Medical Education Department - Rajasthan

34145057 bids are invited for micropipettes single channel of variable volume , adjustable volume digital multiple channel nvhsp for microbiology micropipettes , hot air oven , water bath , bodincubator , vortex mixer , vertical autoclave , water purification system total quantity : 11...

Government University - Rajasthan

34110349 tender for purchase of equipments & instruments x ray machine 300 ma, portable x day machine, cr system emergency trolley, defibrillators, plaster cutter, iv stands, crush carts, dressing trolleys, of tables for ortho, gynet & obst., o1 lights, coutry, labour table, infusion pump, crush cort, bp instruments. fetal dopplers, incubator for baby, minor ot table & portable lights. ortho electrocomd pneumatic drilling machine. all instruments set for general surgery, gynec & obst & orthopedic surgery icu beds 10, anesthesia machine 2 & icu ventilators 1, cardiac monitors central station 108 10 for ot, emergency etc) defibrillator. cssd dressing drums 50, autoclaves 2, trays 10 ward jopd patient stretchers, wheel chairs, bedside lockers, examination couches xray view boxes, round steel stool etc▸ modular ot, icu & emergency curtain etc....

University Of Agriculture - Rajasthan

34007835 supply of field article for ars mandore 1. kraft seed container ( star paper ) 2. kraft seed container ( star paper ) 3. kraft seed container ( star paper ) 4. kraft seed container ( star paper ) 5. kraft seed container ( star paper ) 6. kraft seed container ( star paper ) 7. butter paper bag ( for test weight ) 8. crossing bag ( butter paper ) 9. crossing bag ( butter paper ) 10. luggage label no.4 ( one metal eyeleted ) 11. luggage label. no.4 ( one metal eyeleted ) 12. luggage label no.3 ( one metal eyeleted ) 13. plant tag with thread price label oval shaped 14. field note book 15. data sheet 16. markin cloth bag 17. markin cloth bag 18. markin cloth bag 19. markin cloth bag 20. markin cloth bag 21. markin cloth bag 22. printed markin cloth bag 23. printed markin cloth bag 24. printed markin cloth bag 25. printed markin cloth bag 26. printed jute canvass bag 27. plastic katta 28. polythene bag 29. .., polythene bag 30. polythene bag 31. polythene bag 32. polythene bag 33. polythene bag 34. polythene bag 35. polythene bag ( with zip lock ) 36. polythene bag ( with zip lock ) 37. plastic peg for plot identification 38. plastic peg for plot identification 39. luggage label no.4 with plastic cover 40. plastic water proof label with thread 41. plastic pots 42. laboratory apron terricoat 43. breeding clip ( 1000 / packet ) 44. crossing ! hag machine made ( butter paper ) 45. selfing bag machine made ( butter paper ) 46. selfing bag machine made ( butter paper ) 47. selfing bag ( butter paper ) 48. plastic container with lids 49. plastic crates 50. nylon net plastic bag 51. single side printed markin cloth bag 52. single side printed markin cloth bag, single colour 53. single side printed markin cloth bag single colour 54. single side printed markin cloth bag single colour 55. single side printed markin cloth bag single colour 56. single side printed markin cloth bag single colour 57. single side printed jute canvass bag single colour 58. printed jute canvass bag 59. nylon net seed bag 60. acrylic label with stand for field, acrylic 61. autoclave bag for mushroom 62. plastic ring for mushroom...

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Govind Guru Tribal University - Rajasthan

33934146 supply of pharmacy lab equipments 1 ampoule filling & sealing machine hand operated model 2 magnetic stirrer 500ml & 1 ltr cap with taflon ball 3 aseptic cabinet medium size 4 tablet coating machine 12dia without polish pan lab model note. heavy duty coating pan rate on request 5 ball mill 1 kg cap. fixed seed note. with 1 rpm accuracy rate on request 6 double cone blender lab model fixed speed note. with 1 rpm accuracy rate on request 7 autoclave 12x12 all. 8 steam distillation still glass part complete with heating mantle 9 vacuum pump 15 ltr oil free 10 standard sieves no. 8, 10, 12, 22, 44, 66, 80 set of 7 11 tablet punching machine hand operated 12 capsule filling machine hand operated 13 ampoules washing machine demonstration model 14 tablet disintegration apparatus single basket with digital timer 15 hardness tester monsanto type 16 friability test apparatus single drum with digital timer 17 clarity test apparatus 18 bod incubator 4 cu.ft alluminium digital display 19 digital ph meter 20 bulk density digital model 21 hot plate 8 22 humidity chambers 18x18x18 digital superior quality 23 tray dryer 6 tray with digital temperature display 24 moisture balance 25 water bath 6 hole double wall, 26 ointment filling machine hand operated model 27 capsule counter 28 homoginizer variable speed controller 29 digital balance 10 mg acc. 30 microscope student note. medical microscope with 100x lens & mechanical stage rate on request 31 stage and eye piece micrometers a ) stage micrometer b ) micrometer eye piece 32 brookfileld viscometer model lv 201 note. original brookfield viscometer usa make rate on request. 33 sieve shaker machine hand operated model 34 extractive distillator complete assembly 35 mechanical stirrers with variable speed controller 36 suppository mould 4 mould 37 ultra sonicator 2 ltr cap. 38 sterility tester 3 stage with stand without vaccum pump 39 franz diffusion cell only glass part 40 hot air oven 14x14x14 all. 41 tablet dissolution test app. single stage microprocessor base 42 mortar and pestle porcelean 6 dia 43 milli pore filter 47 mm 44 vacuum distillator 45 desiccators soda glass 6 46 refrigerator pharmacy use 47 tincture press 48 centrifuge 4 tube 49 colony counter digital 50 antibiotic zone rader 51 laminar air flow 2ft x 2ft x 2ft 52 micropipette single & multi channel a ) single channel b ) multi channel 53 uv cabinet 2 tube , 1 refractometer / abbe refractometer 2 polarimeter student model note. research polarimeter rate on request 3 photoelectric colorimeter 8 filter 4 atomic model set 120 balls 5 electronic balance 10 mg 6 periodic table chart 7 hot plates 8 dia 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 analytical balances with wt box 11 digital balance 10mg sensitivity 12 suction pumps glass 13 muffle furnace 9x4x4 digital temperature display 14 mechanical stirrers with variable speed controller 15 magnetic stirrers with thermostat with teflon ball 16 vacuum pump 15 ltr cap oil free 17 digital ph meter 18 microwave oven 19 distillation unit 4 ltr cap. 20 arsenic limit test apparatus 21 reflux flask and condenser double / triple necked a ) double neck b ) triple neck 22 nesslers cylinders 23 reflux flask and condenser single necked 24 electronic water bath ( 12 holes ) 25 copper water bath 6 dia 26 colorimeter 8 filter digital 27 uv visible spectrophotometer single beam with software 28 flourimeter digital 29 digital balance ( 1mg sensitivity ) 30 nephelo turbidity meter digital 1000 ntu superior 31 flame photometer digital double display 32 potentiometer digital 33 conductivity meter digital sup. 34 hplc imported 35 hptlc ( desirable ) , 36 atomic absorption and emission spectrophotometer ( desirable ) 37 biochemistry analyzer ( desirable ) 38 carbon, hydrogen, nitrogen analyzer 39 deep freezer ( desirable ) 40 ion exchanger 50 ltr. cap. 41 lyophilizer ( desirable ) pharmacology dept. 1 microscopes student note. medical microscope with 100x lens & mechanical stage rate on request 2 haemocytometer indian 3 sahil haemoglobinometer 4 hutchinsons spirometer 6 ltr cap. 5 spygmomanometer digital 6 stethoscope 7 contraceptive devices pack in plastic box 8 pregnancy diagnosis kit 9 mercury thermometer 10 cell analyzer ( trinocular microscope with camera attachment ) 11 permanent slides for various tissues pack of 50 12 models for various organs large 13 specimen for various organs and systems small size 14 skeleton with bones 15 muscle electrodes 16 lucas moist chamber without stand 17 myographic lever with board but without stand 18 stimulator student model 19 centrifuge 4 tube 20 sherringtons kymograph machine e 8 model superior 21 sherrington drum spare drum for above 22 perspex bath assembly ( single unit ) 23 aerators 24 software packages for experiment validity for 1 year renew every year charges will be same. 25 standard graph of various drug 26 actophotometer ( activity cage ) 27 rotarod 2 compartment, 29 analgesiometer ( eddys hot plate and radiant heat methods ) a ) eddy hot plate digital b ) radiant heat method analog 30 convulsiometer electro 31 plethysmograph without mercury with stand 32 digital ph meter 33 histamine chamber with glass neubilizer 34 metabolic cage s.s. 35 dissection tray & boards a ) dissection tray 12x10 gi sheet b ) dissection board 7x5 36 stereotaxic apparatus for rat & mice note. other required accessoreis rate on request 37 digital glucometer 38 folin wu tubes 39 hemostatic artery forceps 40 levers , cannula a ) levers ( i ) simple lever with pointer ( ii ) starling heart lever with pointer ( iii ) frontal writing lever b ) cannula ( i ) symes cannula ( ii ) venous cannula ( iii ) arterial cannula 41 hypodermic syringes & needles size 15, 24, 26g pharmacognosy dept. 1 compound microscope ( student microscope ) note. medical microscope with 100x lens & mechanical stage rate on request 2 dissecting microscope 3 projection microscope 6 dia 4 binocular microscope complete with optics 5 polarized microscope monocular 6 electronic digital balance cap. 600 gm acc. 10 mg 7 autoclave 12x12 alluminium, 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 zone reader 11 digital ph meter 12 colorimeter 8 filter 13 sterility testing unit 3 stage with stand without vaccum pump note. available in single stage with flask rate on request 14 camera lucida mirror type 15 eye piece micrometer 10x 16 stage micrometer 17 muffle furnace 9x4x4 digital 18 moisture balance 19 heating mantles small 250 ml 20 vacuum pump 15 ltr cap. oil free 21 micropipette single & multi channel a ) single channel b ) multi channel 22 micro centrifuge digital model t 16 23 electric water bath 6 hole 24 hot plate 8 dia 25 microtome rotary with accessoires 26 mixer grinder 27 uv cabinet double tube 28 water distillation unit 4 ltr.cap. 29 cutter mill ( bark and seed grinder ) 30 medicinal plant chart raxine 31 models fibre glass big size 32 permanent slide pack of 50 33 sonicator 2 ltr cap. 34 electrophoresis with analog power supply 35 fermentor 1 ltr capacity without computer. required accessories for fermentor a ) autoclave 12x12 s.s. b ) chiller bath 36 rotary shaker / v.d.r.l shaker with timer note. rotary shaker with 1 rpm accuracy rate on request phramcy practice lab 1 autoclave sterilizer 12x12 all. 2 hot air oven 14x14x14 all. 3 membrane filter s.s. 4 centrifuge 4 tube, 5 filling machine / bottle filling machine electrical operated 6 sealing machine bottle sealing machine hand operated 7 glucometer with strips 8 sintered glass funnel with complete filtering assemble 9 small disposable membrane filter for iv admixture filtration 10 vacuum pump 15 ltr oil free 11 surgical dressing 12 ph meter digital 13 blood pressure apparatus and stethoscope a ) blood pressure app. mercury b ) stethoscope 14 clinical thermometer mercury....

Dr. S.N.Medical College - Rajasthan

33900480 rate contract for purchase of electrical items rate contract for purchase of electrical items , electricalitems , element 6 kva , element 2 kva , electric 3 pin top isi / iso 6 amp , electric 3 pin top isi / iso 16 amp , electric wall plug 6 amp piano isi / iso , electric wall plug 16 amp piano isi / iso , electric switch piano 6 amp isi / iso , electric switch piano 16 amp isi / iso , switch & socket ( s.s.comand ) 16 amp , electric pandent holder plastic isi / iso , electric tube side pin holder isi / iso , electric bell isi / iso , electric bell switch isi / iso for table , electric mcb switch 25 amp isi / iso , electric mcb switch 6 amp isi / iso , electric mcb switch 16 amp isi / iso , electric mcb switch 32 amp isi / iso , isolator 2 poll32 amp , isolator 4 poll63 amp , isolator 4 poll100 amp , regulator for fan ( switch type ) , regulator for fan ( socket type ) , lid wire ( 3 core ) qty ( 1 coil ) , electric capacitor 4 mfd isi / iso , electric capacitor 2.5mfd isi / iso , electric pvc tape roll isi / iso , electric tube light starter isi / iso , electric wire flexibleisi / iso 23 / 76 gauze ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 4mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 2.5mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 1mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 1.5mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric wire 0.75mm isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric welding rod ( welding electrodes ) 10 h qty ( 1pkt ) , electric bed switch , telephone wire isi / iso ( coil of 90 mtr ) qty ( 1 coil ) , electric china connector pound isi / iso , electric mono block pump ½ h.p.isi / iso , electric bulb 25, 40, 60, 100, 200 watt isi / iso , electric chowk 36 watt isi / iso , electric room heater single rod isi / iso , electric room heater double rod isi / iso , electric tube rod 4’ isi / iso , electric tube rod 2’ isi / iso , 20 pair jelly filled unarmored cable ( 0.5mm copper ) qty ( 1 mtr ) , 10 pair jelly filled unarmored cable ( 0.5mm copper ) qty ( 1 mtr ) , 2 pair jelly filled unarmored cable ( 0.5mm copper ) qty ( 1 mtr ) , 1 pair jelly filled unarmored cable ( 0.5mm copper ) qty ( 1 mtr ) , 4mm wire cable qty ( 1 coil of 90 mtr ) , red bulb led 0.5w , electrical tester , electric drill machine hammer isi / iso , electric cutter machine isi / iso , battery terminal isi / iso , battery lug isi / iso , iron element 1500w isi / iso , gyser element isi / iso 1.5 kva ( 1500 watt ) , led bulb 5w , led bulb 7w , led bulb 9w , led bulb 11w , led bulb 12w , led bulb 15w , led bulb 17w , led bulb 20w , led bulb 23w , bulb holder ( bekellite ) , gyser thermostat , room heater / heat blower , switch board 4”x6” , switch board 8”x6” , switch board 8”x10” , switch board 10”x12” , electric bell for water tank , led tube light rod 4’ , led light 8”x8” ( for ceiling ) , led light 4”x4” ( for ceiling ) , led road light 100w , sterilizer element , desert cooler speed switch , desert cooler on / off switch , laryngoscope bulb , 5 port d link switch , 8 port d link switch , ups 600va , battery 12v 180ah ( on replacement basis ) , battery 12v 88ah ( on replacement basis ) , voltage stabilizer 2 kva for a.c. , voltage stabilizer 4 kva for a.c. , voltage stabilizer 5 kva for a.c. , stabilizer 2 kva , ups battery 42 ah ( on replacement basis ) , ups battery 42 ah ( without replacement basis ) , ups battery 26 ah ( on replacement basis ) , ups battery 26 ah ( without replacement basis ) , ups battery65 amp / 12volt ( on replacement basis ) , ups battery65 amp / 12volt ( without replacement basis ) , receiver cord for telephone , line cord for telephone , connection dp for telephone , 10 pair cable for epabx qty ( 1 mtr ) , contactor relay for autoclave machine 240v , bearing no. 6000 , bearing no. 6001 , bearing no. 6200 , bearing no. 6201 , bearing no. 6202 , bearing no. 6203 , desertcooler fan motor copper , desert cooler submersible pump 23w ( one season ) , desert cooler submersible pump 40w ( one season ) , desert cooler ball cock valve , desert cooler fan blade pvc , desert cooler fan leg , desert cooler fan leg nut , desert cooler distributor pvc , elbow for cooler ( p.v.c ) , electric pump namda isi / iso , endoscopy bulb 15v 150w , fan bush for cooler , fan ring bolt¾” for desert cooler qty ( 1kg ) , fan ring nut bolt 1 ½” for desert cooler qty ( 1kg ) , fan rivet for desert cooler qty ( 1kg ) , fan shaft for cooler , o.t.ceiling light bulb , screw ( for wood work ) various sizes steel 4”, 3”, 2½”, 1¾”, 1½”, ¾”, 1” qty ( 1kg ) , spanner fix , spanner ring , tata for desert cooler big size qty ( 1set ) , tata for desert cooler extra large size qty ( 1set ) , bit 6mm for hammer machine , bit 8mm for hammer machine , bit 10mm for hammer machine , ceiling fan clip , ceiling fan pipe 2 ft. , nut bolt with cottor pin ( no.10 ) for halfshed fan , nut bolt with cottor pin ( no.12 ) for halfshed fan , iron wire g.i. qty ( 1kg ) , electric plier , stone cutter 4” , wooden cutter 4” , stone cutter blade , iron cutter blade , wooden cutter blade , fan blade metal 18” , fan blade bolt , fan blade washer qty ( 1kg ) , rinch spanner 12” , rinch spanner 14” , multimeter , washer ironqty ( 1kg ) , telephone instrument , telephone instrument with id caller , 4 pin cfl 36 watt length 410mm , mcccb 160 amp. 4 pol adjustable o / l s / c , tp 63 amp. , mcccb 100 amp. 4 pol adjustable o / l s / c , bus bar chamber 63 amp. four strip copper , mcccb 100amp. 3pol adjustable o / l s / c , tpn switch side handle 63 amp. , copper wire coil 7 / 16 , copper lug , 811 item no. ( detailed description as per technical specification and compliance sheet ) , 812 item no. ( detailed description as per technical specification and compliance sheet ) , 813 item no. ( detailed description as per technical specification and compliance sheet ) , 814 item no. ( detailed description as per technical specification and compliance sheet ) , 815 item no. ( detailed description as per technical specification and compliance sheet ) , 816 item no. ( detailed description as per technical specification and compliance sheet ) , 817 item no. ( detailed description as per technical specification and compliance sheet ) , 818 item no. ( detailed description as per technical specification and compliance sheet ) , 819 item no. ( detailed description as per technical specification and compliance sheet ) , 820 item no. ( detailed description as per technical specification and compliance sheet ) , 821 item no. ( detailed description as per technical specification and compliance sheet ) , 822 item no. ( detailed description as per technical specification and compliance sheet ) , 823 item no. ( detailed description as per technical specification and compliance sheet ) , 824 item no. ( detailed description as per technical specification and compliance sheet ) , 825 item no. ( detailed description as per technical specification and compliance sheet ) , 826 item no. ( detailed description as per technical specification and compliance sheet ) , 827 item no. ( detailed description as per technical specification and compliance sheet ) , 828 item no. ( detailed description as per technical specification and compliance sheet ) , 829 item no. ( detailed description as per technical specification and compliance sheet ) , 830 item no. ( detailed description as per technical specification and compliance sheet ) , 831 item no. ( detailed description as per technical specification and compliance sheet ) , 832 item no. ( detailed description as per technical specification and compliance sheet ) , 833 item no. ( detailed description as per technical specification and compliance sheet ) , 834 item no. ( detailed description as per technical specification and compliance sheet ) , 835 item no. ( detailed description as per technical specification and compliance sheet ) , 836 item no. ( detailed description as per technical specification and compliance sheet ) , 837 item no. ( detailed description as per technical specification and compliance sheet ) , 838 item no. ( detailed description as per technical specification and compliance sheet ) , 839 item no. ( detailed description as per technical specification and compliance sheet ) , 840 item no. ( detailed description as per technical specification and compliance sheet ) , 841 item no. ( detailed description as per technical specification and compliance sheet ) , 842 item no. ( detailed description as per technical specification and compliance sheet ) , 843 item no. ( detailed description as per technical specification and compliance sheet ) , 844 item no. ( detailed description as per technical specification and compliance sheet ) , 845 item no. ( detailed description as per technical specification and compliance sheet ) , 846 item no. ( detailed description as per technical specification and compliance sheet ) , 847 item no. ( detailed description as per technical specification and compliance sheet ) , 848 item no. ( detailed description as per technical specification and compliance sheet ) , 849 item no. ( detailed description as per technical specification and compliance sheet ) , 850 item no. ( detailed description as per technical specification and compliance sheet ) , 851 item no. ( detailed description as per technical specification and compliance sheet ) , 852 item no. ( detailed description as per technical specification and compliance sheet ) , 853 item no. ( detailed description as per technical specification and compliance sheet ) , 854 item no. ( detailed description as per technical specification and compliance sheet ) , 855 item no. ( detailed description as per technical specification and compliance sheet ) , 856 item no. ( detailed description as per technical specification and compliance sheet ) , 857 item no. ( detailed description as per technical specification and compliance sheet ) , 858 item no. ( detailed description as per technical specification and compliance sheet ) , 859 item no. ( detailed description as per technical specification and compliance sheet ) , 860 item no. ( detailed description as per technical specification and compliance sheet ) , 861 item no. ( detailed description as per technical specification and compliance sheet ) , 862 item no. ( detailed description as per technical specification and compliance sheet ) , 863 item no. ( detailed description as per technical specification and compliance sheet ) , 864 item no. ( detailed description as per technical specification and compliance sheet ) , 865 item no. ( detailed description as per technical specification and compliance sheet ) , 866 item no. ( detailed description as per technical specification and compliance sheet ) , 867 item no. ( detailed description as per technical specification and compliance sheet ) , 868 item no. ( detailed description as per technical specification and compliance sheet ) , 869 item no. ( detailed description as per technical specification and compliance sheet ) , 870 item no. ( detailed description as per technical specification and compliance sheet ) , 871 item no. ( detailed description as per technical specification and compliance sheet ) , 872 item no. ( detailed description as per technical specification and compliance sheet ) , 873 item no. ( detailed description as per technical specification and compliance sheet ) , 874 item no. ( detailed description as per technical specification and compliance sheet ) , 875 item no. ( detailed description as per technical specification and compliance sheet ) , 876 item no. ( detailed description as per technical specification and compliance sheet ) , 877 item no. ( detailed description as per technical specification and compliance sheet ) , 878 item no. ( detailed description as per technical specification and compliance sheet ) , 879 item no. ( detailed description as per technical specification and compliance sheet ) , 880 item no. ( detailed description as per technical specification and compliance sheet ) , 881 item no. ( detailed description as per technical specification and compliance sheet ) , 882 item no. ( detailed description as per technical specification and compliance sheet ) , 883 item no. ( detailed description as per technical specification and compliance sheet ) , 884 item no. ( detailed description as per technical specification and compliance sheet ) , 885 item no. ( detailed description as per technical specification and compliance sheet ) , 886 item no. ( detailed description as per technical specification and compliance sheet ) , 887 item no. ( detailed description as per technical specification and compliance sheet ) , 888 item no. ( detailed description as per technical specification and compliance sheet ) , 889 item no. ( detailed description as per technical specification and compliance sheet ) , 890 item no. ( detailed description as per technical specification and compliance sheet ) , 891 item no. ( detailed description as per technical specification and compliance sheet ) , 892 item no. ( detailed description as per technical specification and compliance sheet ) , 893 item no. ( detailed description as per technical specification and compliance sheet ) , 894 item no. ( detailed description as per technical specification and compliance sheet ) , 895 item no. ( detailed description as per technical specification and compliance sheet ) , 896 item no. ( detailed description as per technical specification and compliance sheet ) , 897 item no. ( detailed description as per technical specification and compliance sheet ) , 898 item no. ( detailed description as per technical specification and compliance sheet ) , 899 item no. ( detailed description as per technical specification and compliance sheet ) , 900 item no. ( detailed description as per technical specification and compliance sheet ) , 901 item no. ( detailed description as per technical specification and compliance sheet ) , 902 item no. ( detailed description as per technical specification and compliance sheet ) , 903 item no. ( detailed description as per technical specification and compliance sheet ) , 904 item no. ( detailed description as per technical specification and compliance sheet ) , 905 item no. ( detailed description as per technical specification and compliance sheet ) , 906 item no. ( detailed description as per technical specification and compliance sheet ) , 907 item no. ( detailed description as per technical specification and compliance sheet ) , 908 item no. ( detailed description as per technical specification and compliance sheet ) , 909 item no. ( detailed description as per technical specification and compliance sheet ) , 910 item no. ( detailed description as per technical specification and compliance sheet ) , 911 item no. ( detailed description as per technical specification and compliance sheet ) , 912 item no. ( detailed description as per technical specification and compliance sheet ) , 913 item no. ( detailed description as per technical specification and compliance sheet ) , 914 item no. ( detailed description as per technical specification and compliance sheet ) , 915 item no. ( detailed description as per technical specification and compliance sheet ) , 916 item no. ( detailed description as per technical specification and compliance sheet ) , 917 item no. ( detailed description as per technical specification and compliance sheet ) , 918 item no. ( detailed description as per technical specification and compliance sheet ) , 919 item no. ( detailed description as per technical specification and compliance sheet ) , 920 item no. ( detailed description as per technical specification and compliance sheet ) , 921 item no. ( detailed description as per technical specification and compliance sheet ) , 922 item no. ( detailed description as per technical specification and compliance sheet ) , 923 item no. ( detailed description as per technical specification and compliance sheet ) , 924 item no. ( detailed description as per technical specification and compliance sheet ) , 925 item no. ( detailed description as per technical specification and compliance sheet ) , 926 item no. ( detailed description as per technical specification and compliance sheet ) , 927 item no. ( detailed description as per technical specification and compliance sheet ) , 928 item no. ( detailed description as per technical specification and compliance sheet ) , 929 item no. ( detailed description as per technical specification and compliance sheet ) , 930 item no. ( detailed description as per technical specification and compliance sheet ) , 931 item no. ( detailed description as per technical specification and compliance sheet ) , 932 item no. ( detailed description as per technical specification and compliance sheet ) , 933 item no. ( detailed description as per technical specification and compliance sheet ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Dr. S.N.Medical College - Rajasthan

33897350 rate contract for purchase of electrical items 1 element 6 kva 2 element 2 kva 3 electric 3 pin top isi / iso 6 amp 4 electric 3 pin top isi / iso 16 amp 5 electric wall plug 6 amp piano isi / iso 6 electric wall plug 16 amp piano isipso 7 electric switch piano 6 amp isi / iso 8 electric switch piano 16 amp isi / iso 9 switch & socket ( s.s.comand ) 16 amp 10 electric pandent holder plastic isi / iso 11 electric tube side pin holder isi / iso 12 electric bell isi / iso 13 electric bell switch i51 / iso for table 14 electric mcb switch 25 amp 151 / 150 15 electric mg switch 6 amp isi / i50 16 electric mcb switch 16 amp isi / iso 17 electric mcb switch 32 amp isi / iso 18 isolator 2 poll 32 amp 19 isolator 4 poll 63 amp 20 isolator 4 poll 100 amp 21 regulator for fan ( switch type ) 22 regulator for fan ( socket type ) 23 lid wire ( 3 core ) 24 electric capacitor 4 mfd isi / iso 25 electric capacitor 2.5mfd isi / iso 26 electric pvc tape roll 151 / 150 27 electric tube light starter isi / iso 28 electric wire flexible isi / iso 23 / 76 gauze ( coil of 90 mtr ) 29 electric wire 4mm isi / iso ( coil of 90 mtr ) 30 electric wire 2.5mm isipso ( coil of 90 mtr ) 31 electric wire 1mm isi / iso ( coil of 90 mtr ) 32 electric wire 1.smm 151 / iso ( coil of 90 mtr ) 33 electric wire 0.75mm 1s1 / iso ( coil of 90 mtr ) 34 electric welding rod ( welding electrodes ) 10 h 35 electric bed switch 36 telephone wire isi / iso ( coil of 90 mtr ) 37 electric chy ia connector pound 15i / iso, 38 electric mono block pump a h.p.isi / iso 39 electric bulb 25, 40, 60, 100, 200 watt isi / iso 40 electric chowk 36 wattisi / i50 41 electric room heater single r00151 / 150 42 electric room heater double rod isi / iso 43 electric tube rod 4 151 / 150 44 electric tube rod 2 151 / iso 45 20 pair jelly filled unarmored cable ( 0.5mm copper ) 46 10 pair jelly filled unarmored cable ( 0.5mm copper ) 47 2 pair jelly filled unarmored cable ( 0.5mm copper ) 48 1 pair jelly filled unarmored cable ( 0.5mm copper ) 49 4mm wire cable 50 red bulb led 0.5w 51 electrical tester 52 electric drill machine hammer isi / iso 53 electric cutter machine 151 / 150 54 battery terminal isi / iso 55 battery lug isi / 150 56 iron element 1500w151 / 150 57 gyser element 151 / 150 1.5 kva ( 1500 watt ) 58 led bulb 5w 59 led bulb 7w 60 led bulb 9w 61 led bulb 11w 62 led bulb 12w 63 led bulb 15w 64 led bulb 17w 65 led bulb 20w 66 led bulb 23w 67 bulb holder ( bekellite ) 68 gyser thermostat 69 room heater / heat blower 70 switch board 4x6 71 switch board 8xb 72 switch board 8x10 73 switch board 101 ( 12 74 electric bell for water tank 75 led tube light rod 4 76 led light 8x8 ( for ceiling ) / .. ‘ r 77 led light 4x4 ( for ceiling ) 78 led road light 100w 79 sterilizer element 80 desert cooler speed switch 81 desert cooler on / off switch 82 . laryngoscope bulb 83 5 port d link switch 84 8 port d link switch 85 ups 600va 86 battery 12v 180ah ( on replacement basis ) 87 battery 12v 88ah ( on replacement basis ) 88 voltage stabilizer 2 kva for a.c. 89 voltage stabilizer 4 kva for a.c. 90 voltage stabilizer 5 kva for a.c. 91 stabilizer 2 kva 92 ups battery 42 ah ( on replacement basis ) 93 ups battery 42 ah ( without replacement basis ) 94 ups battery 26 ah ( on replacement basis ) 95 ups battery 26 ah ( without replacement basis ) 96 ups battery65 amp / 12volt ( on replacement basis ) 97 ups battery65 amp / 12volt ( without replacement basis ) 98 receiver cord for telephone 99 line cord for telephone 100 connection dp for telephone 101 10 pair cable for epabx 102 contactor relay for autoclave machine 240v 103 bearing no. 6000 104 bearing no. 6001 105 bearing no. 6200 106 bearing no. 6201 107 bearing no. 6202 108 bearing no. 6203 109 desert cooler fan motor copper 110 desert cooler submersible pump 23w ( one season ) 111 desert cooler submersible pump 40w ( one season ) 112 desert cooler ball cock valve 113 desert cooler fan blade pvc 114 desert cooler fan leg 115 desert cooler fan leg nut 116 desert cooler distributor pvc, 7 , r 117 elbow for cooler ( p.v.c ) 118 electric pump namda isi / iso 11.9 endoscopy bulb 15v 150w 120 fan bush for cooler fan ring bolt % for desert cooler 121 122 fan ring nut bolt 1 m for desert cooler 123 fan rivet for desert cooler 124 fan shaft for cooler 125 o.t.ceiling light bulb 126 screw ( for wood work ) various sizes steel 4, 3, 2y2, 1%, 1y2, %, 1 127 spanner fix 128 spanner ring 129 tata for desert cooler big size 130 tata for desert cooler extra large size 131 bit 6mm for hammer machine 132 bit 8mm for hammer machine 133 bit 10mm for hammer machine 134 ceiling fan clip 135 ceiling fan pipe 2 ft. 136 nut bolt with cottor pin ( no.10 ) for halfshed fan 137 nut bolt with cottor pin ( no.12 ) for halfshed fan 138 iron wire g.i. 139 electric plier 140 stone cutter 4 141 wooden cutter 4 142 stone cutter blade 143 iron cutter blade 144 wooden cutter blade 145 fan blade metal 18 146 fan blade bolt 147 fan blade washer 148 rinch spanner 12 149 rinch spanner 14 150 multimeter 151 washer iron 152 telephone instrument 153 telephone instrument with id caller 154 4 pin cfl 36 watt length 410mm 155 mcccb 160 amp. 4 pol adjustable oil s / c 156 tp 63 amp. 7 j , 157 mcccb 100 amp. 4 pol adjustable oil s / c 158 bus bar chamber 63 amp. four strip copper 159 mcccb 100amp. 3 pol adjustable oil s / c 160 tpn switch side handle 63 amp. 161 copper wire coil 7 / 16 62 copper lug....

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Govind Guru Tribal University - Rajasthan

33678311 supply of pharmacy lab equipments pharmaceutics dept. 1 ampoule filling & sealing machine hand operated model 2 magnetic stirrer 500ml & 1 ltr cap with taflon ball 3 aseptic cabinet medium size 4 tablet coating machine 12dia without polish pan lab model note. heavy duty coating pan rate on request 5 ball mill 1 kg cap. fixed seed note. with 1 rpm accuracy rate on request 6 double cone blender lab model fixed speed note. with 1 rpm accuracy rate on request 7 autoclave 12x12 all. 8 steam distillation still glass part complete with heating mantle 9 vacuum pump 15 ltr oil free 10 standard sieves no. 8, 10, 12, 22, 44, 66, 80 set of 7 11 tablet punching machine hand operated 12 capsule filling machine hand operated 13 ampoules washing machine demonstration model 14 tablet disintegration apparatus single basket with digital timer 15 hardness tester monsanto type 16 friability test apparatus single drum with digital timer 17 clarity test apparatus 18 bod incubator 4 cu.ft alluminium digital display 19 digital ph meter 20 bulk density digital model 21 hot plate 8 22 humidity chambers 18x18x18 digital superior quality 23 tray dryer 6 tray with digital temperature display 24 moisture balance 25 water bath 6 hole double wall 9 | p a g e ggtutender 26 ointment filling machine hand operated model 27 capsule counter 28 homoginizer variable speed controller 29 digital balance 10 mg acc. 30 microscope student note. medical microscope with 100x lens & mechanical stage rate on request 31 stage and eye piece micrometers a) stage micrometer b) micrometer eye piece 32 brookfileld viscometer model lv 201 note. original brookfield viscometer usa make rate on request. 33 sieve shaker machine hand operated model 34 extractive distillator complete assembly 35 mechanical stirrers with variable speed controller 36 suppository mould 4 mould 37 ultra sonicator 2 ltr cap. 38 sterility tester 3 stage with stand without vaccum pump 39 franz diffusion cell only glass part 40 hot air oven 14x14x14 all. 41 tablet dissolution test app. single stage microprocessor base 42 mortar and pestle porcelean 6 dia 43 milli pore filter 47 mm 44 vacuum distillator 45 desiccators soda glass 6 46 refrigerator pharmacy use 47 tincture press 48 centrifuge 4 tube 49 colony counter digital 50 antibiotic zone rader 51 laminar air flow 2ft x 2ft x 2ft 52 micropipette single & multi channel a) single channel b) multi channel 53 uv cabinet 2 tube pharmaceutical chemistry dept. 1 refractometer/abbe refractometer 2 polarimeter student model note. research polarimeter rate on request 3 photoelectric colorimeter 8 filter 4 atomic model set 120 balls 5 electronic balance 10 mg 6 periodic table chart 7 hot plates 8 dia 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 analytical balances with wt box 11 digital balance 10mg sensitivity 12 suction pumps glass 13 muffle furnace 9x4x4 digital temperature display 14 mechanical stirrers with variable speed controller 15 magnetic stirrers with thermostat with teflon ball 16 vacuum pump 15 ltr cap oil free 17 digital ph meter 18 microwave oven 19 distillation unit 4 ltr cap. 20 arsenic limit test apparatus 21 reflux flask and condenser double/ triple necked a) double neck b) triple neck 22 nesslers cylinders 23 reflux flask and condenser single necked 24 electronic water bath (12 holes) 25 copper water bath 6 dia 26 colorimeter 8 filter digital 27 uv visible spectrophotometer single beam with software 28 flourimeter digital 29 digital balance (1mg sensitivity) 30 nephelo turbidity meter digital 1000 ntu superior 31 flame photometer digital double display 32 potentiometer digital 33 conductivity meter digital sup. 34 hplc imported 35 hptlc (desirable) 11 | p a g e ggtutender 36 atomic absorption and emission spectrophotometer (desirable) 37 biochemistry analyzer (desirable) 38 carbon,hydrogen,nitrogen analyzer 39 deep freezer (desirable) 40 ion exchanger 50 ltr. cap. 41 lyophilizer (desirable) pharmacology dept. 1 microscopes student note. medical microscope with 100x lens & mechanical stage rate on request 2 haemocytometer indian 3 sahil haemoglobinometer 4 hutchinsons spirometer 6 ltr cap. 5 spygmomanometer digital 6 stethoscope 7 contraceptive devices pack in plastic box 8 pregnancy diagnosis kit 9 mercury thermometer 10 cell analyzer (trinocular microscope with camera attachment) 11 permanent slides for various tissues pack of 50 12 models for various organs large 13 specimen for various organs and systems small size 14 skeleton with bones 15 muscle electrodes 16 lucas moist chamber without stand 17 myographic lever with board but without stand 18 stimulator student model 19 centrifuge 4 tube 20 sherringtons kymograph machine e 8 model superior 21 sherrington drum spare drum for above 22 perspex bath assembly(single unit) 23 aerators 24 software packages for experiment validity for 1 year renew every year charges will be same. 25 standard graph of various drug 26 actophotometer(activity cage) 27 rotarod 2 compartment note. rotarod with 1 rpm accuracy rate on request 12 | p a g e ggtutender 28 pole climbing apparatus 29 analgesiometer (eddys hot plate and radiant heat methods) a) eddy hot plate digital b) radiant heat method analog 30 convulsiometer electro 31 plethysmograph without mercury with stand 32 digital ph meter 33 histamine chamber with glass neubilizer 34 metabolic cage s.s. 35 dissection tray & boards a) dissection tray 12x10 gi sheet b) dissection board 7x5 36 stereotaxic apparatus for rat & mice note. other required accessoreis rate on request 37 digital glucometer 38 folin wu tubes 39 hemostatic artery forceps 40 levers , cannula a) levers (i) simple lever with pointer (ii) starling heart lever with pointer (iii) frontal writing lever b) cannula (i) symes cannula (ii) venous cannula (iii) arterial cannula 41 hypodermic syringes & needles size 15,24,26g pharmacognosy dept. 1 compound microscope (student microscope) note. medical microscope with 100x lens & mechanical stage rate on request 2 dissecting microscope 3 projection microscope 6 dia 4 binocular microscope complete with optics 5 polarized microscope monocular 6 electronic digital balance cap. 600 gm acc. 10 mg 7 autoclave 12x12 alluminium 13 | p a g e ggtutender 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 zone reader 11 digital ph meter 12 colorimeter 8 filter 13 sterility testing unit 3 stage with stand without vaccum pump note. available in single stage with flask rate on request 14 camera lucida mirror type 15 eye piece micrometer 10x 16 stage micrometer 17 muffle furnace 9x4x4 digital 18 moisture balance 19 heating mantles small 250 ml 20 vacuum pump 15 ltr cap. oil free 21 micropipette single & multi channel a) single channel b) multi channel 22 micro centrifuge digital model t 16 23 electric water bath 6 hole 24 hot plate 8 dia 25 microtome rotary with accessoires 26 mixer grinder 27 uv cabinet double tube 28 water distillation unit 4 ltr.cap. 29 cutter mill (bark and seed grinder) 30 medicinal plant chart raxine 31 models fibre glass big size 32 permanent slide pack of 50 33 sonicator 2 ltr cap. 34 electrophoresis with analog power supply 35 fermentor 1 ltr capacity without computer. required accessories for fermentor a) autoclave 12x12 s.s. b) chiller bath 36 rotary shaker / v.d.r.l shaker with timer note. rotary shaker with 1 rpm accuracy rate on request phramcy practice lab 1 autoclave sterilizer 12x12 all. 2 hot air oven 14x14x14 all. 3 membrane filter s.s. 4 centrifuge 4 tube 14 | p a g e ggtutender 5 filling machine / bottle filling machine electrical operated 6 sealing machine bottle sealing machine hand operated 7 glucometer with strips 8 sintered glass funnel with complete filtering assemble 9 small disposable membrane filter for iv admixture filtration 10 vacuum pump 15 ltr oil free 11 surgical dressing 12 ph meter digital 13 blood pressure apparatus and stethoscope a) blood pressure app. mercury b) stethoscope 14 clinical thermometer mercury ...

Sms Medical College - Rajasthan

33641597 rate contract for disposable and glassware and consumable and miscellaneous items ( nit 48 ) i. aluminium foil — 2. autoclavable borosil screw capped tubes 5ml 3. autoclavable borosil screw capped tubes1 omm 4. autoclavable petridish sample required 5. disposable gloves ( non sterile in pack of 25 to 50 pairs ) b a ) size 6.5 b ) size 7 c ) size 7.5 d ) size 8 6. centrifuge plastic test tubes with cap sterile 4, ’ 7. coplin jar with lid ( rectangular pvc ) 8. sterile disposable, polystyrene, optically clear, petridishes 9omm x15mm ( 4” ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment z aa £ 9. sterile disposable swab sticks individual ipacked size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expjry sample required to be supplied in installment_ 10. sterile disposable swab st1ck wth test tubes individually packed size ( 150 mmx 12mm ) , sterulized by gamma radlation with date of manufacture & exp1ry sample required 11. sample racks ( 96 slois / rack ) 12x75 mm tube 12. disposable stool sample coniainer with spatula 13. plastic discard container with lid and sieve 14. disposable autoclave bag a ) red 30l b ) yellow30l 15. transparentbag30l a ) red _15l b ) yellow.i5mlb 16. c ) transparent bag 15 l 17. disposable bag a. ) black 30l plastic basket ( jali ) autoclavable—small 18. a ) medium 7”x7”x7” b ) large 9”x9”x9” 19. 20. plastic pipe for water supply / 2 inch plastic trays i y2’ xi wx 6” 21. i plastic trays for reagent bottles 22. plastic dropper a ) b ) big 23. tissue paper rolls 100 meter 24. tie 8” long for lying plastic bags — 25. syringe needle sterile disposable . _... a ) 10ml b ) 2nml — c ) 5ml 26. disposable test tube with screw cap and label, individually packed, sterilized by gamma radiation with date of manufacture & expiry _.... sample require! ) a ) 1onmlr _ b ) 5ml — 27. steriledisposa [ 3le container wide mouth individually packed supplied in installment ( for sputum, urine ) without spoon 30 ml self standmng, sterilized by gamma radiation — 28. test tube stand 29. microtitre polystyrene plate of 96 round bottom wells with lid, individually packed sterilized by gamma radiation with date of manufacture & expiry sample required 30. nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plast1c shaft with breakable point about .._. i5cmnlong !—m 31. plain vial for blood collection 5ml — 32.. microcentrifuge tube ( 1.8 ml molecular biology grade ) 33. tooth pick...

Medical College - Rajasthan

33634349 rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department , a. disposable items , aluminium foil , autoclavable borosil screw capped tubes 5ml , autoclavable borosil screw capped tubes 10ml , autoclavable petridish sample required , disposable gloves ( non sterile in pack of 25 to 50 pairs ) , a ) size 6.5 , b ) size 7 , c ) size 7.5 , d ) size 8 , centrifuge plastic test tubes with cap sterile4” , coplin jar with lid ( rectangular pvc ) , sterile disposable, polystyrene, optically clear, petridishes 90mm x15mm ( 4 ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab sticks individual packed size ( 150 mmx 12mm ) , sterilized by gamma radiationwith date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab stick wth test tubes individually packed size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expiry sample required , sample racks ( 96 slots / rack ) 12x75 mm tube , disposable stool sample container with spatula , plastic discard container with lid and sieve , disposable autoclave bag , a ) red30 l , b ) yellow 30 l , transparent bag 30l , a ) red15 l , b ) yellow 15 l , c ) transparent bag 15 l , disposable bag , a. ) black 30l , plastic basket ( jali ) autoclavable—small , a ) medium 7”x7”x7” , b ) large 9”x9”x9” , plastic pipe for water supply ½ inch , plastic trays 1 ½’ x1 ½’x 6” , plastic trays for reagent bottles , plastic dropper , a ) small , b ) big , tissue paper rolls 100 meter , tie 8” long for lying plastic bags , syringe needle sterile disposable , a ) 10 ml , b ) 2 ml , c ) 5 ml , disposable test tube with screw cap and label, individually packed , sterilized by gamma radiationwith date of manufacture & expiry sample required , a ) 10 ml , b ) 5 ml , steriledisposable container wide mouth individually packedsupplied in installment ( for sputum, urine ) without spoon 30 ml self standing, sterilized by gamma radiation , test tube stand , a ) 6” , b ) 4” , microtitre polystyrene plate of 96 round bottom wells with lid , individually packedsterilized by gamma radiationwith date of manufacture & expiry sample required , nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plastic shaft with breakable point about 15 cm long , plain vial for blood collection 5ml , microcentrifuge tube ( 1.8 ml molecular biology grade ) , tooth pick , b. glassware items , borosilicate glass cover slips, size 22x22mm no.0 10gms x 26100pkt , durhams tube ( 2cm ) , dark brown reagent dropping bottle with glass deopper and rubber treat 125ml borosil , dark brown reagent bottle with screwcap 250ml , dark brown reagent bottle with screwcap 1 liter , flask conical flat bottom ( long neck ) with graduation ( borosilicate ) , a ) 5000ml , b ) 2000ml , c ) 3000ml , d ) 1000ml , e ) 500 ml , f ) 250 ml , g ) 100ml , cell culture flasks ( 25 ml ) , ( treated, sterile, vented ) with filter cap 25cm , glass funnel8” , glass funnel 3” , glass rods , glass sheet , glass slides , thermometer digital with probe ( 0 100° c ) , ( 0 200° c ) , ( 20° to 10° ) , ( 80° ) , glass beakerborosilicate , a ) 500 ml , b ) 250 ml , reagent storage bottle borosilicate , a ) 2 ltr , b ) 1 ltr. , c ) 500ml , blue cap glass bottles autoclavable borosilicate , a. ) 1000ml , b. ) 500 ml , c. ) 250 ml , d. ) 100 ml , test tube glass round bottom without rim borosilicate , a ) 18x150mm , b ) 15x125mm , c ) 12x100mm , d ) 12x75mm , e ) 150x15mm , test tube glass 10 ml screw capped , glass measuring cylinder borosilicate , a ) 500ml , b ) 1000 ml , c ) 250 ml , d ) 100 ml , e ) 50 ml , glass beads , glass beads , borosilicate screw cap glass bottle , borosilicate screw cap glass bottle , glass petridish 90mm borosilicate , c. consumable items , micropipette tips with filter , a. ) 10?l ( 96×10 ) , b. ) 20 ?l ( 96×10 ) , c. ) 100 ?l ( 96×10 ) , d. ) 200 ?l ( 96×10 ) , e. ) 300 ?l ( 96×10 ) , f. ) 1000 ?l ( 96×10 ) , disposablemicropipette tips without filter 100 ?l , sterile micropipette tips without filter 10 ?l , bar code stickers fot bactrology , eppendorf tubes 0.6 ml , eppendorf tubes 1.5 ml , eppendorf tubes 2 ml , 0.2 ml 8 pcr tube strips with cap , n 95 mask niosh certified , surgical triple layer mask , bamboo stick , wipes , ppe kit , gown , a. ) small , b. ) medium , c. ) large , d. ) xl , disposable gowns back open blue , disposable gowns back open white , disposable plastic lab coat ( m ) , disposable plastic lab coat ( l ) , disposable plastic lab coat ( xl ) , plastic disposable forceps , forceps ss 5 inch. , gloves nitrile powder free small , gloves medium nitrile powder free 6.5 size , gloves large nitrile powder free 7 size , shoe cover knee length , head cap , indicator tapesteam autoclavable , b. stearothermophilus ( no. of spores per strip 10 6 ) for steam sterilization at 1150c indicator tape ( autoclave ) , b. atrophaeus ( no.of spores indicator tape ( hot air oven ) , sanitizer ( 500ml ) with dispenser , falcon tube 50ml sterile , falcon tube 15mlsterile , screw capped cryo vial 1.5ml , screw capped cryo vial 2ml , screw capped cryo vial 1.8ml , screw cap storage vials 1.8ml , screw cap plain tube ( 12x75 mm ) , plain tube ( riya tube ) for sample dilution , plain sample collection tube 5ml double cap with clot activator , edta tube 5ml double cap , assay cups , assay tips , assay samplecups , gauze than , vaccutainerclot / edta / flouride / citrate / heparin , vaccutainer needle , parasep solvent free faecal parasitic concentrator , vtm with two swabs , zip lockbags size 8x4 , barcode sticker for hbv & hcv viral load and bacteriology , wash reagent , spray bottles , manualmicropipette variable volume autoclavable , a. ) 1 10 ?l , b. ) 0.5 10 ?l single channel , c. ) 10 100 ?l single channel , d. ) 5 50 ?l single channel , e. ) 50 200 2 200 ?l single channel , f. ) 100 1000 ?l single channel , g. ) 2 20 ?l multi channel 8 channel , h. ) 10 100 ?l multi channel 8 channel , discarding jars , abi real time pcr fastrctn tubes ( 8 tubes / strips ) each 0.1 ml , abi real time pcrfast rctn tubes ( 8 tubes / strips ) each 0.2 ml , abi fg optical caps for rtpcr ( 8 caps / strips ) each , pcr rack with cover , plastic racks ( 24 tubes racks ) , plastic racks ( 48 tubes racks ) , tough tags for ampoules 1.5 ml , cell culture plates ( 6 well ) ( tissue culture treated, sterile ) , abi sequencing plates ( 10 plates / pk ) , , abi adhesive covers for pcr plate ( 100 pcs ) , , ppe ( jump suits ) , serological pipette 5ml ( filter, sterile ) , u bottom microtitter plates , coolbox , pippette stands , mini coooler 20° for 1.5 ml tube ( 12 place ) , mini coooler 20° for 1.5 ml tube ( 48 place ) 32place , d. miscellaneous items , cotton roll 500 gms , cryovials racks , cryovial boxes , cryovial labels , gas burner, labortary vertical withcontrol knob , match box , washing brush for cleaning test tube , a ) 4 , b ) 6 , c ) 8 , regulator for gas , dustbin with lid and foot operated , a ) black colour , b ) blue colour , c. ) red colour , d. ) yellow colour , e. ) green colour , gas lighter , teasing needle , surgical blades no 22 sterile packed , scalpel & blade , thread rolls , flit pump , waste paper basket , nichrome wire 18 gauge , nichrome wire 21 gauge , aluminium tray with partition 12x18x4inch , jute thread for tying bundle , nichrome wire loop diameter 1.3 mm, double wound, caliberated to 1 ul ( .001 ml ) ( pack of 10 loop each ) , wire loop holder , readymade assorted loops 5 pack x 10 loops each , dustbin with perforated basket inside with lid ( 2 liter ) , dustbin with perforated basket inside with lid ( 15 liter ) , antibioticc zone measuring scale370x65 mm , spirit lamp cotton wick , spirit lamps , spotting sheet ( white paper ) , thermometer 0 to 1000c ( digital ) , thermometer 0 to 2000c ( digital ) , thermometer 200 c to 100 c ( digital ) , thermometer 800 c to 100 c ( digital ) , plastic slide box 4”x12” , slide tray ( metal ) , syringe filter 33 mm , syringe filter 10 ( 25mm diameter ) himedia 0.2mm filter for cell culture , falcon racks 50ml , falcon racks 15ml , parafilm roll...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

33555781 supply of equipments and models for uch, kekri ajmer hot air oven ( 50 c ) for special standing . temperature ambient up to 250c with least count 10c. . latest technology & modern aesthetics. o capacity ( liters ) : 30 o chamber dimension ( mm ) ( wxdxh ) : 325x310x31 o double metal sheet body with air pocket keep the machine cool. o digital temperature control o perforated stainless steel removable two racks for keeping samples. o insulated glass door window to view the sample. o one main unit ( complete lnside made of ss 316 grade ) . two shelves ( made of ss 316 grade ) 0l 1.02 centrifuge machine electric rotofix o rpm: 500 8000 ( in increments of 100 ) . o max. capacity: 4 x 100m1 / 6 x 94m1. o dimensions ( w x d x h ) : 33 x 46 x27cm o timer: 0 99 minutes +constant. 02 1.03 water bath ( electric ) o lnner chamber & lid s. steel ( ss 304 grade ) . o outer chamber mild steel duly powder coated special grade mineral wool, control panel have on / offswitch, heating & main indicators. o power 22o v / 50 hz. holes o diameter 75 mm, o temperature range s to 10ooc. o temperature error correcting function, portable r simple block changing, convenient for cleaning. . lnstant temperature display, timing decreasing display. 1oo ncubator double walled construction outer s.5304 dull finish lnner s.s316 mirror polished puf insulation between two walled full acrylic door permit inspection of specimen, without disturbing the temp. temp controlled by pid controller with auto tuning facility with accuracy of 0.5c temp range 5 c to 60 c accuracy 0.5c lllumination light are provided for viewing cfc free hermetically sealed compressor provide temp for below ambient condition air circulation fan for marinating temp uniformity throughout the chamber the chamber is provided with modular removable shelves made of s.s. for complete flexibility in use temp range 5c to 50c with accuracy of + 1c double walled, inside anodized stainless steel and outside m.s. powder coated to work on 220 / 230 volts a.c 50hz lnner chamber size ( mm ) wxdxh455x410x610. capacity in cu. ft. 4 cu. ft capacitv 112 liters. 1.05 haemocytometer with rbc & wbc pipettes r cover slip and having wooden box o lmproved neubauer chamber r lmproved bc & wbc chamber, having better quality of cover slip. 2s 1.06 haemoglobinometer ( sahl i ) . lmproved quality chamber having better graduated square tube & properly visible comparator ( standard ) tube. 25 1.07 autoclave ( electric ) o made of heavy seamless aluminium sheet. o size 220mm x 230mm x 38mm o capacity 10ltr. o electric power source 220v.50h2 size: 350mm x 330mm + 90mm lid. ( 14 x 16 ) o suitable for two sterlizing / dressing drum and supplied with inner and outer stand 02 1.08 anaerobic apparatus o made of seamless ss body coupled with ss flange & ss lid 02 1.09 stopwatch ( % sec ) r digital o measuring capacity of 01 second, minute & hour 02 1.10 ph meter . ph range :0 14 ph r resolution : 0.01 ph r temperature range : 00 to 100c ( manual compensation ) r display: 3l / 2dieit led display o power suppiy: 230vac *lo%, 50 hz o catibration check facility & calibration error indication for 7.00 t400 ph 03 sign & seal of firms l.l l high speed centrifuge for serological / hematological work o microprocessor based square m s body duly powder coated double walled light weight abs lid o fitted with microprocessor based 2 lines 16 characters lcd panel for 0 59 minutes countdown timer. o digital rpm meter & programmable speed controller. 0l l.l2 esr ( westergren s / wintrobe ) . equipment for esr estimation / westergrens pipette for esr on standwestergrenss stand. o back aluminum scale having capacity of 6 to 8. westergren stand. 02 sets each l .13 colony counter o digital display o readout 0 999999. 7 segment led display o audible confirmation of each count. o uniform glare free illumination. o wolffhugel glass grid with focusing facility. o led based illumination. o dish size : 110mm o magnification : x1.7 o size:260x255x170mm o accessories: o marking pen 1 o magnifier lens 1 o lens holder 1 o height with integral support stand:3o0mm 01 1, l4 coplin jars . material ppcp ( polypropylene co polymer ) . air tight, no moisture absorption, unbreakable, self standing jar to protect glass slides. r holding capacity 5 slides of size 1n x 3n. 06 1.15 machine for estimation of blood sugar / serological test o glucometerdigitalusage / application r to monitor blood glucose level r measurement range20 600 mg / dl . display digital . sample volume 05 ul 01 l.l6 | semi autoanalyser analysis method: kinetics, end point, two point, etc. power supply:20w / !2y halogen light, life time:2000hr optical system: 340 800nm, 8 hard membrane filter: 340, 380, 405, 492, 5t0, 546, 57 8, 630nm ( wavelength ) accuracyt2nm abs range: 2.500 2.5abs resolution:0.001abs. flow cell: titanium quartz alloy, 33ul; optical path: 10mm. temperature: pelti e r elements, 25, 3037 0.1rei, e precision : er rct autoclave, re sterile, reusable, matte finish i i1.04 sponge holding forcep stainless steel ce oualitv.6inch.8inch, i 0inch, i 2, inch i each i 1.05 ovum forcep standard size , non rusted stainless steel i 1 1.06 uterine sound luni heavily serrated, fenestrated angled loops metal brass ( heavy duty, extended longevity ) stain chrome finish 32cm / l3 i i 1.07 cervical dilator ( hegars dilator ) c.rviat ciitator premium quality, set of 8 pieces lmm to l6mm, stainless steel, polish finish, autoclave, reusable i set i 1.08 vulsellum single tooth ( tinaculum ) size to inch, high grade stainless steel i i 1.09 vulsellum multipal tooth ( teals vulsellum ) size l0 inch, high grade stainless steel i i l.l0 uterine currators ooutg eaea, tligh grade stainless steel, set of4 dcs i set il il episiotomy scissor stai n i ess steel, s ize 5. 5 , 6, 7 .5, ce qual ity i each 11.12 towel clip sire +ir, .t, , s i*h, 5. 5 inch, high grade stainless steel, matt finish i each i 1.13 needle holder stainless steel, rust proof size 6inch, 8inch i each t t.t+tcyto urush i 1 l.l5 abdominal retractor shaped , l, ffi ( 5 ) nonrusted stainless steel, reusable, can be autoclave i each 1 1.16 chittle forcep size ginch, t0inch, l2inch, high quality stainless steel, non rusted, reusable, can be autoclaved i each i 1.17 stitch removal scissor stainless steel, standard size, i 1 l.l8 umbilical cord scissor ffirusted, reusable, can be autoclaved i each ll.19 simple dressing scissor blurt &sharp straight premium stainless steel o ualitv.5 inch, 6 inch, 8 inch i each 11.20 curved dressing scissor ntunt asnarp straight premium stainless steel quality, 5inch, 6inch, 8inch i each tt.2l allis tissue forcep size 5 inch, 6inch, 8inch handcrafted withy dremium surgical grade stainless steel i each 11.22 curved artery forcep stainless steel, silk matte satin finish size 5inch.6inch.8inch, i 0inch i each tr.23 bebcocks forcep staintess steel, non rusted, size 6inch, 8inch i each 11.24 foleys cathetor ffinised smooth surface, provided with ultra thin highly elastic balloon size 1 4.1 6.1 8 l0 each fi.25 melcots catheter rubber, siliconised smooth surface l0 11.26 urobag u.ie ac., rtrlati, tn bag with moulded handle.capacity of 2000m1 20 t2 surgery dept. equipments t2.01 kidney tray stainless steel, l0 & 12 inches i each 12.02 i.v. set pvc i box 12.03 b.t. set pvc i box 12.04 proctoscope stainless steel, with light and a lens, large size, app. 5 inches or molq 1 12.05 laryngoscope f. stainlest steel, glare free satin finish miller or macintosh style laryngoscope for adults, or 2. fiber optic light source laryngoscope for adults i seal of firms ttx 12.06 ent set led or optic fiber model with otoscope & oohthalmoscone i 2.07 clamp ( gastric & intestinal ) stainless steel doyens clamp l0 inches. 1 12.08 abdominal retractor stainless steel doyen stille abdominal retractor for adults i 12.09 spermatic cord retractor stainless steel fixation clamp 14.5 cm 5 inch 3 inch 4 inch or larse i 12.10 gland holding forcep stainless steel kochers forcep 6inch 8inch or larse i 2.tt allies tissue forcep stainless steel, 20 cm or large 6inch, 8 inch i 2.12 babcock forcep stainless steel, 8 inches i 2.13 scissor pointed stainless steel, 8 inches i 2.14 scissor curved stainless steel, 8 inches i 12.15 scissor mayo stainless steel, curved & straight, 6 & 8 inches 1 each 12.16 dissected forcep toothed stainless steel, 6 & 8 inches i each 12.t7 dissected forcep plain stainless steel, 7 & 8 inches i each 12.18 kochers artery forcep stainless steel, kochersstille artery forcep, 7 & 8 inches i each 12.19 cheatleforcep stainless steel, 8 & l0 inches i each 12.20 urethral dilator ( male ) stainless steel, set liom 4mm to 12mm i 12.2 urethral dilator ( female ) stainless steel, set fiom 4mm to 1omm i 12.22 catheter rubber rubber urinary catheter, male adult size i 12.23 catheter foleys latex2 or 3 way for adult male i t2.24 suturing needle with thread fersuson stainless steel half circle i set 12.25 needle holding forcep stainless steel, 6 & 8 inches i each 12.26 sponge holding forceps stainless steel, 6, 8, 1 0, 12 inches i each 2.27 straight artery forceps stainless steel.6 inch 8 inches i 12.28 curved artery forceps stainless steel, 6 inch , 8 inches i 12.29 mouth gauge doyens stainless steel for adults i 12.30 mosquito forcep stainless steel straight & curved, 5 or 6 inches i 12.31 sinus forcep stainless steel, straight & cupped, 6 or 8 inches i each 12.32 trocar & cannula laparoscopic i lmm cft, 8 12 inches in length i 12.33 probe stainless steel. 6 or 8 inches i 12.34 aneurism needle syme stainless steel, large 6.5 l65mm i 12.35 tetra towel clip moynihan stainless steel, 4 inch, 5 inch, 6& 8 inches i each 12.36 hydrometer glass and consists of a cylindrical stem and a bulb weighted with mercury or lead. i 12.37 infant mucus extractor pvc & of standard size i 12.38 silvermans biopsy needle stainless steel liver biopsy needle ofstandard size i 12.39 instrument tray stainless steel rectangular ofstandard size i 12.40 needle holder stainless steel, 6 & 8 inches i each l3 forensic medicine and toxicoloev dept. ( li$ dl 4adels ) i 3.01 asphyxial death non toxic pvc with wooden base of size l6*24 inches 0l 13.02 degree ofburns non toxic pvc with wooden base of size l6*24 inches 0l i 3.03 drowning non toxic pvc with wooden base of size l6*24 inches 0t 13.04 entrance & exit wound non toxic pvc with wooden base of size l6*24 inches 0l i 3.05 hanging ( suicidal and homicidal ) non toxic pvc with wooden base of size l6*24 inches 0l 10 i31 sign & seal of firms 13.06 bruises injury. non toxic pvc with wooden base of size 16x24 inches 01 13.07 abrasions injury. ffienbaseofsize l6*24 inches 0l i 3.08 lacerations injury. non toxic pvc with wooden base of size 16*24 inches 0l 13.09 contusions injury non toxic pvc with wooden base of size 16*24 inches 01 13.1 0 signs of death non to^ic pvc with wooden base of size l6*24 inches 01 t4 human skeleton 14.01 human skeleton articulated human skeleton ( female ) . 0l 14.02 human skeleton articulated human skeleton ( male ) 0l 14.03 human skeleton human pelvis articulated female 0l 14.04 human skeleton human pelvis articulated male 0l 14.05 human skeleton full articulated female skull 01 14.06 human skeleton fetal skull 01 l5 anatomv dent. ( list of mtldels ) 15.01 eyes non toxic wc models with wooden base of size l6*24 inches 0l 15.02 ear ffiwoodenbaseof size i 6*24 inches 0l i 5.03 nose nn t ic pvc models with wooden base of size l6*24 inches 01 i 5.04 stomach m; toxi pvc mdett with wooden base of size l6*24 inches 0l i 5.05 liver ffienbaseofsize l6*24 inches 0l 15.06 lungs non toxic pvc models with wooden base of size l6*24 inches 0l 15.07 skin ffienbaseofsize l6*24 inches 01 i 5.08 brain ffioodenbaseofsize i 6*24 inches 01 15.09 i pancreas norntoxic pvc models with wooden base of size l6*24 inches 0l 1 5.10 spleen ffiodenbaseofsize i 6*24 inches 01 15.1 i kidney & bladder norto i. pvc models with wooden base of size l6*24 inches 01 15.12 face ffinbaseofsize lol i 6*24 inches 1 5.13 heart no*toxic pvc models with wooden base of size i 6+24 inches 01 i 5.14 female reproductive organs no*toxic pvc models with wooden base of size i 6*24 inches 01 15.15 male reproductive organs non toxic pvc models with wooden base of size l6*24 inches 0l l6 patholosv & microbioloev dent. ( list of models ) 16.01 atherosclerosis thrombosis and embolism pathology model non toxic pvc models with wooden base of size l6*24 inches 0l 16.02 colon model with following common pathologies : adhesions, appendicitis, bacterial infection, cancer, crohns disease, diverticulitis, diverticulosis, polyps, spastic colon. ulcerative colitis non toxic pvc models with wooden base of size l6*24 inches 01 16.03 bladder pathology ffi fii. pvc *dat *ith wooden base of size i 6t24 inches 0l 16.04 pathological stomach model non toxrc pvc models with wooden base of size l6*24 inches 0l 16.05 pvc liver pathologies model nor toxi. pvc mdels, ith wooden base of size l6*24 inches 01 16.06 lung pathology mn toxic pvc , odels with wooden base of size t6*l / inches 01 1l_x;ii sign & seal of firms 16.07 life cycle of p. vivax non toxic pvc models with wooden base of size 16*24 inches 0l 15.08 osteomyelitis non toxic pvc models with wooden base of size l6*24 inches 0l 16.09 skin pathology non toxic pvc models with wooden base of size l6*24 inches 01 r 6.10 herpes simplex virus non toxic pvc models with wooden base of size l6*24 inches 01 r6.1i shape of aneurism non toxic pvc models with wooden base of size l6*24 inches 0l 16.12 influenza virus non toxic pvc models with wooden base of size l6*24 inches 01 16.13 mumps virus non toxic pvc models with wooden base of size l6+24 inches 0l 16.14 bacterialcell non toxic pvc models with wooden base of size 16*24 inches 0l t 6.15 fibroadenoma of breast nontoxic pvc models with wooden base of size l6*24 inches 01 t7 gynaec & obstetrics dept. ( list of models ) 17.01 a new born child pvc material 16x24 inches 0 17.02 fetus attached to placenta pvc material 16x24 inches 0 17.03 structure of human ovum pvc material 16x24 inches 0 17.04 ectopic pregnancy pop material 16x24 inches 0 17.05 uterus in section showing sperm & ovum in process of fertilization pvc material 16x24 inches 0l 17.06 showing the hemorrhages of presnancy & parturition pop material 16x24 inches 0l 17.07 first stage of labour pop materia 16x24 inches 0 17.08 second stage oflabour pop materia 16x24 inches 0 17.09 third stage of labour pop materia 16x24 inches 0 17.10 maternal surface of placenta pop materia 16x24 inches 0 l7.l i fetal surface of placenta pop materia 16x24 inches 0 17.12 bifth, l: beginning pop material 16x24 inches 0 17.r3 birth, 2: uterus, contracting pop material 16x24 inches 0 17.14 birth, 3: head deep in birth canal pop material 16x24 inches 0l 17.15 birth, 4: head emerging pop material 16x24 inches 01 17.16 birth, 5: head turns, upward pop material 16x24 inches 01 t7 .17 birth, 6: baby born pop material 16x24 inches 0l 17. l8 different clinical condition of uterus pop material 16x24 inches 0l 17.19 different clinical conditionsof fallopian tube pop material 16x24 inches 0l 17.20 different clinical condition of ovary pop material 16x24 inches 01 17.21 obstetrical manikin modelfetus provided is of a realistic newborn size with fontanels and cranial sutures ( for demonstration purpose ) skin color, pvc material, 16x24 inches 01 l8 sureerv dept. ( list of models 16x24 inches ) 18.01 types oftongue unbreakable fiber glass with wooden frame, 1.5 to 2 feet 0l 18.02 gall stone unbreakable fiber glass with wooden frame, 1.5 to 2 feet 0t 18.03 renal stone unbreakable fiber glass with wooden frame, 1.5 to 2 feet 0l 18.04 types of hernia unbreakable fiber glass with wooden frame, 1.5 to 2 feet 0l 18.05 pressure sore 8.06 spina bifida 18.07 deviated nasal septum 18.08 angioplasty 18.09 ano rectal disorders 18.10 mechanism of hearing l8.l i gerd etc...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

33548736 supply of equipments and models for uch kekri ajmer supply of equipments and models for uch, kekri, ajmer , pathology & microbiology dept. equipments , hot air oven ( 50o c ) for special standing , centrifuge machine electric rotofix , water bath ( electric ) , incubator , haemocytometer with rbc & wbc pipettes , haemoglobinometer ( sahli ) , autoclave ( electric ) , anaerobic apparatus , stopwatch ( ½ sec ) , ph meter , high speed centrifuge for serological / hematological work , esr ( westergren’s / wintrobe ) , colony counter , coplin jars , machine for estimation of blood sugar / serological test , semi autoanalyser , cell counter ( cbc machine ) , forensic medicine and toxicology dept. equipments, weapons etc. , equipments , equipment for measuring heights , vernier caliper , weighing machine dial type human , weapons , blunt , i. animal chain , ii. cycle chain , iii. dog chain , iv. gullel , v. hammer , vi. hockey stick , vii. iron rod , viii. laathi ( wooden stick ) , ix. lock , x. meter scale , sharp , i. aari , ii. axe , iii. blade , iv. bread knife , v. chhuri , vi. gandasi , vii. hansiya , viii. iron cutter , ix. kataar , x. khurpi , pointed , i. ballam , ii. broken bottle , iii. garden scissor , iv. gokhru , v. ice cutter , firearms , i. air pistol , ii. air gun , teaching materials postmortem dvd and other dvd’s of f.m.t , gynecology & obstetrics instruments , sim’s speculum , cusco’s speculum , anterior vaginal wall retractor , sponge holding forcep , ovum forcep , uterine sound , cervical dilator ( hegar’s dilator ) , vulsellum single tooth ( tinaculum ) , vulsellum multipal tooth ( teal’s vulsellum ) , uterine currators , episiotomy scissor , towel clip , needle holder , cyto brush , abdominal retractor – ‘l’ shaped , chittle forcep , stitch removal scissor , umbilical cord – scissor , simple dressing scissor , curved dressing scissor , allis tissue forcep , curved artery forcep , bebcock’s forcep , foley’s cathetor , melcot’s catheter , urobag , surgery dept. equipments , kidney tray , i.v. set , b.t. set , proctoscope , laryngoscope , ent set , clamp ( gastric & intestinal ) , abdominal retractor , spermatic cord retractor , gland holding forcep , allie`s tissue forcep , babcock forcep , scissor pointed , scissor curved , scissor mayo , dissected forcep toothed , dissected forcep plain , kocher`s artery forcep , cheatleforcep , urethral dilator ( male ) , urethral dilator ( female ) , catheter rubber , catheter foley`s , suturing needle with thread , needle holding forcep , sponge holding forceps , straight artery forceps , curved artery forceps , mouth gauge , mosquito forcep , sinus forcep , trocar & cannula , probe , aneurism needle syme , tetra towel clip , hydrometer , infant mucus extractor , silverman`s biopsy needle , instrument tray , needle holder , forensic medicine and toxicology dept. ( list of models ) , asphyxial death , degree of burns , drowning , entrance & exit wound , hanging ( suicidal and homicidal ) , bruises injury. , abrasions injury. , lacerations injury. , contusions injury , signs of death , human skeleton , articulated human skeleton ( female ) . , articulated human skeleton ( male ) , human pelvis articulated female , human pelvis articulated male , full articulated female skull , fetal skull , anatomy dept. ( list of models ) , eyes , ear , nose , stomach , liver , lungs , skin , brain , pancreas , spleen , kidney & bladder , face , heart , female reproductive organs , male reproductive organs , pathology & microbiology dept. ( list of models ) , atherosclerosis thrombosis and embolism pathology model , colon model with following common pathologies: adhesions, appendicitis, bacterial infection, cancer, crohns disease, diverticulitis, diverticulosis, polyps, spastic colon, ulcerative colitis , bladder pathology , pathological stomach model , pvc liver pathologies model , lung pathology , life cycle of p. vivax , osteomyelitis , skin pathology , herpes simplex virus , shape of aneurism , influenza virus , mumps virus , bacterial cell , fibroadenoma of breast , gynaec & obstetrics dept. ( list of models ) , a new born child , fetus attached to placenta , structure of human ovum , ectopic pregnancy , uterus in section showing sperm & ovum in process of fertilization , showing the hemorrhages of pregnancy & parturition , first stage of labour , second stage of labour , third stage of labour , maternal surface of placenta , fetal surface of placenta , birth, 1: beginning , birth, 2: uterus, contracting , birth, 3: head deep in birth canal , birth, 4: head emerging , birth, 5: head turns, upward , birth, 6: baby born , different clinical condition of uterus , different clinical conditionsof fallopian tube , different clinical condition of ovary , obstetrical manikin modelfetus provided is of a realistic newborn size with fontanels and cranial sutures ( for demonstration purpose ) , surgery dept. ( list of models 16x24 inches ) , types of tongue , gall stone , renal stone , types of hernia , pressure sore , spina bifida , deviated nasal septum , angioplasty , ano rectal disorders , mechanism of hearing , gerd...

Sms Medical College - Rajasthan

33454893 regarding supply of surgical items and metp items at hospital 1 lens 1ol. all size 2 abdominal drain kit no. 24 2000 ml 3 absorbale gelatin kit sponge 8o x 50 x 10 mm 4 absorhant surgical cotton roll ( 500 gms. ) 5 allies forceps 6 ambu bag adult 7 ambu bag paed. 8 artery forcep 10” curved 9 artery forcep 10” mosquito 1o artery forcep 10” straight 11 artery forcep 6” curved? 12 artery forcep 6 mosquito 13 artery forcep 6” straight 14 artery forcep 8” cursed 15 artery forcep 8” mosquito 16 artery forcep 8” straight 17 asepto syringe with transparent bulb sterile ( 60rnl ) 18 autoclave label 19 b.b. splint l. cull’ 1nail’ 20 bp cuff 21 b.pcuffcomplete set 22 b.p. cuff for cardiac monitor 23 b.p. cuff for digital b.p. instrument 20 b.p cuff mnaual 24 b.p. cuff for monitor 25 b.p. instrument digital 26 b.p. instrument mercury type 27 b.t set ( blood administration set ) 28 baincircuit adult 29 baincircuit paed. 30 bandage 10cm x 4 mtrs. ( pkt of 12 spool ) 31 bandage 15 cm x4.mtrs. ( pktof 12 spool ) 32 bandage 5cm x 4 mtrs. ( pkt of 12 spool ) 33 bandage 7.5cm x 4 mtrs. ( pkt or 12 spool ) 34 barbour thread no. 20, 40. 60. 80 — 35 bed side screen with green cloth ( good quality ) 36 bohlers stirrups 37 bulk conversion unit 38 carmen wire large 39 carmen wire small 40 catheter for urinary drainage ( folys balloon catheter ) . chittal forceps 2 way. size 16 ( s9.c ) slze 18 ( s9.d ) 41 42 catheter for urinary drainage ( folys balloon catheter ) , 2 way, size 16 ( s9.c ) .size 18 ( s9.d ) chittal forceps 42 chittal forceps 43 cresent blade 44 cureter small 45 curved artery forceps 46 cylinder key ( ox>gen, nitrous ) 47 dialator set 48 digital finger pulse oximeter 49 digital thermometer 50 disposable endotracheal tube cuffed 2.5 to 5.0 51 disposable endotracheal tube cuffed 5.5 to 9.0 52 disposable footware 53 disposable plastic g loves ( paper ) 54 disposable razor 55 disposable steriie surgical gloves ( isi mark ) size 6.0. 6.5. 7.0, 7.5. 8.0 56 dispovan needle 26fv2 57 double foot step 58 dressing drum loxi i 1st 59 dressing drum 1 1x15 1st 60 dressing drum 9x1m1 1si 61 dressing trolley as per standard size 62 dynaplast 4” dynaplast 6” 63 64 endotracheal tube with cuff red rubber size: 2.5 .3 .3 .5 a .5 .5 .5 .6 .5 .7 .7 .5 .8.8.5.9 65 ent otoscope 66 esmarch bandage 2” 67 esmarch bandage 4” 68 esmarch bandage 6” 69 eusol 500ml. 70 examination couche ( as per standard size ) 71 face mask ( disposable ) 72 face shield 73 fine scissor 74 finger pulie oximeter — 75 gauge unnedicated size: 120cm x 9mtrs. 76 gauge unmedicated size: 60cm x 9mtrs. 77 hsg cannula all sizes 78 hypodernmic needle 79 i v. cannula three way80 l.v. cannula two way 81 l.v. stand good quality 82 lnsulin syringe with 3g needle ( dispo. ) icc 83 jerry pot 84 kelleys pad 85 kerotorne blade 2.8 ( sharp edge ) 86 kidney tray 87 kirschner wire ( k wire ) 1.0mm. 88 kirschner wire ( k wire ) 1.5mm. 89 knife handle no. 3 & 4 90 laryngoscope with 3 blades adult 91 laryngoscope whh 3 blades paed. 92 lead apron 3mm.thick 93 leucoplast 6 94 low suction machine catheter 95 mackintosh rubber sheet ( good quality ) 96 mattress for bed: size 6’x3’ 97 mattress for examination couche size 6’x2’ 98 medicated baby oil 99 medicated soap 100 mosquito artery forceps straight 1oo mosquito artery forceps straight 101 mucus sucker 102 mva cannula all size 103 mva syringe with cannula 104 n 95 mask ( forcovid 19 ) 105 nasal oxygen cannula 106 nasal oxygen set. twin bore all sizes adult 107 nebuliser machine 108 needle cutter with syringe destroyer electric‘ ss 109 needle holder 10 110 needle holder 6 111 needle holder 8 112 needleno. l1, 14.20.25.26? 113 neubilizer mask with tubing complete set ( disposable ) adult 114 neubilizer mask with tubing complete set [ disposable ) paed. 115 non tooth forceps 6” 116 ovem forceps 117 oxygen cylinder a type 1st with explosive certificate 118 oxygen cylinder b type 1st with explosive certificate 119 oxygen cylinder c type 1st with explosive certificate 120 oxygen cylinde d type 1st with explosive ccrii ficate 121 oxygen regulator with humidifier bottle 122 oxygen tail pipe copper 123 paper adhesive plaster 1” 9 mtrs. 124 paper adhesive plaster 2 9 mtrs. 125 paper adhesive plaster 3” 126 parafin dressing 197s 127 plastic gloves for examination 128 ppe kit ( complete ) 129 pulley traction weight 130 rexine cloth ( good quality ) 131 rubber appron 132 ryles tube / nasogastric tube ( p.v.c. ) slze 6, 8. 16.18 133 s.s. tray with cover 300mm. x 250mm. 134 s.s. tray with cover 350mm. x 240mm. 135 safe delivery kit 136 sanitary napkin 137 sanitary pads 138 sanitizer bottle 500ml. not less than 70% aichohol 139 san itory pads belt type [ s99.b ] 140 scissor for stitch remover 141 skin traction kit large 142 skin traction kit medium 143 skin traction kit small 144 sonography couche with dmawer ( iron ) size: 6x2’ 145 — sponge holder 146 stand for a type oxygen cylinder 147 stand for t3 type oxygen cylinder 148 stand for c type oxygen cylinder 149 — stand for d type oxygen cylinder 150 standard pama intra occular lenses 151 steinman pin 3.0 152 steinman pin 3.5 153 i steinman pin 4.5 154 sterile disposable lv. carmula no. 24 ( three way ) 1s5 sterile disposable i.v. cannula size 1 8. 20 & 22 _ three way 1s6 sterile disposable infusion set with microdrip 157 sterile disposable perfusion set ( i.v. set ) 158 sterile disposable spinal needle 25g 159 sterile disposable syringe 1ome 160 sterile disposable syringe 2ml 161 sterile disposable syringe 5ml 162 steriliser element 1.5kw with holder 163 steriliser element 3.0kw with holder 164 sterlizer element 2 kw. with holder 165 stilet . big 166 stilet small 167 stitch cutting scisor 168 stockinet 169 straight scissor with tip 17o stretcher trolley as per hospital standard ( good oualty ) pi suction cannula no. 4. 6. 8. 10 suction catheter no. 18.16 ( s 9 ) 172 173 suction catheter no. 6 & 8 174 surgical blade 10. 1 1. 15, 20. 22 ( s 30 ) isi mark ( lo0pcs. ) 175 surgical foldable cap. disposable ( 1 x50strip!caps ) 176 surgical scissor curved 10” metazbown 177 surgical scissor curved 8” heavy mayo 178 surgical scissor curved 8” metazbown 179 suture forcep non tooth 6:8.10o 180 suture forcep tooth 6.8.10? 181 suture needle curved size: 6.8. 10.12.14, 16 182 suture needle straight size: 6.8. 10, 12.14. 16 183 thomas splint large 184 thomas splint medium 185 thomas splint small 186 tooth forceps 6” 187 tooth rorceps 6 188 torniquet phenomenon small dinklage cuff 189 trolley for cautery machine 2” x4” 190 umbilical catheter 191 uretheral plain catheter ( k 90 ) 192 urine collection bag cap. 2000 ml 193 vaginal speculum sims 194 vaginal speculum wall retractor 195 vaginal wall retractor 195 — vaginal wall retractor 196 valsuleen 197 viral transmision medium vial ( vtm ) 198 weighing scale adult 199 weighing scale child 200 weight machine electric 201 wheel chair good quality made with as per standard 202 x ray view box two films 203 lris scissor curved ( for eye patient ) 204 hub needle cutter 205 lnfant feeding tube size 8 etc...

Medical Education Department - Rajasthan

33422880 bids are invited for micropipettes single channel of variable volume , adjustable volume digital multiple channel micropipettes , hot air oven , water bath , bodincubator , vortex mixer , vertical autoclave , water purification system total quantity : 11...

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33294149 supply of anaesthesia equipment kit for ot anaesthesia equipment kit for ot , opd , operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33268475 supply and installation of resuscitation kit for o.t’s and wards operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33268179 supply and installation of miscellaneous items for opd and wards operation theatre table operation theatre light pedestal lights electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33268077 supply and installation of resuscitation kit operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33264930 supply and installation of electrosurgical cautery unit ( operation theatre ) operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

Medical And Health Services - Rajasthan

33253191 supply of consumables and miner equipments neonatal laryngoscope , surgical instrument , suture set , oxygen hood , s and m set of 3 each , including connecting tubes , thermometer clinical digital , stethoscope binaural neonate , sphygmomanometer neonate electronic , measuring tape vinyl coated infantometer plexi , emergency light torch , wall clock with seconds hand washing machine with dryer , gowns for staff light pink gowns for mother dark pink , washable slippers , autoclave , x ray view box etc ...

Medical Health And Family Welfare - Rajasthan

33105744 supply of lab and blood bank regents in govt bdm district hospital kotputli supply of lab and blood bank regents in govt bdm district hospital kotputli , list for laboratry & blood bank regents , elisa test kit for hiv 96 test ( 4th generation ) , elisa test kit for hiv 96 test ( 3rd generation ) , elisa test kit for hcv 96 test , elisa test kit for hbsag 96 test ( 4th generation ) , elisa test kit for hbsag 96 test ( 3rd generation ) , elisa test kit for dengue igm 96 test , elisa test kit for dengue igg 96 test , elisa test kit for scrub typhus 96 test , elisa test kit for chickengunia96 test , elisa test kit for hcv 96 test , rapid test card malaria pan ldh 1 piece , rapid test card malaria antigen 1 piece , rapid test card for dengue ns1 1 piece , rapid test card for dengue igm 1 piece , rapid test card for dengue ns1 + igm ( combo ) 1 piece , rapid test card for hiv ( 4th generation ) 1 piece , rapid test card for hiv 1 piece , rapid test card for hcv 1 piece , rapid test card for hcv ( 3rd generation ) 1 piece , rapid test card for hcv ( 4th generation ) 1 piece , rapid test card for hbsag 1 piece , rapid test card for scrub typhus 1 piece , rapid test card for chickengunia 1 piece , rapid test card for typhoid igm + igg 1 piece , rapid test card for syphilis ( rpr ) 1 piece , rapid test strip for syphilis ( rpr ) 1 piece , rapid test card for hiv & syphilis 1 piece , pregnency test strip 1 piece , pregnency test card 1 piece , antisera anti. a monoclonal 10 ml , antisera anti b monoclonal 10 ml , antisera anti ab monoclonal 10 ml , antisera anti d igm monoclonal 10 ml , antisera anti d ( igm + igg ) monoclonal 10 ml , lectin a1 monoclonal 10 ml , ahg monoclonal 10 ml , antisera anti h monoclonal 10 ml , blood grouping test kit ( abd kit ) ( monoclonal ) 10 ml each , bovine alumine 22% 10 ml , gel card ahg ( coomb gel card ) for cross match 1 piece , liss solution 500 ml ( ready ) , blood sample collection edta vial single cap5 ml 100 piece , blood sample collectionplainvial single cap 5 ml 100 piece , blood sample collectionpt vial single cap 5 ml 100 piece , blood sample vial5ml ( edta ) double cap 100 piece , blood sample vial 5ml ( plain ) double cap 100 piece , blood sample collectionclot activater vial single cap 5 ml 100 piece , blood collecting bag cpda 1 paed 100ml 1 piece , blood collecting bag cpda 1 350ml single 1 piece , aslo test kit 5ml ( latex ) , aslo test kit 50ml ( quantitative ) , analyser paper roll for horiba 3 part cbc 1 piece , analyzer paper roll for semi biochemistry analyzer 1 piece , analyzer paper roll for lura urineanalyzer 1 piece , pasture pippett ( plastic ) volume 5 ml 1 piece , wash bottel 2 ltr , wash bottel 5 ltr , wash bottel 10 ltr , throat swab ( cotton ) 100 piece , throat swab ( nylon ) 100 piece , throat swab ( dacron ) 100 piece , plastic zip lock pocket 100 piece , blood sugar test strip with acquachek with glucometer ( 50 strip ) , blood urea test kit , blood sugar accusure insci glucometer strip ( 50 strip ) , crp test kit5ml ( latex ) , crp test kit50ml ( quantitative ) , crp titration test kit5ml , cover slip for neubar chamber 100 piece , cover slip for glass slide 100 piece , counting chamber ( neubar ) 1 piece , capilary tube 1.5 mm diameter x 10 15 cm length ( 50 piece ) , cbc roll ( pos 555 tl ) ( 55mm×15 mtr ) 1 roll , ckmb trop t test card ( 1 piece ) , ckmb trop i card ( 1 piece ) , cknac trop t test card ( 1 piece ) , ck mb solution 1x25 ml , ck nac solution 1x25 ml , disposal droper ( 100 piece ) , plastic test tube with screw cap 10ml ( 100 piece ) , plastic test tube with screw cap 5ml ( 100 piece ) , disposal plastic test tube 5ml ( 100 piece ) , disposal plastic test tube 10ml ( 100 piece ) , disposable face mask ( 100 piece ) , disposal cap ( 100 piece ) , edta solution 500ml bottel , drabkin solution 5 ltr. pack , dettol liquid ( 500ml ) , esr standwestergen blood test pipet ( 5 test stand ) 1 piece , esr tube glass for westergen mathod 1 piece , disposable plastic esr pippet 100 piece , esr pippet cuff 100 piece , elicote vial 100 piece , floride vacutainor vial 100 piece , glass slide 76mmx26mm 100 piece , haemoglobinometer ( german made ) top 1 piece , hb tube square haemometer mesauring tube ( top ) 10 piece , giemsa stain 500 ml , methylene blue stain500 ml , gention violet stain 500 ml , jsb i ( solution ) 500ml , jsb ii ( solution ) 500 ml , leishman stain 500ml , lense cleaning paper packet ( 50 page ) , lable chips ( paper ) 1000 piece , liquid parafin 500ml , micro tips 1000 micro ltr 1000 piece , micro tips 200 micro ltr 1000 piece , micro tips 50 micro ltr 1000 piece , micro tips 20 micro ltr 1000 piece , micro scope blub isi 1 piece , microscope lense ( made in german, japan, poland ) 1 piece , micro pippet10 to 100 micro 1 piece , micro pippet100 to1000 micro 1 piece , multichannel micropippet for elisa 1 piece , n / 10 hcl 500ml , n95 mask with respirator 1 piece , n95 mask without respirator 1 piece , mask tripple layer 100 piece , p.p. e.kit for swine flue 1 piece , p.p. e.kit sitra approved, 90 gsmwith ( n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit 100 gsm sitra approved, 90 gsmwith ( n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit for corona with ( triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit googles 1 piece , face shield 1 piece , surgical sterile gloves 6 no 1 pair , surgical sterile gloves 6.5 no 1 pair , surgical sterile gloves 7 no 1 pair , surgical sterile gloves 7.5 no 1 pair , disposal rubber gloves large size 1 piece , disposal rubber gloves medium size 1 piece , infrared thermometer 1 piece , multi surface disinfectant liquid 500 ml , foot press sanitizer stand 1 piece , uv disinfection sanitizres 1 piece , pulse oxymeter finger tip 1 piece , r.a. test kit 5ml ( latex ) , r.a. test kit 50ml ( quantitative ) , test tube stand 100 test tube ( steel ) 1 stand , sodium citrate solution 500ml , sterile water 5 l packing , semen dilutingfluid 100 ml , spinal niddle 26 g 1 piece , triplefilterd disttled water5 l packing , test tube stand steel 24 test tube , test tube stand steel 12 test tube , test tube stand plastic12 test tube , test tube stand plastic24 test tube , test tube stand plastic48 test tube , test tube stand plastic50 test tube , tissue paper roll 1 piece , arm tourniquites for blood sampling 1 piece , urine test strip for albumine, sugar & ketone body 100 piece , urine test strip ( albumine sugar ) 100 piece , urine container ( disposable ) 30ml , vtmvial forswine flu & corona 1 piece , vial 5 ml ( open mouth ) for cross match ( plastic ) 100 piece , vial 5 ml ( open mouth ) for cross match ( glass ) 100 piece , vacutainor plain vial 5 ml 100 piece , vacutainor edta k3 vial 5 ml 100 piece , vacutainor holder and niddlemulti sample 100 piece , vacume test tube edta ( with niddle ) 2ml 100 piece , vacume test tube edta ( with niddle ) 5ml 100 piece , vacume test tube plain ( with niddle ) 2ml 100 piece , vacume test tube plain ( with niddle ) 5ml 100 piece , widal test kit 4 x 5 ( to, th, ah, bh ) 1 kit rate , dettol hand wash 500ml , phenyle 5 ltr. , vacutainor sodium citrate test tube 100 piece , cuso4 solution for hemoglobine estimation 100 piece , wintrobs tube 100 piece , disposable esr test tube 100 piece , swine flu vaccine 0.5 ml , sodium hypochloride 6% 5 ltr. , sodium hypochloride 5% 5 ltr. , sodium hypochloride 4% 5 ltr. , xylene 100ml , coplin staining jar 100 ml , coplinstainingjar 200 ml , staining jar 250 ml , gram staning regent ( readymade ) 100 ml , sticker roll for computer ( 4 x 4 size ) 1 roll , culture bottle 100 ml , culture bottle 200 ml , culture bottle 500 ml , gluteraldehyde 5 ltr. , vial for calcium test 100 piece , prolyle control ( for electrolite machine ) , multi control for semi auto biochemistry analyzer , bar code sticker l x w ( 2x1 ) 5000 piece , wax ribbon roll forbar code sticker l x w ( 2x1 ) 5000 piece , digital dlc counter machine 1 piece , regents forsemi auto analyser machine , serum calcium test kit liquid , serum creatinine test kit liquid , serum cholestrol test kit liquid , serum bilirubin test kit liquid , serum sgot test kit , spirit 5 ltr. ( methylated ) , serum sgpt test kit , s. alk. phosphate kit liquid 30 x 10ml , s. protein total liquid , s. albumin kit liquid , s. ldh liquid , s. amylase liquid , s. uric acid liquid , p.p.e kit for hiv 1 piece , serum ldh test kit liquid , blood sugar test kit , cpkmm trop ttest kit 1x25ml , cpkmb trop t test kit 1x25ml , hdl chloresterol test kit ( erba, span ) , triglyceride test kit , regents for culture media , nutrient agar plate 1 piece , sheep blood agar plate 1 piece , macconkey agar plate 1 piece , triple sugar iron agar 1 piece , urea agar base ( christensen ) ( autoclavable ) 1 piece , citrate agar , oxidase discs ( 50 discs / vl ) , gram stains kit 50 ml , grams crystal violet , kovacs indole regent , whatman filter paper no 1 100 piece , gention violet staning 100 ml , crystal violet stain100 ml , grams iodine 100 ml , lugol iodine 100 ml , aluminium slide tray for 10 slide 1 piece , potassium iodide 200 gm , safranin counter stain 100 ml , acetone solution 100 ml , absolute ethyl alcohol 100 ml , 95 % ethyl alcohol100 ml , methyl alcohol 100 ml , phosphate buffer solutions ( ph 7.2 ) 500 ml , vial 50 ml 1 piece , folken tube 1 piece , autoclave strip 1 piece , powder sucrose 75 gm , lancet with guard 100 piece , niddle 26 g 100 piece , niddle 23 g 100 piece , draining rack , measuring cylinder 100 ml , measuring cylinder 200 ml , slide staining rack 1 piece , nicrome loop 1 piece , pt vial for pt inr 100 piece , plastic gown ( disposable ) 1 piece , plastic gown ( washable ) 1 piece...

Sms Medical College - Rajasthan

33046439 next generation sequencer with accessories and ancillary equipment for tropical medicine and virology department high throughput sequencing system with 3 year warranty. storage server: 128gb ram, 32 core processor, i0otb storade pre installed with necessary blo informatics pipelines forviral genomeanalysis work station compumer: 8core process or 128gb ram, 4th storage bio safety cabinet class ii a2 1.2 refrigerated microcentrifuge heat i3lock deep freezer •2o deep fteezer ( 40°c ) 1.3 1.4 1.5 1.6 refrigerator 1.7 — mini spin 1.8 1.9 pcr ( thermal cycler ) water purification system a mjcropipe11fes single channel of variable volume 0.1 2.5 jil x 10 10 1. 1 l0j.tix10 2 20plxio 10 100 tl x 10 100 100ojilx10 adjustable volume digital multiple channel micropipettes 1.11 30ul 300u1 5ul 50 ul 1.12 vortex mixer 1.1 1.13 insirument for qc check an perform rragment analysis axd qc check interms of nucleic acid quality and quantity w1t1l plate shaker 1.14 — 1.16’ dna rna quantification system — next generation sequencing consumables (some qty provided along with system start up) rest to be oted the price in financial bid . 1.17’ plastic ware — 1.19 laminar flow non refrigerated m1crocentrifuge — mini cenirifuge . and 20 deg) — 1.20 1.21 1.22 walk in coolbr (cold rooms) (4 8 dbg — 1.23 ice flaking machlne — 1.24 vertical autoclave scanner . 1.25 desktop computer with printer & 1.26 laptop with five — 1 27 inverter air conditioner (split type type) star rating 1.28 gel doc imaging system — 1.29 electrophoresis system magnetic stands 96 well plate 1.5 ml/2 ml tubes 100% exiaust — 1.30 1 31 io1ogica1 safety cabinet based on class u type b 2, vertical flow 1.32’ bioinformatics person support in the lab for3 years vendor should provide support in genome scqucncing with bioinformatics expertise and train the faculty/ technical staff on site till warranty period. v l.l il4ml 12’.j v bioinformatics person support in the iab for3 years vendor should provide support in genome sequencing with bioinformntics expertise and train the fnculty/ technical stafr on site till warranty period. 1.32* 1.33e the vendor shnuld process samples for sars cov 2 genome sequencing at their facility in case of any sysnem breakdpwn ata cost decided by the college 1 34 administration. vendor should provide test kits for sars cov 2 gennme analysis with complete kit. etc ...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

32933593 supply of equipments, model, articles, glassware, reagents and stains hot air oven ( 50o c ) for special standing centrifuge machine electric rotofix inner chamber & lid s. steel ( ss 304 grade ) . outer chamber mild steel duly powder coated special gtade mineral wool, control panel have on / off switch, heating & main indicators. power220 vl50 hz. holes diameter 75 mm. temperature range 5 to lod c. water bath, electric 3.01 weighing machine dialtype iron analog weighing scale. full metal body with antiskid mal capacity 130 kgs. l 3.02 equipment for reporting height stadiometer height measurement:2 feet to 7 feet t 3.03 vemier and other calipers verrnier caliper 125 mm which is smooth finished ( s.s. ) . i 3.04 blunt plastic / pvc / metallic toys of the following blunt weapons: . stone . brick . motorcycle chain . hammer . wooden log . pistol . rifle . shotgun . spade 10 sign & seal of firms 97 1.05 haemocytometer with rbc & wbc pipettes good quality of improved neubauer chamber, wbc, rbc pipette, cover slip and having wooden box improved neubauer chamber improved bc& wbc chamber, having better quality of cover slip. 25 1.06 haemoglobinometer ( sahli ) shalishb meter. good quality chamber having better graduated square tube & properly visible comparator ( standard ) tube. 25 7.o7 autoclave electric made of heavy seamless aluminium sheet. size 220mmx 230mm x 38mm. capacity loltr. electric power source 220v.50h2 2 1.08 anaerobic apparatus a seamless stainless steel body coupled with ss flange &sslid ensures 2 1.09 stopwatch t / z sec having the measuring capacity of 0.1 second, minute &hour digital 2 1.10 ph meter ph range : 0 14 ph resolution:0.01 ph temperature range : 0.0 to 100c ( manual compensation ) display: 3l12digit led display power supply: 230vac |llyo, 50hz calibration check facility & calibration enor indicationfor 7.00 t4.00 ph 1 1, 11. microscope with oil immersion high quality wide field of 10x antifungal anti reflection coated optics semi plan 4x, 10, 40x, and 100x oil objectives illumination system led 3w with intensity control resulator power supply l00v 240v. 25 1.12 high speed centrifuge for serological / hematolo gical work microprocessor based square m s body duly powder coated double walled light weight abs lid fitted with microprocessor based 2 lines l6 characters lcd panel for 0 59 minutes countdown timer. digital rpm meter & progammable speed controller. i 1.13 esr ( westergrens / wintro be ) equipment for esr estimation / westergrens pipette for esr on standwestergrenss stand. back aluminum scale having capacity of 6 to 8. westergren stand. 02 sets each 1, .1, 4 colony counter 1.15 coplin jars material ppcp ( polypropylene co polymer ) air tight, no moisture absorption, unbreakable, selfstandingjar to protect glass slides. 2 1.16 computer with accessories audio visual aids ( computer led monitor, cpu, speaker, ups ) l 1..17 machine for estimation of blood sugar glucometer digitalusage / application to monitor blood glucose levelmeasurement range 20 600 mgldl display digital, sample volume 0.5 ul 1 list of models required in department of patholow 2.ot atherosclerosis thrombosis and embolism pathology model material: resin size: l8x24 inch weight:2kg 1. 2.02 colon model with pathologies cut away view model of the colon with the following common pathologies: adhesions, appendicitis, bacterial infection, cancer, crohns disease, diverticulitis, diverticulosis, polyps, spastic colon, ulcerative colitis material: resin size: 18x24 inch weieht:2ke 7 2.03 bladder pathology this model is designed to help patients understand the anatomy of diseased bladder. mounted on base. supplied with english key card. size 33 x26 x8 cm approx. weight 720 g. 7 2.o4 pathological stomach model 2.05 pvc liver pathologies model size i 50 1 60cm material pvc color skin weight:2kg l list of required equipmentrarticles for department of forensic me=dicine 3 toxicololv 3.01 weighing machine dialtype iron analog weighing scale. full metal body with antiskid mal capacity 130 kgs. l 3.02 equipment for reporting height stadiometer height measurement:2 feet to 7 feet t 3.03 vemier and other calipers verrnier caliper 125 mm which is smooth finished ( s.s. ) etc...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

32926533 supply of equipments, models, articles, glassware, reagents and stains supply of equipments, models, articles, glassware, reagents and stains for uch jodhpur , list of required equipments for department of pathology & microbiology , hot air oven ( 50o c ) for special standing specifications: temperature ambient up to 25000 with least count 10c. most economical with latest technology & modern aesthetics. double metal sheet body with air pocket keep the machine cool. three fans for cooling body, door & even temperature inside chamber respectively. digital temperature control with display thermostat added to control the transfer of heat for fine temperature control. insulated glass door window to view the sample. perforated stainless steel removable two racks for keeping samples. specification: capacity ( liters ) : 30 chamber dimension ( mm ) ( wxdxh ) : 325x310x315 power watts: 700 w details of the accessories supplied with hot air oven main unit ( complete inside made of ss 316 grade ) : 01 no.s.steel shelves ( made of ss 316 grade ) 02 numbers: 02 nos. hot air oven ( tray dryer ) model 24 trav fan motor shp heating kw 6, trolley, fixed rack , centrifuge machine electric rotofix specification: maximum speed: 500 8000 rpm in increments of 10 rpm. three level speed selection slow medium and fast. alarm, digital display, timer 10x10 ml. single phase ac 220 / 230v timer: 0 99 minutes +constant. dims : 27 x 33 x 46 cm. , water bath, electric specification: inner chamber & lid s. steel ( ss 304 grade ) . outer chamber mild steel duly powder coated special grade mineral wool, control panel have on / off switch, heating & main indicators. power 220 v / 50 hz. holes diameter 75 mm. temperature range 5 to 100?c. , incubator specifications: double walled construction outer s.s304 dull finish inner s.s316 mirror polished puf insulation between two walled full acrylic door permit inspection of specimen, s without disturbing the temp temp. controlled by pid controller with auto tuning facility with accuracy of ‡ 0.5c temp range 5 c to 60 c accuracy ‡0.5c illumination light are provided for viewing cfc free hermetically sealed compressor provide temp for below ambient condition air circulation fan for marinating temp uniformity throughout the chamber the chamber is provided with modular removable shelves made of s.s. for complete flexibility in use. to work on 230 volts 50h2 temp. range 5°c to 50°c with accuracy of + 1°c double walled, inside anodized stainless steel and outside m.s. powder coated to work on 220 / 230 volts a.c 50hz inner chamber size ( mm ) wxdxh 455x410x610. capacity in cu. ft. 4 cu. ft.; capacity 112 liters. , haemocytometer with rbc & wbc pipettes specifications: good quality of improved neubauer chamber, wbc, rbc pipette, cover slip and having wooden box improved neubauer chamber improved bc& wbc chamber, having better quality of cover slip. , haemoglobinometer ( sahli ) specification: shalishb meter. good quality chamber having better graduated square tube & properly visible comparator ( standard ) tube. , autoclave electric specification: made of heavy seamless aluminium sheet. size 220mm x 230mm x 38mm. capacity 10ltr. electric power source 220v.50hz , anaerobic apparatus specification: a seamless stainless steel body coupled with ss flange &sslid ensures , stopwatch ½ sec specification: having the measuring capacity of 0.1 second, minute &hour digital , ph meter specification: ph range : 0 14 ph resolution : 0.01 ph temperature range : 0.0 to 100°c ( manual compensation ) display: 31 / 2 digit led display power supply: 230vac ‡10%, 50 hz calibration check facility & calibration error indicationfor 7.00 t4.00 ph , microscope with oil immersion specification: high quality wide field of 10x antifungal anti reflection coated optics semi plan 4x, 10, 40x, and 100x oil objectives illumination system led 3w with intensity control regulator power supply 100v 240v. , high speed centrifuge for serological / hematological work specification: microprocessor based square m s body duly powder coated double walled light weight abs lid fitted with microprocessor based 2 lines 16 characters lcd panel for 0 59 minutes countdown timer. digital rpm meter & programmable speed controller. , esr ( westergren’s / wintrobe ) specification: equipment for esr estimation / westergren’s pipette for esr on standwestergrenss stand. back aluminum scale having capacity of 6 to 8. westergren stand. , colony counter specification: digital colony counter. readout 0 999999. 7 segment led display. auto marker pen. audible confirmation of each count. uniform glare free illumination. wolffhugel glass grid with focusing facility. led based illumination. , coplin jars specification: material ppcp ( polypropylene co polymer ) air tight, no moisture absorption, unbreakable, self standing jar to protect glass slides. , computer with accessories specification: audio visual aids ( computer led monitor, cpu, speaker, ups ) , machine for estimation of blood sugar specification: glucometer digitalusage / application to monitor blood glucose levelmeasurement range 20 600 mg / dl display digital, sample volume 0.5 ul , list of models required in department of pathology , atherosclerosis thrombosis and embolism pathology model specification: material: resin size: 18x24 inch weight: 2kg , colon model with pathologies specification: cut away view model of the colon with the following common pathologies: adhesions, appendicitis, bacterial infection, cancer, crohns disease, diverticulitis, diverticulosis, polyps, spastic colon, ulcerative colitis material: resin size: 18x24 inch weight: 2kg , bladder pathology specification: this model is designed to help patients understand the anatomy of diseased bladder. mounted on base. supplied with english key card. size 33 x 26 x 8 cm approx. weight 720 g. , pathological stomach model specification: size150 160cm material pvc color skin weight: 2kg , pvc liver pathologies model specification: size150 160cm material pvc color skin weight: 2kg , list of required equipment / articles for department of forensic medicine & toxicology , weighing machine dial type specification: iron analog weighing scale. full metal body with anti skid mat. capacity 130 kgs. , equipment for reporting height specification: stadiometer height measurement: 2 feet to 7 feet , vernier and other calipers specification: verrnier caliper 125 mm which is smooth finished ( s.s. ) . , blunt specification: plastic / pvc / metallic toys of the following blunt weapons: • stone • brick • motorcycle chain • hammer • wooden log • pistol • rifle • shotgun • spade , sharp specification: plastic / pvc / metallic toys of the following sharp weapons: • kitchen knife • chef’s knife • beard knife • cleaver • butcher’s knife • trench knife • sword • axe • sickle , pointed specification: plastic / pvc / metallic toys of the following pointed weapons: • arrow • spear • dart • dagger , models specification: embossed models of the following: • case of drowning. • case of rape. • case of strangulation. • case of hanging. • case of traffic accident. • case of poisoning. • bruises injury. • abrasions injury. • lacerations injury. • contusions injury. , specimens ( organic, inorganic, poison & chemicals ) specification: 500 ml. / 500 gms. packed bottles of the following chemicals: i.inorganic corrosives sulphuric, nitric & hydrochloric acid ii. organic corrosives phenol, oxalic acid iii. inorganic non metallic irritants phosphorus, halogens iv. inorganic metallic irritants arsenic, lead, mercury, copper specimens in the transparent glass / plastic jars of the following poisons: i. organic vegetable irritants abrus, castor, croton, calotropis, semicarpus, ergot. ii. organic animal irritants – snake, scorpion & other common poisonous insects neurotoxic : i. ineberiates ethyl alcohol, methyl alcohol ii. somniferous and sedative hypnotics – opium and derivatives, barbiturates iii. deliriants dhathura, cannabis, cocaine . iv. insecticides / pesticides / agrochemical organo phosphorus compounds. organo chlorides, carbamates , pyrethriods, aluminium phosphide. v. spinal poisons strychnine vi. peripheral poisons curare cardiac poisons oleanders, aconite, tobacco other poisons: i. domestic / household poisons kerosene, detergents, disinfectants, cosmetics, rodenticide mothballs etc. ii. therapeutic drug toxicity / poisoning by medicines salicylates, paracetamol, newer derivatives of sedatives iii. food poisoning bacterial, viral, mushrooms, chemical etc. iv. drugs of dependence and drug abuse , list of required equipment for department of surgeryy , retractor double hook 10 , scissor straight 6 inches , scissor curved 6 inches , cuscos speculam small , cuscos speculam medium , cuscos speculam large , valselum forcep 8 , valselum forcep 10 , ryles tube , stich cutting scissor 6 inches , sponge holding forcep 8 , sponge holding forcep 10 , dest forceps blunt 5 , dest forceps blunt 6 , kocher artery forceps st. 61 , kocher artery forceps cd. 8 , artery forceps cd. 6 , artery forceps cd. 8 , artery forceps st. 6 , artery forceps st. 8 , kocher artery forceps st. 61 , kocher artery forceps cd. 8 , trachial tube 23cm male & 21 cm female , plaster cutter current 5amp , needle holder st. 4 , needle holder st. 5 , needle holder st. 6 , needle holder st. 8 , needle holder st. 9 , toung dipreser ss. st. , toung dipreser ss. cd , instrument tray s.s. 12x15 , kidney tray s.s. 10 , endotracheal tube with cuff , anterior vaginal wall retractor , dilators hegards double ended , allis forceps 8 , allis forceps 6 , plastic aprons , needles curved round , towels , proctoscope , autoscope ( ent box ) , catheter 30cm child, adult 40cm , cannula , list of model , vertebral with femue & pelvis , magnified human larynx , liver, pancreas, duodenum , male urogenital system , anatomy of nasal cavity , human eye , human ear , appendix , list of glass ware required in department of pathalogy , centrifuging conical tubes – 15 ml , pipettes – 10 ml , pipettes – 15 ml , testtubes ( 15ml ) , test tubes stands , test tubes holders , stainingtray ( for pbf ) , watch glass , reagents bottles 125 ml wide mouth , glass slide pkt. , cover slip pkt. , dropping bottles plastic – 120 ml , beaker 25 ml , beaker 50 ml , capillary tubes for blood clotting , list of reagentsrequired in department of pathology , benedict’s solution , fehling’s solution a and b , iodine solution , ringer’s solution , list of stains required in department of pathology , acetocarmine stains , methyl green , pyronin , triple mallory stain , leishman’s stain , safranin , methylene blue , gram positive gram negative...

Medical And Health Services - Rajasthan

32903687 supply of reagents and stationary for chc sadulsahar under mndy / mnjy / jssk blood urea kit blood group kit , serum creatinine kit , sgot kit sgpt kit , s bilirubin kit / serum cholestrol kit s serum triglycride kit 9 serum hdl 10 widal ii aborh kit 12 vdrl card 13 his’ card 14 hcv card 15 hiisag card 16 hiv tridot 17 hcv tridot 18 malaria card 19 dengue card 20 pregnancy card •1 21 urine test 10 reagent strip ( multi strip ) 22 n / 10iicl 23 sodium citrate 24 jsb stain 1st and 2nd 251 gtips . 26 small tips 27 cbc vail ( edta k3 ) e 28 plain tube ( clot activate ) 29 glass test tube 30 hb tube hb pipet h. 32 glass slidc 34 distal water 35 ( rifle ‘vfllaitier? s capiliri tube ( cl’ ) 37 ycnmrniquet bishaste hag 39 ) biowaste ba ( black ) ( red ) ( yellow ) — 41 hvpo cloride solution 42 glucomneterstr ip ( 1+ ) 43 horiba abx cleaner 4.4 horiba abx minoclair 45 horiba abx diluent 46 horiba abx lyse ., ‘ l:sr pipet 40 bio waste bag 47 esr.vacuum tube 48 binocular microscope x ray developer ( to make 9ltrs. ) 50 x ray film l0’x12’ blue sansitive x ray film 8”xj0” blue sansitivf 52 x ray film jo”x12” blue sansitive • x ray film dental blue sansitive 54 x ray i’ixer ( to make 9ltrs. ) 55 ecg jelly 56 ecg roll — glass inomer cement 15gm ( jowder / lip. ) 58 caldum hydroxide cement ( powder ) zinc oxide cement powder eugeonol , cotton roll , bone rounger , bone file t.l lcd iir riitiir “ ith jmish httiiiii ith ( 5 ( :ie t pel i rdstir1ti i ni.iterlal — e ___r_l ( i ( ( ‘onipwsite light clirn ft’%torativc mi ( crhil light curt unit 67 ts t1ft11c 6’ ) finnii crcsol solution 2 ( ) ml 70 ldniini. spra 71 ( lutta pcrcha poinls ( i 5—10 ) 72 acccssor ) ( julia perchi points ( 2 ( ) no. ) 73 accessory gutia percha points ( i 5 no ) 74 absorbent paper poinl ( 1s 40 ) 75 blo torch 76 plastic lilling instrument 77 spreader_ ( 15 40 no ) 78 air rotor lubricating oil 79 sunction sct (ramsons) 80 elastic adhesive pluster 10*4 8i hernia mesh kit _____ 82 cthilon non absorable suture 2.0 83 ithilon non absorable suctuchcr 3.0 84 ithilon non absorablc suctuchvr 4.0 85 mackintosh sheet 86 thermameter digital _..._ 87 liquid formaline 88 phenoil 89 tejab acid sutcher suture proline (polyprophline)blue monoplament 2,0 taper 95 powder acroflavn 96 rubber examination gloves large 97 rubber examination gloves medium s blue sharp container biowaste lw white sharp containe, biowaste 100 disposable gown 1 0 1 n 95 mask without filter 102 oxygen high flow mask 103 ‘entun mask 104 dianoprost gel 105 bipap mask iikeloxygen mank c pipe lq7jnitrile gloves blue colour 108b.p. cuff (adult) 109 oxygen flow meter 110 nasal oxygen cannula neonatal 111 parafin gauge 112 fogger solution i 13 autoclave tape _.____ 114 syringe 5 ml 1 15 b.p. cuff paid 116 transperent rubber sheet 117 dispo. 01 sheet 118 uro bag 2000m1 119 microtibremop ]5.4j”5b 120 cidex(glutrerlhyde) solution 121 sucture silk 2.0 122 aeroneb (nebulizer cup) 123 bandage 104 (4meter) 124 bandage 15!4 (6mcler) 125 gaugthan 120*9 meter . i a4 rim paper 2 sudex file (ghoda file) 3 spring file 4 register big having 70 page approx 5 register small having 50 page approx. 6 dotmatrix computer paper double with carbon size 8* 10 (7ogsm) — dotmatrix computer paper single size 8* 10 (70gsm) — 8 dak pad — 9 lnk stamp pad big j0 ink stamp pad smni1? ii stock register 12 marker 13 feviseick fevistick etc 90 coutary pencil 9! vickryl 92 bleaching powder 93 kallypaid ...

Jawaharlal Nehru Medical College - Rajasthan

32832157 tender for drug and medicine items for satellite hospital, adash nagar, ajmer drug and medicine item list of drug and medicine 2 1.5% hydrogen peroxide 3 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements (detail in rc) 4 3 way stop cock with extension tube (vein o extension line) size 100cm (non pyrogenic & single use) (detail in rc) 5 3 way stop cock with extension tube (vein o extension line) size 10cm (non pyrogenic & single use) (detail in rc) 6 3 way stop cock with extension tube (vein o extension line) size 150cm (non pyrogenic & single use) (detail in rc) 7 3 way stop cock with extension tube (vein o extension line) size 50cm (non pyrogenic & single use) (detail in rc) 8 3rd generation recombinant f viii 1000 iu with diluent 9 3rd generation recombinant f viii 250 iu with diluent 10 6 thioguanine tablet usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) 11 6 mercaptopurine 20 mg 12 abdominal drain kit (with collection bag 2000 ml size 24 (details in rc) 13 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 16) (detail in rc) 14 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) (detail in rc) 15 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) size 28 (details in rc) 16 abdominal drain kit,sterile,having drainage cather and collection bag(2000) ml size 32 (details in rc) 17 abiraterone acetate tablet ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) 18 absorbable gelatin sponge 80 x 50x 10mm(details in rc) 19 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property(details in rc) 20 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 20 mm length 76 cm) size 3/0 21 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 1/0 22 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 2/0 23 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 40mm length 76 cm) size 1/0 24 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 45 mm length 100 cm) size 1 25 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 30 mm length 76 cm) size 2/0 26 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 40 mm length 76 cm) size 1/0 27 absorbable surgical suture (sterile catgut), needled suture chromic size 3/0 (3/8 cir rcutting needle 26mm, length 76 cm) 28 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 1/0 1/2 circle reverse cutting 36mm, os needle, suture length 90 cm 29 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 2/0 1/2 circle round bodied 30mm, suture length 90 cm 30 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1 1/2 circle reverse cutting,os 40mm, suture length 90 cm 31 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture(braided coated polyglactin/polyglycolic acid violet)size 3/0 1/2 circle round bodied 20mm, suture length 70 cm 32 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 30mm length 90 cm 33 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 40mm l 90cm 34 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1 (1/2 circle reverse cutting 50 mm length 90cm) 35 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1/0(1/2 circle rb 30mm needle,length 70cm) 36 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 2/0 (1/2 circle rb 31mm needle, length 70cm) 37 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)1/2 cir rb needle size 1/0 30mm length 90 cm 38 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 3/0 1/2cir rb needle 20mm length 70 cm 39 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1 1/2 cir rb needle40mm length 90 cm 40 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1/0(1/2 cir rb needle 40mm length 90 cm) 41 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 4/0 (1/2 cir rb needle 20mm length 70 cm) 42 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0 3/8 circle cutting needle 22mm length 45 cm 43 absorbable surgical suture (synthetic)antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 3/0 3/8 circle r cutting, ps 1,24mm, suture length 70 cm 44 absorbable surgical suture (synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 1 1/2 cir tapercut needle (heavy) 40mm length 90 cm 45 absorbable surgical suture(synthetic)antibacterial coated sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 46 absorbable surgical suture(synthetic)antibacterial with sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1/0 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 47 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0(1/2 cir conventional 25mm length 90 cm)undyed 48 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 4/0 3/8 circle cutting 16mm needle,suture length 70cm 49 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate,size 3/0 (1/2 circle ovalrb contrast needle 26mm, suture length 70cm) 50 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 3/0 (3/8 circle cutting 25mm needle, suture length of 70cm) 51 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 4/0 (1/2 circle cutting 16mm needle,suture length 70cm) 52 absorbable surgical sutures,sterilised needled polyglecaprone/polyglyconate,monofilament sutures size 2/0 (1/2 circle oval rb needle 26mm needle,suture length of 70cm) 53 absorbent cotton wool ip 500 gm 54 acebrophylline sr 200 mg 55 acebrophylline tablet/capsule 100 mg 56 aceclofenac + thiocolchicoside 57 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 58 aceclofenac sr 200 mg 59 aceclofenac+paracetamol+ serratiopeptidase (100+325+15 mg) 60 acenocoumarol tab ip/ nicoumalone tab ip 2 mg 61 acetazolamide tab ip 250mg 62 acetic acid otic solution 2% 63 acetylcystine solution usp (injection) 200 mg/ml 64 acitretin 10 mg 65 acitretin 25 mg 66 act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of sulphadoxine and pyrimethamine(750mg+37.5mg) 67 act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 68 act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and pyrimethamine(250mg+12.5mg) 69 act kit containing 3 tablets of artesunate(50 mg each) and 1 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 70 acth synacthen 250 mcg 71 acyclovir cream 5% 72 acyclovir eye ointment ip 3% w/w 5gm size 73 acyclovir intravenous infusion ip 250mg 74 acyclovir intravenous infusion ip 500mg 75 acyclovir oral suspension ip 400mg/5ml 76 acyclovir tab ip 200 mg 77 acyclovir tab ip 800 mg 78 adalimumab 40 mg 79 adaplene (0.1% w/w) 80 adenosine injection ip 6 mg/2ml 81 ado trastuzumab 100 mg 82 ado trastuzumab 160 mg 83 adrenaline injection ip 1mg/ml im/iv use 84 afatinib 20 mg 85 afatinib 30 mg 86 afatinib 40 mg 87 albendazole oral suspension ip 400 mg/10ml 88 albendazole tablets ip 400 mg(detail in rc) 89 alectinib 150 mg (monopoly) 90 alendronate sodium 70 mg 91 alendronate sodium tablets usp / bp 35 mg 92 alfuzosin 10 mg 93 alkylizer syrup 1.4 gm/5 ml( 100 ml )(disodium hydrogen citrate) 94 all trans retinoic acid 10 mg 95 allopurinol tablets ip 100 mg 96 aloe vera moisturizing 97 alpelisib 150 mg (monopoly) 98 alpelisib 200 mg (monopoly) 99 alpelisib 250 mg (monopoly) 100 alpha beta arteether 2 ml 101 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit 102 alpha+lipoic acid + leycopen +multivitamin and miltiminerals 103 alprazolam tab ip 0.25 mg 104 alprazolam tab ip 0.5mg 105 amantidine 100mg 106 ambroxol 107 amikacin inj ip 100 mg 108 amikacin inj ip 250 mg 109 amikacin inj ip 500 mg 110 amino acid 10% injection 100ml size 111 aminocaproicacid 20ml 112 aminophylline inj ip 25 mg/ml 113 amiodarone hydrochloride inj 50 mg/ml 114 amiodarone tab ip 100 mg 115 amiodarone tab ip 200 mg 116 amisulpride 50 mg 117 amitriptyline tab ip 25mg film coated 118 amlodipine and atenolol tablet (amlodipine besilate equivalent to amlodipine 5mg,atenolol 50mg) 119 amlodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) 120 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg 121 amlodipine oral solution 1 mg/ ml 122 amlodipine tab ip 2.5 mg 123 amlodipine tablets ip 5 mg 124 amophous hydrogel with colloid silver wound dressing 125 amorolfine 0.25% 126 amoxicillin and potassium clavulanate inj ip 1.2gm 127 amoxicillin and potassium clavulanic ip inj 600mg 128 amoxycillin & clavulanic acid 300 mg 129 amoxycillin and cloxacillin cap 250 + 250 mg 130 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg 131 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg/5 ml (30ml bottle) 132 amoxycillin cap ip 250mg 133 amoxycillin cap ip 500mg 134 amoxycillin dispersible tablets ip 125 mg 135 amoxycillin oral suspension ip (dry syrup) 125 mg/5ml 136 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 137 amphotericin b inj ip 50 mg 138 ampicillin + salbactum 1.5g 139 ampicillin cap ip 500mg 140 ampicillin injection ip 500 mg 141 antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 142 antacid tablets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 143 anti a blood grouping serum ip(anti a monoclonal serum) 144 anti b blood grouping serum ip(anti b mono clonal serum) 145 anti d(rh) blood grouping serum ip/anti d blood grouping serum ip 146 anti inhibitor coagulation complex (human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial) 147 anticold 148 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg 149 anti oxidants (beta carotene 10 mg,vit e 25mg,vit c 100 mg,copper 1.5 mg,managanese 1.5 mg,zinc 7.5 mg,selenium 150 microgram) 150 apixaban 2.5 mg 151 apixaban 5mg 152 aprepitant 125 mg 153 aripiprazole 10 mg 154 aripiprazole 5 mg 155 artemether 40mg + lumefantrine 240 mg 30ml 156 artemether and leumefantrine tablet (40 mg and 240 mg) 157 artemether and leumefantrine tablet (80 mg and 480 mg) 158 artesunate 120 mg 159 artesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o/o w/v (1ml ampoule),sodium chloride injection ip 0.9o/o w/v (5ml ampoule) 160 artificial saliva 161 asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% 162 ascorbic acid tab ip 500 mg 163 asepto syringe with transparent bulb sterile, 60 ml 164 aspirinip 300 mg 165 aspirin delayed release tablet / aspirin gastroresistant tab ip (each enteric coated tablet contains acetyl salicylic acid 75 mg) 166 aspirin dispresible 325mg 167 aspirin tablet ip (gastro resistant) 150 mg 168 astyminec (vitamin c+ essential amino acid) 169 atenolol tab ip 25 mg 170 atenolol tab ip 50 mg 171 atezolizumab 1200 mg(monopoly) 172 atomoxetin 10 mg 173 atomoxetin 18 mg 174 atomoxetin 25 mg 175 atorvastatin tab ip 10mg 176 atorvastatin tablets ip 40 mg 177 atracurium inj 10 mg/ml 178 atropine eye ointment ip 1% 179 atropine sulphate injection 0.6mg/ml 180 atropine sulphate ophthalmic solution usp 1% 181 atroxentine 250mg (trientine hcl) 182 avelumab 200 mg (monopoly) 183 axitinib 5 mg 184 azacitidine 100mg 185 azacitidine 50mg 186 azathioprine tab ip 50 mg 187 azelaic acid 20% 188 azithromycin 1% 189 azithromycin 10 ml vial equaivelent to 500 mg 190 azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 191 azithromycin tab ip 500 mg 192 azithromycin tablets ip 250mg 193 aztreonam injection 1gm 194 aztreonam injection usp 500 mg 195 b. complex 196 b.b silk suture (3/8 cir rb needle 16mm, length 76 cm size 5/0 (details in rc) 197 b.b silk suture (3/8 cir rb needle 20mm, length 76 cm size 4/0 (details in rc) 198 bacitracin for injection 25,000 iu 199 baclofen oral solution 5 mg /ml 200 baclofen tablet ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) 201 balanced salt calcium free 1000 ml [solution], non pvc polyolefin sterile free flex bag 202 beclomethasone inhalation ip 200 mcg/dose 203 beclomethasone, neomycin and clotrimazole cream (beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 %) 204 bendamustine injection 100 mg 205 benzathine benzylpenicillin inj ip 12 lac units 206 benzathine benzylpenicillin inj ip 6 lac units 207 benzoyl peroxide 2.5 % 208 betadin 5% 209 betahistine tab ip 16 mg 210 betahistine tab ip 8 mg 211 betamethasone dipropionate cream ip 0.05% 212 betamethasone lotion ip 0.05 o/o 213 betamethasone sod phos inj ip 4mg/ml 214 betamethasone tab ip 0.5mg 215 betaxolol eye drops 0.5 o/o 216 bevacizumab injection 100 mg 217 bevacizumab injection 400 mg 218 bicalutamide tablet ip 50 mg (each film tablet contains bicalutamide ip 50 mg) 219 bilastin 20 mg 220 biotin 5 mg 221 biphasic isophane insulin inj ip (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) 222 bisacodyl tab ip 5 mg 223 black disinfectant fluid (phenyl) as per schedule o grade iii 224 bleomycin injection ip 15mg (bleomycin sulphate injection 15 units) 225 blood administration set blood transfusion set (details in rc) 226 bone cement 227 bone wax sterilised 228 bortezomib 2.5 229 bortezomib injection 2mg 230 bosentan62.5 mg 231 bosutinib 500 mg 232 botulinum toxin type a for injection/botulinum toxin type b for injection100 iu 233 botulinum toxin type a for injection/botulinum toxin type b for injection50 iu 234 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 235 brinozolamide+brimonidine 236 brivaracetam 50mg 237 bromocriptine tablets ip 2.5 mg 238 budesonide 0.5mg/ml 239 budesonide 1ml 240 budesonide 200 mcg. 241 budesonide 400 mcg 242 budesonide 9 mg 243 budesonide nebulizer suspension 0.25mg/ml 244 budesonide powder for inhalation 200 mcg 245 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 246 bupivacaine inj ip 0.5% 247 buprinorphine 2 mg 248 busulfan 60mg/1ml 249 butorphanol tartrate injection usp 1mg/ml 1ml size 250 cabazitaxel 20 mg 251 cabazitaxel 40 mg 252 cabergoline tablet ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) 253 caffeine cirate 20mg/ml 254 caffeine citrate usp injection 20mg/ml (equivalent to 10 mg caffeine base/ml) 3ml size 255 caffiene citrate oral solution 256 calamine lotion ip 100ml 257 calcitriol capsules ip 0.25 mcg 258 calcium acetate 667 259 calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 260 calcium chloride 5ml vial 261 calcium dobesilate 500mg 262 calcium folinate 15 mg 263 calcium gluconate inj ip 10% (iv use) 264 calcium gluconate/folinate 265 calcium phosphate 200 ml 266 calcium with vitamin d tablets usp /calcium and colecalciferol tablets bp/calcium and vitamin d3 tablets ip(elemental calcium 500 mg, vitamin d3 250 iu) (non chewable) 267 capecitabine tablet ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) 268 capmatinib 200 mg (monopoly) 269 carbamazepine oral suspension usp 100 mg/5ml 270 carbamazepine tab ip 100 mg 271 carbamazepine tab ip 200 mg 272 carbetocin 1ml/100micro. 273 carbimazole 10 mg 274 carbimazole tabs ip 5 mg (film coated) 275 carbolic acid 100% in 500 ml 276 carbolic acid 50% in 500 ml 277 carboplatin injection ip 150 mg 278 carboplatin injection ip 450 mg 279 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg/ml 280 carboxymethylcellulose + glycerin 281 carboxymethylcellulose eye drops ip 0.5% 282 carfilzomib 20 mg 283 carfilzomib 60 mg 284 carmustine 100 mg 285 carvedilol tablet 3.125 mg 286 caspofungin 50 mg 287 caspofungin 70 mg 288 catheter,size 10(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 289 catheter,size 16(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 290 catheter,size 18(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 291 catheter,size 20(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 292 catheter,size 22(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 293 catheter,size 24(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 294 catheter,size 8(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 295 cefaclor each 5 ml contain cefaclor 125 mg 296 cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) 297 cefadroxil tablet 500 mg 298 cefepime injection ip 500 mg 299 cefipime 1000mg + tazobactum 125mg 300 cefixime + potassium clavulanate 200+125mg 301 cefixime oral suspension50mg 302 cefixime oral suspension 100mg 303 cefixime oral suspension ip 25mg/ml (paediatric drops) 304 cefixime tab ip 100 mg 305 cefixime tab ip 200 mg 306 cefoperazone 1gm+tazobactum 125mg 307 cefoperazone 1mg inj. 308 cefoperazone 500mg 309 cefoperazone and sulbactum for inj (cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm)(im/iv use) 310 cefotaxime inj ip 250 mg 311 cefotaxime injection ip 1 g 312 cefpodoxime 200mg 313 cefpodoxime cv 375 314 cefpodoxime dispersible tab 50 mg 315 cefpodoxime oral suspension 20mg/ml 316 cefpodoxime proxetil 100mg 317 cefpodoxime proxetil oral suspension 100mg 318 cefpodoxime proxetil oral suspension 50mg 319 ceftazidime 1gm+sulbactam500 mg 320 ceftazidime inj ip 1g 321 ceftazidime inj ip 250 mg 322 ceftazidime inj ip 500 mg 323 ceftazidime+ avibactum 2gm+500mg 324 ceftizoxime 1 gm 325 ceftriaxoneip 125 mg 326 ceftriaxone +salbactum+ disodium edta 327 ceftriaxone 1 gm + tazobactum 125 mg injection 328 ceftriaxone and sulbactam 1.5g 329 ceftriaxone inj ip 1g /vial 330 ceftriaxone inj ip 250 mg/vial 331 ceftriaxone inj ip 500mg/vial 332 ceftriaxone1000mg+ tazobactom125mg 333 cefuroxime 1gm 334 cefuroxime axetil500 mg. 335 cefuroxime axetil oral suspension 125mg/5ml 336 cefuroxime axetil tab ip 250 mg 337 cephalexin cap ip 250 mg 338 cephalexin cap ip 500 mg 339 cephalexin oral suspension ip (cephalexin dry syrup ip) 125mg/ 5 ml 340 cephalexin tablets 125 mg (dispersible tablets) 341 ceritinib 100 mg 342 ceritinib 200 mg 343 ceritinib 250mg 344 ceritinib 50 mg 345 ceruminolytic drops (wax dissolving ear drops) paradichlorobenzene 2 o/o , benzocaine 2.7 o/o , chlorbutol 5 o/o, turpentine oil 15 o/o 346 cetirizine syrup ip 5mg/5 ml 347 cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg,phenylephrine 10 mg & paracetamol 325 mg tab 348 cetrimide cream ip 15 gm 349 cetrorelix acetate 0.25 mg 350 cetuximab 100 mg 351 cetuximab 500mg 352 chemotherapy port & non coring needles(pediatric) (detail in rc) 353 chemotherapy port and non coring needles(adult) (detail in rc) 354 chlorambucil tab ip 5 mg 355 chloramphenicol0.5% 356 chloramphenicol +polymycin 357 chloramphenicol +polymycine + dexamethasone 358 chloramphenicol 1% w/w eye ointment ip, 3gm size 359 chloramphenicol 1gm/vial 360 chloramphenicol eye drops ip 0.5 0/0 361 chlordiazepoxide 25 mg 362 chlordiazepoxide tablets ip 10mg 363 chlordiazsepoxide 10 mg + clidinium 25 mg 364 chlorhexidine gluconate solution 5% 250 ml 365 chlorhexidine mouthwash ip 0.2 o/o 366 chloroquine phosphate inj ip 40 mg/ ml 367 chloroquine phosphate suspension ip 50 mg/5ml 368 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 369 chlorpheniramine maleate tab ip 4mg 370 chlorpromazine inj. ip 25mg/ml 371 chlorpromazine tablets ip 100 mg (coated tablet) 372 chlorpromazine tablets ip 25 mg (sugar coated) 373 chlorpromazine tablets ip 50 mg (coated tablets) 374 chlorthalidone 6.25 mg 375 chlorzoxazone , diclofenac sodium & paracetamol tablets (chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg) 376 cholchicine 0.5mg 377 cholecalciferol granules 60,000 iu /gm 378 chromic catgut suture(3/8 cir cutting needle 8 mm, suture length 35 cm) size 6/0 (details in rc) 379 chromic catgut suture(3/8 cir r cutting needle 19 mm needle, suture length 76 cm) size 4/0 (details in rc) 380 chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm) size 5/0 (details in rc) 381 cilnidipine 20 mg 382 cilnidipine 5 mg 383 cilnidipine10 mg 384 cilostazol 100mg 385 cilostazol 50mg 386 cinnarizine tablet ip 75 mg 387 cinnarizine tablets ip 25 mg 388 ciprofloxacin 0.3 o/o and dexamethasone 0.1 o/o ear drops ciprofloxacin and dexamethasone otic suspension usp 389 ciprofloxacin eye drops ip 0.3 o/o w/v 390 ciprofloxacin injection ip 200mg/100ml 391 ciprofloxacin ophthalmic ointment usp 0.3% 392 ciprofloxacin tablet ip 500 mg film coated 393 ciprofloxacin tablets ip 250 mg film coated 394 cis atracurium besylate injection 2 mg/ml in 5 ml vial 395 cisplatin inj ip 10 mg/10 ml 396 cisplatin inj ip 50 mg/ 50 ml 397 cladrabine 10 mg 398 clarithromycin 250 mg 399 clarithromycin 500mg 400 clarithromycin 500mg 401 clarithromycin for oral suspension 125mg/5ml 402 clindamycin600mg/4ml 403 clindamycin capsule ip 150mg 404 clindamycin capsule ip 300 mg 405 clindamycin phosphate gel usp 1 o/o 406 clindamycin phosphate injection ip 300 mg 407 clobazam tablet/capsule 10 mg 408 clobazam tablet/capsule 5 mg 409 clobetasol propionate cream ip 0.05 o/o 410 clobetasol+salicylic acid 0.5%+6% 411 clomifene tab ip 25 mg 412 clomiphene tab ip 50 mg 413 clomipramineip 25 mg 414 clonazepam 0.25 415 clonazepam 1mg 416 clonazepam tablet 0.5 mg 417 clonidine 150mcg/ml 418 clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) 419 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 420 clopidogrel tab ip 75 mg 421 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 16 (details in rc) 422 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 18 (details in rc) 423 clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops 424 clotrimazole 1%+beclomethasone 0.25% 425 clotrimazole 10mg 426 clotrimazole cream ip 2% w/w 427 clotrimazole mouth paint (clotrimazole 1 o/o w/v) 428 clotrimazole vaginal tab ip 500mg 429 cloxacillin sodium inj ip 500mg 430 clozapine 100 mg 431 clozapine 25 mg 432 clozapine 50 mg 433 coal tar 6% & salicylic acid 3% ointment 434 codienephosphate 435 colistimethate injection ip 1m iu powder for solution 436 coloplast60 gm 437 compound benzoic acid ointment ip benzoic acid 6 o/o + salicylic acid 3 o/o 438 compound benzoin tincture ip 439 compound sodium lactate (ringer lactate) in glass bottle 500ml 440 compound sodium lactate inj. ip 441 conc haemodialysis fluid b.p acetate concentrate 10 litre can 442 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans 443 conjugated estrogen tabs usp 0.625 mg. 444 continuous ambulatory peritoneal dialysis fluid 2 ltr 445 coq 300mg(capsule of co enzyme q10 with lycopene,selenium & omega 3 fatty acid ) 446 corrugated drainage sheet all sizes(details in rc) 447 cotriamazole 480mgs 448 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 449 co trimoxazole tablet ip (trimethoprim 160mg+sulphamethoxazole 800mg) 450 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 451 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg,ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup q.s. 452 cough syrup/expectorant(50) ml 453 cpm+cmc+nephazoline 454 crystilline penicillin 2 lakh 455 cyclopentolate 1% 456 cyclophosphamide inj ip 200 mg 457 cyclophosphamide inj ip 500 mg 458 cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) 459 cyclosporin capsule usp/ip 50 mg 460 cyclosporine 100 mg 461 cyclosporine oral solution 100mg/ml 462 cyproheptadine200ml 463 cyproheptadine 4mg 464 cyproterone acetate 2 mg +ethynil estradiol. 035mg 465 cytarabine 1000 mg 466 cytarabine injection bp 500mg 467 d penicillamine 250mg 468 dabigatran 110 mg 469 dabigatran 150 mg 470 dabrafenib 50 mg 471 dacarbazine 200 mg 472 dacarbazine injection 500 mg usp/ bp 473 dacomitinib 15 mg (monopoly) 474 dacomitinib 30 mg (monopoly) 475 danazol 100mg 476 danazol cap ip 50 mg 477 dapagliflozin 10 mg 478 dapoxetine 30 mg 479 dapsone 100 mg 480 daratumumab 100 mg (monopoly) 481 daratumumab400 mg(monopoly) 482 darbepoietin alfa 100mcg 483 darbepoietin alfa 200 mcg 484 darbepoietin alfa 500mcg 485 dasatinib tab 100 mg 486 daunorubicin inj ip 20 mg 487 decitabine 100 mg 488 decitabine 50 mg 489 deferasirox tab 100 mg 490 deferasirox tab 500 mg 491 deferiprone cap 250 mg 492 deferiprone cap 500 mg 493 deflazacort 12 mg 494 deflazacort 6mg 495 degarelix 120 mg 496 degarelix 80 mg 497 degludec insulin 300iu/3ml 498 denosumab 120 mg 499 dental gel choline salicylate 8.7 o/o, benzalkonium chloride 0.01 o/o, lignocaine hcl 2 o/o (flavoured gel base) 500 deriphylline 1 ampul 501 desferrioxamine injection ip 500 mg / vial (for i.m. inj and i.v s.c. infusion) 502 desfluraneusp 240 ml bottle 503 desonide0.05% 504 desvenlafaxine 50mg 505 detemir insuline 506 dexamethasone inj ip 8mg/2ml 507 dexamethasone tab ip 0.5 mg 508 dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) 509 dexmedetomidine 100mcg/ml 510 dextran 40 511 dextromethorphan hbr syrup ip 13.5mg / 5ml 512 dextromethorphan hcl + chlorpheniramine 513 dextrose 5% 500 mlglass bottle 514 dextrose inj ip 10% 515 dextrose inj ip 25% w/v 516 dextrose inj ip 5% 517 dextrose with sod.chloride polypack 5% 500ml 518 diastasepepsin with simethicone 15 ml 519 diatrizoate meglumine & diatrizoate sodium inj usp 60% (iodine conc.= 292 mg/ml) 520 diatrizoate meglumine and diat sod inj usp 76%w/v (iodine = 370 mg/ml) 521 diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg/ml 30 ml 522 diazepam inj ip 10mg/2ml (1m/iv use) 523 diazepam tab ip 5 mg 524 diazoxide 300 mg/20ml 525 diclo & sera& para. 526 diclofenac + thiocolchicoside 527 diclofenac each transdermal patch contain 200 mg diclofenac 528 diclofenac gastro resistant tablet ip 50 mg(enteric coated) 529 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 530 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 531 diclofenac sodium aqueous injection 75mg/ml 1ml size, iv & im use 532 diclofenac sodium inj ip 25 mg/ ml (im/iv use) 533 diclofence prolonged release tablet ip 100 mg 534 dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 535 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 536 dicyclomine hydrochloride oral solution ip 10mg /5ml 537 dicyclomine inj ip 10 mg /ml 538 dicyclomine tab ip 10 mg 539 dienogest 2mg 540 diethylcarbamazine tab ip 100 mg 541 digoxin 2mg 542 digoxin 0.25% 543 digoxin inj ip 0.25 mg/ml 544 digoxin tab ip 0.25 mg. 545 diltiazemprolonged released90mg 546 diltiazem 2%p/r 547 diltiazem 25 mg 548 diltiazem tabs ip 30 mg film coated 549 dimethyl fumarate 240mg 550 dimethyl fumarate120 mg 551 dinoprostone cream/ gel 0.5 mg dinoprostone in syringe 552 diphtheria antitoxin 10000 iu 553 disposable sterile surgical rubber gloves size 8 inches,powder free 554 disposable sterile surgical rubber gloves size 8 inches,powdered 555 distilled water 10ml 556 disulfiram 125 mg 557 disulfiram 250mg 558 divalproex extended release tablet ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) 559 dobutamine inj ip 50mg/ml/250mg (vial/)dobutamine inj ip 250 mg/5ml(amp) 560 docetaxel 120 mg 561 docetaxel 20mg 562 docetaxel 80 mg 563 docosahexaenoic 30ml 564 domperidone oral drops 10mg/ ml (10ml) 565 domperidone suspension ip 5mg/5ml 566 domperidone tab ip 10 mg 567 donepezil 5 mg 568 dopamine hydrochloride inj ip 40 mg/ml 569 dorzolamide 2% 570 double j stent, sterile, both ends open size 4f, length 16 cm 571 double j stent, sterile, both ends open, size 5f, length 20 cm 572 double j stent, sterile, one end closed size 4f, length 16 cm 573 double j stent, sterile, one end closed, size 5f, length 20 cm 574 doxorubicin inj ip 50 mg/ 25 ml 575 doxycycline cap ip 100 mg 576 doxycycline for injection 100 mg 577 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 578 dried factor viii fraction ip (iv use) 1000 iu/vial 579 dried factor viii fraction ip (iv use) 500 iu/vial 580 dried human anti haemophlic fraction ip (dried factor viii fraction ip) 250 iu/ vial (iv use) 581 drotavarine 582 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 583 drotaverine hydrochloride inj 40 mg/2 ml 584 drotaverine tab ip 40 mg 585 duloxetine gastro resistant 20 mg 586 duloxitine gastro resistant30 mg 587 durvalumab 120 mg (monopoly) 588 durvalumab 500mg (monopoly) 589 dutasteride tablet 0.5 mg 590 dydrogesterone 10mg 591 each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml 592 each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml 593 each combi bliste pack: containing 3 tablets of artesunate(200 mg each) and 2 tablet of sulphadoxine pyrimethamine(750mg+37.5mg)each or 3 tablets of sulphadoxine pyrimethamine(500+25)mg 594 ecg electrode (detail in rc) 595 eeg 400gm 596 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property (detail in rc) 597 eltrombopag 25mg 598 eltrombopag 50mg 599 empagliflazone 10mg 600 empagliflazone 25mg 601 enalapril1.25 mg 1 ml 602 enalapril maleate tab ip 2.5mg 603 enalapril maleate tab ip 5mg 604 enalapril maleate tablets ip 10 mg 605 endotracheal tube, cuff size 4.5 (details in rc) 606 endotracheal tube, cuff size 5 details in rc 607 endotracheal tube, cuff size 6 (details in rc) 608 endotracheal tube, cuff size 7 (details in rc) 609 endotracheal tube, cuff size 7.5 (details in rc) 610 endotracheal tube, cuff size 8 (details in rc) 611 endotracheal tube, cuff size 8.5 (details in rc) 612 endotracheal tube, cuff size 9 (details in rc) 613 endotracheal tube, cuff size 6.5 (details in rc) 614 endotracheal tube, cuffed size 4 (details in rc) 615 endotracheal tube, plain size 2.5 (details in rc) 616 endotracheal tube, plain size 3 (details in rc) 617 endotracheal tube, plain size 3.5 (details in rc) 618 endotracheal tube, plain size 4 (details in rc) 619 endotracheal tube, plain size 4.5 (details in rc) 620 endotracheal tube, plain size 5 (details in rc) 621 endotracheal tube, plain size 5.5 (details in rc) 622 endotracheal tube, plain size 6 (details in rc) 623 endotracheal tube, plain size 7 (details in rc) 624 endotracheal tube, plain size 7.5 (details in rc) 625 endotracheal tube, plain size 8 (details in rc) 626 endotracheal tube, plain size 8.5 (details in rc) 627 endotracheal tube, plain size 6.5 (details in rc) 628 enoxaparin sodium inj ip 60 mg 629 entacapone 200 mg 630 entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) 631 enterogermina 2billion spores 5ml 632 enzalupamide 40mg 633 enzyme 634 enzyme 100 ml 635 ephedrine 30 mg/ml 636 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile (detail in rc) 637 epirubicin 150mg/ml 638 epirubicin 50mg/ml 639 eribulin 0.5mg 640 eribulin 1 mg 641 erlotinib 100mg 642 erlotinib 150 mg 643 ertapenem sodium 1gm = ertapenem 1.046 gm 644 escitalopram tab ip 10 mg 645 esmolol hydrochloride injection 10mg/ml 10ml size 646 esmoprazole 10mg 647 esomeprazole 40 mg 648 esomperazole 649 estradiolvalerate 650 estradiolvalerate 2 mg 651 etanercept 25mg/0.5ml 652 ethamsylate inj 250 mg/ 2ml (im/iv) 653 ethamsylate tablet 500 mg (each uncoated coated tablet contains ethamsylate 500 mg) 654 ethinyloestradiol tabs ip 50 mcg 655 ethynil estradiol 0.02mg+ tab desogestral 0.15mg 656 etizolam 0.5 mg 657 etomidate 20 mg 658 etomidate mct/lct 10ml vial 659 etoposide inj ip 100 mg 660 etoricoxib tab ip 120mg 661 etoricoxib tablet ip 90 mg 662 etoricoxib+thiocolchicoside(60+8 mg) 663 eveningprimosa 1000 mg 664 everolimus 10mg 665 everolimus 5mg 666 exemestane 25 mg 667 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size 668 face mask, disposable(details in rc) 669 factor ix concentrate (purified) ip 500 600 i.u.(human coagulation factor ix) 670 faropenem tablet sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) 671 febuxostat 40 mg 672 febuxostat 80 mg 673 fenofibrate capsules/ tab ip 200 mg 674 fentanyl 25iu patch 675 fentanyl 50iu patch 676 fentanyl citrate injection 50mcg/ml 677 fentanyl citrate injection ip 2 ml 678 fenticonazole 2% 679 feracrylum 1% w/v sterile solution 100 ml 680 ferric carboxymaltose injection 50 mg/ml 10 ml size 681 ferrous sulphate with folic acid tab (paediatric) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 682 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 683 fexofenadine120 mg 684 fexofenadine180 mg 685 filgrastim injection ip (granulocyte colony stimulating factor) (sc/iv use) 300 mcg 686 finasteride tablets ip 5 mg 687 fingolimod 0.5 mg 688 flavoxate tablets ip 200 mg (coated tablet) 689 fluconazole 100mg 690 fluconazole 200 mg 691 fluconazole eye drops 0.3% 692 fluconazole oral suspension 693 fluconazole tablets ip 150mg 694 fludarabine phosphate injection 100mg 695 fludarabine phosphate injection 50mg 696 fludrocortisone 100mcg 697 flunarizine 10mg 698 flunarizine tab 5 mg 699 fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography 700 fluorouracil inj ip 250 mg/ 5ml 701 fluoxetine cap ip 20 mg 702 fluphenazine deconate injection (long acting) 25mg/ml ampule 703 flurbiprofen sodium ophthalmic solution ip 0.03 o/o w/v 704 fluromethalone 0.1% 705 fluticasone 706 fluticasone ft 707 fluvoxamine 100 mg 708 fluvoxamine 50 mg 709 foldable intra ocular lense with injector (details in rc) 11 to 17.5 710 foldable intra ocular lense with injector (details in rc) 18 to 24 711 foldable intra ocular lense with injector (details in rc) 24.5 to 28.5 712 foleys catheter no. 14 (detail in rc) 713 folic acid +methylcobalamine 10 ml pack 714 folic acid tab ip 5 mg 715 folinic acid 15mg 716 folinic acid 200mg/vial 717 fondaparinux 2.5mg 718 formaldehyde solution (34.5 per. 38 per.) 719 formaline 720 formeterol 20mcg +budesonide 0.5mg 721 formeterol 6mcg.+ fluticasone 250 mcg. inhalation 722 formetrol 12mcg + budesonide 400 mcg. 723 formoterol 6 mcg. + budesonide 200 mcg. 724 formoterol 6 mcg. + budesonide 400 mcg. 725 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 726 fosfomycin3gm 727 fosphenytoin sodium 150mg/ml 728 framycetin sulphate cream 1 o/o 100 gm pack 729 framycetin sulphate cream 1 o/o 30gm pack 730 frusemide tab ip 40 mg 731 fsh 150 iu 732 fsh 75 iu 733 fulvestrant 250mg 734 furosemide 10mg/ml 735 furosemide 20mg + spironolactone 50mg 736 furosemide injection ip 10mg/ml (im and iv use) 737 furosemide oral solution 10mg/30ml 738 fusidic acid cream ip 2% 739 gabapentine tablet/capsule 100mg 740 gabapentine tablet/capsule 300mg 741 gadodiamide inj. 0.5mml/ml vial 742 gamma benzene hexachloride lotion 1%(lindane lotion usp) 743 ganciclovir 0.15% 744 ganciclovir sodium injection 500mg (lyophilized powder for reconstitution) 745 gatifloxacin 0.3% 746 gatifloxacin+prednisolone 747 gdw 5% glass bottle/500ml 748 gefitinib tablet ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) 749 gemcitabine for injection 200 mg 750 gemcitabine for injection ip 1gm 751 gentamycin 752 gentamycin injection ip 80mg/2ml (im/ iv use) 753 gentian violet topical solution usp 1o/o 754 glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg (sustained release) 755 glibenclamide tab ip 5 mg 756 gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 500 mg) 757 gliclazide tab ip 40 mg 758 glimepiride tab ip 1mg 759 glimepiride tab ip 2 mg 760 glimepiride, pioglitazone and metformin hydrochloride (sustained release) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride (sustained release) 500 mg 761 glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) 762 glipizide tab ip 5mg 763 gloves size 6.5 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) 764 gloves size 6.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 765 gloves size 7 .5inches,powder free (disposablesterile surgical rubber gloves)(details in rc) 766 gloves size 7 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) 767 gloves size 7 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 768 gloves size 7.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 769 glucagon for injection usp 1 mg/ml 770 glucosamine + hydrochloride +methylsulfonylmethane 771 glucosamine hydrocloride + diacerin 50 mg 772 gluteraldehyde solution 2% 773 glycerin2 gm/ml 774 glycerin ip 100 ml 775 glycerin ip 400 gm 776 glyceryl trinitrate injection, diluted 5mg/ml 777 glyceryl trinitrate tablets 2.6 mg controlled release tablets 778 glycine irrigation solution 1.5% 3ltr 779 glycolic acid 6% 780 glycopyrrolate inj ip 0.2 mg/ml 781 glycopyrronium 25 782 glycopyrronium 25 + formoterol 6 mcg 783 glycopyrronium 25mcg. inhalation 2ml. 784 glycopyrronium 50 785 goserelin acetate implant 3.6 mg 786 griseofulvin tab ip 125 mg 787 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 788 haemocoagulase1 ml 789 haloperidol (long acting) 50mg/ml ampoule 790 haloperidol inj ip 5 mg/ml 791 haloperidol tab ip 1.5 mg 792 haloperidol tab ip 5 mg 793 halothane bp 794 heparin 50 iu benzyl nicotinate 2 mg 795 heparin sodium inj ip 5000 iu/ml (im/iv use) 796 hepatitis b immunologlobin injection ip 200 i.u 797 hmffor pretem 798 homatropine eye drops ip 2% 799 hormonalintra uterine device 800 horse atg(anti thymocyte globulin) 250 mg 801 hp kit(pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg 802 hp hmg (highly human menopausal parodiedgonadotropin) 150 iu 803 hp hmg (highly human menopausal parodiedgonadotropin) 75 iu 804 hpmc 0.3% 805 human albumin 20% in 50 ml vial 806 human albumin solution ip 20% 807 human anti d immunoglobulin 150 mcg 808 human anti d immunoglobulin injection 300mcg (im use) 809 human chorionic gonadotropin injection ip 5000 i.u. 810 human immunoglobulin inj with 12%igm,12%iga,76%igg in pack of 10ml(0.5gm) 811 human rabies immunoglobulin inj 150 iu/ ml 812 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. 813 hydralazine 20mg/ml 814 hydrochlorthiazide tab ip 12.5 mg 815 hydrochlorthiazide tab ip 25mg 816 hydrocortisone 1% 817 hydrocortisone oromucosal 20 mg 818 hydrocortisone oromucosal 5 mg 819 hydrocortisone oromucosal10 mg 820 hydrocortisone sodium succinate injection ip 100 mg base / vial (im/iv use) 821 hydrogen 11% + silver nitrate .01% 822 hydrogen peroxide solution ip 6 o/o (20 vol) 823 hydroquinone 2% 824 hydroxychloroquine sulphate tablets 200mg 825 hydroxyethyl starch (130/0.4) 6 o/o w/v with sodium chloride 0.9 o/o w/v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 826 hydroxyprogesterone inj ip 250mg /ml 827 hydroxypropylmethyl cellulose solution 20 mg/ ml 828 hydroxyurea 500mg 829 hydroxyzine oral solution 15 ml 830 hydroxyzine tab ip 25 mg 831 hyoscine butyl bromide tablets ip 10mg 832 hyoscine butylbromide inj ip 20 mg/ ml 833 ibrutinib 140mg 834 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 835 ibuprofen oral suspension bp /usp 100 mg/ 5 ml 836 ibuprofen tab ip 200 mg (coated) 837 ibuprofen tab ip 400 mg (coated) 838 ifosfamide injection ip/bp/usp 1gm 839 imatinib tab ip 400mg 840 imipenem + cilastatin injection 500mg/500mg ip powder for solution 841 imipramine tab ip 25 mg (coated tab) 842 imipramine tab ip 75 mg (coated) 843 indacaterol andglycopyronium inhalation powder110/50 mcg 844 indomethacin 75 mg sr 845 indomethacin cap ip 25 mg 846 indomethacin lyophilized powder 1mg 847 infant feeding tube size 10fg(details in rc) 848 infant feeding tube size 5fg(details in rc) 849 infant feeding tube size 8fg(details in rc) 850 infusion set with microdrip,(i.v.)sterile disposable(details in rc) 851 inj poractant alpha 80 mg/ml in pack of 1.5 ml (detail in rc) 852 inositol + myoinositol 1000mg 853 inotuzumab1 mg(monopoly) 854 insulinaspart 855 insulinglulisine(monocomponent insulin glulisine) 100 iu/ml/3 ml cartridges 856 insulinglulisine (monocomponent insulin glulisine) 100 iu/ml/3 ml prefilled pen 857 insulin glargine300 iu per ml/prefilled pen 858 insulin glargine 10 ml vial (100 iu/ml) with 30 insuline syringes with needle 859 insulin glargine 3ml (100iu/ml) with 15 insulin syringes and needles/cartridge 3ml (100iu/ml) with 15 needles and 1 pen per 20 cartridges 860 insulin injection ip (soluble insulin/neutral insulin injection)40 iu/ml(r.dna origin) 861 insulin lispro 862 insulin syringe ( 40 units) with (fixed) 30 g needle shall conforn to is 12227 863 insuline 50/50 864 interferon beta 1 a 30mg 865 intralipds 866 intravenous fat emulsion 20% w/v 250ml 867 invert sugar 10% (fructodex 10%) 500 cc 868 iohexol usp (solution for injection) non ionic contrast medium in sterile aqueous solution, 300 mg lodine/ml non ionic 50 ml 869 iohexol usp (solution for injection) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml 870 iohexol usp(solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. 871 ipilimumab 50 mg 872 ipratropium bromide nebulizer solution 250 mcg/ ml 873 ipratropium powder for inhalation ip 40 mcg 874 irinotecan 100 mg/5ml 875 irinotecan 40mg/5ml 876 iron (ferrous ascorbate) 877 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 878 iron sucrose injection usp/bp 20mg/ml (for iv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 879 isoflurane usp 880 isolyte g 881 isolyte p 10% 500 ml 882 isophane insulin inj ip 40 iu /ml 883 isoprenaline injection ip 2mg / ml 884 isosorbide dinitrate tab ip 5 mg 885 isosorbide mononitrate tabs ip 20 mg 886 isotretinoin 10mg 887 isotretinoin 20 mg 888 isoxsuprine inj ip 5 mg/ml 889 isoxsuprine tab ip 20 mg 890 itraconazole 1% 891 itraconazole 1% 892 itraconazole cap 100 mg 893 ivabradine 5mg 894 ivermectin 12mg 895 ivermectin 6 mg + albendazole 400 mg 896 ivermectin 6mg 897 k wire, length 375 mm; 1.6mm(details in rc) 898 k wire, length 375 mm; 1.8mm(details in rc) 899 k wire, length 375 mm; 1mm(details in rc) 900 ketaconazole 2% 901 ketamine inj ip 50 mg/ml 902 ketoconazole 200 mg 903 ketoconazole cream 2% 904 ketorolac tromethamine dispersible tablet 10 mg(each uncoated dispersible tablet contains ketorolac tromethamine 10 mg) 905 kojic acid 2%, arbutin,niacinamide 906 labetalol hcl inj ip 20mg/4ml 907 labetalol tab ip 100mg 908 lacosamide 50 mg 909 lacosamide infusion 910 lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100 mg) 911 lactic acid bacillus tab 60 million spores 912 lactulose 913 lactulose solution usp/bp 10gm/15ml or 3.35 gm/5ml 914 lamotrigine dispersible 100mg 915 lamotrigine tablet ip 50 mg (each sustained releasetablet contains lamotrigine ip 50 mg) 916 lapatinib 500mg 917 l arginine+proanthocynadine granules 3mg 918 l asparaginase inj 10000 iu 919 l carnitine 500mg/5ml in 30 ml 920 l carnosine 100mg/5ml in 200ml 921 leflunomide tablets ip 10mg(film coated) 922 leflunomide tablets ip/usp 20mg (film coated) 923 lenalidomide25mg 924 lenalidomide 10 mg 925 lenvatinib 10 mg 926 lenvatinib 4 mg 927 leosalbutamol 50mcg.+ ipratopium 40mcg. 928 letrozole tablet ip 2.5 mg (each film coated tablet contains letrozole ip 2.5 mg) 929 leucovorin calcium inj ip / calcium folinate inj ip 10 mg /ml 930 leurprolide acetate depot 11.25 mg 931 leurprolide acetate depot 3.75 mg 932 levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatin levamisol hydrochloride ip 50 mg) 933 levetiracetamip 250 mg 934 levetiracetam injection 500mg/5ml 935 levetiracetam oral solution/suspension 100mg/ml 936 levetiracetam tablet ip 500 mg 937 levobupivacaine 0.5% (20mg/4ml) ampule 938 levoceitrizine tablet 5mg 939 levodopa and carbidopa tab 250 mg+ 25 mg 940 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg 941 levodopa+carbidopa 125 942 levodopa+carbidopa+entacapone 100mg/25mg/200mg 943 levofloxacin 750 mg 944 levofloxacin oral solution 945 levofloxacin tablet ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) 946 levofloxacin tablets ip 250 mg 947 levofloxacine 500mg/100 ml 948 levosalbutamol 100mcg+ ipratropium bromide 40mcg 949 levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml 950 levosalbutamol inhalation solution 50ml/gm 951 levosulpiride tablet 25 mg (each uncoated tablet contains levosulpiride 25 mg) 952 levosulpride 12.5 mg/ml 953 levosulpride 75mg 954 levothyroxine sodium25 mcg 955 levothyroxine sodium75 mcg 956 lidocaine10%20ml 957 lidocaine 25 mg + prilocaine25mg 958 lidocaine hcl topical solution usp 4% 959 lidocaine1% intra cameral 960 lignocaine (preservative free) 2% 961 lignocaine + adrenaline (1:10000, 2:10000) 962 lignocaine 1% 963 lignocaine 10% spray 964 lignocaine 4%30ml 965 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 966 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg 967 lignocaine gel ip 2% 968 lignocaine hydrochloride 2% 50ml vial 969 lignocaine inj ip 2 o/o 970 lignocaine ointment 5 o/o 971 lignocaine viscous 972 linaglipitin 2.5mg 973 linaglipitin 5mg 974 linezolid 100mg/5ml in 30ml 975 linezolid inj 200mg/100ml 976 linezolid tablets ip 600 mg 977 liposomal doxorubicin 20mg 978 liposomal doxorubicin 50 mg 979 liposomol amphotericine injection b 50mg 980 liquid medical oxygen (lmo) 981 liquid paraffin ip 100 ml 982 liquid paraffin ip 400 ml 983 lisinopril tab ip 2.5 mg 984 lisinopril tab ip 5 mg 985 lisinopril tablets ip 10 mg 986 lithium carbonate tab ip 300 mg 987 liver specific mri contrast agent (gadobenate disodium (gd bopta), gadoxetate disodium (gd eob dtpa), mangafodipirtri sodium (mn dpdp), ferumoxide, ferucarbotran) 988 lomustine 40 mg 989 lomustine capsule ip 40 mg (each capsule contains lomustine ip 40 mg) 990 loperamide tab ip 2 mg 991 lopinavir 200mg+ritonavir 50 mg 992 loratadine 10 mg 993 lorazepam5 mg 994 lorazepam 1.0 mg 995 lorazepam inj ip 2 mg/ml 996 lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) 997 l orinithine l aspartate 10 ml 998 lorlatinib 100 mg 999 lorlatinib 25 mg 1000 l ornithine l aspartate (150mg) + pancreatin (100mg) 1001 losartan potassium and amlodipine tablets ip (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) 1002 losartan potassium and hydrochlorothiazide tablets ip(losartan potassium 50 mg, hydochlorothiazide 12.5 mg) 1003 losartan tab ip 25 mg 1004 losartan tab ip 50 mg 1005 loteprednol 0.25% 1006 low molecular wt. heparin 0.4mg 1007 luliconazole 1% 1008 lysol (cresol with soap solution) ip (cresol 50 o/o + soap 50 o/o) 1009 magnesium sulphate inj. ip 500mg/ml (50%w/v) 1010 magnesium sulphate, sulphacetamide, urea 75 gm 1011 mannitol inj ip 20% w/v 1012 mannitol with glycerin injection 10 o/o + 10 o/o w/v (for intravenous infusion) 1013 mecobalamin inj 500 mcg/ml 1014 medium chain triglyceride 1015 medroxyprogesterone acetate tablets ip 10 mg 1016 mefenamic acid tablets bp 500 mg 1017 mefenamice acid 100mg/5ml 1018 mefenemic acid 50 mg + paracetamol 250 mg /60 ml 1019 mefloquine tablets ip 250 mg 1020 megestrol acetate 160 mg 1021 melatonin 3 mg 1022 melatonin 60 ml 1023 melphalan 2mg 1024 melphalan tab ip 5 mg 1025 mephentermine 50mg/ml 1026 mercaptopurine tab ip 50 mg 1027 mercunium chloride 1028 meropenem 2gm 1029 meropenem inj ip 500 mg 1030 meropenem inj. ip 1gm 1031 meropenem injection ip 250 mg 1032 mesalamine tablet usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) 1033 mesalazine 1034 mesna 200 mg/2ml (sod. mercaptoethane sulphate) 1035 metformin hcl (sustained release) and glimepiride tab metformin hcl (sustained release) 500mg ,glimepiride 1mg 1036 metformin hydrochloride (sustained release) and glimepiride tablets ip (metformin hydrochloride(sustained release) 500 mg, glimipiride 2mg) 1037 metformin hydrochloride(sustained release tablets ip 1000 mg 1038 metformin tab ip 500 mg(film coated) 1039 methimazole10mg 1040 methimazole5 mg 1041 methotrexate 1000 mg 1042 methotrexate 15mg 1043 methotrexate 250 mg 1044 methotrexate 7.5mg 1045 methotrexate inj ip 50 mg/2 ml 1046 methotrexate tab ip 2.5 mg 1047 methotrexate tablets ip 10 mg 1048 methyl cobalmine tablet 1500mcg 1049 methyl cobalmine tablet 500mcg 1050 methyl prednisolone sodium succinate for injection usp 500 mg 1051 methyldopa tab ip 250mg film coated 1052 methylene blue 1053 methylergometrine inj ip 0.2 mg/ml 1054 methylergometrine tab ip 0.125 mg 1055 methylphenidate 10 mg 1056 methylprednisolon acetate40mg 1057 methylprednisolon acetate 125mg 1058 methylprednisolone4mg 1059 methylprednisolone 16mg 1060 methylprednisolone 8mg 1061 metoclopramide hydrochloride syrup ip 5 mg/ 5ml 1062 metoclopramide inj ip 10mg/2ml 1063 metoclopramide tab ip 10 mg 1064 metolazone 5mg 1065 metoprolol 5ml vial 1066 metoprolol succinate extended release tablets ip 50 mg 1067 metoprolol tablets ip 25 mg 1068 metotrexate 15mg (preservative free) 1069 metronidazole 1% and chlorhexidine gluconade 0.25% gel 1070 metronidazole benzoate oral suspension ip 100 mg of base/5ml 1071 metronidazole inj ip 500 mg/100ml 1072 metronidazole tablets ip 200 mg (film coated) 1073 metronidazole tablets ip 400 mg (film coated) 1074 meverberine 135 mg + chlordiazepoxide 10 mg 1075 miconazole nitrate cream ip 2% 1076 midazolam 0.5mg/5ml 1077 midazolam 5mg/ml 1 ml 1078 midazolam inj ip 1 mg/ml 1079 midodrine 5mg 1080 midostaurin 25 mg (monopoly) 1081 mifepristone25mg 1082 mifepristone tab ip 200mg 1083 milk low birth formula 1084 milrinone 10 mg 1085 minocycline 100mg. 1086 minoxidil 10 % 1087 minoxidil 2% 1088 minoxidil 5% 1089 mirabegeron50 mg 1090 mirabegeron 25 mg 1091 mirtazapine 15mg 1092 mirtazapine 7.5mg 1093 misoprostol tab ip 200 mcg 1094 mitomycin 2 mg 1095 mitomycin 40 mg 1096 mitomycine injection ip 10 mg/mitomycine for injection usp 10 mg 1097 mitoxanthrone infusion 10 mg 1098 mitoxanthrone infusion 20mg 1099 mometasone 0.1 % 1100 mometasone 2% 1101 montelucast(10mg) + levocetrizine tablet (5mg) 1102 montelucast+levocetrizine 1103 montelukast 10 mg 1104 montelukast 4mg 1105 montelukast 5 mg 1106 morphine10mg 1107 morphine30mg 1108 morphine sulphate inj ip 10mg/ml 1109 moxifloxacin0.5% 1110 moxifloxacin400 mg 1111 moxifloxacin 0.5%+ketorolac tromethamine 0.5% 1112 moxifloxacin and dexamethasone 1113 moxifloxacin and prednisolone 1114 moxifloxacin intra cameral 0.5% 1115 moxifloxacin+ difluoprednate 1116 moxifloxin 400mg/100ml 1117 moxonidine 0.2 mg 1118 moxonidine 0.3 mg 1119 mucus extractor sterile(details in rc) 1120 multi vitamin syrup 1121 multiple electrolytes and dextrose injection type i ip (electrolyte p injection ) 1122 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 1123 multistix test strip 1124 multivitamin 10 ml 1125 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 1126 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 1127 mycophenolate mofetil 500mg 1128 mycophenolate mofetil capsule/tablets ip 250 mg (each capsule/tablets conatin mycophenolate mofetil ip 250 mg) 1129 mycophenolate sodium tablet 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) 1130 n butyl alcohol injection 0.26mg/5ml, citric acid 2.5mg/5ml and sod. chloride solution 5 ml size 1131 nabpaclitaxel (paclitaxel nano particle)100 mg 1132 n acetylcysteine (nac) 200mg/ml 1133 n acetylecystine effervescent form, orange flavour, 600 mg 1134 naloxone inj ip 0.4mg/ ml 1135 naltrexone50 mg 1136 nandrolone decanoate 100mg 1137 nandrolone decanoate 50 mg 1138 naproxen tablet ip 250mg 1139 naproxen tablet ip 500mg 1140 nasal oxygen set, twin bore all sizes adult (details in rc) 1141 nasal oxygen set, twin bore all sizes paediatrics (details in rc) 1142 nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube (detail in rc) 1143 natalizumab 300 mg (monopoly) 1144 natamycin opthalmic suspension 5% 1145 natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron ip 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron ip 200 mg) 1146 nebivolol 10mg 1147 nebivolol 5mg 1148 nebulization mask adult (detail in rc) 1149 nebulization mask paediatric (detail in rc) 1150 nelaton catheter size 14 fg(detail in rc) 1151 neomycin bacitracin and sulphacetamide powder (neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg) 1152 neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu/gm 1153 neomycin sulphate cream 1154 neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip 1155 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 1156 neostigmine inj ip 0.5 mg/ml 1157 neostigmine injection ip 2.5mg/5ml 1158 neostigmine tab ip 15 mg 1159 neostigmine+ glycopyrrolate2.5 mg/ 0.5 mg 1160 nepafenac 0.1% 1161 netilmycin 300mg/3ml 1162 netupitant + palonosetron 300 mg + 0.5 mg 1163 nicardipin 10mg 1164 nicorandil 48 mg 1165 nicorandil 5mg 1166 nicoumalone 1 mg 1167 nicoumalone 3 mg 1168 nicoumalone 4 mg 1169 nifedipine + lidocaine p/r 1170 nifedipine cap ip 5mg 1171 nifedipine tablets ip 10 mg (sustained release) 1172 nifidipine 20mg 1173 nifidipine 20mg sr 1174 nilotinib200 mg (monopoly) 1175 nilotinib 150 mg (monopoly) 1176 nilotinib 300mg (monopoly) 1177 nimodipine infusion 10mg/50 ml 1178 nimotuzumab 50 mg 1179 nintedanib 150mg 1180 nitazoxanide 500mg 1181 nitrazepam 10 mg 1182 nitrazepam 5mg 1183 nitrofurantoin oral suspension 25mg/5ml in 100 1184 nitrofurantoin tab ip 100mg 1185 nitroglycerin inj 5 mg/ ml 1186 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for bipap with vent (detail in rc) 1187 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for ventilator without vent (detail in rc) 1188 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for bipap with vent (detail in rc) 1189 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for ventilator without vent (detail in rc) 1190 niv mask (noninvasive ventilation mask) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support (detail in rc) 1191 nivolumab 100 mg (monopoly) 1192 nivolumab 40 mg (monopoly) 1193 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2/0 1/2 circle taper cut,17mm double armed needle,suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1194 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2 0 1/2 circle taper cut,25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1195 non absorbable surgical suture, sterilised needled black braided silk size 2/0(3/8cir reverse cutting needle 45mm, length 76 cm) 1196 non absorbable surgical suture, sterilised needled black braided silk size 3/0(1/2 cir rb needle 20mm, length 76 cm) 1197 non absorbable surgical suture, sterilised needled black braided silk size 3/0(3/8cir reverse cutting needle 26mm, length 76 cm) 1198 non absorbable surgical suture, sterilised needled coated polyster braided, green/white or blue/white coated polyster braided (green / blue) with size 3/0 1/2 circle tapercut double needle 25mm,suture length 90 cm 1199 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir rb heavy 40mm, length 90 cm) 1200 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir reverse cutting, 45 mm needle length 100 cm) 1201 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1(1/2 cir rb heavy needle 45mm length 90 cm) 1202 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1/0(1/2 cir rb needle 30mm length 90 cm) 1203 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 cir rb needle 30mm, length 90 cm) 1204 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 circle tapercut needle 17mm suture length of 90cm) double arm 1205 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0(1/2 cir tapercut needle,25 mm length 90 cm) double arm 1206 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, length 90 cm) double arm 1207 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, suture length of 75cm) double arm 1208 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0(3/8 cir cutting needle 25mm length 45 cm) 1209 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 cir tapercut double needle 17mm length 70 cm)(detail in rc) 1210 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 circle tapercut 13mm double needle 70cm) 1211 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb 13 mm needle,length 75cm) double arm 1212 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb double needle 17mm length 90 cm)(detail in rc) 1213 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(3/8cir rb 16 mm needle, length 70 cm) 1214 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6/0(3/8 cir rb 13mm needle, length 90 cm double arm 1215 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 10/0 (3/8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 1216 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 8/0 (3/8 cir micropoint round body ,6mm length 38 cm) 1217 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 1/0 (3/8 cir r cutting needle 45mm length 70 cm.) 1218 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 2/0 (3/8 cir r cutting needle 45mm length 70 cm.) 1219 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 3/0 (3/8 conventional cutting needle 16mm length 70 cm) 1220 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 4/0 (3/8 conventional cutting needle 19mm length 60 cm.) 1221 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2/0 (1/2 cir tapercut ,17 mm double needle, length 90 cm) 1222 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/ blue size 4/0(1/2 cir tapercut ,17 mm double needle, length 75 cm) 1223 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/blue size 2/0(1/2 cir tapercut ,17 mm double needle, length 90 cm)(detail in rc) 1224 non absorbable surgical suture,sterilised needled monofilament polypropylene blue (3/8cir rb 16 mm needle,length 90 cm)size 6/0 1225 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir tapercut needle 17mm length 75 cm) double arm 1226 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 4/0(1/2 cir rb needle 16 mm length 70 cm) 1227 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 5/0 (1/2 circle cc 13mm needle, suture length of 70cm) double arm 1228 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 6/0(3/8 cir conventional cutting pc 3needle 15mm length 60cm) 1229 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 7/0 (3/8cir rb double 8mm needle, length 60 cm) 1230 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 8/0 (3/8 cir rb , 8mm double needle, suture length of 70cm) 1231 non absorbable surgical suture,sterilised needled polyamide monofilament black (nylon)size 5/0(3/8 cir slim blade cutting needle 15mm length 70 cm) 1232 noradrenaline injection ip 2 mg/ml 1233 norethisterone tab ip 5 mg 1234 norfloxacin tab ip 400mg film coated 1235 normal human intravenous immunoglobulin 5g/100ml 1236 normal saline 1000 mlglass bottle 1237 normal saline 500 mlglass bottle 1238 octreotide 100mg 1239 octreotide injection 50 mcg/ml 1240 octreotide lar (long acting release) 20 mg 1241 octreotide lar (long acting release) 30 mg 1242 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 1243 ofloxacin infusion ip 200mg / 100 ml(in nacl inj) 1244 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size 1245 ofloxacin oral suspension ip 50mg/ 5ml 1246 ofloxacin tab ip 200 mg 1247 ointment(modified lanolin) 1248 ointment containing lidocaine ip 3 o/o zinc oxide ip 5 o/o , hydrocortisone ip 0.25 o/o, allantoin ip 0.5 o/o 1249 oitment mupirocin ip 2% 1250 olanzapine tab ip 5 mg 1251 olaparib 150 mg (monopoly) 1252 olaparib 50 mg (monopoly) 1253 olaptadine & ketorolac 1254 olmesartan medoxomil 20 mg 1255 olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size 1256 oloptadine opthalmic solution0.1% 1257 omalizumab 150 mg vial 1258 omega 3fatty acid 50ml 1259 omeprazole cap ip 20 mg 1260 ondansetron inj ip 2mg/ml 1261 ondansetron oral solution 30 ml 1262 ondansetron oral suspension 1263 ondansetron orally disintegrating tablets ip 4mg 1264 orciprenaline 10 mg 1265 ornidazole 500mg 1266 ors powder ip 1267 oseltamivir capsule ip 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) 1268 oseltamivir capsule ip 45 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg) 1269 oseltamivir capsule ip 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) 1270 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 1271 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 1272 osimertinib 80 mg (monopoly) 1273 oxaliplatin injection usp 50 mg 1274 oxazepam 15mg 1275 oxcarbazepine 300mg 1276 oxcarbazepine 450mg 1277 oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) 1278 oxybutynin oral suspension5 ml 1279 oxygen mask (adult) 1280 oxygen mask (pediatric) 1281 oxytocin inj ip 5 iu/ml 1282 paclitaxel inj ip 100 mg 1283 paclitaxel inj ip 260 mg 1284 palonosetron 0.25mg 1285 pancreatin gastroresistant 10,000mg(with proteiase & amylase) 1286 pantoprazole 20mg 1287 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 1288 paper adhesive plaster 1 inch x 9.0 mts (with cutter) non woven adhesive tape 1289 paper adhesive plaster 2 inch x 9.0 mts (with cutter) non woven adhesive tape 1290 paper adhesive plaster 3 inch x 9.0 mts (with cutter) non woven adhesive tape 1291 paracetamol 170 mg each suppsitory contain paracetamol 170 mg 1292 paracetamol drops paediatric paracetamol oral suspension ip(each ml contains paracetamol 150mg) 1293 paracetamol infusion 1000 mg with both temper evident caps spray 10% 1294 paracetamol infusion 500 mg with both temper evident caps spray 10% 1295 paracetamol infusion ip 1% w/v 100ml size 1296 paracetamol inj. 150 mg/ml 1297 paracetamol syrup ip 125 mg/5ml (detail in rc) 1298 paracetamol tab ip 500 mg 1299 paracetomol 650 mg 1300 paroxetine 12.5mg 1301 paroxetine 25mg 1302 pazopanib 200mg 1303 pazopanib 400mg 1304 peg asparaginase 3750 iu 5 ml 1305 peg filgrastim injection 6mg 1306 pembrolizumab 50 mg (monopoly) 1307 pembrolizumab100 mg (monopoly) 1308 pemetrexed 100mg 1309 pemetrexed 500 mg 1310 penicillin v 400mg 1311 pentazocine inj ip 30mg/ml (im/iv use) 1312 pentoprazole inj 40 mg 1313 pentoxifylline extended release/sr 400mg 1314 perampanel 2 mg 1315 perampanel 4mg 1316 perfusion set (infusion set) with airway and needle (paediatric use)sterile disposable(details in rc) 1317 perfusion set with airway and needle,(adult use) sterile disposable(details in rc) 1318 peritonial dialysis solution ip 1319 permethrin 1%rinse 1320 permethrin cream 5% 1321 permethrin lotion 5% 1322 pertuzumab 100 mg 1323 phenazopyridine tablet 5 mg 1324 pheniramine 25 mg 1325 pheniramine inj ip 22.75mg /ml 1326 phenobarbitone 20mg/5ml in 100ml 1327 phenobarbitone inj ip 200mg/ml 1328 phenobarbitone tab ip 30 mg 1329 phenozopyridine 200mg 1330 phenylephrine hydrochloride10 mg/ml 1331 phenylephrine hydrochloride opthalmic solution usp/phenylephrine eye drops bp 5% 1332 phenytoin injection bp 50mg/ml 1333 phenytoin oral suspension ip 25mg/ml 1334 phenytoin tab ip 100 mg (film coated) 1335 pilocarpine 1336 pilocarpine 0.5% w/v 1337 pioglitazone tab ip 15 mg 1338 piperacillin + tazobactum for injection ip 4gm+500mg 1339 piperacillin 1 gm + tazobactum 125 mg 1340 piperacillin injection 2 gm + tazobactom 250mg ip 1341 piracetam 200mg 1342 piracetam 500mg/5ml in 100ml 1343 pirfenidone 200 mg 1344 pirfenidone 400 mg 1345 piroxicam dt 20mg 1346 placental extract 2ml 1347 plaster of paris bandage 10cm x 2.7mts 1348 plaster of paris bandage 15cm x 2.7 mts/roll 1349 plerixafor 24 mg 1350 podophyliin toxin 1351 polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride 1352 polyethyene glycol with elctrolyte approx 130gm 1353 polygeline 3.5% solution with electrolytes for i.v. infusion 1354 polymixin sulphate b injection usp 5 lac i.u. 1355 polymyxin b 10000iu/gm + neomycin 3400iu/gm 1356 polymyxin b for injection 1 million 1357 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm 1358 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm 1359 pomalidomide 2 mg 1360 pomalidomide 4 mg 1361 posacozazole 100mg 1362 posacozazole 40mg/ml 1363 potassium chloride for injection 1364 potassium chloride inj. 0.15 gm/ml 1365 potassium chloride oral solution u.s.p 500mg/ 5ml 1366 potassium magnesium citrate 1367 povidone iodine 1368 povidone iodine 1369 povidone iodine ointment 5% 15 gm 1370 povidone iodine ointment usp 250 gm 1371 povidone iodine scrub solution / cleansing solution 7.5 o/o w/v povidone iodine (suitable for hand wash) 1372 povidone iodine solution ip 10 % 1373 povidone iodine solution ip 5 % 500 ml 1374 povidone iodine solution ip 5% 100ml bottle 1375 powder clotrimazole 1% w/w 30 gm 1376 pralidoxime chloride injection ip 25 mg/ml / 500 mg 1377 prasugrel 10mg tab 1378 prazosin 5mg 1379 prazosin tablets (extended release) 2.5 mg 1380 prednisoloneip 40mg 1381 prednisoloneip 50mg 1382 prednisolone acetate opthalmic suspension 10 ml 1383 prednisolone sodium phosphate1% 1384 prednisolone tab ip 20 mg 1385 prednisolone tab ip 5 mg 1386 prednisolone tablet ip 10 mg 1387 pregabalin cap ip 75 mg 1388 pressure monitoring line / high pressure extension line (details in rc) 1389 primaquine tab ip 2.5 mg 1390 primaquine tab ip 7.5 mg 1391 primidone 250 mg 1392 primidone 50 mg 1393 probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 1394 procaine penicillin fortified 2 lack 1395 procarbazine hydrochloride capsule usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) 1396 prochlorperazine 5mg 1397 prochlorperazine mesylate injection 12.5mg/ml 5ml size 1398 progesterone inj 200 mg/ 2ml 1399 progesterone injection 50 1400 progesterone only pills 1401 promethazine inj ip 25mg/ml 1402 promethazine syrup ip 5 mg/5ml 1403 promethazine tab ip 25 mg 1404 proparacaine 0.5% w/v 1405 propofol inj ip 10 mg/ml 1406 propranolol 10mg 1407 propranolol 40 mg sr 1408 propranolol tab ip 40 mg 1409 propylthiouracil 100 mg 1410 prostaglandin 500mcg/ml 1411 protamine sulphate 5ml 1412 pyridostigmine tablet ip 60 mg (each tablet contains pyridostigmine ip 60 mg ) 1413 pyridoxine100 mg 1414 pyridoxine tablet ip 10 mg 1415 pyridoxine tablet ip 40mg 1416 quetiapine tablet ip 25mg 1417 quetiapine tablet ip 50mg 1418 quinine dihydrochloride inj ip 300 mg/ml 1419 quinine sulphate tablets ip 300 mg (film coated) 1420 rabbit atg (anti thymocyte globulin) 250 mg 1421 rabbit atg (anti thymocyte globulin)100 mg 1422 rabeprazole +levosulpiride 1423 rabies antiserum ip (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (i.m./sc use) 1424 rabies vaccine human (cell culture) ip (intradermal) 2.5 iu 1425 rabies vaccine human (cell culture) ip (intramuscular) 2.5 iu/ dose 1426 racecadotril 100mg 1427 racecadotril sachet 30 mg 1428 ramiprilip 5 mg 1429 ramipril tablets ip 2.5 mg 1430 ramucirumab 100 mg(monopoly) 1431 ramucirumab 500 mg (monopoly) 1432 ranitidine hcl injection ip 50mg/2ml 1433 ranitidine oral suspension 1434 ranitidine tab ip 150mg film coated 1435 ranitidine tab ip 300mg film coated 1436 ranizumab 10mg/ml 1437 ranolazine 500mg 1438 rasagiline1mg 1439 rasburicase 1.5 mg 1440 recombinant coagulation factor viia 1mg 1441 recombinant coagulation factor viia 2mg 1442 recombinant f ix 500 iu with diluent 1443 recombinant fsh 150 iu 1444 recombinant fsh 300iu 1445 recombinant hcg 250 iu 1446 recombinant human growth hormone 4iu vial with syringe 1447 recombinant lh 75iu 1448 regorafenib 40 mg 1449 repaglinamide 0.5mg 1450 repaglinamide 1mg 1451 reteplase 18 mg 1452 revolizer/ rotahaler device 1453 rh erythropoetin inj 4000 iu 1454 rh erythropoetin inj ip 10000 iu 1455 rh erythropoetin inj ip 2000iu 1456 ribociclib 200 mg (monopoly) 1457 rifampicin 150 mg 1458 rifampicin 450 mg 1459 rifampicin 600 mg 1460 rifaximin 1461 rifaximin 200mg 1462 rifaximin 550mg 1463 ringer acetate infusion 500 ml 1464 risperidone prolonged releaseddepot 25 mg 1465 risperidone prolonged releaseddepot 50mg 1466 risperidone tab 1 mg 1467 risperidone tab 2mg 1468 rituximab500 mg 1469 rituximab 100 mg 1470 rivaroxaban 10mg 1471 rivaroxaban 15mg 1472 rivaroxaban 20mg 1473 rizatriptan 10mg 1474 rocuronium 100mg/10ml 1475 romiplostim 125 mcg 1476 romiplostim 250 mcg 1477 romiplostim 500 mcg 1478 root canal sealer (calcium carbonate) 1479 ropinirole 0.25mg 1480 ropivacaine 0.75% 20ml vial 1481 ropivacaine 0.75% 3 ml ampule (heavy) 1482 rosuvastatin 10mg + fenofibrate 160mg 1483 rosuvastatin tablet 10 mg 1484 rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) 1485 rubber examination gloves made of natural rubber latex, non sterile, size large (details in rc) 1486 rubber examination gloves, non sterile, extra small(details in rc) 1487 rubber examination gloves,size medium (details in rc) 1488 rubber examination gloves,size small (details in rc) 1489 rucaparib300 mg 1490 rucaparib 200 mg 1491 ruxolitinib 10 mg 1492 ruxolitinib 15 mg 1493 ruxolitinib 20 mg 1494 ruxolitinib 5 mg 1495 ryles tube / nasogastric tube size: 10(details in rc) 1496 ryles tube / nasogastric tube size: 12(details in rc) 1497 ryles tube / nasogastric tube size: 16 (details in rc) 1498 ryles tube / nasogastric tube size: 18 (details in rc) 1499 ryles tube / nasogastric tube size:14 (details in rc) 1500 sacubitril 24 mg and valsartan 26 mg tablet 1501 salbutamol inhalation 100 mcg /dose 1502 salbutamol nebuliser solution bp 5 mg/ml 1503 salbutamol syrup ip 2mg/ 5ml 1504 salbutamol tab ip 2 mg 1505 salbutamol tablet ip 4 mg 1506 salicylic acid 16.7% + lactic acid 16.7% 1507 saline nasal solution (drops) (sodium chloride 0.65 o/o) 1508 salmetrol 50mcg+fluticasone 500 mcg 1509 sanitary napkin beltless with wings (details in rc) 1510 sanitary napkin beltless(details in rc) 1511 sanitary pads belt type(details in rc) 1512 savelamer carbonate tablet 400 mg (each film coated tablet contains savelamer carbonate 400 mg) 1513 scalp vein set (disposable) size 18g (details in rc) 1514 scalp vein set (disposable) size 20g (details in rc) 1515 scalp vein set (disposable) size 22g (details in rc) 1516 scalp vein set (disposable) size 24 g (details in rc) 1517 secukinumab 150 mg 1518 selegiline 5mg 1519 serratiopeptidase 10mg 1520 serratiopeptidase 20 mg 1521 sertraline tab ip 50 mg 1522 sevelamer carbonate 800 mg 1523 sevoflurane 1524 sildenafil 0.8mg 1525 sildenafil 20 mg 1526 sildosin + dutasteride 1527 silodosin 4 mg 1528 silodosin 8 mg 1529 silver sulphadiazine cream ip 1% 500 gm jar 1530 silver sulphadiazine cream ip 1% 50gm tube 1531 silymarin 70mg. 1532 simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml 1533 sitagliptine + metformin (50/500) 1534 skin graft knife blade (sterile)(details in rc) 1535 snake venum anti serum ip (lyophilized)polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum,0.45 mg of common kraite(bungaras)venum(details in rc) 1536 sodium bicarbonate inj ip 7.5% w/v 1537 sodium bicarbonate injection 1538 sodium bicarbonate oral suspension 1539 sodium bicarbonate tablet usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) 1540 sodium chloride 0.45% w/v polypack 500 ml 1541 sodium chloride 0.9% 3000ml(n.s) 1542 sodium chloride 3 % 1543 sodium chloride 3% 100ml 1544 sodium chloride 5 % 1545 sodium chloride 6% 1546 sodium chloride and dextrose0.45% infusion 500ml 1547 sodium chloride and dextrose injection ip 0.9 o/o + 5 o/o 1548 sodium chloride bottel 100ml 1549 sodium chloride inj ip 500 ml 1550 sodium chloride injection ip 100 ml 1551 sodium fluroresceinedye 20% 1552 sodium hyaluronate 1.4mg 1553 sodium nitroprusside injection 25mg/ml 2ml size 1554 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o/o disodium hydrogen phosphate dodecahydrate 8 o/o 1555 sodium picosulphate oral suspension 1556 sodium valproate gastro resistant tablets ip 200 mg 1557 sodium valproate inj 100 mg/ ml 1558 sodium valproate oral solution ip 200 mg / 5 ml 1559 sodium valproate tablet(gastro resistant) ip 500mg 1560 sofosbuvir 400 mg+ velpatasvir 100 mg 1561 solifenacin succinate10 mg 1562 sorafenib 200 mg 1563 sorbitol + tricholine citrate 1564 sotalol hydrochloride tablet usp/bp 40mg (each film coated tablet contains sotalol hydrochloride usp/bp 40mg) 1565 spironolactone tab ip 25mg 1566 spironolactone tablets ip 50 mg 1567 standard pama intra ocular lenses (details in rc) 11 to 17.5 1568 standard pama intra ocular lenses (details in rc) 18 to 24 1569 standard pama intra ocular lenses (details in rc) 24.5 to 28.5 1570 sterile disposable (single use teflon/ptfe i.v cannula with integrated 3 way stop cock size 26g (detail in rc) 1571 sterile disposable (single use) teflon/ ptfe i.v. cannula without port size 24g (details in rc) 1572 sterile disposable (single use) teflon/ptfe i.v cannula with integrated 3 way stop cock size 16g (details in rc) 1573 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 20 g (details in rc) 1574 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 22g (details in rc) 1575 sterile disposable (single useteflon / ptfe i.v. cannula with integrated 3 way stop cock.) size 18g (details in rc) 1576 sterile disposable spinal needle for single use. 22g x 3 1/2 inch (details in rc) 1577 sterile disposable spinal needle for single use. 25g x 3 1/2 inch (details in rc) 1578 sterile hypodermic syringe with needle attached, 22g, single use 50 ml (detail in rc) 1579 sterilized umbilical cotton tape width 3 mm, length 75 cm(details in rc) 1580 streptokinase injection 15 lac units ip 1581 streptomycin1gm 1582 streptomycin500mg 1583 succinylcholine inj. ip 50 mg/ml (iv use) 1584 sucralphate 1585 suction catheter, sterile. size: f g 10 (details in rc) 1586 suction catheter, sterile. size: f g 12 (details in rc) 1587 suction catheter, sterile. size: f g 14 (details in rc) 1588 suction catheter, sterile. size: f g 16 (details in rc) 1589 suction catheter, sterile. size: f g 18 (details in rc) 1590 suction catheter, sterile. size: f g 20 (details in rc) 1591 suction catheter, sterile. size: f g 22 (details in rc) 1592 suction catheter, sterile. size: f g 6 (details in rc) 1593 suction catheter, sterile. size: f g 8 (details in rc) 1594 suction catheter, sterile.size: fg 5 (details in rc) 1595 sugmadex 1596 sulfacetamide 20% 1597 sulfasalazine gastroresistant tablets ip 500 mg ip 1598 sulphur + calamine 1599 sultamicin 375 mg 1600 sunitinib 12.5 mg 1601 sunitinib 25 mg 1602 sunitinib 50 mg 1603 sunscreen (octinoxate,avobenzone , oxybenzone) spf 30 1604 superoxidized 1605 surfactant for intratrecheal instillation (natural bovine lung surfactant) 1606 surgical blade sterile, size 11(details in rc) 1607 surgical blade sterile, size 15(details in rc) 1608 surgical blade sterile, size 22(details in rc) 1609 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 (detail in rc) 1610 surgical cap disposable (for surgeons)(details in rc) 1611 surgical cap, disposable (for nurses) (details in rc)(details in rc) 1612 surgical spirit ip (100 ml) 1613 surgical spirit ip (500 ml) 1614 susp. azithromycin oral suspension 100mg/5ml 1615 susp. azithromycin oral suspension 200mg/5ml 1616 suture needles curved 1/2 circle round body assorted size 11 15(details in rc) 1617 suture needles curved 1/2 circle round body assorted size 1 5(details in rc) 1618 suture needles curved 1/2 circle round body assorted size 16 20(details in rc) 1619 suture needles curved 1/2 circle round body assorted size 6 10(details in rc) 1620 suture needles curved and cutting 1/2 circle cutting size 6 10(details in rc) 1621 suture needles curved and cutting 1/2 circle size 11 15(details in rc) 1622 suture needles curved and cutting 1/2 circle size 16 20(details in rc) 1623 suture needles curved and cutting size 1 5(details in rc) 1624 syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 1625 syringe 2 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 1626 syringe 20 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 1627 syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 1628 tacrolimus 0 .03%15 gm 1629 tacrolimus 0 .1% 15 gm 1630 tacrolimus 0.25 1631 tacrolimus 1mg 1632 tacrolimus capsule ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) 1633 tamoxifen tab ip 10 mg 1634 tamsulosin + dutasteride 1635 tamsulosin hcl tablets/capsule 0.4 mg 1636 tapentadol50mg 1637 tegafur + uracil 100 mg 1638 teicoplanin 200 mg 1639 teicoplanin 400 mg 1640 telmisartan tablets ip 40 mg 1641 temozolamide 250 mg 1642 temozolomide capsule ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) 1643 temporary cardiac pacing wire (electrode) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm 1644 tenaligliptin tablet ip 20mg 1645 tenecteplase 20mg 1646 tenecteplase 40 mg 1647 tenofovir 300mg 1648 terbinafine cream 1%w/w (10 gm tube) 1649 terbinafine hydrochloride tablet 250 mg 1650 terbutalin 1651 terbutaline tablets ip 2.5 mg 1652 testosteron propionate 250mg 1653 testosteron propionate 50mg 1654 tetanus immunoglobulin ip 250 iu/ vial 1655 tetanus vaccine (adsorbed) ip 5 ml vial 1656 tetanus vaccine (adsorbed) ip in 0.5 ml 1657 tetrabenazine 25mg 1658 thalidomide capsule usp 100 mg (each hard gelatin capsule contains thalidomide usp 100 mg) 1659 theophylline and etofylline injection (anhydrous theophylline 50.6mg + etofylline 169.4 mg) 1660 theophylline and etofylline tablets (theophylline ip 23mg + etofylline 77 mg) 1661 theophylline tablet 400mg sustained release/ controlled release (theophylline prolonged released tablet ip) 1662 thiamine 100ml 1663 thiamine tablets ip 100 mg 1664 thiopentone inj ip 0.5 g 1665 thyroxine sodium tablets ip 100mcg 1666 thyroxine tablets ip 50 mcg 1667 ticagrelor 90mg 1668 ticarcillinand clavulanic acid 1669 tigecycline for injection 100mg 1670 tigecycline for injection 50mg 1671 timolol eye drops ip 0.5 o/o w/v 1672 tinidazole tab ip 300 mg (film coated) 1673 tinidazole tab ip 500 mg (film coated) 1674 tiotropium + glycopyrolate 25mg 1675 tiotropium 9mcg inhaler 1676 tiotropium bromide dry powder30/pack 1677 tizanidine hydrochloride tablet ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg) 1678 tobaramycin 80mg 1679 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o/o +0.1 o/o 1680 tobramycin eye drops 0.3% [331] 1681 tobramycin ophthalmic ointment usp 0.3% 1682 tofacitinib 5 mg 1683 tolvapatan 15mg 1684 tooth gel sodium monofluorophosphate 0.7 o/o and potassium nitrate 5 o/o (in flavoured base) 1685 topiramate50mg 1686 topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) 1687 topotecan 2.5 mg 1688 topotecan 4 mg 1689 topotecan1 mg 1690 torsemide20mg 1691 torsemide inj 10 mg/ml 1692 torsemide tab 10 ip mg 1693 t pa 20mg alteplase for injection 1694 t pa 50mg alteplase for injection 1695 trabectedin 1 mg 1696 tracheostomy tube (pvc), cuffed all sizes(details in rc) 1697 tracheostomy tube, plain all sizes(details in rc) 1698 tramadol 37.5mg + paracetamol 325mg 1699 tramadol cap ip 50 mg 1700 tramadol inj 50 mg/ml 1701 trametinib 0.5mg + davarafenide 150mg (monopoly) 1702 tranexamic acid 500mg/5ml 1703 tranexamic acid injection ip 100mg/ml 5ml size 1704 tranexamic acid tablets ip 500 mg 1705 trastuzumab 440 mg 1706 trastuzumab150mg 1707 travapost+timolol 1708 travoprost eye drops ip 0.004 o/o 1709 tretenoin cream usp 0.025% 1710 triamcinolone acetonide 10 mg per ml 1711 triamcinolone acetonide 40 mg per ml 1712 triclofos oral suspension500 mg/ 5mlin 30ml 1713 trifluperazine tab ip 5 mg coated 1714 trihexyphenidyl hcl tab ip 2 mg 1715 trimetazidine 35mg 1716 trimetazidine 60mg 1717 triptorelin 0.1 mg 1718 triptorelin 11.25 mg 1719 triptorelin 3.75 mg 1720 tropicamide eye drop ip 1o/o 1721 tropicamide+phenylepherine 1722 trypan blue 0.6% 1723 trypsin + rutoside+bromelain 1724 trypsin chymotripsin 1725 t tube for common bile duct drainage, length 20x60 cm, size (details in rc) 1726 ulipristal 5mg 1727 umbilical catheter for new born, all sizes (details in rc) 1728 umbilical cord clamp (details in rc) 1729 urethral catheter 90 (fg 14) made up of medical grade pvc (detail in rc) 1730 urethral catheter 91 (fg 10), made up of medical grade pvc (detail in rc) 1731 urine collecting bag for new born /paediatric urine collection bag, capacity 100ml (details in rc) 1732 urine collecting bag, disposable 2000 ml(details in rc) 1733 urokinase injection 5 lac unit (lyophilized) 1734 ursodeoxycholic acid tablets ip 300 mg 1735 ursodeoxycholic oral suspension 125mg/5ml in 100ml 1736 vaccum suction set, 2.5 meter length (detail in rc) 1737 valethamate bromide inj 8mg / ml 1738 valganciclovir tablet 450 mg 1739 vancomycin for intravenous infusion ip 1 gm 1740 vancomycin for intravenous infusion ip 500 mg 1741 varicella immunoglobulin for iv use 1742 vascular catheter with metal guide no. 16 double lumen size 45 cm (longline iv) (detail in rc) 1743 vascular catheter with metal guide no. 16, double lumen size 30 cm (longline iv) (detail in rc) 1744 vascular catheter with metal guide no. 18 double lumen size 30 cm (longline iv) (detail in rc) 1745 vascular catheter with metal guide no. 18 double lumen size 45 cm (longline iv) (detail in rc) 1746 vascular catheter with metal guide no. 20 double lumen size 30 cm (longline iv) (detail in rc) 1747 vascular catheter with metal guide no. 20 double lumen size 45 cm (longline iv) (detail in rc) 1748 vascular catheter with metal guide no. 22 double lumen size 30 cm (longline iv) (detail in rc) 1749 vascular catheter with metal guide no. 22 double lumen size 45 cm (longline iv) (detail in rc) 1750 vasopressin 3ml 1751 vdrl antigen (with + ve and ve control) / rpr slide kit 1752 vecuronium bromide for injection 4mg (freeze dried) 1753 verapamil2.5 mg/ml 1754 verapamil hydrochloride sustained release 120 1755 verapamil hydrochloride sustained release 40 1756 verapamil tab ip 40 mg film coated 1757 vildagliptin 50mg 1758 vinblastine inj ip 10mg/ 10ml 1759 vincristine inj ip 1mg(vial)/vincristin injection usp 1mg/ml (amp) 1760 vinorelbine 10mg 1761 vinorelbine 50mg 1762 vitamin – e50mg/ml, 400 iu 1763 vitamin a 25000 iu 1764 vitamin a paediatric oral solution ip(vitamin a concentrate oil ip)each ml contains vitamin a 100000 iu 1765 vitamin b complex inj nfi 1766 vitamin b complex tablet nfi (prophylactic) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg (with appropriate overages) 1767 vitamin d (600000 iu) 1768 vitamin d3 400iu/ml 1769 vitamin d3 800iu/ml 1770 vitamin d3 oral solution 60000 iu 1771 vitamin e capsule 400 mg 1772 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. (aqueous solution) 1773 vitamin k 1 (phytomenadione) ip 1mg/0.5ml injection (detail in rc) 1774 voglibose 0.2 mg tab 1775 voglibose 0.3 mg tab 1776 voriconazole 1777 voriconazole 200 mg 1778 voriconazole injection 200mg/vial 1779 warfarin 1mg 1780 warfarin 2mg 1781 warfarin 3mg 1782 warfarin sodium. tab ip 5mg 1783 water for inj ip 1784 xylocaine lubricating30gm 1785 xylometazoline nasal drops ip 0.1% 1786 zinc 50mg 1787 zinc oral suspension 20 mg/100 ml 1788 zinc oxide +alo vera +semethicone 1789 zinc sulphate dispersible tablets ip elemental zinc 10 mg 1790 zoledronic acid injection ip 4mg vial 1791 zolpidem 10mg 1792 zolpidem tablet 5 mg 1793 zonisamide 100 mg 1794 zonisamide 50mg 1795 non edl 1796 balance salt solution glass bottle 500ml (sterile opthelmic irrigatiing sol.) sodium chloride 0.49%, pottasium chloride 0.075% , calcium chloride 0.048% , magnisium chloride 0.03% , sodium acetate 0.39% ,sodium citrate 0.17% 1797 inj. sodium chloride 0.9% 1798 micronised progesteron soft gelatin capsule 100mg 1799 sterilium 2propanolol 45gm , 1 propanolol 30mg/100mg 1800 korsolex rapid gluteraldehyde 15.2mg , 1.6 dihyroxy 2,5 dioxahaxane 19.7gm 1801 taurine 500mg + n acetylcysteine 150mg tablets 1802 adhesive tap cotton 6inch 1803 autoclave indicator tap (sigma lock) 1804 bandages 5cm x 4mts 2 1805 bandages 10cm x 4mts 4 1806 bandages 15cm x 4mts 6 1807 crescent 2.6 mm (sharpedge) 1808 dispo needle 26.5 1809 ecoshield/bacillocid (hydrogen peroxide 11% with silver nitrate 0.01%) 1810 surgical pad 1811 gauze than 120cm x 9mts 1812 keratom 2.8 mm (sharpedge) 1813 opthalmic micro surgical blade(mvr knife 20 g) 1814 cotton roll 1815 cotton buds 1816 makintosh 1817 bleeching powder 1818 haemocoagulase topical sol. 1819 charcoal powder 1820 suture needle (size 11 15) 1821 face shield 1822 n 95 mask 1823 hand rub 1824 glass ionomer cement (gic) 1825 personal protection equipment (ppe kit) ...

Jawaharlal Nehru Medical College - Rajasthan

32809777 supply of drug & medicines tender injection tablet syrup etc 1.5% hydrogen peroxide mouthwash 3 way stop cock non pyrogenic and single use, should be leak proof, , 2 s119 each piece with smooth movements (detail in rc) 3 way stop cock with extension tube (vein o extension line) size 3 s122 each piece 100cm (non pyrogenic & single use) (detail ln rc) 3 way stop cock with extension tube (vein o extension line) size 1ocm 4 s1 20 each piece pyrogenic & single use) (detail in rc) lnon 3 way stop cock with extension tube (vein o extension line) size 5 s1 23 each piece 150cm (non pyrogenic & single use) (detail ln rc) 3 way stop cock with extension tube (vein o extension line) size 50cm 6 s1 21 each piece (non pyrogenic & single use) (detail in rc) 7 750 3rd generation recombinant f vlll 1000 lu with diluent vial with diluent 8 749 3rd generation recombinant f vlll 250 lu with diluent vial with diluent 5 thioguanine tablet usp 40 mg (each uncoated tablet contains 6 9 742 rc not exists thioguanine usp 40 mg) 10 nrd 534 5 mercaptopurine 20 mg tab. abdominal drain kit (with collection bag 2000 ml size 24 (details in rc) 11 547.a each piece abdominal drain kit, sterile, having drainage catheter and collection bag 12 s124 each piece (2000 ml) (size 16) (detail in rc) abdominal drain kit, sterile, having drainage catheter and collection bag 13 s1 25 each piece (2000 ml) (size 20) (detail in rc) abdominal drain kit, sterile, having drainage catheter and collection bag l4 s47.b each piece (2000 ml) size 28 (details in rc) abdominal drain kit,sterile,having drainage cather and collection 15 547.c each piece baq(2000) ml size 32 (details in rc) abiraterone acetate tablet lp 250 mg (each uncoated tablet contains 16 731 bottle of 30 tablets abiraterone acetate lp 250 mq) 77 s1 absorbable gelatin sponge b0 x 50x 1omm(details in rc) piece absorbable oxidized regenerated cellulose netsize 2 x 3 topical 18 s9s rc not exists absorbable haemostatic bactericidal property(details in rc) absorbable surgical suture (sterile catgut) bp/usp needled suture 19 r2 chromic(1/2 cir rb needle 20 mm length 76 cm) size 3/0 1x12 foils absorbable surgical suture (sterile catgut) bp/usp needled suture 1l0 1x12 20 r4 3hromic(l/2 cir rb needle 30 mm length 76 cm) size foils absorbable surgical suture (sterile catgut) bp/usp needled suture 2t r3 3hromic(1/2 cir rb needle 30 mm length 76 cm) size 2l0 1x12 foils absorbable surgical suture (sterile catgut) bp/usp needled suture 22 r5 chromic(1/2 cir rb needle 40mm length 76 cm) size 1l0 1x12 foils absorbable surgical suture (sterile catgut) bp/usp needled suture 23 r7 1xl 2 foils chromic(1/2 cir rb needle 45 mm length 100 cm) size 1 absorbable surgical suture (sterile catgut) bp/usp needled suture 24 r6 chromic(3/8 cir rb needle 30 mm length 76 cm) size 2/0 1x12 foils absorbable surgical suture (sterile catgut) bp/usp needled suture 25 r,i 3hromic(3/8 cir rb needle 40 mm length 76 cm) size 1l0 1 x12 foils absorbable surgical suture (sterile catgut), needled suture chromic size 26 r8 1x12 foils 3/0 (3/8 cir rcutting needle 26mm, length 76 cm) absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 110 112 27 r72 1x12 foils :ircle reverse cutting 36mm, os needle, suture length 90 cm absorbable surgical suture (synthetic) antibacterial with sterilised reedled suture (braided coated polyglactin / polyglycolic acid violet)size 28 r70 1x12 foils 210 112 cicle round bodied 30mm, suture length 90 cm absorbable surgical suture (synthetic) antibacterial with sterilised 29 r71 needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1 lx1 2 foils 112 circle reverse cutting,os 40mm, suture length 90 cm ry l}.d s,no. il:: orug t{ame packino unlt rate/unit cst finafrate without gst rate wlth gsr absorbable surgical s@ sterilised needled suture(braided polyglactin/polygtycolic 30 r73 coated acid violet)size 3/0 112 cicle round bodied 20mm, suture 1x12 foils length 70 cm aosoroadte uurgrcat suture (synthetic) sterilised needled (braioedl 31 rl0 coated polyglactin /porygrycoric acid / pory(grycoride co ljactide)dize 2/0 1x12 foils 1/2 cir rb needle 30mm length g0 cm 32 r16 a co b a so te rb d a p b _ le oly s g u la r c g tin ica / l p s o u ry t g u r r y e co l r s ic yntn p@ory(grycoride co l ractide)size 2/o acid / 1x12 foils 1/2 cir rb needle 40mm l g0cm absorbabte surgical suture (synthetic; steritised neeege sg 33 r65 monofilament polydioxanone violet size i (1d cnde reverse cutting 50 lx1 2 foils mm leng g0cm) th aosordadte surgicat suture (synthetic) sterilised needled sutlrre 34 r67 monofilament polydioxanone violet size 110(112 circle rb 30mm 1x12 foils needle,length 70cm) absorbable su 35 r66 monofilament polydioxanone vioret size 2ro (1t2 circle rb 3rmm needre, 1x36 foils length 7ocm) absorbable surgical suture lsynt@ coated polyglactin /porygrycoric pory(grycoride co l ractide)1/2 acid / cir 36 rl 1 rb needle size 1/0 30mm length g0 1x12 foils cm absorbable surgical s /potygtycotic poty(gtycolide_co_l_tactide)size acid / _ 37 r9 99a!9 d^polglacrin 310 1l2cir rb needle 20mm length 70 1x12 foils cm absorbabte surgical suture (synthetic) sterilised naaled(berdeo coated p,olyglactin /polyglycolic poly(glycolide_co_l lactide)size_ 1 acid / 38 r13 1/2 cir rb needle40mm length g0 1x12 foils cm absorbable surgical suture 1sy /potystycotic poty(gtycotide co_l_tactide)size_ acid / 39 r17 99a199 fglis]actin 110(112 cir rb needle 40mm tength g0 1x12 foils cm) absorbable surgical suture (synthetic) s@ coated polyglactin /porygrycoric pory(grycoride co l ractide)bize 4/0 acid / 40 r15 (1/2 cir rb needte 20mm length 1x12 foils 70 cm) absorbable surgical suture 1 4t r18 coated polyglactin/porygrycoric acid/pory(grycoride co l ractide)size 3/o 3/8 circle cutting needle 22mm length 1x12 foils 45 cm adsordabre surgicat suture (synthetic)antibacterial witn sgriliseo neeeiil suture (braided coated porygractin/ porygrycoric 42 r74 acid vioret)size 3/0 3/8 circle r cutting, ps 1,24mm, suture 1x12 foils length 70 cm adsorda0re $urgicar suture (synthetic)sterilised needtedlbraidedpoated 43 r12 polyglactin/polygtycotic acid/poty(gtycotide co ljacride)size 1 1 i cn tapercut needte (heavy) 40mm length 1x12 foils 90 cm absorbabte surgical suture(syntheticyantibacterial oagd sgriiildneedled(braided po .t 44 r6b coated lyglactin/polyglycolic acid violet)size 1/2 circle ct round bodied 40mm,gs needle,suture g0 1x12 foils length cm absorbable surgical suturelsyntheffi needle d(braided porygractin/porygrycoric 45 r69 coated acid vioret)size 1/0 1/2 circle ct round bodied 40mm,gs need 1x12 foils le,suture length 90 cm adsoroa0re !iurgrcar suture(synthetic)sterilised needledlbraidedlcoated 46 r14 polyglactin/polygtycotic acid/poty(ctycotide co l tactide)size_3 to(1n cu 1x12 foils 30nventronal 25mm length 90 cm)undyed adsorbabre surgicar suture(synthetic)steritised rueeoteo@raioeoffizif polyglactin/polygtycotic acid/poly(glycolide co l tactide)size_4/0 47 r19 3/g circle cutting 16mm needle,suture 1x12 foils length tocm %*ji.si$lod .dc ro ua ol f,ate/unit gst final rate s,no. drug name packldg unit without gst rate with gst absorbable surgical sutures sterilised needled 48 r62 monofilament polyglecaprone / polyglyconate,size 3/0 (1/2 1x12 foils circle ovalrb contrast needle 26mm, suture length 70cm) absorbable surgical sutures sterilised needled 49 r64 monofilamentpolyglecaprone /polyglyconale size 3/0 (3/8 circle cutting 1x12 foils 25mm needle, suture length of 70cm) absorbable surgical sutures sterilised needled 50 r63 monofilamentpolyglecaprone /polyglyconate size 4/0 (1/2 circle cutting 1 x12 foils 16mm needle,suture length 70cm) absorbable surgical sutures,sterilised needled 51 r61 polyglecaproneipoiyg|yconate,monofilament sutures size 1x12 foils 210 (112 circle oval rb needle 26mm needle,suture length of 70cm) 52 s2 absorbent cotton wool lp 500 gm rc not exists 53 nrd 535 acebrophylline sr 200 mg tab 54 780 acebrophylline tableucapsule 100 mg 10x10 tablets nrd 536 aceclofenac + thiocolchicoside 55 tab. aceclofenac and paracetamol tablets aceclofenac 100 mg and 56 492 rc not exists paracetamol 325 mg 57 nrd 537 aceclofenac sr 200 mg tab. 58 nrd 538 aceclofenac+paracetamol+ serratiopeptidase (1 00+325+1 5 mg) tab. 59 163 acenocoumarol tab lp/ nicoumalone tab lp 2 mg 10x10 tab slrip 60 253 acetazolamide tab lp 250m9 10x10 tab blister 61 nrd 89 acetic acid otic solution 2% ear drop 62 500 acetylcystine solution usp (lnjection) 200 mg/ml rc not exists 63 nrd 7 acitretin 10 mg cap. nrd 8 acitretin 25 mg 64 cap act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of 65 647 one combi blister pack sulphadoxine and pyrimethamine(750m9+37,5mq) act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of 66 648 one combi blister pack sulphadoxine and pvrimethamine(500mq+25mo) act kit containing 3 tablets of artesunate(2smg each) and 1 tablet of 67 645 one combi blister pack sulphadoxine and pyrimethamine(250m9+1 2.5m9) act kit containing 3 tablets of artesunate(so mg each) and 1 tablet of 68 646 one combi blister pack sulphadoxine and pyrimethamine(500mq+25mq) 69 nrd 146 acth synacthen 250 mcg lnj acyclovir cream 5% 70 213 5 gm tube in unit carton 71 769 acyclovir eye ointment lp 3% w/w 5gm size 5 gm tube 72 502 acyclovir lntravenous lnfusion lp 250m9 vial 73 503 acyclovir lntravenous lnfusion lp 500m9 rc not exists acyclovir oral suspension lp 400m9/5ml 50 ml bottle (with 74 62 vleasurinq cao) 75 bj acyclovir tab lp 200 mg 10x10 tab blister 76 64 acyclovir tab lp 800 mg 10x10 tab strip 77 nrd 147 adalimumab 40 mg lnj. 78 nrd 60 adaplene (0.1% waiv) gel 79 547 adenosine lnjection lp 6 mg/2ml 2ml vial/ ampoule 80 nrd 148 ado trastuzumab 100 mg lnj. 81 nrd.149 ado trastuzumab 160 mg lnj, adrenaline lnjection lp 1mg/ml lm/lv use 1ml 82 34 amp(ambercolor)25 amp 83 nrd 539 afatinib 20 mg tab. 84 nrd 540 afatinib 30 mg tab. 85 nrd 541 afatinib 40 mg tab. 86 65 albendazole oral suspension lp 400 mg/10m1 10 ml bottle 87 66a albendazole tablets lp 400 mg(detail in rc) rc not exists nrd alectinib 150 mg (monopoly) 88 9 cap. 89 nrd 542 alendronate sodium 70 mg tab ct) drug rate/unit gst finat rate s.no. drug name packlng unlt code without gst rate with gst alendronate sodium tablets usp / bp 35 mg .4tablet) 90 631 4 tablets (20 91 nrd.543 alfuzosin 10 mg tab alkylizer 1 gm/s 100 92 788 syrup .4 ml( ml )(disodium hydrogen citrate) rc not exists 93 nrd.1o all trans retinoic acid 10 mg cap 94 598 allopurinol tablets lp 100 mg 10x10 tablets 95 nrd 44 aloe vera moisturizing cream nrd alpelisib 150 mg (monopoly) 96 544 tab. nrd alpelisib 200 mg (monopoly) 97 .545 tab. nrd alpelisib 250 mg (monopoly) 98 ..546 tab. 99 nrd 150 qlpha beta arteether 2 ml lnj. alpha lnterferon lnlection lnterferon alpha 2 concentrated solution lp 3 100 525 vial vlillion unit l 01 nrd 3 alpha+lipoic acid + leycopen +multivitamin and miltiminerals cap. alprazolam tab lp 0.25 mg 102 339 1 0x1 0 tab strip/blister alprazolam tab lp 0.5m9 103 340 10x10 tab strip/blister 104 nrd.547 amantidine 100m9 tab. 105 nrd 77 ambroxol drop 106 o/ amikacin lnj lp 100 mg 2 ml vial 707 504 amikacin lnj lp 250 mg vial 108 6b amikacin lnj lp 500 mg 2 ml vial 109 794 amino acid 10% lnjection 100m1 size 100 ml bottle 110 nrd 152 aminocaproic acid 20ml nj. 111 365 aminophylline lnj lp 25 mg/ml 10 ml amp 25 ampoules 712 183 amiodarone hydrochloride lnj 50 mg/ml 3 ml amp (10 amp) tab 100 113 181 amiodarone ip mg 10x10 tablets t74 182 amiodarone tab lp 200 mg 10x10 tab strip 115 nrd.54b amisulpride 50 mg tab. 116 341 amitriptyline tab lp 25mg film coated 10x10 tab strip amlodipine and atenolol tablet (amlodipine besilate equivalent to 717 461 10x10 tab blister amlodipine 5mg,atenolol 50mg) amlodipine and enalapril maleate tablets (amlodipine besilate equivalent t.18 457 10x10 tab strip to amlodipine 5 mg, enalapril maleate 5 mq) amlodipine and lisinopril tablets amlodipine besilate equivalent to 119 460 10x10 tab strip/blister amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mo 120 nrd 477 amlodipine oral solution 1 mg/ ml syrup amlodipine tab lp 2.5 mg 721, 184 1 0x1 0 tab strip/blister 722 185 amlodipine tablets lp 5 mg 10x10 tab blister 1,23 nrd 45 amophous hydrogel with colloid silver wound dressing cream 124 nrd 46 amorolflne 0 25% cream 12s 506 amoxicillin and potassium clavulanate lnj lp 1.2gm vial 726 505 amoxicillin and potassium clavulanic lp lnj 600mg 10 ml vial 1.27 nrd 153 amoxycillin & clavulanic acid 300 mg lnj 728 69 amoxycillin and cloxacillin cap 250 + 250 mg 1 0x10 cap strip amoxycillin and potassium clavulanate tabs lp 500 mg + llg 69 729 70 rc not exists amoxycillin and potassium clavunate oral suspension lp 200 mgr|z8s 30 ml bottle with 130 507 mg/5 ml (30m1 bottle) measurinq cao amorycillin cap lp 250m9 131 71 10xl 0 cap strip/blister amoxycillin cap lp 500m9 132 72 1 0x10 cap strip/blister 133 t3 amoxycillin dispersible tablets tp 125 mg 10x10 tab strip amoxycillin oral suspension lp (dry syrup) 125 mg/sml 30 ml bottle with 134 473 /easurino cao a. .r l r{6. ii: d,g n4n , < ..no. druo . rate/unit gst final rate drug name unlt coai acxtng witho;t gsr rate wath gst amorycillin tablet 250 mg+calvulanic acid 125 mg lp each film coated 135 706 tab conatin amorycillin trihydrate lp 250 mg & potassium clavulanate lp 10x10 tablets 125 mg 136 74 amphotericin b lnj lp 50 mg vial 737 nrd.154 ampicillin + salbactum 1.59 lnj 138 412 ampicillin cap lp 500m9 10x10 cap blister 139 75 ampicillin lnjection lp 500 mg vial antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg 30 ml bottle (with 140 261a magnesium hydroxide 250m9, activated polydimethyl siloxane 50mg n/easuring cap) antacid tablets. formula,each chewable tablet contains magnesium 747 260a trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint 10x10 tab blister cil 742 225 anti a blood grouping serum lp(anti a monoclonal serum) 10 ml vial l43 lzo anti b blood grouping serum lp(anti b mono clonal serum) 10 ml vial anti d(rh) blood grouping serum lp/anti d blood grouping serum lp l44 227 10 ml vial anti lnhibitor coagulation complex (human plasma protein with a factor 145 407 vial with 20ml solvant vlll lnhibitor bypassing activity of 500 l.u. per vial) 146 nrd.78 anticold drop anticold syrup each 5 ml contains phenylephrine hydrochloride 2.smg , 30 ml bottle with 147 497 chlorpheniramine maleate 1 mg, and paracetamol 125 mg measuring cap anti oxidants (beta carotene 10 mg,vit e 25mg,vit c 100 mg,copper 1.5 148 nrd 11 mg,managanesel.5 mg,zinc 7.5 m cap mg,selenium,l50 icrogram) l49 nrd 549 apixaban 2.5 mg tab. 150 nrd 550 apixaban 5mg tab. 151 nrd.12 aprepitant 125 mg cap. 752 nrd.551 aripiprazole 10 mg tab 153 nrd 552 aripiprazole 5 mg tab 754 nrd 478 artemether 40mg + lumefantrine 240 mg 30ml syrup 155 686 artemether and leumefantrine tablet (40 mg and 240 mg) lx6 tablet blister 156 651 artemether and leumefantrine tablet (80 mg and 480 mg) 1x6 tablet blister l57 nrd 156 artesunate 120 mg nj. artesunate lnjection 60 mg (1.m. l.v.use) each combo pack contains artesunate lnjection 60 mgvial, sodium bicarbonate lnjection lp 5 o/o w/v each combo pack in a 158 508a (lml ampoule),sodium chloride lnjection lp 0.9o/o w/v (5ml ampoule) unit carton 159 nrd.1 artificial saliva solution asceptic ( chlorhexadine gluconate 7.5o/o +=1so/ocatrimide solu + lsopropyl 160 nrd 410 lotion 17o/o 161 j6/ ascorbic acid tab lp 500 mg 10x10 tab strip t62 s3 asepto syringe with transparent bulb sterile, 60 ml rc not exists 163 nrd.553 aspirin lp 300 mg tab, aspirin delayed release tablet / aspirin gastroresistant tab lp (each 164 444 10x14 tab strips 3nteric coated tablet contains acetyl salicylic acid 75 mg) 165 nrd.554 aspirin dispresible 325m9 tab. 166 679 aspirin tablet lp (gastro resistant) 150 mg 14x10 tablet 167 nrd.79 astymine c (vitamin c+ essential amino acid) drop 168 462 atenolol tab lp 25 mg 10x14 tab blister 169 186 atenolol tab lp 50 mg 10x14 tab blister tt0 nrd.157 atezolizumab 1 200 mg(monopoly) ni. t7t nrd 555 atomoxetin 10 mg tab. 772 nrd 556 atomoxetin 18 mg l ab. 173 nrd.557 atomoxetin 25 mg tab. atorvastatin tab lp 1omg 174 187 l 0x1 0 tab strip/blister 175 548 atorvastatin tablets lp 40 mg 1 0x 10 tablets atracurium lnj 10 mg/ml 2.5 ml amp(10 176 311 ampoules) orug s,no. drug name packins un final late g rt ode #irtj|[t, :j: wltt gst 777 319 atropine eye ointment lp 1% rc not exists atropine sulphate lnjection 0.6m9/ml 178 654 1ml amp 25 ampoules atropine sulphate ophthalmic solution usp 1% 5 ml. vial with sterilized 779 320 dropper,or squeeze vial 180 nrd.558 atroxentine 250m9 (trientine hcl) tab. 181 nrd.158 avelumab 200 mg (monopoly) lnj 182 nrd.559 axitinib 5 mg tab. 183 nrd 160 azacitidine 100m9 lnj 184 nrd.159 azacitidine 50mg lnj 18s 133 azathioprine tab lp 50 mg 10x10 tab strip 186 nrd 47 azelaic acid 20% cream 187 nrd.120 azithromycin 1% eye ointment 188 nrd 161 azithromycin 10 ml vial equaivelent to 500 mg lnj. azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 10x3x3 tab 189 78a strip/blister(strip/blister of 3 tab) azithromycin tab lp 500 mg 10x3x3 tab 190 80a strip/bliste(strip/blister of 3 tab) azithromycin tablets lp 250m9 l0x3x3 tab 191 79a strip/bliste(strip/blister of 3 tab) 792 683 aztreonam lnjection 1gm vial 193 509 azlreonam lnjection usp 500 mg vial 194 nrd.479 b. complex syrup b,b silk suture (3/b cir rb needle 16mm, length 76 cm size 5/0 (details 195 r79 1x12 foils in rc) b.b silk suture (3/8 cir rb needle 20mm, length 76 cm size 4/0 (details 196 r78 1x12 foils in rc) 197 nrd.162 bacitracin for lnjection 25,000 lu lnj. 198 nrd 4bo baclofen oral solution 5 mg /ml syrup baclofen tablet lp 10 mg (each uncoated tablet contains baclofen lp 10 199 698 m 10x10 tablets g) balanced salt calcium free 1000 ml [solution], non pvc polyolefin sterile 200 nrd.2 solution free flex bag beclomethasone lnhalation lp 200 mcg/dose 200metered dose 201 366 container beclomethasone, neomycin and clotrimazole cream (beclomethasone 202 445 dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 %) 10 gm tube in unit carton 203 726 3endamustine ln.jection 100 mg vial 204 b1 3enzathine benzylpenicillin lnjlp 12lac units vial 205 82 benzalhine benzylpenicillin lnj lp 6 lac units vial 206 nrd 48 benzoyl peroxide 2.5 % cream 207 nrd 97 betadin 5% eye drop 208 542 betahistine tab lp16 mg 10x10 tablets 209 541 betahistine tab lp 8 mg 10x10 tablets 210 558 betamethasone dipropionate cream lp 0.05% 15gm tube in a unit carton 21.1 <(o betamethasone lotion lp 0.05 o/o rc not exists 272 418 betamethasone sod phos lnj lp 4mg/ml 1 ml ampouletuial 213 1e betamethasone tab lp 0,5m9 10x10 tab blister 274 612 betaxolol eye drops 0,5 o/o rc not exists 275 735 bevacizumab lnjection 100 mg vial 276 734 bevacizumab lnjection 400 mg vial bicalutamide tablet lp 50 mg (each film tablet contains gicalutamide lp 277 741 50 mg) rc not exists 278 nrd.56o bilastin 20 mg tab gt j.. r+ , (i1 r r {1 l ? i o , druo rate/unit gst final rate .,s.no, , drug name packing unit coal without gst rate with gst :i 219 nrd 561 3iotin 5 mg tab. o/o biphasic lsophane lnsulin lnj lp (30 % soluble insulin and 70 isophane 220 279 10 ml vial nsulin) ini. 40 lu/ml(r dna oriqin) 221 262 bisacodyl tab lp 5 mg 10x10 tab strip 222 398 black disinfectant fluid (phenyl) as per schedule o grade lll 5 ltrs can 223 134 bleomycin lnjection lp 15mg (bleomycin sulphate lnjection 15 units) vial 224 s4 blood administration set blood transfusion set (details in rc) unit 225 s98 bone cement rc not exists 226 s80 bone wax sterilised 2.5 gram/packet 227 nrd 163 bortezomib 2.5 lnj. 228 730 bortezomib lnjection 2mg vial 229 nrd 562 bosentan 62.5 mg tab. 230 nrd.563 bosutinib 500 mg tab botulinum toxin type a for injection/botulinum toxin type b for inlection 231 nrd 164 ln,i 100 tu botulinum toxin type a for injection/botulinum toxin type b for injection 232 nrd ,i65 lnj. 50 lu 233 487 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5 ml squeeze vial 234 nrd.98 brin ozo la m ide+ brim on id ine eye drop 235 nrd 564 brivaracetam 50mg tab. 236 540 bromocriptine tablets lp 2.5 mg 10x10 tab strip 237 nrd 456 budesonide 0.5mg/ml respules nrd budesonide 1ml 238 457 respules 239 nrd 421 3udesonide 200 mcg mdi 240 nrd 66 budesonide 400 mcg dpi 247 nrd 13 budesonide 9 mg oap budesonide nebulizer suspension 0.25m9/ml 242 367 2 ml amp 10 ampoules 243 617 budesonide powder for lnhalation 200 mcg 30 capsules bupivacaine hydochloride in dextrose lnjection usp each ml contains 244 2 4ml amp(10 ampoules) buoivacaine hvdrochloride 5.0 mq dextrose 80.0 mq 245 4 bupivacaine lnj lp 0.5% 20 ml vial 246 nrd 565 buprinorphine 2 mg tab, nrd busulfan 60mg/1ml 247 .166 lnj 248 694 butorphanol tartrate lnjection usp 1mg/ml 1ml size rc not exists 249 nrd 167 cabazitaxel 20 mg ln.i 250 nrd 168 cabazitaxel 40 mg lnj. cabergoline tablet lp 0.5m9 (each uncoated coated tablet contains 251 773 10x10 tablets caberqoline lp 0.smo) nrd caffeine cirate 20mg/ml 252 .169 ni laffeine citrate usp lnjection 20mg/ml (equivalent to 10 mg caffeine 253 793 3ml vial )ase/ml) 3ml size 254 nrd 443 laffiene citrate oral solution sral drop 25s 671 lalamine lotion lp 100m1 100 ml bottle 3alcitriol capsules lp 0.25 mcg 256 630 1 0xl 0 cap strip/blister 257 nrd 566 lalcium acetate 667 tab. 3alcium and vitamin d3 suspension (each 5 ml contains calcium 100 ml bottle(with 258 441 3arbonate equivalent to elemental calcium 250 mg, vitamin d3 125 lu ) measuring cap) nrd calcium chloride 5ml vial 259 .170 lnj 260 nrd 14 calcium dobesilate 500mg cap 261 nrd 567 calcium folinate 15 mg tab. 262 388 calcium gluconate lnj lp 10% (lv use) rc not exists 263 nrd.,i71 calcium gluconate/folinate lnj, nrd calcium phosphate 200 ml 264 481 syrup :setr1 {l.f{q drug rat€/unlt gst flnal rate s,no. drug name packlng unit code without gst rate wlth gst calcium with vitamin d tablets usp /calcium and colecalciferol tablets 26s 622 bp/calcium and vitamin d3 tablets lp(elemental calcium 500 mg, 10x10 tablets vitamin d3 250 lu) (non chewable) capecitabine tablet lp 500 mg (each film coated tablet contains 266 727 10x10 tablets capecitabine lp 500 mq) nrd capmatinib 200 mg (monopoly) 267 .56b tab. carbamazepine oral suspension usp 100 mg/sml 100 ml bottle(with 268 474 measurino cao) carbamazepine tab lp 100 mg 269 54 1 0x1 0 tab strip/blister carbamazepine tab lp 200 mg 270 53 1 0x1 0 tab strip/blister 271 nrd 172 carbetocin 1 ml/1 00micro. lnj. 272 nrd.569 carbimazole 10 mg tab. 273 280 3arbimazole tabs lp 5 mg (film coated) 10x10 tab blister nrd larbolic acid 100% in 500 ml 274 .4o solution nrd larbolic acid 50% in 500 ml 275 .39 solution 276 526 3arboplatin lnjection lp 150 mg 15 ml vial 277 527 carboplatin lnjection lp 450 mg 45 ml vial carboprosl tromethamine lnjection lp each ml contains carboprost 0.25 278 281 rc not exists mq/ml 279 nrd 92 )arboxymethylcellulose + glycerin eye drop 280 613 arboxymethylcellulose eye drops lp 0.5% 10 ml squeeze vial 281 nrd.173 arfilzomib 20 mg lnj. 282 nrd 174 arfilzomib 60 mg lnj. 283 nrd.175 carmustine 100 mg lnj. 284 aae carvedilol tablet 3.125 mg 10x10 tablets 28s nrd 176 caspofungin 50 mg lnj. 286 nrd.177 caspofungin 70 mg lnj catheter,size 10(foleys ballon catheter sterile,2 way for urinary 287 s9.b drainage,single use,)silicon coated natural latex material(details in rc) each piece catheter,size 16(foleys ballon catheter sterile,2 way for urinary 288 s9.c drainage,single use,)silicon coated natural latex material(details in rc) each piece catheter,size 18(foleys ballon catheter sterile,2 way for urinary 289 s9.d drainage,single use,)silicon coated natural latex material(details in rc) each piece satheter,size 20(foleys ballon catheter sterile,2 way for urinary 290 s9.e drainage,single use,)silicon coated natural latex material(details in rc) each piece catheter,size 22(foleys ballon catheter sterile,2 way for urinary 29]. s9.f drainage,single use,)silicon coated natural latex material(details in rc) ach piece catheter,size 24(foleys ballon catheter sterile,2 way for urinary 292 ssg drainage,single use,)silicon coated natural latex material(details in rc) each piece catheter,size b(foleys ballon catheter sterile,2 way for urinary 293 s9.a drainage,single use,)silicon coated natural latex material(details in rc) each piece 294 nrd 475 cefaclor each 5 ml contain cefaclor 125 mg svp. cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet 295 709 10x10 tablets contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) 296 710 cefadroxil tablet 500 mg rc not exists 297 510 cefepime lnjection lp 500 mg vial 298 nrd 1 78 3efipime 1000mg + tazobactum 125mg lnj 299 nrd.57o 3efixime + potassium clavulanate 200+125m9 tab. 300 nrd.482 3eflxime oral suspension 50mg syrup 301 nrd 483 3efixime oral suspension 100mg syrup 302 511 sefixime oral suspension lp 2smg/ml (paediatric drops) 10 ml bottle 303 b4 oefixime tab lp 100 mg 10x10 tab strip gaj . ,;. 1l *€g rate/unit gst fanal rate uithout gst rate with gsf ie lefixime tab lp 200 mg 10x10 tab strip 304 85 i @mg nj. 305 nrd.179 1mg ln.i 3efoperazone lnj. 306 nrd.48b l ce 500m9 lnj. nrd 180 foperazone 307 erazone sodium eq.to 1gm and sulbactum sodium eq. to sulbactum 0 sgm)(lm/lv rc not exists 308 86 )efoperazone rse) 250 mg vial 8b cefotaxime lnj lp 309 cefotaxime lnjection lp 1 g rc not exists 310 87 cefpodoxime 200m9 tab 311 nrd.572 ce cv 375 tab. 3 nrd.573 fpodoxime t2 10x10 tab strip 313 475 @ drops 3t4 nrd 86 rmt iab. 315 nrd.571 3etpoooxime proxetil oral suspension 100mg syrup 316 nrd.485 cetpoooxime proxetil oral suspension 50mg syrup 317 nrd 484 ce 1 gm+sulbactam500 mg lnj. nrd.1b1 ftazidime 318 vial ceftazidime lnj lp 1g 319 89 lp 250 mg vial ceftazidime lnj 320 90 vial ceftazidime lnj lp 500 mg 321 91 av 29m+59969 inl. nrd 182 ceftazldime+ ibactum 322 ce 1 gm lnj nrd.1 83 ftizoxime 323 ce lp 125 mg lnt. nrd.184 ftriaxone 324 ce +salbactum+ disodium edta lni nrd 185 ftriaxone 325 seftriaxone 1 gm + tazobactum 125 mg lnjection rc not exists 326 708 se sulbactam 1.59 lnj. nrd.186 ftriaxone and 327 vial (packed in cef lnj lp 1g /vial lriaxone 328 93 monocarton) ce lnj lp 250 mg/vial vial (amber colour) 94 ftriaxone 329 vial (packed in ceftriaxone lnj lp 500m9/vial 330 95 monocarton) 000m9+ tazobactom 1 25mg lnj. nrd leftriaxonel 331 187 ce 1gm lnj nrd.l bb furoxime 332 ce axetil 500 mg. ab. nrd 591 furoxime 333 cefuroxime axetil oral suspension 125m9/5ml syrup 334 nrd 486 xfuroxirne nxetil tab lp 250 mg 10x10 tab strip 335 512 3epha cap lp 250 mg 0x10 cap blister 96 lexin 336 oepha cap lp 500 mg 0x10 cap blister 97 lexin 337 g lp (cephalexin dry syrup lp) 125m9/ 5 ml 30 ml bottle with pe atexin od=uspension 338 427 measurino cao ceph lexin tablets 125 mg (dispersible tablets) 0x10 tab strip 339 476 nrd ceritinib 100 mg cap, 340 .16 nrd ]eritinib 200 mg cap. 341 17 nrd 0eritinib 250m9 cap. 342 18 nrd ceritinib 50 mg cap. 343 15 eeum drops (wax dissolving ear drops) paradichlorobenzene 2 inolytf benzocain e 2.7 olo chlorbutol 5 o/o, turpentine oil 15 o/o 10 ml bottle 344 589 o/o , , lp 5mg/5 ml 30 ml bottle.with 3etirizine syrup 345 499 veasurino cao setirizine,phenylephrine & paracetamol tablets cetirizine 5 rc not exists 346 498 mq.phenvlephrine 10 mq & paracetamol 325 mg tab gm 1sgm tube in a unit cetrimide cream lp 15 347 2l5a carton nrd cetrorelix acetate 0.25 mg lni 348 .189 nrd cetuximab 100 mg lnj. 349 190 nrd 3etuximab 500m9 lni. 350 .191 c) qil.{(h{ s dfuo final fate no drsg name packrns unit coal #i.:jl*, :;: with cst chemotherapy port & non coring needles(pediatric) (detail in rc) 351 s1 37 each piece 352 s136 chemotherapy port and non coring needles(adult) (detail in rc) each piece 353 tjt) chlorambucil tab lp 5 mg rc not exists 354 nrd 121 chloramphenicol 0.5% eye ointment nrd 122 chloramphenicol +polymycin 355 eye ointment 3s6 nrd 123 chloramphenicol +polymycine + dexamethasone eye ointment 357 771 chloramphenicol 1% w/w eye ointment lp, 3gm size rc not exists nrd chloramphenicol 1 gm/vial 358 .,i92 lnl. 359 321 chloramphenicol eye drops lp 0.5 0/0 5 ml. vial 360 nrd 574 chlordiazepoxide 25 mg tab. 361 342 chlordiazepoxide tablets lp 1omg 10x10 tab strip 362 nrd 575 chlordiazsepoxide 10 mg + clidinium 25 mg tab. 363 447 chlorhexidine gluconate solution 5% 250 ml 250 ml bottle 364 580 chlorhexidine mouthwash lp 0.2 olo 50 ml bottle 365 9b chloroquine phosphate lnj lp 40 mg/ ml 5 ml amp(25 amp) chloroquine phosphate suspension lp 50 mg/sml 50 ml bottle (with 366 1 00a measurino cao) chloroquine phosphate tab. lp 250m9 eq to 155 mg of chloroquine base oo 367 1 0x1 0 tab strip/blister film coated 368 37 chlorpheniramine maleate tab lp 4mg rc not exists 369 346 chlorpromazine lnj. lp 2smg/ml rc not exists 370 343 chlorpromazine tablets lp 100 mg (coated tablet) 10x10 tab strip 37r 344 chlorpromazine tablets lp 25 mg (sugar coated) 10x10 tab strip 372 345 chlorpromazine tablets lp 50 mg (coated tablets) 10x10 tab strip 373 nrd.576 chlorthalidone 6,25 mg tab. chlorzoxazone , diclofenac sodium & paracetamol tablets 374 610 (chlorzoxazone 250m9 , diclofenac sodium 50mg paracetamol 325 mg) rc not exists 375 nrd 577 cholchicine 0.5m9 tab. holecalciferol granules 60,000 lu /gm 1 gm sachet(s0 376 623 sachets) chromic catgut suture(3/b cir cutting needle 8 mm, suture length 35 cm) 377 r77 rc not exists size 6/0 (details in rc) chromic catgut suture(3/8 cir r cutting needle 19 mm needle, suture 378 rbo lx12 foils length 76 cm) size 4/0 (details in rc) chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 379 r76 1x12 foils cm) size 5/0 (details in rc) 380 nrd.584 cilnidipine 20 mg tab. 381 nrd.582 cilnidipine 5 mg tab. 382 nrd.5b3 urlnrdrprnel u mg tab. 383 nrd.579 cilostazol 100m9 tab. 384 nrd.57b cilostazol 50mg tab. 385 544 cinnarizine tablet lp 75 mg 10x10 tab blister 386 543 cinnarizine tablets lp 25 mg 10x10 tab blister ciprofloxacin 0.3 o/o and dexamethasone 0.1 o/o ear drops ciprofloxacin 387 585 5 ml. vial and dexamethasone otic suspension usp 388 322 ciprofloxacin eye drops lp 0.3 o/o w/v 5 ml squeeze vial ciprofloxacin lnjection lp 200m9/1 00ml 389 101 100 ml ffs / bfs bottle ciprofloxacin ophthalmic ointment usp 0.3% 390 323 5 gm tube in unit carton 391 103 ciprofloxacin tablet lp 500 mg film coated rc not exists 392 102 ciprofloxacin tablets lp 250 mg film coated 10x10 tab blister 393 768 cis atracurium besylate lnjection 2 mg/ml in 5 ml vial 5 ml vial 394 528 cisplatin lnj lp 10 mg/10 ml 10 ml vial 395 137 oisplatin lnj lp 50 mgi 50 ml 50 ml vial 396 nrd.1 93 3ladrabine 10 mg lnl. 397 nrd 580 3larithromycin 250 mg tab. a^) rtrrtr fiffa drug hate/unlt gst fanal iate 6.no. drug name packang unit .code without gst rate with gst 398 nrd 581 clarithromycin 500m9 tab. 399 nrd 194 clarithromycin 500m9 lnt. nrd clarithromycin for oral suspension 125m9/5ml 400 487 syrup nrd clindamycin 600m9/4ml 401 .195 nj clindamycin capsule lp 150m9 402 s13 10x10 cap strip/blister clindamycin capsule lp 300 mg 403 514 1 0x1 0 cap strip/blister clindamycin phosphate gel usp 1 o/o 20gm tube in mono 404 560 carton 405 714 3lindamycin phosphate lniection lp 300 mg vial/ampoules clobazam tableucapsule 10 mg 10x10 tablet/capsule 406 663 blister clobazam tablet/capsule 5 mg 10x10 tablet/capsule 407 662 blister 408 561 3lobetasol propionate cream lp 0.05 o/o 20 gm tube 409 nrd 435 llobetasol+salicylic acid 0.5%+6% sintment 410 282 3lomifene tab lp 25 mg 10x10 tab strip 411 283 3lomiphene tab lp 50 mg 10x10 tab strip 412 nrd .19 3lomipramine lp 25 mg 3ap. 413 nrd 585 3lonazepam 0.25 tab. 414 nrd 586 3lonazepam 1mg tab. 415 678 3lonazepam tablet 0.5 mg 10x10 tablets 4l6 nrd 196 llonidine 150mcg/ml nj. llonidine hydrochloride tablet lp 0.1 mg (each tablet contains clonidine 4l7 751 10x10 tablets lydrochloride lp 0.1 mg) clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 418 549 10x10 tab strip 4t9 188 clopidogrel tab lp 75 mg 10x10 tab strip close wound drainage device under negalive pressure (closed wound 420 s96.a suction unit) size of bellow 800 ml, catheter size 16 (details in rc) each piece close wound drainage device under negative pressure (closed wound 421 s96.b suction unit) size of bellow 800 ml, catheter size 18 (details in rc) each piece clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops 422 586 5 ml ear drops 423 nrd 41 t clotrimazole 1 %+beclomethasone 0.25% lotion 424 nrd 419 clotrimazole 10mg lozenses clotrimazole cream lp 2o/owlw 1sgm tube in a unit 425 104 carton 426 443 clotrimazole mouth paint (clotrimazole 1 o/o w/v) 15 ml squeeze bottle clotrimazole vaginal tab lp 500m9 single tablet(10 tabs 427 105 with an applicator) 428 417 cloxacillin sodium lnj lp 500m9 vial 429 nrd 589 clozapine 100 mg tab 430 nrd.587 i.;lozaprne 25 mg tab 43l nrd 588 clozapine 50 mg tab. 432 670 coal tar 6% & salicylic acid 3% ointment 20gm 433 nrd.476 codiene phosphate syrup 434 718 colistimethate lnjection lp 1m lu powder for solution vial 435 nrd.446 ooloplast 60 gm paste compound benzoic acid ointment lp benzoic acid 6 o/o + salicylic acid 3 1sgm tube in mono 436 106 clo carton 437 244 compound benzoin tincture lp 500 ml bottle compound sodium lactate (ringer lactate) in glass bottle 500m1 438 nrd 197 lnj. ,it l eye drop 569 s41.a double j stent, sterile, both ends open size +f, lengt6 16 crn rc not exists 570 s41 b double j stent, sterile, both ends open, size sf, lengtn z0 crn rc not exists 577 542.a double j stent, sterile, one end closed size 4f, length t6 cm rc not exists 572 s42.b double j stent, sterile, one end closed, size sf, lengtn 20 cm rc not exists 573 144 doxorubicin lnj lp 50 mg/ 25 mt rial doxycycline cap lp 100 mg 574 111 1 0x10 cap strip/blister 575 nrd 221 doxycycline for lnjection 100 mg nj. 6) ) ;h.t+.,.t,11 ,rf}f7tr s,no . .. dc r o u a o l d rate/unit gst final rate rug name packing unit without gst rate with gst dorylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet 576 763 (each enteric coated tablet contains doxylamine succinate usp 20 mg 10x10 tablets & pyridoxine hydrochloride lp 20 mg ) 577 689 dried factor vlll fraction lp (lv use) 1000 iua/ial vial with diluent 688 dried factor vlll fraction lp (lv use) 500 iua/ial 578 r,rial with diluent dried human anti haemophlic fraction lp (dried factor vlll fraction lp) 579 171 /ial with diluent 250 lu/ vial (lv use) 580 nrd 4s4 )rotavarine syrup )rotaverine and mefenamic acid tablets drotaverine 80 mg and 581 591 t0x10 tablets vefenamic acid 250 mg jrotaverine hydrochloride lnj 40 mg/2 ml e 582 2 ml amp 10 ampoules 583 415 jrotaverine tab lp 40 mg 10x10 tab blister 584 nrd 614 juloxetine gastro resistant 20 mg l ab. 585 nrd 615 fuloxitine gastro resistant30 mg iab. nrd )urvalumab 120 mg (monopoly) 586 222 lni. 587 nrd 223 durvalumab 500m9 (monopoly) lni. 588 787 dutasteride tablet 0.5 mg 10x10 tablets s89 nrd 616 dydrogesterone 10mg tab each 15 ml contains: milk of magnesia 11.25 ml+ liquid paraffin 3.75 ml 590 nrd 495 syrup 170 ml each 5 ml containing:paracetamol 125 mg + lbuprofen 100 mg 60 ml 591 nrd.496 syrup each combi bliste pack: containing 3 tablets of artesunate(2oo mg each) and 2 tablet of sulphadoxine pyrimethamine(750m9+37,5m9)each or 3 s92 649 one combi blister pack tablets of sulphadoxine pyrimethamine(500+25)mg 593 s1 04 ecg electrode (detail in rc) each piece 594 nrd 447 eeg 4oogm paste elastic adhesive bandage bp 1ocm x l mtr stretched length adhesive 595 s127 material should have good quality sticking property (detail in rc) each piece 596 nrd.617 eltrombopag 25mg tab. 597 nrd 618 eltrombopag 50mg tab. 598 nrd 619 empagliflazone 1omg tab. 599 nrd 620 empagliflazone 25mg tab. 600 nrd 224 enalapril 1.25 mg 1 ml lnj. 601 195 enalapril maleate tab lp 2.5m9 10x10 tab strip 602 194 enalapril maleate tab lp 5mg 10x10 tab strip 603 463 enalapril maleate tablets lp 10 mg 10x10 tab strip 604 s44.b endotracheal tube, cuff size 4.5 (details in rc) each piece 605 s44.c endotracheal tube, cuff size 5 details in rc each piece 606 s44.d endotracheal tube, cuff size 6 (details in rc) each piece 607 s44.f endotracheal tube, cuff size 7 (details in rc) each piece 608 s44.9 endotracheal tube, cuff size 7.5 (details in rc) each piece 609 s44.h ndotracheal tube, cuff size 8 (details in rc) each piece 610 s44.i endotracheal tube, cuff size 8.5 (details in rc) each piece 611 s44.j endotracheal tube, cuff size 9 (details in rc) each piece 672 s44.e endotracheal tube, cuff size 6.5 (details in rc) each piece 613 s44.a endotracheal tube, cuffed size 4 (details in rc) each piece 614 s43.a endotracheal tube, plain size 2.5 (details in rc) each piece 615 s43.b endotracheal tube, plain size 3 (details in rc) each piece 616 543.c endotracheal tube, plain size 3.5 (details in rc) ach piece 617 s43.d endotracheal tube, plain size 4 (details in rc) each piece 618 543.e endotracheal tube, plain size 4.5 (details in rc) each piece 619 s43.f endotracheal tube, plain size 5 (details in rc) each piece 620 sa3.g endotracheal tube, plain size 5.5 (details in rc; each piece 621 s43.h endotracheal tube, plain size 6 (detaits in re each piece ,)^ q{{q 1if{q fe i{{(q ffia ffq qtr ic druo sno drug name rate/unit gst flnatrnte coal packlng unlt wlthout gst rate wlth gst 622 s43 j endotracheal tube, plain size 7 (details in rc) ach piece 623 s43 k endotracheal tube, plain size = @etails in rc) each piece 624 s43.t endolracheal tube, plain size 8 loetarts in nc) rc not exists 625 543.m endotracheal tube, plain see s^s(daarb rn rc) each piece 626 s43.i ndotracheal tube, plain size 6.5 (details in rc) each piece 627 172 enoxaparin sodium tn1 le oo mg vial/pfs 628 nrd.621 ntacapone 200 mg tab. 723 entecavir tablet tp 0.5 mg (each fitm coated te6let conatrns enge 629 10x10 lp 0.5 mg) tablets 630 nrd 452 enterogermina zuittion spores srnl resp 631 nrd 627 enzalupamide 40mg tab. 632 nrd bo enzyme drop 633 nrd 497 enzyme 100 ml syrup 634 nrd 225 ephedrine 30 mg/ml lnj epidural minipack lsg 63s s1 10 sterile (detail in rc) each piece 636 nrd 227 epirubicin 150m9/ml lnj. 637 nrd 226 epirubicin 50mg/ml lnj 638 nrd.22b eribulin 0.5m9 lnj 639 nrd.229 eribulin 1 mg nj. 640 nrd.623 erlotinib 100m9 tab. 641, nrd.622 erlotinib 150 mg tab. .1 642 nrd.230 rtapenem sodium 1gm = ertapenem .046 gm n,. escitalopram tab lp 10 mg 643 351 1 0xl 0 tab strip/blister 644 smolol hydrochloride 1omg j0nrl 753 lnjection /ml size 10 ml vial esmoprazole lomg 645 nrd.1 33 granules 646 nrd.624 esomeprazole 40 mg tab. 647 nrd.498 esomperazole syrup 648 nrd 626 estradiol valerate cream 649 nrd.625 estradiol valerate 2 mg tab 650 nrd.468 ttanercept 25mg/o.5m1 lnj. ethamsylate lnj 250 mg/ 2mt (tm/tv) l aa 651 2 ml amp 10 ampoules ethamsylate tablet 500 mg (each unffi 6s2 745 ethamgylate 500 mg) rc not exists 653 286 ethinyloestradiot taos tt, so nrcg 10x10 tab strip 654 nrd 628 ethynil estradiol 0.02m9+ tab desogestrat o.tsrng tab. 655 nrd 629 etizolam 0.5 mg tab. 656 nrd 231 etomidate 20 mg nj. 657 nrd 232 etomidate ivct/lct 1on rl lal nj. 658 146 etoposide lnj lp 100 mg 5 ml glass vial 6s9 495 toricoxib tab lp 120m9 10x10 tab blister 660 658 toricoxib tablet lp 90 mg 10x 10 tablets 661 nrd 630 etoricoxib+thiocotcfricosioe1oo*a mg; tab. 662 nrd 23 evening primosa 1000 fig cap. 663 nrd 531 everolimus 1omg tab./cap. 664 nrd 530 everolimus 5mg tab./cap. 66s nrd 631 exemestane 25 mg tab. 666 770 eye drop tvtoxifl oxa@sml size 5 ml. vial 667 sb5 face mask, disposabteldetails in rc) siece factor lx concentrate (purified) tp 500 600 l.u.(human coagulation 668 406 = lx) 500 lu vial with solvent actor =aropenem tablet sodium 200 mg (each film tantei contalns 669 713 :aropenem sod 10x10 tablets ium gquivalent to faropenem sodium 200 mg) 670 nrd.632 febuxostat 40 mg tab. 671 nrd.633 ebuxostat b0 mg tab. o) , druo nate/unit gst fanal rate s.no, ,code drug name packang unit without gst rate with gst 672 550 fenofibrate capsules/ tab lp 200 mg rc not exists 673 nrd 233 fentanyl 25lu patch patch 674 nrd.234 fentanyl 50lu patch patch 675 655 fentanyl citrate lnjection 50mcg/ml 10ml vial/amp fentanyl citrate lnjection lp 2 ml 676 21 2 ml amp 10 ampoules 677 nrd 50 fenticonazole 2% sream 746 treracrylum 1% w/v sterile solution 100 ml 678 100m1 679 789 ferric carborymaltose lnjection 50 mg/ml 10 ml size 10 ml vial ferrous sulphate with folic acid tab (paediatric) lp each film coated tab 680 391 3ontaining dried ferrous sulphate lp eqivalent to 20mg elemental lron 10x10 tab strip/blister and folic acid lp 100 mcg ferrous sulphate with folic acid tab lp each film coated tab. containing 10x10 tab strip/blister 681 390 dried ferrous sulphate lp equiv 100 mg elemental lron and folicacid lp ).5 mg 682 nrd.634 fexofenadine 120 mg tab. 683 nrd.635 fexofenadine 180 mg tab. filgrastim lnjection lp (granulocyte colony stimulating factor) (sc/lv 684 530 pre filled syringea/ial use) 300 mcq finasteride tablets lp 5 mg 685 575 10x10 tab strip/blister 686 nrd.636 fingolimod 0.5 mg tab. 687 579 flavoxate tablets lp 200 mg (coated tablet) 10x10 tablets nrd 235 fluconazole 100m9 688 ln.i, nrd 236 fluconazole 200 mg 689 lni 690 425 fluconazole eye drops 0.3% 5 ml. vial 691 nrd 499 fluconazole oral suspension syrup fluconazole tablets lp 150m9 10 10 1 tab strip 692 114a (perforated) 693 nrd 237 fludarabine phosphate lnjection 1 00mg lnj 694 nrd 238 fludarabine phosphate lnjection 50mg lnj. 69s nrd.637 fludrocortisone 1 00mcg tab. 696 nrd.638 flunarizine 10mg tab. 697 147 flunarizine tab 5 mg 10x10 tab blister fluorescien sodium lp 20o/o vail3 ml for diagnostic fundus fluorescien 698 nrd 239 lnj. angiography 699 148 fluorouracil lnj lp 250 mg/ sml rc not exists fluoxetine cap lp 20 mg 700 352 10x10 cap strip/blister 701 nrd 240 fluphenazine deconate lnjection (long acting) 25mg/ml ampule lnj, 702 421 flurbiprofen sodium ophthalmic solution lp 0.03 o/o w/v 5 ml squeeze vial 703 nrd.102 fluromethalone 0.1% ye drop 704 nrd 437 fluticasone cintment 705 nrd 429 fluticasone ft nasal spray 706 nrd 639 fluvoxamine 100 mg tab. 707 nrd 640 fluvoxamine 50 mg tab. 708 s87.a foldable lntra ocular lense with lnjector (details in rc) 11 to 17.5 each piece 709 s87.b foldable lntra ocular lense with lnjector (details in rc) 18 to 24 each piece foldable lntra ocular lense with lnjector (details in rc) 24.5 to 28.5 710 sb7.c each piece 771 s1 02 foleys catheter no. 14 (detail in rc) each piece 772 nrd 241 folic acid +methylcobalamine 10 ml pack lnj 773 392 folic acid tab lp 5 mg 10x10 tab blister 714 nrd.641 folinic acid 1smg tab. 715 nrd.144 folinic acid 200m9/vial nj 716 nrd 242 fondaparinux 2.5m9 lnj 717 245 formaldehyde solution (34.5 per. 38 per.) rc not exists 71,8 nrd 642 formaline tab. 0r €ttlq iifl.q orug packrns flnal rate s,no, orug name unrt gode :;: with gst iffiji[:, 719 nrd 453 formelerol 20mcg +su6seonide 0.5m9 resp. 720 nrd 422 formeterol 6mcg.+ fluticasone 250 mcg. lnhalation n/ldi 727 nrd 24 formetrol 12mcg + budesonide 400 mcg. respule 722 nrd.423 formoterol 6 mcg. + budesonide 200 mcg. mdi 723 nrd 424 formoterol 6 mcg. + budesonrde 400 mcg. mdi formoterol fumerate & budesonide powder for lnhalation lp 6 mcg + 30 capsules 724 616 200 mcq 725 nrd.463 fosfomycin 39m sachet nrd fosphenytoin sodium 150m9/ml 726 .243 lnj. 727 685 framycetin sulphate cream 1 o/o 100 gm pack 1009m pack 728 684 framycetin sulplrate cream 1 o/o 30gm pack 30gm pack 729 254 frusemide tab lp 40 mg 10x10 tab strip 730 nrd.245 fsh 150 iu lnj 73r nrd.244 fsh 75 iu lnj. 732 nrd.246 fulvestrant 250m9 lnj, 733 nrd 72 furosemide 10mg/ml drop 734 nrd.643 furosemide 20mg + spironolactone 50mg tab. 735 .ef furosemide lnjection lp 10mg/ml (lm and lv use) 2 ml ampoule 736 nrd 5oo furosemide oral solution 10mg/30m1 syrup fusidic acid cream lp 2% 1ogm tube in mono 737 216a carton gabapentine tablevcapsule 1 00mg 10x10 tableucapsule 738 bb/ blister/strip gabapentine tablet/capsule 300m9 10x10 tablevcapsule 739 668 blister/strip 740 235 gadodiamide ln.i. 0 5mml/ml vial 10 ml vial 741 446 gamma benzene hexachloride lotion 1%(lindane lotion usp) 100 ml bottle 742 nrd,124 ganciclovir 0.1 5% eye ointment ganciclovir sodium lnjection 500m9 (lyophilized powder for reconstitution) 743 724 vial 744 nrd 129 gatifloxacin 0.3% eye drop 745 nrd.103 satifloxacin+prednisolone eye drop 746 nrd 247 3dw 5% glass bottle/500m1 lnj. 3efitinib tablet lp 250 mg (each film coated tablet contarns gefitinib lp 747 t3t 10x10 tablets 250 mq) 748 531 3emcitabine for lnjection 200 mg vial e1a 749 gemcitabine for lnjection lp 1gm vial 750 nrd 90 gentamycin ear drop gentamycin lnjection lp 80mg/2ml (lm/ lv use) 751 116 2 ml amp 50 ampoules 752 246 gentian violet topical solution usp 1olo 200 ml bottle glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 753 453 mg, metformin hydrochloride 500 mg (sustained release) rc not exists glibenclamide tab lp 5 mg 754 287 10x10 tab strip/blister gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 10x10 tablets 755 603 500 mg) gliclazide tab lp 40 mg 756 288 1 0x1 0 tab strip/blister glimepiride tab lp1mg 757 290 1 0x1 0 tab stripiblister glimepiride tab lp 2 mg 758 289 1 0x1 0 tab strip/blister glimepiride, pioglitazone and metformin hydrochloride (sustained release) tablets each tablet contains glimepiride 2mg, pioglitazone 15 759 456 10x10 tab blister mg, metformin hydrochloride (sustained release) 500 mg a) 1, .4:t .,ftt4 i4ilr(d i . druo s.no. d final .ate coal rug name packins unit #ffij$l :;: wath gst glipizide and melformin hydrochloride tablets usp (glipizide 5 mg, 760 452 m 10x10 tab blister etformin hydrochloride 500 mg) 767 291 glipizide tab lp 5mg 10x10 tab blister gloves size 6.5 lnches,powder free (disposable sterile surgical rubber 762 s5.b pair glovesxdetails in rc) gloves size 6.5 lnches,powdered (disposable sterile surgical ruouer 763 s5.a pair gloves)(details in rc) gloves size 7 .5lnches,powder free (dlsposablesterile surgical rubber 764 s7.b pair gloves)(details in rc) gloves size 7 lnches,powder free (disposable sterile surgical rubber 765 s6.b pair gloves)(details in rc) gloves size 7 lnches,powdered (disposabte sterile surgical rubber 766 56.a pair gloves)(details in rc) gloves size 7.5 lnches,powdered (disposable sterile surgical rubber 767 s7.a pair 3loves)(details in rc) 768 604 glucagon for lnjection usp 1 mg/ml vial 769 nrd 4 glucosamine + hydrochloride +methylsulfonylmethane cap 770 nrd 644 glucosamine hydrocloride + diacerin 50 mg tab. 771 247 gluteraldehyde solution 2% 5 ltrs can nrd glycerin 2 gm/ml 772 .473 suppsitory 773 564 glycerin lp 100 ml rc not exists 774 217 glycerin lp 400 gm rc not exists 775 nrd 248 glyceryl trinitrate injection, diluted smglml tnl. 776 650 glyceryl trinitrate tablets 2.6 mg controlled release tablets 30 tab bottles s 1.5olo 777 nrd 1 32 glycine lrrigation olution 3ltr solution 778 nrd 51 glycolic acid 6% cream 779 312 glycopyrrolate lnj lp 0.2 mg/ml 1 ml amp (10 amp) 780 nrd 68 slycopyrronium 25 dpi 787 nrd 67 slycopyrronium 25 + formoterol 6 mcg )pt 782 nrd 458 3lycopyrronium 25mcg. lnhalation 2ml. lespules 783 nrd 69 3lycopyrronium 50 )pr 784 nrd 249 3oserelin acetate implant 3.6 mg lnj 785 117 griseofulvin tab lp 125 mg rc not exists gum paint containing tannic acid 2%, cetrimide o.1o/o, zinc chloridel./. 786 583 15 ml squeeze vial 787 nrd.25o haemocoagulase 1 ml lnj 788 nrd 251 haloperidol (long acting) 50mg/ml ampoule lnj 789 353 haloperidol lnj lp 5 mg/ml 1 ml amp (10 amp) 790 354 haloperidol tab lp 1.5 mg 10x10 tab strip 79t 355 haloperidol tab lp 5 mg 10x10 tab strip halothane bp 250 ml in amber colour 792 6 bottle 793 nrd 436 heparin 50 lu benzyl nicotinate 2 mg ointment 794 174 heparin sodium lnj lp 5000 lu/ml (lm/lv use) rc not exists 795 767 hepatitis b lmmunologlobin lnjection lp 200 l.u vial/pfs 796 nrd 464 hmf for pretem sachet 797 485 homatropine eye drops lp 2% 5 ml squeeze vial 798 nrd 134 hormonal lntra uterine device 799 nrd 252 horse atg(anti thymocyte globulin) 250 mg lnj hp kit (pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 800 nrd 1 35 m tab. g hp hmg (highly human menopausal parodied gonadotropin) 150 iu 801 nrd 253 lnj. hp hmg (highly human menopausal parodied gonadotropin) 75 llj 802 nrd.254 lnj. 803 nrd 104 hpmc 0.3% eye drop 804 nrd 823 human albumin 20% in 50 ml vial lnj 805 175 human albumin solution lp 20% 100 ml bottle 806 304 human anti d lmmunoglobulin 150 mcg pre filled syringea/ial try +._ir rrflra 6.no. drug drug ltlame rate/unit cst final ra.te code packlng unlt wlthout gst rate with gst 807 303 human anti d lmmunoglobulin lnjection 300mcg (lm use) pre filled syringea/ial 808 774 human chorionic gonadotropin lnjection lp 5000 l.u vial human lmmunoglobulin inj with 12%lgm,t2%194,z6ollgg in pack of 809 798 1oml vial (0.59m) 1oml(0 59m) 810 305 human rabies lmmunoglobulin lnj 150 lu/ ml rc not exists hyaluronidase lnjection lp each vial contains hyaluronidase lp 1so0 llj. 811 423 vial 872 nrd.255 hydralazine 20mg/ml lnj. 813 256 hydrochlorthiazide tab lp 12.5 mg 10x10 tab strip 874 464 hydrochlorthiazide tab lp 25mg 10x10 tab strip 815 nrd.52 hydrocortisone 1% ream 816 nrd 138 hydrocorlisone oromucosal 20 mg tab. 877 nrd 136 hydrocortisone oromucosal 5 mg tab. 818 nrd.1 37 hydrocortisone oromucosal 10 mg tab. hydrocorlisone sodium succinate lnjection lp 100 mg brse h/ial ([r//lv 819 42 vial use) 820 nrd 139 hydrogen 11% + silver nitrate .01% solution 82l 248 hydrogen peroxide solution tp 6 o/o (20 vot) rc not exists 822 nrd 53 hydroquinone 2% 3ream 823 599 hydroxychloroquine sutpfrate taotets 200rng 10x10 tablets hydroxyethyl starch (130/0.4) 6 o/o w/v with sodium chloride og o/,0 w/v 416 lntravenous lnfusion / balanced electrolyte solution of sodium chloride, 500 ml plastic bottle/s0o 824 sodium acetate, potassium chloride, magnesium chloride lntravenous ml free flex lnfusion lydroxyprogesterone lnj lp 250m9 /ml 82s 293 lml amp 25 ampoules hydroxypropylmethyl cellulose solution 20 mg/ ml 826 2ml glass syringe(with 324 cannula) 827 nrd.528 hydroxyurea 500m9 tab./cap. 828 nrd 76 hydroxyzine oral solution 15 ml drop hydroxyzine tab lp 25 mg 829 43 t oxt o f.u slrip/blister 830 414 hyoscine butyl bromide tablets lp 1omg 10x10 tab blister hyoscine butylbromide lnj lp 20 mg/ ml 831 268 1ml amp 25 ampoules 832 nrd 645 lbrutinibl40mg tab. lbuprofen and paracetamol tablets lp lbuprofen 400 mg*paracetamol 833 22 325 mg l 0x10 tab blister lbuprofen oral suspension bp /usp 100 mg/ 5 ml 60 ml bottle (with 834 477 measurrno cao) 835 aa lbuprofen tab lp 200 mg (coated) 10x10 tab blister 836 24 lbuprofen tab lp 400 mg (coated) rc not exists all 533 lfosfamide lnjection lp/bp/usp 1 gm vial 838 534 lmatinib tab lp 400m9 10x10 caps/tab lmipenem + powoeifor cilastatin lnjection 500mg/500mg tp sotution 839 715 vial 840 356 lmipramine tab lp 25 mg (coated tab) rc not exists 841 357 lmipramine tab lp 75 mg (coated) 10x10 tab blister 842 nrd.25 lndacaterol and glycopyronium inhalation powoei t toiso rncg 3ap. 843 nrd.646 lndomethacin 75 mg sr iab. 844 436 ndomethacin cap lp 25 mg 10x10 cap strip 845 nrd.256 ndomethacin lyophilized powder 1mg lnj. 846 s10.a nfant feeding tube size 10fg(details in rc) each piece 847 s10.c nfant feeding tube size sfg(details in rc) each piece 848 s10.b lnfant feeding tube size bfg(details in rc) each piece 849 sl3 lnfusionsetwithmicrodrip,(l.v.)steritedispos@ unit 850 796 lnj poractant alpha b0 mg/ml in pack of 1.5 ml ldetail in re 1.5m1 vial 851 nrd 647 lnositol + myoinositol 1000m9 ab. cn tih.q 1{ { {u{ . l.c ;1ilrfi t . druo final rate s.no. , drug name packinsunit codi ff: with gst lxtjilt, 852 nrd.257 lnotuzumabl mg(monopoly) lnj 853 nrd 258 insulin aspart nj. lnsulin glulisine (monocomponent lnsulin glulisine) 100 lu/ml/3 m 854 nrd.259 nj. 0artridqes insulin glulisine (monocomponent lnsulin glulisine) 100 lu/ml/3 ml 855 nrd 260 nj. orefilled pen 8s6 nrd.4o3 lnsulin glargine 300 lu per ml/prefilled pen nj. nsulin glargine 10 ml vial (100 lu/ml) with 30 lnsuline syringes wrth 857 693 10 ml vial needle lnsulin glargine 3ml (1001u/ml) with 15 lnsulin syringes and 858 680 needles/cartridge 3ml (1001u/ml) with 15 needles and 1 pen per 20 3ml vial cartridqes insulln lnjection lp (soluble lnsulin/neutral lnsulin lnjection)4o lu/ml(r.dna 859 300 10 ml vial criqin) 860 nrd 261 lnsulin lispro lnj lnsulin syringe ( 40 units) with (fixed) 30 g needle shall conforn to ls 861 s14 unit 12227 862 nrd.4o4 nsuline 50/50 lnj 863 nrd.262 nterferon beta 1 a 30mg lni. 864 nrd.263 ntralipds lni. 865 791 ntravenous fat emulsion 20o/owlv 250m1 250 ml bottle 866 nrd 264 nvert sugar 10% (fructodex 10%) 500 cc lnj lohexol usp (solution for lnlection) non lonic contrast medium in sterile 867 nrd 265 lnj aqueous solution, 300 mg lodine/ml non ionic 50 ml lohexol usp (solution for lnjection) non lonic contrast medium in sterile 868 482 20 ml pack aquous solution 300 mg lodine/ml lohexol usp(solution for lnjection) non lonic contrast medium in sterile 869 672 rc not exists aqueous solution 350 mg lodine/ml. nrd.266 lpilimumab 50 mg 870 lnj 871 369 lpratropium bromide nebulizer solution 250 mcg/ ml 15 ml glass bottle lpratropium powder for lnhalation lp 40 mcg 872 618 30 capsule (rota caps) 873 nrd 268 lrinotecan 100 mg/sml lnj 874 nrd 267 lrinotecan 40mg/5ml lnj 875 nrd 81 lron (ferrous ascorbate) drop lron and folic acid suspension. each 5ml contains ferrous fumerate 876 448 100 ml bottle equivalent to elemental iron 100m9, folic acid 500 mcg lron sucrose lnjection usp/bp 20mg/ml (for lv use) each ml conlains 5 ml ampoule (amber 877 488 ferric hydroxide in complex with sucrose equiv. to elemental lron 20 mg colour) 878 7 lsoflurane usp 100 ml bottle 879 nrd 269 lsolyte g lnj. nrd.27o lsolyte p 10% 500 ml 880 lnj. 881 294 lsophane lnsulin lnj lp 40 lu /ml 10 ml vial 882 aa4 lsoprenaline lnjection lp 2mg / ml rc not exists 883 197 lsosorbide dinitrate tab lp 5 mg 10x10 tab blister 884 198 lsosorbide mononitrate tabs lp 20 mg 10x10 tab strip nrd.26 lsotretinoin 10mg 88s cap. nrd 27 lsotretinoin 20 mg 886 cap 887 333 lsoxsuprine lnj lp 5 mg/ml rc not exists 888 334 lsoxsuprine tab lp 20 mg 10x10 tab strip 889 nrd 105 itraconazole 1% eye drop 890 nrd 125 itraconazole 1% eye ointment 891 118 itraconazole cap 100 mg 10x4 cap strip 892 nrd 648 lvabradine 5mg tab. 893 nrd.65,i lvermectin 12mg tab. 894 nrd 649 lvermectin 6 mg + 415s66rzole 400 mg tab. 895 nrd 650 lvermectin 6mg tab. 896 s84.b k wire, length 375 mm; 1.6mm(details in rc) rc not exists a) h{iq ehe trr+iq frtmft f{fth ntdq rate/unit gst final rate drug d name packlng unlt s,no. rug wlthout gst rate wlth gst code s84.c k wire, length 375 mm; 1.8mm(details in rc) rc not exists 897 s84.a k wire, length 375 mm; 1mm(details in rc) rc not exists 898 nrd 412 ketaconazole 2% lotion 899 k 10 a etamine lnj lp 50 mg/ml ml vial 900 nrd keloconazole 200 mg iab. 901 .652 ketoconazole cream 2o/o 1sgm tube in mono 902 565 carton t 10 t.e :;t{fffil * c do rua o i rate/unit gst fanal rate s.no. drug name packang unit urithout gst rate with gst )olypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm 1356 s74 piece )olypropylene s73 nonabsorbable synthetic surgical mesh 7.6cm x 1scm or riece 7357 /.scm x 1 scm 1358 nrd 740 romalidomide 2 mg ab 13s9 nrd 741 pomalidomide 4 mg fab. 1360 nrd.742 posacozazole 100m9 fab. 1361 nrd 743 posacozazole 40mg/ml svp t362 nrd.34o potassium chloride for lnjection lnj potassium chloride lnj. 0.15 gm/ml 1363 383 10 ml amp 10 ampoules potassium chloride oral solution u.s.p 500m9/ sml 200m1 bottle(amber 1364 384 solor) 1365 nrd.515 )otassium magnesium citrate syrup 1355 nrd 128 povidone iodine 3argle nrd 449 rovidone iodine ressary t367 )ovidone lodine ointment 5% 15 gm 15gm tube in a unit 1368 221 carton 1369 571 )ovidone lodine ointment usp 250 gm 250 gm pack rovidone lodine scrub solution / cleansing solution 7.5 o/o w/v povidone 1370 250 500 ml bottle odine (suitable for hand wash) )ovidone o/o 7371 572 lodine solution lp 10 100 ml bottle 7372 222 rovidone lodine solution lp 5 % 500 ml 500 ml bottle rovidone 7373 450 lodine solution lp 5% 100m1 bottle 100 ml bottle rowder 7374 759 clotrimazole 1o/o w/w 30 gm 30 gm bottle 1375 52 )ralidoxime chloride lnjection lp 25 mg/ml / 500 mg i/ial rrasugrel 1376 nrd 744 1omg tab iab. rrazosin 1377 nrd.745 5mg iab. 7378 555 rrazosin tablets (extended release) 2.5 mg rc not exists rrednisolone nrd.746 lp 40mg 1379 tab. f,rednisolone 1380 nrd.513 lp 50mg tab. rrednisolone 1381 nrd 74 acetate opthalmic suspension 10 ml ye drop rrednisolone 1382 nrd 113 sodium phosphate 1% eye/ear drop rrednisolone tab lp 20 mg 1383 470 1 0x1 0 tab strip/blister f,rednisolone tab lp 5 mg 1384 47 1 0x1 0 tab strip/blister 3rednisolone tablet lp 10 mg 1385 469 1 0xl 0 tab strip/blister 1386 634 rregabalin cap lp 75 mg 10 x 10 capsule 3ressure monitoring line / high pressure extension line (details in rc) each piece in blister 1387 s91 pack )rimaquine tab lp 2.5 mg 1388 128 10x10 tab strip/blister primaquine tab lp 7.5 mg 1389 129 1 0x1 0 tab strip/blister )rimidone 1390 nrd 748 250 mg tab. )rimidone 1391 nrd 747 50 mg tab. probiotic sachets 1 gm size (each gram sachet contains saccharomyces l392 765 boulardii 250m9 & lactic acid bacillus 150 million spores) 1 gm each sachet procaine 1393 nrd 341 penicillin fortified 2 lack nj procarbazine hydrochloride capsule usp 50 mg (each capsule contains 7394 725 rc not exists procarbazine hydrochloride usp 50 mg) rrochlorperazine 1395 nrd 749 5mg tab rrochlorperazine 1396 764 mesylate lnjection 12.5mg/ml 5ml size rc not exists )rogesterone lnj 200 mg/ 2ml 1397 298 2 ml amp 10 ampoules drogesterone 1398 nrd 155 lnjection 50 nl 1399 nrd 750 progesterone only pills tab. iifl:l {rrq s druo rate/unit gsf final rnte no drug name facklng unlt corl*e wlthout gst rate with gst promethazine lni lp 25mg/ml 2 ml amp (amber 1400 49 colo0(10 ampoules) promethazine syrup lp 5 mg/sml 60 ml bottle (with 1407 48 measurinq cap) i402 50 promethazine tab lp 25 mg 10x10 tab strip 1403 nrd.,i ,14 proparacaine 0.5% wv eye drop l404 14 propofol lnj lp 10 mg/ml 20 ml vial / ampoule 1405 nrd 751 propranolol 1omg tab. 1406 nrd.752 propranolol 40 mg sr tab. propranolol tab lp 40 mg r407 207 i 0x1 0 tab strip/blister 1408 nrd 753 propylthiouracil 100 mg tab. 1409 nrd 15,i prostaglandin 500mcg/ml lnj. 1,41,0 nrd 342 protamine sulphate 5ml 08 nrd 753 propylthiouracil 100 mg tab. 1409 nrd 15,i prostaglandin 500mcg/ml lnj. 1,41,0 nrd 342 protamine sulphate 5ml nj. pyridostigmine tablet lp 60 mg (each tablet contains pyridosigrnrne lp 74t1 792 10x10 tablets 60mg) 1472 nrd.754 pyridoxine 100 mg tab, t473 626 pyridoxrne tablet lp 10 mg rc not exists dyridoxine 74t4 627 tablet lp 40mg 10x10 tab strip 1415 675 quetiapine tablet lp 25mg 10x10 tab blister t416 674 quetiapine tablet lp 50mg 10x10 tab blister quinine dihydrochloride lnj lp 300 mg/ml 1477 131 2 ml amp 25 ampoules t4t8 132 quinine sulphate tablets lp 300 mg (film coated) 10x10 tab blister t4t9 nrd.490 rabbit atg (anti thymocyte clobulin) 250 mg lnj. l420 nrd 343 rabbit atg (anti thymocyte globulin)100 mg ln.l 1427 nrd.6 rabeprazole +levosulpiride 3ap. rabies antiserum lp (equine) 300 units per ml contains equine anti+abies 1422 408 5 ml vial immunoglobulin fragments (1.m./sc use) rabies vaccine human (cell culture) lp 2.5 lu 1 l llntradermal) ml vial with .0 ml t423 306 diluent rabies vaccine human (cell culture) lp (lntramuscula4 2^s rul oose single dose vial with 1424 307 diluent and syringe with needle 1425 nrd 5 racecadotril 100m9 cap. r426 nrd.467 racecadotril sachet 30 mg sachet 1.427 nrd.32 ramipril lp 5 mg cap. 1428 636 ramipril tablets lp 2,5 mg 10x10 tablets 1429 nrd 344 ramucirumab 1 00 mg(monopoly) lnj 1430 nrd.345 ramucirumab 500 mg (monopoly) lnj 7431 lt6 ranitidine hcl lnjection lp 50mg/2ml rc not exists 1432 nrd.516 anitidine oral suspension syrup 1433 277 anitidine tab lp 150m9 film coated rc not exists 1434 433 anitidine tab lp 300m9 film coated rc not exists 1435 nrd.346 anizumab 10mg/ml lnj 7436 nrd 755 anolazine 500mg ab 1437 nrd 756 asagilinel mg ab 1438 nrd.347 asburicase 1.5 mg nj 7439 690 recombinant coagulation factor vlla 1mg vial 1440 691 recombinant coagulation factor vlla 2mg vial r447 748 recombinant f lx 500 lu with diluent vial with diluent t442 nrd.34b recombinant fsh 150 lu inj. t443 nrd 349 recombinant fsh 3001u lnj. 444 nrd 350 recombinant hcg 250 lu nj. 445 nrd.451 recombinant human growth hormone 4lu vial with syringe nj. 446 nrd.351 recombinant lh 75lu nj. nrd regorafenib 40 mg ab. 447 .757 cj :..4 +.v:l !;:i1.rt ., ,.a . ?*mmrdq rate/unit gst final rate ,!j|! drug name packtng unlt witho;t gsr rate with gst ... 7727 s94 umbilical cord clamp (details in rc) each piece urethral catheter 90 (fg 14) made up of medical grade pvc (detail in l728 s1 07 each piece rc) urethral catheter 91 (fg 10), made up of medical grade pvc (detail in 1729 s1 08 each piece rc) urine collecting bag for new born /paediatric urine collection bag, 1730 s92 each piece capacity 100m1 (details in rc) 1731 s40 urine collecting bag, disposable 2000 ml(details in rc) rc not exists 7732 ee1 urokinase lnjection 5 lac unit (lyophilized) rc not exists ursodeorycholic acid tablets lp 300 mg 7733 597 10x10 tab strip/blister 1734 nrd 523 ursodeoxycholic oral suspension 125m9/5ml in 100m1 syrup s vaccum suction set, 2.5 meter length (detail in rc) 7735 109 each piece 7736 318 valethamate bromide lnj 8mg / ml rc not exists 7737 722 valganciclovir tablet 450 mg rc not exists 1738 524 vancomycin for lntravenous lnfusion lp 1 gm vial 1739 523 vancomycin for lntravenous lnfusion lp 500 mg vial 1740 nrd 397 varicella immunoglobulin for lv use lnj vascular catheter with metal guide no. 16 double lumen size 45 cm 174t s1 15 rc not exists (longline lv) (detail in rc) vascular catheter with metal guide no. 16, double lumen size 30 cm 7742 s111 rc not exists (longline lv) (detail in rc) vascular catheter with metal guide no. 18 double lumen size 30 cm 7743 s112 each piece (longline lv) (detail in rc) vascular catheter with metal guide no. 18 double lumen size 45 cm 7744 s116 rc not exists (longline lv) (detail in rc) vascular catheter with metal guide no. 20 double lumen size 30 cm 1745 st 13 each piece (detail llonqline lv) in rc) vascular catheter with metal guide no. 20 double lumen size 45 cm 1746 s117 rc not exists (lonqline lv) (detail in rc) vascular catheter with metal guide no. 22 double lumen size 30 cm l747 s114 each piece (lonsline lv) (detail in rc) vascular catheter with metal guide no. 22 double lumen size 45 cm 7748 s1 18 rc not exists (longline (detail lv) in rc) nrd 398 vasopressin 3ml 7749 lnj. 1750 242 vdrl antigen (with + vg and ve control) / rpr slide kit 1o0 test kits 415 vecuronium bromide for lnjection 4mg (freeze dried) t757 rc not exists verapamil 2.5 mg/ml l752 nrd.399 lnj. 1753 nrd 811 verapamil hydrochloride sustained release 120 tab. 1754 nrd.81o verapamil hydrochloride sustained release 40 tab. 1755 211 verapamil tab lp 40 mg film coated 10x10 tab strip 1756 nrd 812 vildagliptin 50mg tab 1757 158 vinblastine lnj lp 10mg/ 1oml vial 1758 159 vincristine lnj lp 1mg(vial)a/incristin lnjection usp 1mg/ml (amp) vial/ampoules 1759 nrd.4oo vinorelbine 1omg nj 7760 nrd 401 vinorelbine 50mg nj 1767 nrd.b3 r/itamin e s0mg/ml, 400 lu frop yitamin 1762 nrd 38 a 25000 lu lap. ritamin a paediatric oral solution lp(vitamin a concentrate oil lp)each 100 ml bottle and spoon 7763 409 nl contains vitamln a 100000 lu with marking 1 ml/2ml in unit carton 7764 395 ritamin b complex lnj nfi 10 ml vial yitamin b complex tablet nfi (prophylactic) b1 2mg b2 2mg 86 0.5m9 1765 397 iacinamide 2smg calcium pantothenate 1mg (with appropriate 1 0x1 0 tab strip/blister rveraqes) 1766 nrd.402 yitamin d (600000 lu) nl. 7767 nrd 84 /itamin d3 4001u/ml drop 1768 nrd.85 vitamin d3 b00lu/ml drop vitamin d3 oral solution 60000 lu 5ml glass bottle in unit 7769 676 carton n :..( . i e , :11 druo flnal rate sno drug name packrns unrt coal *ti.tjl[j, :11 witt gst vitamin e capsule 400 mg t770 795 1 0x10 cap strip/blister k lml vitamin lnjection each ml contains menadione sodium bisulphite 1omg t77t 180 equivalenl to 5.2 mg of menadione. (aqueous solution) amp(ambercolor)25 amp vitamin k 1 (phytomenadione) lp 1mg/o.5m1 injection (detail in rc) each pack along with 1772 644 syringe in a unit carton 1773 nrd.813 voglibose 0,2 mg tab tab. r774 nrd 814 voglibose 0.3 mg tab tab. 1,775 nrd.1 19 voriconazole eye drop 1776 nrd bo9 vonconazole 200 mg tab. 720 voriconazole lnjection 200mga/ial 7777 /ial 7778 nrd.815 warfarin 1mg tab. 1,779 nrd 816 warfarin 2mg tab. 1780 nrd.b17 warfarin 3mg tab. 1781 546 warfarin sodium. tab lp smg 10x10 tablets 1782 404 water for lnj lp rc not exists 7783 nrd.4o5 xylocaine lubricating 30gm jelly xylometazoline nasal drops lp 0.1% 5ml vial/bottle(with a 1784 620 seperate dropper) in a unit carton 1,785 nrd b1b zinc 50mg tab. 7786 nrd 524 zinc oral suspension 20 mg/100 ml syrup nrd zinc oxide +alo vera +semethicone 1787 441 3intment zinc sulphate dispersible tablets lp elemental zinc 10 mg 1788 472 1 0x1 0 tab strip/blister l789 743 zoledronic acid lnjection lp 4mg vial rial zolpidem lomg t790 nrd.b19 tab. t797 779 zolpidem tablet 5 mg 10x10 tablets 1792 nrd.821 zonisamide 100 mg tab. 1793 nrd 820 zonisamide 50mg tab. non edl balance salt solution glass bottle 500m1 (sterile opthelmic irrigatiing sol.) 500m1 glass bottle sodium chloride 0.49%, pottasium chloride 0.075o/o, calcium chloride7794 0.048% , magnisium chloride 0.03% , sodium acetate 0.39% ,sodium citrate 0.17% r795 lnj. sodium chloride 0.9% 500m1 glass bottle micronised s gelatin l00mg 1,796 progesteron oft capsule rap. l797 sterilium 2propanolol 45gm , 1 propanolol 30mg/100m9 korsolex rapid gluteraldehyde 15.2m9 1.6 dihyroxy 2,5 dioxahaxane (lnstrumental , lt98 19.79m disinfactant concentration) 1799 taurine 500m9 + n acetylcysteine 150m9 tablets tab. 1800 adhesive tap cotton 6inch 1ocm x smts 1801 autoclave indicator tap (sigma lock) l8mm x 55 mts 1802 bandages scm x 4mts 2 scm x 4mts 1803 bandages locm x 4mts 4 1ocm x 4 mts 1804 bandages 1scm x 4mts 6 lscm x 4mts 1805 crescent 2.6 mm (sharpedge) 2.6 mm 1806 dispo needle 26.5 26.5 g/ 0.45 x 13mm ecoshield/bacillocid (hydrogen peroxide 1 1% with silver nitrate 0.01%) 500m1 1807 1808 surgical pad gauze 120cm gmts 1809 than x 120cm x 9mts 1810 keratom 2,8 mm (sharpedge) 2.8 mm 181 1 cpthalmic micro surgical blade(mvr knife 20 g) 22g l8l2 0otton roll 5009m d rate/unit gst final rate 3 rug name packing unit ;:: .d without gst rate with cst 1813 cotton buds 1814 makintosh rubber sheet 1815 bleeching powder 1816 haemocoagulase topical sol. 10ml 1877 charcoal powder 1818 suture needle (size 1 1 1 5) 18 19 face shield 1820 n 95 mask rilhout valve 182 1 hand rub sanitizer 500m1) 7822 glass lonomer cement (glc) 1823 personal protection equipment (ppe kit) ...

Medical And Health Services - Rajasthan

32776606 medicine tender to buy medicine for govt. dist. hospital, sri ganganagar , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) , nicumalone 1 mg , nicumalone 4 mg , inj alamine , inj nikethamide , machintosh ( bluesheet ) , kallys pad , cautry pencile , under water seal , oxygen flow meter , ambu beg adult , ambu beg child , bross v drope , mircopore 3 / 4 , micropore 1 / 2 , nebulizer machine , autoclave tape signlock , inj dilitazem , chymotrysin , citicoline , clarithromycin 500mg , dapagliflozin 10mg , deflazacort 6 mg , esomeprazole 40 mg , febuxastat 40 mg , febuxastat 80 mg , glucosamine + diacerein 50 mg tab , ketorolac 10 mg , levothyroxine sodium tablet 25 mcg , methylpredinisolone 16 mg , methylpredinisolone 8 mg , moxifloxacin400 mg , nitrazepam 10 mg , paracetamol 650 mg , pentoprazole 40 + levosulpiride 150 mgcap , propylthiouracial 100 mg , repaglinide and voglibose ( 0.5+0.3 ) , rifaximin 500mg , rosuvastatin 160mg + finofib 10mg , serratiopeptidase 10mg , silodocin 4 mg cap , silodocin 8 mg cap , sitagliptin 50mg , sulphasalazine 500 mg , thiocolchicosite 4 mg , vildagliptine 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , zinc 50mg , azithromycine 100 mg , azithromycine 200 mg , cefpodoxime 100 mg , cyproheptidine , drotavarine , mefenamice acid 100mg / 5ml , montelucast+levocetrizine , phenobarbitone 20mg / 5ml, 100 ml , levofloxacine , ondansetron , zink 20 mg, 100 ml , abdominal suction set , arterial line , av blood line , av fistula needle 16g , av fistula needle 17g , baby diaper small size for infents , bain circuit adult , bain circuit ped. , bains circuit paediatric / adult , bandage 10 inch , bandage 15 inch , bandage 2.5 inch , bandage 4 inch , bandage 6 inch , bandage 7.5 inch , bipolar prosthesis set , calcanum plate all size , ccs screw 4 mm, 6mm, 5mm , chest drainage catheter ( i.c.d. ) ( thoracic catheter ) size : fg: 16, 20, 24, 28, 32, 36 & 40. , chlorhexidine inpregnade paraffin gauze 10x10 , chlorhexidine inpregnade paraffin gauze 30x10 , chlorhexidine inpregnade paraffin gauze roll , clavical plate all size , close circuit , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, ( all size ) , creep bandage 10 inch , creep bandage 2 inch , creep bandage 4 inch , creep bandage 6 inch , diaper adult ( s / m / l ) , cream luliconazole 1% w / w , lignocain mouth paint , alpha beta arteether [ lp.26 ] [ m ] , multivitamine , azithromycin 10 ml vial equivalent to 500 mg , caffein 10 mg , citicoline 250 / 500 mg , colistine 10 lakh unit , compound sodium 500ml, glass bottel , dexmedetomidine 100mcg / ml , doxcyline100 mg , etomidate 10ml , etomidate 20 mg , ferric carbo maltose 500mg / 10 ml vial , fluconazole 200mg , gdw 5% glass bottle , levofloxacine 100 ml , l ornithine l aspartate 10 ml , mephentermine 30ml / ml , methylprednisolon injection 40mg , moxifloxacin 100ml , nandrolone decanoate 50 mg inj , nicorandil 48 mg , normal saline 500 ml glass bottle , ondansetron 8 mg , pilocarpine 0.5 %v / v , piracetam 200 mg , ravici 5 ml , reteplase 18 mg , tirofiban 0.5 mg , vitamin d ( 600000 iu ) , chloramphenicol +polymycine , chloramphenicol +polymycine + dexamethason , carboxymethylcellulose + glycerin , gatifloxacin and prednisolone , moxifloxacilline+ dyliprednate , moxifloxacilline+ prednisone , natamycin 5% , sodium chloride 5% , tropicamide + phenlyephrine , dorzolamide , moxifloxacin and prednisolone eye drop , olaptadine & ketrolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , anti cold15 ml , calcium30 ml , diastasepepsin with simethicone 15 ml , digestive enzyme 15 ml , hydroxyzine 15 ml , ondensetrone 30 ml , prednisolone 10 ml , terbutalin , vitamind3 400 iu , vitamind3 800 iu , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprebitant 125 / 80 , dulexitim 20mg , dulexitim 30mg , glucosamine + chloride +msm , racecadotril 100mg , rebeprazole +levosulpiride , docetaxil 120 mg , coddun filter set , bevacizumab 400g , transtuzumab , caffein citrate 1 ml, 3 ml , pipra + tazobactum 1.25 gm , calcium + phosphate 2:1 ratio , identical tag for new born , ppf 12 lac unit , frusemide , sidenafil 5 gm / 10ml , ntg 6 no , caffine citrate 1ml , caffine citrate 3ml , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) [ 705 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm [ r18 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm [ r19 ] , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) [ r79 ] , betaxolol eye drops 0.5 o / o [ 612 ] , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) [ 751 ] , finasteride tablets ip 5 mg [ 575 ] , isoprenaline injection ip 2mg / ml [ 551 ] , leflunomide tablets ip 10mg ( film coated ) [ 600 ] , leflunomide tablets ip / usp 20mg ( film coated ) [ 601 ] , rosuvastatin tablet 10 mg [ 757 ] , sacubitril 24 mg and valsartan 26 mg tablet [ 758 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) [ r15 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm [ r12 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed [ r14 ] , cefepime injection ip 500 mg [ 510 ] , ceftriaxone 1 gm + tazobactum 125 mginjection [ 708 ] , esmolol hydrochloride injection 10mg / ml 10ml size [ 753 ] , linezolid inj200mg / 100ml [ 517 ] , linezolid tablets ip 600 mg [ 516 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) [ r38 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) [ r24 ] , normal human intravenous immunoglobulin 5g / 100ml [ 633 ] , rh erythropoetininj 10000 iu [ 176 ] , rh erythropoetininj 4000 iu [ 179 ] , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) [ 756 ] , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg [ 602 ] , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , thiopentone inj ip 0.5 g , sevoflurane , fentanyl citrate injection ip 2 ml , ibuprofen tab ip 400 mg ( coated ) , morphine sulphate inj ip 10mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , fentanyl citrate injection 50mcg / ml , butorphanol tartrate injection usp 1mg / ml 1ml size , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , chlorpheniramine maleate tab ip 4mg , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , naloxone inj ip 0.4mg / ml , sodium valproate inj 100 mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , gabapentine tablet / capsule 100mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , ceftazidime inj ip 500 mg , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , griseofulvin tab ip 125 mg , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , cloxacillin sodium inj ip 500mg , amoxicillin and potassium clavulanic ip inj 600mg , clindamycin capsule ip 150mg , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , clindamycin phosphate injection ip 300 mg , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , chlorambucil tab ip 5 mg , cisplatin inj ip 50 mg / 50 ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cytarabine injection bp 500mg , daunorubicin inj ip 20 mg , doxorubicin inj ip 50 mg / 25 ml , etoposide inj ip 100 mg , fluorouracil inj ip 250 mg / 5ml , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , methotrexate tab ip 2.5 mg , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , dacarbazine injection 500 mg usp / bp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg , oxaliplatin injection usp 50 mg , cyclosporin capsule usp / ip 50 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg / 100ml 100ml size , levodopa and carbidopa tab 250 mg+ 25 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , polygeline 3.5% solution with electrolytes for i.v. infusion , factor ix concentrate ( purified ) ip 600 i.u. ( human coagulation factor ix ) , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , feracrylum 1% w / w sterile solution 100 ml , methyldopa tab ip 250mg film coated , verapamil tab ip 40 mg film coated , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , lisinopril tab ip 2.5 mg , adenosine injection ip 6 mg / 2ml , urokinase injection 5 lac unit ( lyophilized ) , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , metronidazole 1% and chlorhexidine gluconade 0.25% gel , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , gentian violet topical solution usp 1o / o , betamethasone dipropionate cream ip 0.05% , coal tar 6% & salicylic acid 3% ointment , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , diagnostic sticks for multiple use strip ( sugar, ketone, albumin ) , diagnostic strip for glucose, ketone , diagnostic strip for glucose, protein , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , furosemide injection ip 10mg / ml ( im and iv use ) , torsemide inj 10 mg / ml , spironolactone tablets ip 50 mg , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , dicyclomine hydrochloride oral solution ip 10mg / 5ml , metoclopramide hydrochloride syrup ip 5 mg / 5ml , prochlorperazine mesylate injection 12.5mg / ml 5ml size , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , ethinyloestradiol tabs ip 50 mcg , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , medroxyprogesterone acetate tablets ip 10 mg , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , diphtheria antitoxin 10000 iu , hepatitis b immunologlobin injection ip 100 i.u , neostigmine inj ip 0.5 mg / ml , neostigmine tab ip 15 mg , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin ophthalmic ointment usp 0.3% , tobramycin ophthalmic ointment usp 0.3% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , acyclovir eye ointment ip 3% w / w 5gm size , chloramphenicol 1% w / w eye ointment ip, 3gm size , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , misoprostol tab ip 200 mcg , mifepristone tab ip 200mg , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorpromazine inj. ip 25mg / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , trifluperazine tab ip 5 mg coated , beclomethasone inhalation ip 200 mcg / dose , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , sodium chloride injection ip 100 ml , sodium chloride 0.45% w / v polypack 500 ml , phenazopyridine tablet 5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , vitamin b complex inj nfi , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , zinc sulphate dispersible tablets ip elemental zinc 10 mg , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , ferric carboxymaltose injection 50 mg / ml 10 ml size , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , black disinfectant fluid ( phenyl ) as per schedule o grade iii , conc haemodialysis fluid b.p acetate concentrate 10 litre can , peritonial dialysis solution ip , water for inj ip , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , pyridostigmine tablet usp 60 mg ( each tablet contains pyridostigmine usp 60 mg ) , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) , surgical blade sterile, size 23 ( detail in rc ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) , niv mask ( noninvasive ventilation mask ) adult large size single use for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) adult medium size single use for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) adult large size single use for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) adult medium size single use for bipap with vent ( detail in rc ) , nebulization mask adult ( detail in rc ) , chemotherapy port &non coring needles ( pediatric ) ( detail in rc ) , elastic adhesive bandage bp 1m x 10cm adhesive material should have good quality sticking property ( detail in rc ) , niv mask ( noninvasive ventilation mask ) paediatric small size single use with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) , chemotherapy port and non coring needles ( adult ) ( detail in rc ) , ecg electrode ( detail in rc ) , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , asepto syringe with transparent bulb sterile, 60 ml , suction catheter, sterile.size: fg 5 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , plaster of paris bandage 15cm x 2.7 mts / roll , plaster of paris bandage 10cm x 2.7mts , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , tracheostomy tube, plain all sizes ( details in rc ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) , corrugated drainage sheet all sizes ( details in rc ) , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , bone wax sterilised , skin graft knife blade ( sterile ) ( details in rc ) , k wire, length 375 mm; 1mm ( details in rc ) , k wire, length 375 mm; 1.6mm ( details in rc ) , k wire, length 375 mm; 1.8mm ( details in rc ) , face mask, disposable ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) , t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) , bone cement , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , sanitary napkin beltless with wings ( details in rc ) , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 ( detail in rc ) , nelaton catheter size 14 fg ( detail in rc ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , inj. noradrenaline 2mg / ml , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g , hepatitis b immunologlobin injection ip 200 i.u...

Medical And Health Services - Rajasthan

32773300 supply of medicines for govt. dist. hospital, sri ganganagar injection tablet syrup , capsule , lotion , cream , eye and ear drops , etc hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) , nicumalone 1 mg , nicumalone 4 mg , inj alamine , inj nikethamide , machintosh ( bluesheet ) , kallys pad , cautry pencile , under water seal , oxygen flow meter , ambu beg adult , ambu beg child , bross v drope , mircopore 3 / 4 , micropore 1 / 2 , nebulizer machine , autoclave tape signlock , inj dilitazem , chymotrysin , citicoline , clarithromycin 500mg , dapagliflozin 10mg , deflazacort 6 mg , esomeprazole 40 mg , febuxastat 40 mg , febuxastat 80 mg , glucosamine + diacerein 50 mg tab , ketorolac 10 mg , levothyroxine sodium tablet 25 mcg , methylpredinisolone 16 mg , methylpredinisolone 8 mg , moxifloxacin400 mg , nitrazepam 10 mg , paracetamol 650 mg , pentoprazole 40 + levosulpiride 150 mgcap , propylthiouracial 100 mg , repaglinide and voglibose ( 0.5+0.3 ) , rifaximin 500mg , rosuvastatin 160mg + finofib 10mg , serratiopeptidase 10mg , silodocin 4 mg cap , silodocin 8 mg cap , sitagliptin 50mg , sulphasalazine 500 mg , thiocolchicosite 4 mg , vildagliptine 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , zinc 50mg , azithromycine 100 mg , azithromycine 200 mg , cefpodoxime 100 mg , cyproheptidine , drotavarine , mefenamice acid 100mg / 5ml , montelucast+levocetrizine , phenobarbitone 20mg / 5ml, 100 ml , levofloxacine , ondansetron , zink 20 mg, 100 ml , abdominal suction set , arterial line , av blood line , av fistula needle 16g , av fistula needle 17g , baby diaper small size for infents , bain circuit adult , bain circuit ped. , bains circuit paediatric / adult , bandage 10 inch , bandage 15 inch , bandage 2.5 inch , bandage 4 inch , bandage 6 inch , bandage 7.5 inch , bipolar prosthesis set , calcanum plate all size , ccs screw 4 mm, 6mm, 5mm , chest drainage catheter ( i.c.d. ) ( thoracic catheter ) size : fg: 16, 20, 24, 28, 32, 36 & 40. , chlorhexidine inpregnade paraffin gauze 10x10 , chlorhexidine inpregnade paraffin gauze 30x10 , chlorhexidine inpregnade paraffin gauze roll , clavical plate all size , close circuit , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, ( all size ) , creep bandage 10 inch , creep bandage 2 inch , creep bandage 4 inch , creep bandage 6 inch , diaper adult ( s / m / l ) , cream luliconazole 1% w / w , lignocain mouth paint , alpha beta arteether [ lp.26 ] [ m ] , multivitamine , azithromycin 10 ml vial equivalent to 500 mg , caffein 10 mg , citicoline 250 / 500 mg , colistine 10 lakh unit , compound sodium 500ml, glass bottel , dexmedetomidine 100mcg / ml , doxcyline100 mg , etomidate 10ml , etomidate 20 mg , ferric carbo maltose 500mg / 10 ml vial , fluconazole 200mg , gdw 5% glass bottle , levofloxacine 100 ml , l ornithine l aspartate 10 ml , mephentermine 30ml / ml , methylprednisolon injection 40mg , moxifloxacin 100ml , nandrolone decanoate 50 mg inj , nicorandil 48 mg , normal saline 500 ml glass bottle , ondansetron 8 mg , pilocarpine 0.5 %v / v , piracetam 200 mg , ravici 5 ml , reteplase 18 mg , tirofiban 0.5 mg , vitamin d ( 600000 iu ) , chloramphenicol +polymycine , chloramphenicol +polymycine + dexamethason , carboxymethylcellulose + glycerin , gatifloxacin and prednisolone , moxifloxacilline+ dyliprednate , moxifloxacilline+ prednisone , natamycin 5% , sodium chloride 5% , tropicamide + phenlyephrine , dorzolamide , moxifloxacin and prednisolone eye drop , olaptadine & ketrolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , anti cold15 ml , calcium30 ml , diastasepepsin with simethicone 15 ml , digestive enzyme 15 ml , hydroxyzine 15 ml , ondensetrone 30 ml , prednisolone 10 ml , terbutalin , vitamind3 400 iu , vitamind3 800 iu , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprebitant 125 / 80 , dulexitim 20mg , dulexitim 30mg , glucosamine + chloride +msm , racecadotril 100mg , rebeprazole +levosulpiride , docetaxil 120 mg , coddun filter set , bevacizumab 400g , transtuzumab , caffein citrate 1 ml, 3 ml , pipra + tazobactum 1.25 gm , calcium + phosphate 2:1 ratio , identical tag for new born , ppf 12 lac unit , frusemide , sidenafil 5 gm / 10ml , ntg 6 no , caffine citrate 1ml , caffine citrate 3ml , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) [ 705 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm [ r18 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm [ r19 ] , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) [ r79 ] , betaxolol eye drops 0.5 o / o [ 612 ] , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) [ 751 ] , finasteride tablets ip 5 mg [ 575 ] , isoprenaline injection ip 2mg / ml [ 551 ] , leflunomide tablets ip 10mg ( film coated ) [ 600 ] , leflunomide tablets ip / usp 20mg ( film coated ) [ 601 ] , rosuvastatin tablet 10 mg [ 757 ] , sacubitril 24 mg and valsartan 26 mg tablet [ 758 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) [ r15 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm [ r12 ] , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed [ r14 ] , cefepime injection ip 500 mg [ 510 ] , ceftriaxone 1 gm + tazobactum 125 mginjection [ 708 ] , esmolol hydrochloride injection 10mg / ml 10ml size [ 753 ] , linezolid inj200mg / 100ml [ 517 ] , linezolid tablets ip 600 mg [ 516 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) [ r38 ] , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) [ r24 ] , normal human intravenous immunoglobulin 5g / 100ml [ 633 ] , rh erythropoetininj 10000 iu [ 176 ] , rh erythropoetininj 4000 iu [ 179 ] , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) [ 756 ] , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg [ 602 ] , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , thiopentone inj ip 0.5 g , sevoflurane , fentanyl citrate injection ip 2 ml , ibuprofen tab ip 400 mg ( coated ) , morphine sulphate inj ip 10mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , fentanyl citrate injection 50mcg / ml , butorphanol tartrate injection usp 1mg / ml 1ml size , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , chlorpheniramine maleate tab ip 4mg , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , naloxone inj ip 0.4mg / ml , sodium valproate inj 100 mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , gabapentine tablet / capsule 100mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , ceftazidime inj ip 500 mg , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , griseofulvin tab ip 125 mg , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , cloxacillin sodium inj ip 500mg , amoxicillin and potassium clavulanic ip inj 600mg , clindamycin capsule ip 150mg , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , clindamycin phosphate injection ip 300 mg , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , chlorambucil tab ip 5 mg , cisplatin inj ip 50 mg / 50 ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cytarabine injection bp 500mg , daunorubicin inj ip 20 mg , doxorubicin inj ip 50 mg / 25 ml , etoposide inj ip 100 mg , fluorouracil inj ip 250 mg / 5ml , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , methotrexate tab ip 2.5 mg , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , dacarbazine injection 500 mg usp / bp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg , oxaliplatin injection usp 50 mg , cyclosporin capsule usp / ip 50 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg / 100ml 100ml size , levodopa and carbidopa tab 250 mg+ 25 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , polygeline 3.5% solution with electrolytes for i.v. infusion , factor ix concentrate ( purified ) ip 600 i.u. ( human coagulation factor ix ) , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , feracrylum 1% w / w sterile solution 100 ml , methyldopa tab ip 250mg film coated , verapamil tab ip 40 mg film coated , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , lisinopril tab ip 2.5 mg , adenosine injection ip 6 mg / 2ml , urokinase injection 5 lac unit ( lyophilized ) , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , metronidazole 1% and chlorhexidine gluconade 0.25% gel , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , gentian violet topical solution usp 1o / o , betamethasone dipropionate cream ip 0.05% , coal tar 6% & salicylic acid 3% ointment , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , diagnostic sticks for multiple use strip ( sugar, ketone, albumin ) , diagnostic strip for glucose, ketone , diagnostic strip for glucose, protein , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , furosemide injection ip 10mg / ml ( im and iv use ) , torsemide inj 10 mg / ml , spironolactone tablets ip 50 mg , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , dicyclomine hydrochloride oral solution ip 10mg / 5ml , metoclopramide hydrochloride syrup ip 5 mg / 5ml , prochlorperazine mesylate injection 12.5mg / ml 5ml size , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , ethinyloestradiol tabs ip 50 mcg , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , medroxyprogesterone acetate tablets ip 10 mg , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , diphtheria antitoxin 10000 iu , hepatitis b immunologlobin injection ip 100 i.u , neostigmine inj ip 0.5 mg / ml , neostigmine tab ip 15 mg , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin ophthalmic ointment usp 0.3% , tobramycin ophthalmic ointment usp 0.3% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , acyclovir eye ointment ip 3% w / w 5gm size , chloramphenicol 1% w / w eye ointment ip, 3gm size , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , misoprostol tab ip 200 mcg , mifepristone tab ip 200mg , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorpromazine inj. ip 25mg / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , trifluperazine tab ip 5 mg coated , beclomethasone inhalation ip 200 mcg / dose , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , sodium chloride injection ip 100 ml , sodium chloride 0.45% w / v polypack 500 ml , phenazopyridine tablet 5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , vitamin b complex inj nfi , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , zinc sulphate dispersible tablets ip elemental zinc 10 mg , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , ferric carboxymaltose injection 50 mg / ml 10 ml size , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , black disinfectant fluid ( phenyl ) as per schedule o grade iii , conc haemodialysis fluid b.p acetate concentrate 10 litre can , peritonial dialysis solution ip , water for inj ip , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , pyridostigmine tablet usp 60 mg ( each tablet contains pyridostigmine usp 60 mg ) , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) , surgical blade sterile, size 23 ( detail in rc ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) , niv mask ( noninvasive ventilation mask ) adult large size single use for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) adult medium size single use for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) adult large size single use for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) adult medium size single use for bipap with vent ( detail in rc ) , nebulization mask adult ( detail in rc ) , chemotherapy port &non coring needles ( pediatric ) ( detail in rc ) , elastic adhesive bandage bp 1m x 10cm adhesive material should have good quality sticking property ( detail in rc ) , niv mask ( noninvasive ventilation mask ) paediatric small size single use with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) , chemotherapy port and non coring needles ( adult ) ( detail in rc ) , ecg electrode ( detail in rc ) , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , asepto syringe with transparent bulb sterile, 60 ml , suction catheter, sterile.size: fg 5 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , plaster of paris bandage 15cm x 2.7 mts / roll , plaster of paris bandage 10cm x 2.7mts , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , tracheostomy tube, plain all sizes ( details in rc ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) , corrugated drainage sheet all sizes ( details in rc ) , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , bone wax sterilised , skin graft knife blade ( sterile ) ( details in rc ) , k wire, length 375 mm; 1mm ( details in rc ) , k wire, length 375 mm; 1.6mm ( details in rc ) , k wire, length 375 mm; 1.8mm ( details in rc ) , face mask, disposable ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) , t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) , bone cement , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , sanitary napkin beltless with wings ( details in rc ) , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 ( detail in rc ) , nelaton catheter size 14 fg ( detail in rc ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , inj. noradrenaline 2mg / ml , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g , hepatitis b immunologlobin injection ip 200 i.u ...

Indian Army - Rajasthan

32699441 procurement of expendable medical stores for 187 military hospital drugs , mdi salmeterol 50mcg + fluticasone 250mcg , polypropylene blue monofilament 1 / 2 circle rb 70cm, size 2 / 0 , syp levosalbutamol 1mg / 5 ml , bottleof 100 ml , abdominal drain kit size 20 fg , abdominal drain kit size 24 fg , abdominal drain kit size 28 fg , abdominal drain kit size 32 fg , abgel , absorbable surgical suture violet 1 / 2 circle , rb 20mm, size 3 / 0 , adenosine 3 mg / ml, 2 ml inj , adjustable arm pouch sling l / m / s , adult bain circuit , aluminium foil , ankle brace , ankle support , ansell non latex gloves s 7.5 , ascorbic acid 500 mg tab , bacillocid , bandage dvt stocking large , bandage dvt stocking medium , benzathine penicillin 6, 00, 00 unit inj , biological indicator for autoclave machine , bulb for laryngscope , cap primosa evening oil , cap probiotic ( multibacillary 4 or more organisms ) , chest drain system with trocar ( icd ) s 24 , chest drain system with trocar ( icd ) s 28 , chest drain system with trocar ( icd ) s 30 , chest drain system with trocar ( icd ) s 32 , closed wound suction system romovac 10 fg , closed wound suction system romovac 12 fg , closed wound suction system romovac 14 fg , closed wound suction system romovac 16 fg , closed wound suction system romovac 18 fg , collagen dressing , combined spinal epidural set 18 / 27 g , common cold tab ( antihistiminics + paracetamol 500 mg without pseudoephedrine ) , cord clamp , cotton wool, absorbent pkt of 500 gm , cream clobetasole + g , crutches elbow adjustable , cutacept , cvp manometer , deflazacort 6mg tab , dextrose 50%, 25 ml inj , dextrose inj 25%, 25 ml inj , dextrose monohydrate for oral use , diethylcarbamazine 50mg tab , disp bladeless trocar 10 mm , disp bladeless trocar 7 mm , disp needle s 26 g , disp skin marker , donepezil 5 mg tab , dressing, shell, compressed , drop vit d3 60k nanoshot ( dee 3 ) , pkt of 4 bottle , duram tube , ecg electrodes ( disposable ) , endo bag , endo loop , endoclip lt 200 , endoclip lt 300 , endoclip lt 400 , epidural set 18g , escitalopran 10 mg tab , feeding tube 08 fr , feeding tube 10 fr , folleys catheter s 14 , formoterol 12 mcg & fluticasone 250 mcg dry powder , fusidic acid cream 2% w / w 10 g tube , g dressing s 15 , g dressing s 25 , g dressing s 5 , gelofusion plasma substitute soln , glucosamine 250mg+ chondroitin sulphate 200 mg cap , guedel airway size 01 , guedel airway size 02 , haemacel infusion, bott of 500ml , heel pad , hiv kit for ot , hydrocolloid dressing , hydroquinone 2% tube of 50 gm , inj depomedrol 80 mg / 2ml , inj etomidate 2 mg / ml , inj neostigmine 5ml , inj triamcinalone ( kenacort ) 10mg , injection anti spasmodic each ml containing analgin 500mg p piperidino ethyoxy o carbmethoxy benzophenone hcl 2.0mg and diphenylpiperidinoethyl acetamide bromomethylate 0.02mg amp of 5ml , insulin disposable syringe 1ml , insulin highly purified human neutral40iu / ml, 10 ml inj , ipratropium bromide respirator soln 250 mcg / ml vial of 15ml , iron syp with vitamins each 5 ml containing ferrous fumarate 100mg folic acid ip 3mg & vit b12 10mcg , isapgol / ispaghula husk 3.5 gm , keto strips , ketorolac 10 mg tab , kit albumin ( erba ) , kit alkaline phosphate ( erba ) , kit calcium ( erba ) , kit prothrombin time ( siemens ) , kit creatinine ( ( erba ) , kit for estimation of amylase ( 12 x 5 ml ) ( erba ) , kit for estimation of bilirubin ( erba ) , kit mifepristone 200 mg + misoprostol 800 mg , kit total protein ( erba ) , kit urea ( erba ) , kits for estimation of cholesterol ( erba ) , kits for estimation of glucose ( erba ) , kits for estimation of sgot ( erba ) , kits for estimation of urea ( erba ) , kits for estimation of uric acid ( erba ) , keto strips , swab stick , petri dish , erba machine printer roll , knee cap large , knee cap medium , knee cap small , knife bard parker, blade size 1 fitting ( commercial no. 11 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no. 12 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no. 15 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no.10 ) packet of 6 , knife bard parker, blade size 2 fitting ( commercial no. 20 ) packet of 6 , knife bard parker, blade size 2 fitting ( commercial no.22 ) packet of 6 , l arginine sachet , lactic acid bacillus sachet , levosalbutamol + ipratropium bromide ( duolin ) respules , lidocaine spray , linear cutter reload unit blue cartidge for use with safety lock out 75mm , linear stapler 90mm reload unit heavy wire for use with variable staple height 1.5mm 2.5mm , lint absorbent, cotton , liquid formalin , loperamide 2mg tab , lot iorep , malaria antigen test card , mdi budesunide 200mcg , mesh prosthesis for hernia small polypropylene mesh size 6*11 cms. composite light wtmesh of polypropylene and polygalactin 910 / polygycolic acid, size 6 *11 cms , methylene blue , metoprolol 1 mg / ml, 5 ml inj , microgen d 125 , microtips 1 1000 ul , microtips 1 50 ul , monocryl polyglecaprone 25 4 / 0cutting needle , monocryl polyglecaprone 70cm, 3 / 0 , nifedipine retard 20 mg cap / tab , ns bott of 100 ml , oint heparin , oint luliconazole , ot pack , oxytocin 5 oxytocic units per 0.5ml, 0.5ml inj , paedia drip , paraformaldehyde tab for sterilisation of catheters , pcm suppository , pmo line 100 / 200cm , polyamidemonofilament size 1, 100 cm, 1 / 2 circle rb 40 mm , polyamidemonofilament size 2 / 0, 70 80 cm 3 / 8 circle reserve cutting 40 45 mm , polyamidemonofilament size 3 / 0, 70 80 cm, 3 / 8 circle reverse cutting 25 30 mm , polyamidemonofilament size 4 / 0, 40 50 cm, 3 / 8 circle cutting 15 20 mm , polyamidemonofilament size 5 / 0, 60 70 cm 3 / 8 circle cutting 15 20 mm , polydioxanone size 1, 1.5cms loop, 1 / 2 circlerb needle 50 55 mm , polydioxanone size 1, 90 cms, 1 / 2 circle needle 40 45 mm , polyglicaprone size 3 / 0, 70 75 cm, 1 / 2 circle rb 20 25mm , polypropylene blue monofilament 70 75 cm size 3 / 0, 3 / 8 circle reverse cutting 12 mm , polypropylene blue monofilament 70 75 cm size 4 / 0, 1 / 2 circle rb25 mm double needle , polypropylene blue monofilament 70 75 cm, size 1 / 0 3 / 8 circle reverse cutting, 12 mm , polypropylene blue monofilament 70 75 cm, size 2 / 0, 3 / 8 circle reverse cutting, 12 mm , polypropylene blue monofilament 70 75 cm, size 4 / 0, 3 / 8 circle reverse cutting, 12 mm , polypropylene mesh 15 x 15 cms, mesh prosthesis for hernia medium / polypropylene mesh, size 15cms*15 cms.composite light weight mesh of polypropylene and polygalactin910 / polygycolic acid size 15cms*15 cms , polypropylene mesh 6 cm x 11 cm ( box of 6 ) , pttk reagent ( siemens ) , mdi formoterol 6 mcg + budesonide 400mcg , r / c levosalbutamol + ipratropium bromide ( duolin ) , r / c salbutamol , resp salbutamol , respulesenterogermina , rifampicin 150mg cap , rotacap salmeterol 50mcg +fluticasone 250mcg , ryles tube s 14 , ryles tube s 16 , salbutamol 100 mcg + ipratropium 20 mcg inhaler , salbutamol 2.5mg + ipratropium 40mcg solution , salbutamol sulphate respirator solution 5mg / ml, vial of 15 ml , serratiopeptidase 10 mg tab , silicon folleys catheter s 16 [ transparent ] , silicon folleys catheter s 18 [ transparent ] , silicon gel dressing , silicon tubal ring , silk braided size 0 70 76 cm reverse cutting 3 / 8 circle needle 45 mm , silk braided size 1 / 0 70 76 cms taper cut 1 / 2 circle needle 25mm , silk braided size 1 / 0 reel 6 reels x 25 mtrs , silk braided size 2 / 0 reel 6 reels x 25 mtrs , silk braided size 2 / 0, 70 76 cm rb 3 / 8 circle needle 45mm , silk braided size 3 / 0, 70 76 cm cutting 3 / 8 circle needle 45mm , skin stapler with 35 / 55 stainless staples , slide microscope , soda lime , sofratulle , spinal needle s 25 g , spinal needle s 26 g , steristrip , streptokinase 15 lacs iu inj , suction catheter s 08 , suction catheter s 10 , surgeons masks , surgicel , suspensory scrotal , swab stick , synthetic absorabable polygalactin rapid absorption 2 / 0, 80 90 cms, 1 / 2 circle cutting , 30 40 mm double arm , synthetic absorbable polygalactin 910 / polyglycolic acid coated with polycaprolate size 1 / 0, 70 90 cms, 1 / 2 circle rb 20 25 mm , synthetic absorbable polygalactin 910 / polyglycolic acid coated with polycaprolate size 2 / 0, 70 90 cms, 1 / 2 circle rb 30 40 mm , syp ambroxol bott of 100 ml , syp b complex , syp disodium hydrogen ( alkasol ) , syp grilintus , syp ofloxacin + ornidazole , syrup calcium phosphate , tab alpha keto analouge , tab bilastine 20mg , tab biotin , tab cabergoline 0.25mg , tab clinidipine 10mg , tab dapagliflozin 10 mg , tab dynapar , tab estradiol 2mg ( progynova ) , tab flunarazin 10mg , tab hydroxyzine 25mg , tab isosorbide dinitrate 10mg , tab levocarnitine 500mg , tab lithium carbonate 300 mg , tab micronised purified flavonoid fraction 500mg ( daflon ) , tab n acetyl cystene 600mg , tab nebivilol 5mg , tab pantop + d , tab paracetamol 650 mg , tab rifaximin 440 mg , tab sertaline 50 mg , tab sodium valporate 500 mg cr , tab teneligliptin 20mg , tab terbinafine 250 mg , tab thyroxin sodium 75 mcg , tab topiramate 50mg , tab torsemide 10mg , tegaderm s 10 cm , thumb spica splint , tiotropium bromide 18 mcg & formoterol 12 mcg dry powder cap , r / c tiotropium bromide 18 mcg dry powder , tmppd , tracheostomy tube 6.5 mm , tracheostomy tube 7 mm , tramadol hcl 50 mg / ml inj , transparent anaesthesia face mask set of size 0, 1, 2, 3, 4, 5 , tube endo tracheal reinforced pvc size 2.5 with out cuff , tube endo tracheal reinforced pvc size 3.0 with out cuff , tube endo tracheal reinforced pvc size 3.5 with out cuff , tube endo tracheal reinforced pvc size 4.0 with out cuff , tube endo tracheal reinforced pvc size 4.5 withcuff , tube endo tracheal reinforced pvc size 7.5 withcuff , tubing kit , u drain size l & m , under water sealed drainage bag , urine container , urine strips ( protein + glucose ) , uro bag , usg printer paper roll , ventilator circuit for anaesthesia machine , vicryl 3 / 0, 20mm , vicryl 4 / 0, 20mm , vicryl no 1 ( rb ) , vicryl rapid no 1 ( rb ) , vitamin e 200 mg cap , volini spray , walker tripod , warfarin 5 mg tab , wrist guard with thumb support , zolpidem 10 mg tab...

Directorate Of Agriculture - Rajasthan

32675099 food testing laboratory sl. no. item description 1 utilities and auxiliary equipment 2 hot air ovan 3 drying ovan 4 analytical balance 5 distilled water plant 6 water bath 7 autoclave 8 microbiological incubator 9 refrigrator 10 deep fridge 11 colony counter 12 laminar flow chamber 13 bunsen burner 14 micro pipette 15 ph meter 16 brix refractometer 17 uv lamp 18 abbe refractometer 19 soxhlet appartaus 20 muffle furnance 21 kjeldal distillation unit 22 glasswares erienmeyer flask 23 conical flask 24 flat bottom flask 25 tlc plates consumbale 26 separating funnel 27 glassbeaker 28 distillation flask 29 burette 30 petri plates consumbale ...

State Agriculture Marketing Board - Rajasthan

32660485 food testing laboratory in gon mandi yard sohela. hot air oven , drying oven analytical balance distiled water plant , water bath autoclave microbio logical incubator , refrigerator , deep fridge , colony counter , laminar flow chamber bunsen burner micro pipette ph meter brix refractometer uv lamp , abbe refractometer , soxhlet apparatus , muffle furnance , kjeldal distilation unit , erlenmeyer flask , conical flask , flat bottom flask , tlc plates , separating funnel , glass beaker distillation flask , burette petri plates ...

University of Rajasthan - Rajasthan

32589382 supply of chemicals and glasswares at botany department, uor, jaipur chemical items : , ( 10x buffer a with mgcl2 ) minimum pack , 100bp ladder dna minimum pack , 10x tbe 100ml , 2, 3, 5 ttc 50gm , 2, 4, 5t 100mg , 2, 4d 100gm , 2 mercaptoethanol / ? mercaptoethanol 100ml , acetic acid 2.5l , acetic acid 500ml , acetic anhydride500ml , acetocarmine 50ml , acetone2.5l , acetonitrile 500ml , acrylamide 500gm , agar 500gm , agarose 250gm , aluminium chloride 500gm , ammonium acetate 500gm , ammonium ferric citrate 500gm , ammonium molybdate ( tetrahydrate ) 100gm , ammonium molybdate 250gm , ammonium persulphate , ammonium persulphate 100gm , aneline blue 25gm , anthrone reagent 100gm , auxin 50gm , bacillus subtilis bacterial strain / gram positive minimum pack , bap 1gm , basic fuschine 25gm , bioreagent, for molecular biology, low eeo , biotin 1gm , bleaching powder 500gm , bodipy™ 493 / 503 , boric acid 500gm , boric acid powder 500gm , bovine serum albumin 5gm , bromophenol blue 25gm , butanol 500ml , calcium chloride ( fused ) 500gm , calcium chloride dihydrate500gm , calcium nitrate tetrahydrate 500gm , candida albicans fungal strain / nonseptate minimum pack , carbendazim 1gm , casein 500gm , chloroform ( alcohol stabilised ) 500ml , chloroform isoamyl alcohol mixture 500ml , citric acid 500gm , cobalt chloride hexahydrate 100gm , cobalt nitrate hexahydrate 100gm , coomasie brilliant blue g 5gm , coomasie brilliant blue r2505gm , copper sulphate pentahydrate 500gm , copper sulphate.7h2o 500gm , ctab rm 4867 100gm , cupric chloride 500gm , cyanocobalamin ( vitamin b12 ) 250mg , cytokinin 1gm , deionised water 5l , dichloromethane 500ml , diethyl ether 500ml , diethylene glycol dimethyl ether 500ml , dimethyl sulfoxide 500ml , dipotassium hydrogen phosphate 500gm , dipotassium phosphate 500gm , dpph1gm , edta di sodium 100gm , escherchia coli bacterial strain / gram negative minimum pack , ethanol 500ml , ether500ml , ethidium bromide 1gm , ethidium bromide, for molecular biology 1gm , ethyl acetate 500ml , ethylenediaminetetraacetic acid disodium magnesium salt ( edtana2mg ) 100gm , fast green 25gm , ferric ammonium citrate 500gm , ferric chloride hexahydrate 500gm , ferrous sulphate 500gm , ferrous sulphate heptahydrate 500gm , follin &ciocalteus phenol reagent 100ml , formaldehyde 500ml , furfural 500ml , gallic acid 500gm , gibbrellic acid 1gm , glacial acetic acid 500ml , glucose500gm , gluteraldehyde 50ml , glycerol500ml , glycine 250gm , gypsum , hepta decanoic acid 5gm , heptanes 500ml , hplc grade methyl tertiary butyl ether ( mtbe ) 500ml , hydrochloric acid 500ml , iaa 5gm , iba 5gm , iron ( ii ) chloride 500gm , isoamyl alcohol 500ml , isopropanol 500ml , k2hpo4 100gm , kinetin 1gm , lactic acid 500ml , litmus milk 500ml , magnesium chloride tetrahydrate 500gm , magnesium di sodium edta 100gm , magnesium sulphate heptahydrate 500gm , manganese ( ll ) chloride tetrahydrate 500gm , manganese bi chloride 500gm , mannitol 500gm , mercuric chloride 100gm , methanol 500ml , molybdate 100gm , molybdenum trioxide 100gm , monopotassium phosphate 100gm , ms media ( 1l ) , n, n methylene bis acrylamide 25gm , n, n, n, n cetyl trimethyl ammonium bromide, a.r. 500gm , naa 25gm , n hexane 500ml , nile red dye 100mg , nitrate teaching kit minimum pack , nitric acid 500ml , nutrient agar 500gm , nutrient broth 500gm , octane 500gm , ortho phosphoric acid 500ml , osmium tetraoxide 500gm , pentadecanoic acid 1gm , petroleum ether ( 40 60°c ) 500ml , petroleum ether ( 60 80°c ) 500ml , petroleum ether ( 80 100°c ) 500ml , petroleum ether 500ml , phenol 500ml , phosphoric acid 500ml , plant dna isolation kit 1 pack , polyvinylpyrrolidone ( pvp ) k 30 100gm , potassium acetate 500gm , potassium chloride 500gm , potassium hydrogen phosphate 500gm , potassium hydroxide500gm , potassium hydroxide pellets 500gm , potassium mercuric iodide500gm , potassium nitrate 500gm , potassium phosphate dibasic 500gm , potassium sulphate 500gm , pseudomonas aeruginosa minimum pack bacterial strain / gram negative , quercetin 500 mg , rnase a ( dnase free ) 20mg / ml 5ml , rutin 500gm , salt ( nacl ) 500gm , silica gel 500gm , silica gel 60 120 mesh 1000gm , silica gelself indicating 1000gm , sodium bicarbonate 500gm , sodium carbonate 500gm , sodium chloride 500gm , sodium citrate500gm , sodium dodecyl sulphate 100gm , sodium dodecyl sulphate 500gm , sodium edta 100gm , sodium hydroxide 500gm , sodium hydroxide pellets 500gm , sodium hypochlorite 1 l , sodium metasilicate nanohydrate 100gm , sodium metavanadate 100gm , sodium methoxide 500gm , sodium molybdate dihydrate 250gm , sodium molybdate100gm , sodium nitrate 500gm , sodium nitrite 500gm , sodium sulphate anhydrous 500gm , sodium tartrate dihydrate 500gm , staphylococcus aureus minimum pack , sulfuric acid 500ml , taq polymerase ( 1 unit / ?l ) 500u , temed 100ml , thiamine hydrochloride 100gm , toluene 500ml , toluidere blue 25gm , trichloro acetic acid 100gm , tris buffer 100gm , tris free base 100gm , tris, free base, for molecular biology 100gm , tris hcl 100gm , triton x100 100ml , vanadyl sulfate10gm , vitamin b1 25gm , vitamin b12 100 mg , yeast extract mannitol ( yem ) 500gm , zeatin 100mg , zinc chloride 500gm , zinc nitrate heptahydrate 500gm , zinc sulphate.7h2o 500gm , ? naphthol 100gm , glassware items : , test tubes ( culture ) , without rim 15ml, 20ml, 25 , 10x tbe , 200c pcr minicoler, 96 places, 0.2 capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 250ml flasks 250ml , autoclave bags , autoclave indicator tape , beaker 1000ml , beaker 100ml , beaker 2000ml , beaker 250ml , beaker 500ml , beaker 50ml , bod bottles 300ml , burettes borollo 50ml , cell spreader 3cm , cover glass 22x22 , culture petri dishess line 100 x 15, 100 x 20, 150 x 25 , eppendorf tubes 2ml , flask1000ml , flask 100ml , flask 2000ml , flask 250ml , glass spreader , flask 500ml , flasks erlenmeyer, conical, narrow mouth 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , funnels 50ml, 100ml , glass rod ( all size ) , glass spreader6 x 150 mm l shaped , inoculating nichrome wire loopwith insulated handle 2mm long, 4mm long , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 25ml , measuring cylinder 50ml , measuring cylinder 5ml , measuring tape ( high quality ) , micro centrifuge tube 1.5ml , micropipette:single channel variable vol pipette and pipette tips 0.2 2 ?l, 0.5 10 ?l, 2 20 ?l, 5 50 ?l, 10 100 ?l , micropipetts ( all size ) , microscopic slides 76 x 26 x 1 , microtip box 200 1000?l , microtips0.5 10 ?l , microtips2 200 ?l , microtips200µl , microtips200 1000?l , microtips5 10 ?l , parafilm 2 wide , petridish ( all size ) , pipette standbox 6 pipette stand with drawer , pipette tips10µl, 50?l, 100?l, 200?l, 1ml , pipettes measuring ( mohr type ) , class a 2ml, 5ml, 10ml, 25ml , quartz cuvetts , reagent bottles ( graduated with screw caps and pouring ring ) 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , reagent bottles amber ( graduated with screw caps and pouring ring ) 100ml, 250ml, 500ml, 1000ml , schott bottles 1000ml , schott bottles 250ml , schott bottles 500ml , screw cap storage bottles 2000ml , separating funnel , spatula ( chattaway spatula, big spoon spatulaone end flat and one end spoon ) , sprayer ( automatic / manual ) , stirrer 7 x 150, 9 x 150 , test tube holder , test tube stand ( plastic, 19 and 25 holes assorted ) , test tubes ( all size ) , tissue papers , tongs beaker tong capicity12 flask tong capicity12 , tubes culture, media, round bottom, with pp screw cap and liner capacity 10, 30, 50 , volumetic flasks 50ml, 100ml 200ml 500ml 1000ml , whatman filter papers round – grade no 1 size 110 mm...

University of Rajasthan - Rajasthan

32582693 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , ( 10x buffer a with mgcl2 ) minimum pack , 100bp ladder dna minimum pack , 10x tbe 100ml , 2, 3, 5 ttc 50gm , 2, 4, 5t 100mg , 2, 4d 100gm , 2 mercaptoethanol / ? mercaptoethanol 100ml , acetic acid 2.5l , acetic acid 500ml , acetic anhydride500ml , acetocarmine 50ml , acetone2.5l , acetonitrile 500ml , acrylamide 500gm , agar 500gm , agarose 250gm , aluminium chloride 500gm , ammonium acetate 500gm , ammonium ferric citrate 500gm , ammonium molybdate ( tetrahydrate ) 100gm , ammonium molybdate 250gm , ammonium persulphate , ammonium persulphate 100gm , aneline blue 25gm , anthrone reagent 100gm , auxin 50gm , bacillus subtilis bacterial strain / gram positive minimum pack , bap 1gm , basic fuschine 25gm , bioreagent, for molecular biology, low eeo , biotin 1gm , bleaching powder 500gm , bodipy™ 493 / 503 , boric acid 500gm , boric acid powder 500gm , bovine serum albumin 5gm , bromophenol blue 25gm , butanol 500ml , calcium chloride ( fused ) 500gm , calcium chloride dihydrate500gm , calcium nitrate tetrahydrate 500gm , candida albicans fungal strain / nonseptate minimum pack , carbendazim 1gm , casein 500gm , chloroform ( alcohol stabilised ) 500ml , chloroform isoamyl alcohol mixture 500ml , citric acid 500gm , cobalt chloride hexahydrate 100gm , cobalt nitrate hexahydrate 100gm , coomasie brilliant blue g 5gm , coomasie brilliant blue r2505gm , copper sulphate pentahydrate 500gm , copper sulphate.7h2o 500gm , ctab rm 4867 100gm , cupric chloride 500gm , cyanocobalamin ( vitamin b12 ) 250mg , cytokinin 1gm , deionised water 5l , dichloromethane 500ml , diethyl ether 500ml , diethylene glycol dimethyl ether 500ml , dimethyl sulfoxide 500ml , dipotassium hydrogen phosphate 500gm , dipotassium phosphate 500gm , dpph1gm , edta di sodium 100gm , escherchia coli bacterial strain / gram negative minimum pack , ethanol 500ml , ether500ml , ethidium bromide 1gm , ethidium bromide, for molecular biology 1gm , ethyl acetate 500ml , ethylenediaminetetraacetic acid disodium magnesium salt ( edtana2mg ) 100gm , fast green 25gm , ferric ammonium citrate 500gm , ferric chloride hexahydrate 500gm , ferrous sulphate 500gm , ferrous sulphate heptahydrate 500gm , follin &ciocalteus phenol reagent 100ml , formaldehyde 500ml , furfural 500ml , gallic acid 500gm , gibbrellic acid 1gm , glacial acetic acid 500ml , glucose500gm , gluteraldehyde 50ml , glycerol500ml , glycine 250gm , gypsum , hepta decanoic acid 5gm , heptanes 500ml , hplc grade methyl tertiary butyl ether ( mtbe ) 500ml , hydrochloric acid 500ml , iaa 5gm , iba 5gm , iron ( ii ) chloride 500gm , isoamyl alcohol 500ml , isopropanol 500ml , k2hpo4 100gm , kinetin 1gm , lactic acid 500ml , litmus milk 500ml , magnesium chloride tetrahydrate 500gm , magnesium di sodium edta 100gm , magnesium sulphate heptahydrate 500gm , manganese ( ll ) chloride tetrahydrate 500gm , manganese bi chloride 500gm , mannitol 500gm , mercuric chloride 100gm , methanol 500ml , molybdate 100gm , molybdenum trioxide 100gm , monopotassium phosphate 100gm , ms media ( 1l ) , n, n methylene bis acrylamide 25gm , n, n, n, n cetyl trimethyl ammonium bromide, a.r. 500gm , naa 25gm , n hexane 500ml , nile red dye 100mg , nitrate teaching kit minimum pack , nitric acid 500ml , nutrient agar 500gm , nutrient broth 500gm , octane 500gm , ortho phosphoric acid 500ml , osmium tetraoxide 500gm , pentadecanoic acid 1gm , petroleum ether ( 40 60°c ) 500ml , petroleum ether ( 60 80°c ) 500ml , petroleum ether ( 80 100°c ) 500ml , petroleum ether 500ml , phenol 500ml , phosphoric acid 500ml , plant dna isolation kit 1 pack , polyvinylpyrrolidone ( pvp ) k 30 100gm , potassium acetate 500gm , potassium chloride 500gm , potassium hydrogen phosphate 500gm , potassium hydroxide500gm , potassium hydroxide pellets 500gm , potassium mercuric iodide500gm , potassium nitrate 500gm , potassium phosphate dibasic 500gm , potassium sulphate 500gm , pseudomonas aeruginosa minimum pack bacterial strain / gram negative , quercetin 500 mg , rnase a ( dnase free ) 20mg / ml 5ml , rutin 500gm , salt ( nacl ) 500gm , silica gel 500gm , silica gel 60 120 mesh 1000gm , silica gelself indicating 1000gm , sodium bicarbonate 500gm , sodium carbonate 500gm , sodium chloride 500gm , sodium citrate500gm , sodium dodecyl sulphate 100gm , sodium dodecyl sulphate 500gm , sodium edta 100gm , sodium hydroxide 500gm , sodium hydroxide pellets 500gm , sodium hypochlorite 1 l , sodium metasilicate nanohydrate 100gm , sodium metavanadate 100gm , sodium methoxide 500gm , sodium molybdate dihydrate 250gm , sodium molybdate100gm , sodium nitrate 500gm , sodium nitrite 500gm , sodium sulphate anhydrous 500gm , sodium tartrate dihydrate 500gm , staphylococcus aureus minimum pack , sulfuric acid 500ml , taq polymerase ( 1 unit / ?l ) 500u , temed 100ml , thiamine hydrochloride 100gm , toluene 500ml , toluidere blue 25gm , trichloro acetic acid 100gm , tris buffer 100gm , tris free base 100gm , tris, free base, for molecular biology 100gm , tris hcl 100gm , triton x100 100ml , vanadyl sulfate10gm , vitamin b1 25gm , vitamin b12 100 mg , yeast extract mannitol ( yem ) 500gm , zeatin 100mg , zinc chloride 500gm , zinc nitrate heptahydrate 500gm , zinc sulphate.7h2o 500gm , ? naphthol 100gm , glassware items : , test tubes ( culture ) , without rim 15ml, 20ml, 25 , 10x tbe , 200c pcr minicoler, 96 places, 0.2 capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 200cminicoler with gel filled cover 32 places, 1.5 ml capacity , 250ml flasks 250ml , autoclave bags , autoclave indicator tape , beaker 1000ml , beaker 100ml , beaker 2000ml , beaker 250ml , beaker 500ml , beaker 50ml , bod bottles 300ml , burettes borollo 50ml , cell spreader 3cm , cover glass 22x22 , culture petri dishess line 100 x 15, 100 x 20, 150 x 25 , eppendorf tubes 2ml , flask1000ml , flask 100ml , flask 2000ml , flask 250ml , glass spreader , flask 500ml , flasks erlenmeyer, conical, narrow mouth 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , funnels 50ml, 100ml , glass rod ( all size ) , glass spreader6 x 150 mm l shaped , inoculating nichrome wire loopwith insulated handle 2mm long, 4mm long , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 25ml , measuring cylinder 50ml , measuring cylinder 5ml , measuring tape ( high quality ) , micro centrifuge tube 1.5ml , micropipette:single channel variable vol pipette and pipette tips 0.2 2 ?l, 0.5 10 ?l, 2 20 ?l, 5 50 ?l, 10 100 ?l , micropipetts ( all size ) , microscopic slides 76 x 26 x 1 , microtip box 200 1000?l , microtips0.5 10 ?l , microtips2 200 ?l , microtips200µl , microtips200 1000?l , microtips5 10 ?l , parafilm 2 wide , petridish ( all size ) , pipette standbox 6 pipette stand with drawer , pipette tips10µl, 50?l, 100?l, 200?l, 1ml , pipettes measuring ( mohr type ) , class a 2ml, 5ml, 10ml, 25ml , quartz cuvetts , reagent bottles ( graduated with screw caps and pouring ring ) 50ml, 100ml, 250ml, 500ml, 1000ml, 2000ml , reagent bottles amber ( graduated with screw caps and pouring ring ) 100ml, 250ml, 500ml, 1000ml , schott bottles 1000ml , schott bottles 250ml , schott bottles 500ml , screw cap storage bottles 2000ml , separating funnel , spatula ( chattaway spatula, big spoon spatulaone end flat and one end spoon ) , sprayer ( automatic / manual ) , stirrer 7 x 150, 9 x 150 , test tube holder , test tube stand ( plastic, 19 and 25 holes assorted ) , test tubes ( all size ) , tissue papers , tongs beaker tong capicity12 flask tong capicity12 , tubes culture, media, round bottom, with pp screw cap and liner capacity 10, 30, 50 , volumetic flasks 50ml, 100ml 200ml 500ml 1000ml , whatman filter papers round – grade no 1 size 110 mm...

National Institute Of Ayurveda - Rajasthan

32548700 rate contract for surgical items rate contract for surgical items , injection : , inj.n.s. 100ml , inj.n.s. 500ml , inj. dns 500 ml , inj.d5% 500ml , inj. d 10% 500 ml , inj. d 25% 100 ml , inj.rl 500ml , inj dexa , inj genta , inj piloearpine , inj adrenaline ( 1 ml ) ( 1x50 ampuls ) , inj.xylocaine2%withadrenaline , inj.xylocaine2% ( lox ) , inj. anawin heavy ( bupivacaine ) , inj. lox heavy ( lignocaine ) , inj atropine ( 1x50 ampuls ) , inj. dexona ( dexamethasone ) , inj.avil ( pheniraminemaleate ) , inj.thiopentone ( thiopentalsodium ) 0.5gm , inj.succinylcholine ( sueol ) , inj.perinorn2m ( metoclopramide ) , inj.emeset2ml ( ondansetron ) , inj.rantac2ml ( ranitidine ) , inj.ketamine5ml , inj.t.t.5ml ( inj. tetanus toxide 0.5ml ) , inj.neostigmine 1ml , inj.atracuriumbesylate 10ml , inj.midazolam 10ml.10mg , inj.dynapar 1ml / ( diclofenec ) , inj.gentamycin 2ml 80 mg , inj.maczone plus 1.5gms / ( ceftrixone + salbectam ) , inj.tramadol2ml , inj. vit. k , inj. deriphyllin , inj. hydrocort / ( hydrocortisone ) , inj. lasix 2ml ( furosemide ) , inj. paracetamol ( 150 mg ) , inj. buscopan ( hyoscine ) , inj. tranexa 5ml ( tranexamic ) , inj. magnesium sulphate 50% 2ml , inj. hydrocortison , inj. metrogyl 100ml , inj. ketamin / aneket vial , inj. haemaccel 500 ml , inj. labetatol , inj. carbetocin , inj. perinorm / metoclopramide 2ml , inj. epidosin , inj. drotin , inj. phenargan , inj. carboprost , inj. fevastin / neomol , inj. betnesol , inj. amikacin 2ml 500 mg , inj. dexomethosne , inj. kaplin 10mg , inj. botropase , inj. iron sucrose , sterile water 10ml , sterile water 5ml , sepguard 100ml , halothane liquid 250ml , mannitol 100ml , povidine iodine 7.5% ( 500ml ) , povidine iodine 10% ( 100ml ) , povidine iodine 5% ( 100ml ) , solution asthalin 15ml , omnipaque dye 50ml , abgel foam , betadine ointment 250gm , inj. methergin , xylocaine jelly 2% 50gm , pc enema 100ml , justin suppository 25mg , betadine 5% 1 ltr , xylocaine jelly 2% 50gm , tablet : , tab. paracetamol ( 500 mg ) , tab. ranitidine ( 150 mg ) , tab. meftal spas ( 1x10 ) , tab. sorbitrat , cap. nicardia 5mg , tab. formaline ( 100 pcs ) , items ( suture ) : , barbours thread surgical linen no. 20 , barbours thread surgical linen no. 40 , chromic catgut 1.1 ( 110cm45mm needle ) 2crb , chromic catgut 1.1 ( 40mm needle ) 2crb , chromic catgut 0.0 ( zero ) 2crb , chromic catgut 1.0 ( 110cm45mm needle ) 1 / 2crb , chromic catgut 2.0 1 / 2crb , chromic catgut 3.01 / 2crb , vicryl no. 0.0 ( zero ) , vicryl no. 1.0 ( 110cm45mmneedle ) , vicryl no. 1.1 ( 110cm45mmneedle ) , vicryl no. 1 0 / 2crb , vicryl no. 1 1 / 2crb , vicryl 2.0 round body 1 / 2 crb , vicryl 3.0 1 / 2 crb , monocryl suture 3 0 with needle , prolene no. 1 , prolene no. 1 , prolene no. 1.0 , prolene 2.0 , monoglyde 3.0 , ethilono 1 3 / 8 cce , ethilono 1.0 3 / 8 cce , ethilono 2.0 3 / 8 cce , ethilono 3.0 3 / 8 cce , surgical sature 4.0 , surgical sature 5.0 , surgical sature 8.0 , surgical sature 10.0 , surgical items : , n 95 , surgical masks 3 layers , clinical surgical spirit 5 ltr , hand sanitizer 5 ltr , surgical gloves ( sterile+ packed ) 6 no. , surgical gloves ( sterile+ packed ) 6.5 no. , surgical gloves ( sterile+ packed ) 7 no. , surgical gloves ( sterile+ packed ) 7.5 no. , examination gloves ( latex ) small size , examination gloves ( latex ) medium size , examination gloves ( latex ) large size , surgical gowns ( green cloth ) , patient ot gown ( disposable ) ( size standard ) , surgical caps , surgical absorbant cotton ( 500gm ) , cotton roll 500gms , cotton roll bandages 15cmx3mtr. ( deluxe ) , cotton roll bandages 10cmx3mtr. ( deluxe ) , cotton roll bandages 5cmx3mtr. ( deluxe ) , soft roll 15cmx3mtr , soft rolll 10cm x 3 mtr , surgical gauze cloth ( than ) 90cmx180mtr. ( deluxe ) , surgical gauze piece 10cmx10cmx8ply , surgical gauze piece 2inchx2inch , pop bandages 15cmx2.7 mtr , pop bandages 10cmx2.7 mtr , disposable syringes with hypodermic needles 1ml , disposable syringes with hypodermic needles 2ml , disposable syringes with hypodermic needles 5ml , disposable syringes with hypodermic needles 10ml , disposable syringes with hypodermic needles 50ml , disposable hypodermic needles 18no. , disposable hypodermic needles 20no. , disposable hypodermic needles 22no. , disposable hypodermic needles 24no. , disposable hypodermic needles 25 no. , disposable hypodermic needles 26no. , iv cannula 20 no. , iv cannula 22 no. , iv cannula 18 no. , iv cannula three way 20 no. , iv sets , uro bags standard , folleys catheter 18 , folleys catheter 16 , folleys adaptors ( standard size ) , ultrasound jelly , paper tape 2.5 cm x 9 mtr , paper tape 5 cm x 9 mtr , paper tape 7.5 cm x 9 mtr , paper tape 10 cm x 9 mtr , ampule cutter , disposable needle cutter ( electric ) , elastic band tourniques adjustable free size , k 90 size f.c. 14 ( urethral catheter ) , surgical blade no. 24 , surgical blade no.15 , surgical blade no.11 , surgical needles cutting edge 1 / 2 circle no. 10 , surgical needles cutting edge 1 / 2 circle no. 08 , surgical needles cutting edge 1 / 2 circle no. 06 , surgical needles round body 1 / 2 circle no. 08 , plastic box 8x10 , plastic containers 500gm , disposable suction tube with tip , abdominal drainage kit no. 12 , ryles tube 16 no. , infant feeding tubes 6 no. , infant feeding tubes 8 no. , endotracheal tube ( disposable ) 3mm , endotracheal tube ( disposable ) 3.5mm , endotracheal tube ( disposable ) 6mm , endotracheal tube ( disposable ) 6.5mm , endotracheal tube ( disposable ) 7mm , spinal needle 25 no. , mops sponge cotton 25x25x12 ply ( with x ray ) , mops sponge cotton 30x30x12 ply ( with x ray ) , macintosh sheet ( 1 roll=20mtr. ) , plastic aprons standard , hernia kit with polypropylene mesh suze 4x6 with polypropylene sutures 1 0, polypropylene sutures 2 0, polygalectin 1 0, sounds closure suture material preferred monoglide or nylon. , surgical cautery pencil unipolar , blood transfusion set ( bt set ) adult , blood transfusion set ( bt set ) paediatric , iv cannula 20g triway pink , eye drap sheet 100 cm x 120 cm , trolley sheet 100 cm x 200 cm ( preferably green & blue ) , steel drum medium size for autoclave , pulse oxymeter ( monitor ) , peak flow meter , pocket mask adult , pocket mask child , ecg jelly 5ltr , ecg paper ( cardiart 9108 d ) , mouth piece for spirometry , miscellaneous items : , lyzol solution for pharmacy grade , formaline liquid 5ltr , hydrogen peroxide 400 ml , anticeptic liquid 1 ltr , hypochlorite solution 5% 5 ltr , anticeptic handwash 5 ltr , anticeptic soaps 125 gm , anticeptic liquid 1 ltr , surf washing powder ( dit. ) , slipper ( ot m / f ) , printer ink ( espon bonus hitman 774 ) ...