide mononitrate tabs ip 20 mg [198] , lisinopril tab ip 5 mg [ 199] , losartan tab ip 50 mg [ 200] , magnesium sulphate inj. ip 500mg/ml (50%w/v) [201] , methyldopa tab ip 250mgfilm coated [ 202] , nifedipine cap ip 5mg [ 203] , nifedipine tablets ip 10 mg (sustained release) [204] , nitroglycerininj5 mg/ ml [205] , propranolol tabip 40 mg [207] , streptokinase injection 15 lac units ip [209] , verapamil tab ip 40 mg film coated [211] , labetalol tab ip 100mg [410] , labetalol hcl inj ip 20mg/4ml [411] , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg) [ 444] , amlodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) [457] , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) [458] , losartan potassium and hydrochlorothiazide tablets ip(losartanpotassium 50 mg, hydochlorothiazide 12.5 mg) [459] , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg [460] , atenolol tab ip 25 mg [ 462] , enalapril maleate tablets ip 10 mg [463] , lisinopril tablets ip 10 mg [465] , lisinopril tab ip 2.5 mg [466] , losartan tab ip 25 mg [ 467] , atorvastatin tablets ip 40 mg [548] , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg [549] , fenofibrate capsules/ tab ip 200 mg [550] , metoprolol tablets ip 25 mg [552] , metoprolol succinate extended release tablets ip 50 mg[553] , prazosin tablets ( extended release) 2.5 mg [555] , telmisartan tablets ip 40 mg [556] , urokinase injection 5 lac unit (lyophilized) [ 557] , ramipril tablets ip 2.5 mg [636] , glyceryl trinitrate tablets 2.6 mg controlled release tablets [650] , clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) [751] , esmolol hydrochloride injection 10mg/ml 10ml size [753] , carvedilol tablet 3.125mg [755] , rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) [ 756] , rosuvastatin tablet 10 mg [757] , chlorhexidine mouthwash ip 0.2 o/o [ 580] , dental gel choline salicylate 8.7 o/o, benzalkonium chloride 0.01 o/o, lignocaine hcl 2 o/o (flavoured gel base) [581] , tooth gel sodium monofluorophosphate 0.7 o/o andpotassium nitrate 5 o/o (in flavoured base) [582] , metronidazole 1% and chlorhexidine gluconade 0.25% gel [ 584] , compound benzoic acid ointment ip benzoic acid 6 o/o + salicylic acid 3 o/o [106] , acyclovir cream 5% [ 213] , cetrimide cream ip 15 gm [215a] , fusidic acid cream ip 2 % [216a] , liquid paraffin ip 400 ml [218] , silver sulphadiazine cream ip 1% 50gm tube [224] , gentian violet topical solution usp 1o/o [246] , clotrimazole mouth paint (clotrimazole 1 o/o w/v) [443] , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5% and clotrimazole 1 %) [445] , gamma benzene hexachloride lotion 1%(lindane lotion usp) [ 446] , betamethasone dipropionate cream ip 0.05% [558] , betamethasone lotion ip0.05 o/o [559] , clindamycin phosphate gel usp 1 o/o [560] , clobetasol propionate cream ip 0.05 o/o [561] , glycerin ip 100 ml [564] , ketoconazole cream 2% [565] , permethrinlotion5% [ 568] , permethrin cream 5% [ 569] , tretenoin cream usp 0.025% [570] , coal tar 6% & salicylic acid 3% ointment [670] , calamine lotion ip 100ml [671] , powder clotrimazole 1% w/w 30 gm [759] , terbinafine cream 1%w/ w (10 gm tube) [760] , olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size [761] , oitment mupirocin ip 2% [762] , anti a blood grouping serum ip(anti amonoclonal serum) [ 225] , anti b blood grouping serum ip(anti b mono clonal serum) [226] , anti d(rh) blood grouping serum ip/anti d blood grouping serum ip [227] , vdrl antigen (with + ve and ve control) / rpr slide kit [242] , iohexol usp (solution for injection) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml [482] , iohexol usp(solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. [672] , compound benzoin tincture ip [244] , formaldehyde solution ( 34.5 per. 38 per.) [245] , gluteraldehyde solution 2% [247] , chlorhexidine gluconate solution 5% 250 ml [447] , povidone iodine solution ip 5% 100ml bottle [ 450] , povidone iodine ointment usp250 gm [ 571] , povidone iodine solution ip 10 % [572] , acetazolamide tab ip 250mg [253] , frusemide tab ip 40 mg [254] , furosemide injectionip 10mg/ml (im and iv use) [255] , hydrochlorthiazide tab ip 12.5 mg [256] , mannitol inj ip 20% w/v [257a] , spironolactone tabip 25mg [258] , torsemide tab 10 ip mg [259] , hydrochlorthiazide tab ip 25mg[464] , spironolactone tablets ip50 mg [574] , ciprofloxacin 0.3 o/o and dexamethasone 0.1 o/o ear drops ciprofloxacin and dexamethasone otic suspension usp [585] , clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops [586] , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp [588] , ceruminolytic drops ( wax dissolving ear drops) paradichlorobenzene 2 o/o , benzocaine 2.7 o/o , chlorbutol 5 o/o, turpentine oil 15 o/o [ 589] , drotaverine hydrochloride inj 40 mg/2 ml [5] , ointment containing lidocaine ip 3 o/o zinc oxide ip 5 o/o , hydrocortisone ip 0.25 o/o,allantoin ip 0.5 o/o [219] , antacid tablets. formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil [260a] , antacidliquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide250mg, activatedpolydimethyl siloxane 50mg [261a] , bisacodyl tab ip 5 mg [ 262] , dicyclominetab ip 10 mg [263] , dicyclomineinj ip 10 mg /ml [264] , dicyclomine hydrochloride oral solution ip 10mg /5ml [ 265] , domperidone suspension ip 5mg/5ml[266] , domperidone tab ip10 mg [267] , loperamide tabip 2 mg [269] , metoclopramide injip 10mg/2ml [270] , metoclopramide tabip 10 mg [271] , omeprazole cap ip 20 mg [272] , ondansetron inj ip 2mg/ ml [273] , ors powder ip [274] , pentoprazole inj40 mg [275] , ranitidine hcl injectionip 50mg/2ml [ 276] , ranitidine tabip 150mgfilm coated [ 277] , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate10 o/o disodium hydrogen phosphate dodecahydrate8 o/o[ 278] , hyoscine butyl bromide tablets ip 10mg [414] , drotaverine tab ip 40 mg [415] , ranitidine tabip 300mg film coated [433] , dicyclomine hydrochloride and activated dimethicone suspensioneach ml contains dicyclomine hydrochloride 10mg activated dimethicone40mg[438] , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets [439a] , metoclopramide hydrochloride syrup ip 5 mg/ 5ml [478] , domperidone oral drops 10mg/ ml(10ml) [590] , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg [591] , lactic acid bacillus tab 60 million spores [592] , lactulose solution usp/ bp 10gm/15ml or 3.35 gm/5ml [593] , liquid paraffin ip 100 ml [594] , ondansetron orally disintegrating tablets ip 4mg [595] , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets [596] , ursodeoxycholic acid tablets ip 300 mg [597] , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg) [763] , prochlorperazine mesylate injection 12.5mg/ml 5ml size [ 764] , probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) [765] , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2gm) [766] , allopurinol tabletsip 100 mg [598] , hydroxychloroquine sulphate tablets 200mg [599] , leflunomide tablets ip 10mg(film coated) [600] , leflunomide tablets ip/usp 20mg (film coated) [601] , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg [602] , biphasic isophane insulin inj ip (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) [ 279] , carbimazole tabs ip5 mg (film coated) [280] , clomifene tab ip 25 mg [282] , clomiphene tab ip 50 mg [283] , dinoprostone cream/ gel 0.5 mg dinoprostone in syringe [285] , glibenclamide tab ip 5 mg [287] , gliclazide tab ip 40 mg [288] , glimepiride tabip 2 mg [289] , glimepiride tab ip1mg [290] , glipizide tab ip 5mg [ 291] , hydroxyprogesterone inj ip 250mg /ml [293] , metformin tab ip 500 mg(film coated) [295] , norethisterone tab ip 5 mg [296] , pioglitazone tab ip 15 mg [297] , progesteroneinj 200mg/ 2ml [298] , insulin injection ip ( soluble insulin/neutral insulin injection)40 iu/ ml(r.dna origin) [300] , thyroxine sodium tablets ip 100mcg [301] , metformin hydrochloride(sustained release tablets ip 1000 mg [451] , glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) [ 452] , glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release) [453] , metformin hcl ( sustained release) and glimepiride tab metformin hcl ( sustained release) 500mg ,glimepiride 1mg [454] , metformin hydrochloride ( sustained release) and glimepiride tablets ip ( metformin hydrochloride (sustained release) 500 mg, glimipiride 2mg) [455] , glimepiride, pioglitazone and metformin hydrochloride ( sustainedrelease) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release) 500 mg [456] , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg) [603] , glucagon for injection usp 1 mg/ml [604] , thyroxine tablets ip 50 mcg [607] , insulin glargine 3ml ( 100iu/ml) with 15 insulin syringes and needles/cartridge 3ml ( 100iu/ml) with 15 needles and 1 pen per 20 cartridges [680] , tenaligliptin tablet ip 20mg [682] , human rabies immunoglobulin inj 150 iu/ ml [305] , rabies vaccine human ( cell culture) ip(intradermal)2.5 iu[ 306] , rabies vaccine human ( cell culture) ip (intramuscular) 2.5 iu/dose [307] , snake venum anti serum ip (lyophilized) polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6mg of cobra venum,0.45 mg of common kraite (bungaras)venum(details in rc) [308] , tetanus vaccine( adsorbed) ip 5 ml vial [ 310] , rabies antiserum ip ( equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (i.m./sc use) [408] , hepatitis b immunologlobin injection ip 200 i.u [767] , glycopyrrolate inj ip 0.2 mg/ml [312] , neostigmine inj ip 0.5 mg/ml [314] , neostigmine tab ip 15 mg [316] , chlorzoxazone , diclofenac sodium & paracetamol tablets (chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg) [610] , tropicamide eye drop ip 1o/o [241] , atropine eye ointment ip 1% [319] , atropine sulphate ophthalmic solution usp 1% [320] , chloramphenicol eye drops ip 0.5 0/0 [321] , ciprofloxacin eye drops ip 0.3 o/o w/v [322] , hydroxypropylmethyl cellulose solution 20 mg/ ml [324] , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o/o +0.1 o/o [330] , tobramycin eye drops 0.3% [331] [331] , flurbiprofen sodium ophthalmic solution ip 0.03 o/o w/v [421] , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. [423] , lidocaine hcl topical solution usp 4% [424] , timolol eye drops ip 0.5 o/o w/v [484] , homatropine eye drops ip 2% [485] , travoprost eye drops ip 0.004 o/o [486] , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% [487] , betaxolol eye drops 0.5 o/o [612] , carboxymethylcellulose eye dropsip 0.5% [613] , phenylephrine hydrochloride opthalmic solution usp/ phenylephrine eye drops bp 5% [614] , acyclovir eye ointment ip 3% w/w 5gm size [ 769] , eye drop moxifloxacin 0.5% w/v ophthalmic solutionip 5ml size [ 770] , chloramphenicol 1% w/ w eye ointment ip, 3gm size [771] , isoxsuprine tab ip 20 mg [334] , methylergometrine inj ip 0.2 mg/ml [335] , methylergometrine tab ip 0.125 mg [336] , misoprostol tab ip 200 mcg [337] , oxytocin injip 5 iu/ml [338] , mifepristone tab ip 200mg [615] , natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule containsprogesteron ip 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron ip 200 mg) [772] , cabergoline tabletip 0.5mg(each uncoated coated tablet contains cabergoline ip 0.5mg) [ 773] , human chorionic gonadotropin injection ip 5000 i.u. [774] , alprazolam tab ip 0.25 mg [339] , alprazolam tab ip 0.5mg [340] , amitriptyline tabip 25mgfilm coated [341] , chlordiazepoxide tablets ip 10mg [342] , chlorpromazine tablets ip 100 mg (coated tablet) [343] , chlorpromazine tablets ip 25 mg (sugar coated) [344] , chlorpromazine tablets ip 50 mg(coated tablets) [345] , escitalopram tab ip 10 mg [351] , fluoxetine cap ip 20 mg [352] , haloperidol inj ip 5 mg/ ml [353] , haloperidol tab ip 5 mg [355] , imipramine tab ip 25 mg (coated tab) [356] , imipramine tab ip 75 mg (coated) [357] , lithium carbonate tab ip 300 mg [358] , lorazepam inj ip 2 mg/ ml [359] , olanzapine tabip 5 mg [360] , risperidone tab2mg [ 361] , risperidone tab 1 mg [ 362] , sertraline tab ip 50 mg [363] , trifluperazine tabip 5 mgcoated [364] , quetiapine tablet ip 50mg [674] , quetiapine tablet ip 25mg [675] , clonazepam tablet 0.5mg [678] , levosulpiride tablet 25 mg (each uncoated tablet contains levosulpiride 25 mg) [ 777] , lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) [ 778] , aminophylline inj ip 25 mg/ml [365] , beclomethasone inhalation ip 200 mcg/ dose [366] , budesonide nebulizer suspension 0.25mg/ml [ 367] , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup q.s. [368] , ipratropium bromide nebulizer solution 250 mcg/ ml [369] , salbutamol tablet ip 4 mg [370] , salbutamol inhalation 100 mcg /dose [371] , salbutamol nebuliser solution bp 5 mg/ml [ 372] , salbutamol tabip 2 mg [373] , theophylline and etofylline injection( anhydrous theophylline 50.6mg + etofylline 169.4 mg) [374] , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg) [375] , theophylline tablet 400mg sustained release/ controlled release (theophylline prolonged released tablet ip) [376] , salbutamol syrup ip 2mg/ 5ml [432] , dextromethorphan hbr syrup ip 13.5mg / 5ml [ 440] , saline nasal solution ( drops) (sodium chloride 0.65 o/o) [442] , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg [616] , budesonide powder for inhalation200 mcg [ 617] , ipratropium powder for inhalation ip 40 mcg [ 618] , xylometazolinenasal dropsip 0.1% [620] , cough syrup/ expectorant(50) ml [692] , acebrophylline tablet/ capsule 100 mg [780] , compound sodium lactate inj. ip [377] , dextrose inj ip 10% [ 379] , dextrose inj ip 5% [380] , potassium chloride inj. 0.15 gm/ml [383] , potassium chloride oral solution u.s.p 500mg/ 5ml [384] , sodium chloride and dextrose injection ip 0.9 o/o + 5 o/o [385] , sodium chloride inj ip 500 ml [386] , sodium chloride injection ip 100 ml [621] , tamsulosin hcl tablets/ capsule 0.4 mg [576] , flavoxate tablets ip 200 mg (coated tablet) [ 579] , levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatinlevamisol hydrochloride ip 50 mg) [785] , dutasteride tablet 0.5 mg [787] , alkylizer syrup 1.4 gm/ 5 ml( 100 ml ) (disodium hydrogen citrate) [788] , betahistine tab ip 8 mg [541] , betahistine tab ip 16 mg [542] , cinnarizine tablets ip 25 mg [543] , cinnarizine tablet ip 75 mg [544] , ascorbic acid tab ip 500 mg [387] , calcium gluconate inj ip 10%(iv use) [388] , ferrous sulphate with folic acid