University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Sms Medical College - Rajasthan

33641597 rate contract for disposable and glassware and consumable and miscellaneous items ( nit 48 ) i. aluminium foil — 2. autoclavable borosil screw capped tubes 5ml 3. autoclavable borosil screw capped tubes1 omm 4. autoclavable petridish sample required 5. disposable gloves ( non sterile in pack of 25 to 50 pairs ) b a ) size 6.5 b ) size 7 c ) size 7.5 d ) size 8 6. centrifuge plastic test tubes with cap sterile 4, ’ 7. coplin jar with lid ( rectangular pvc ) 8. sterile disposable, polystyrene, optically clear, petridishes 9omm x15mm ( 4” ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment z aa £ 9. sterile disposable swab sticks individual ipacked size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expjry sample required to be supplied in installment_ 10. sterile disposable swab st1ck wth test tubes individually packed size ( 150 mmx 12mm ) , sterulized by gamma radlation with date of manufacture & exp1ry sample required 11. sample racks ( 96 slois / rack ) 12x75 mm tube 12. disposable stool sample coniainer with spatula 13. plastic discard container with lid and sieve 14. disposable autoclave bag a ) red 30l b ) yellow30l 15. transparentbag30l a ) red _15l b ) yellow.i5mlb 16. c ) transparent bag 15 l 17. disposable bag a. ) black 30l plastic basket ( jali ) autoclavable—small 18. a ) medium 7”x7”x7” b ) large 9”x9”x9” 19. 20. plastic pipe for water supply / 2 inch plastic trays i y2’ xi wx 6” 21. i plastic trays for reagent bottles 22. plastic dropper a ) b ) big 23. tissue paper rolls 100 meter 24. tie 8” long for lying plastic bags — 25. syringe needle sterile disposable . _... a ) 10ml b ) 2nml — c ) 5ml 26. disposable test tube with screw cap and label, individually packed, sterilized by gamma radiation with date of manufacture & expiry _.... sample require! ) a ) 1onmlr _ b ) 5ml — 27. steriledisposa [ 3le container wide mouth individually packed supplied in installment ( for sputum, urine ) without spoon 30 ml self standmng, sterilized by gamma radiation — 28. test tube stand 29. microtitre polystyrene plate of 96 round bottom wells with lid, individually packed sterilized by gamma radiation with date of manufacture & expiry sample required 30. nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plast1c shaft with breakable point about .._. i5cmnlong !—m 31. plain vial for blood collection 5ml — 32.. microcentrifuge tube ( 1.8 ml molecular biology grade ) 33. tooth pick...

Medical College - Rajasthan

33634349 rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department , a. disposable items , aluminium foil , autoclavable borosil screw capped tubes 5ml , autoclavable borosil screw capped tubes 10ml , autoclavable petridish sample required , disposable gloves ( non sterile in pack of 25 to 50 pairs ) , a ) size 6.5 , b ) size 7 , c ) size 7.5 , d ) size 8 , centrifuge plastic test tubes with cap sterile4” , coplin jar with lid ( rectangular pvc ) , sterile disposable, polystyrene, optically clear, petridishes 90mm x15mm ( 4 ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab sticks individual packed size ( 150 mmx 12mm ) , sterilized by gamma radiationwith date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab stick wth test tubes individually packed size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expiry sample required , sample racks ( 96 slots / rack ) 12x75 mm tube , disposable stool sample container with spatula , plastic discard container with lid and sieve , disposable autoclave bag , a ) red30 l , b ) yellow 30 l , transparent bag 30l , a ) red15 l , b ) yellow 15 l , c ) transparent bag 15 l , disposable bag , a. ) black 30l , plastic basket ( jali ) autoclavable—small , a ) medium 7”x7”x7” , b ) large 9”x9”x9” , plastic pipe for water supply ½ inch , plastic trays 1 ½’ x1 ½’x 6” , plastic trays for reagent bottles , plastic dropper , a ) small , b ) big , tissue paper rolls 100 meter , tie 8” long for lying plastic bags , syringe needle sterile disposable , a ) 10 ml , b ) 2 ml , c ) 5 ml , disposable test tube with screw cap and label, individually packed , sterilized by gamma radiationwith date of manufacture & expiry sample required , a ) 10 ml , b ) 5 ml , steriledisposable container wide mouth individually packedsupplied in installment ( for sputum, urine ) without spoon 30 ml self standing, sterilized by gamma radiation , test tube stand , a ) 6” , b ) 4” , microtitre polystyrene plate of 96 round bottom wells with lid , individually packedsterilized by gamma radiationwith date of manufacture & expiry sample required , nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plastic shaft with breakable point about 15 cm long , plain vial for blood collection 5ml , microcentrifuge tube ( 1.8 ml molecular biology grade ) , tooth pick , b. glassware items , borosilicate glass cover slips, size 22x22mm no.0 10gms x 26100pkt , durhams tube ( 2cm ) , dark brown reagent dropping bottle with glass deopper and rubber treat 125ml borosil , dark brown reagent bottle with screwcap 250ml , dark brown reagent bottle with screwcap 1 liter , flask conical flat bottom ( long neck ) with graduation ( borosilicate ) , a ) 5000ml , b ) 2000ml , c ) 3000ml , d ) 1000ml , e ) 500 ml , f ) 250 ml , g ) 100ml , cell culture flasks ( 25 ml ) , ( treated, sterile, vented ) with filter cap 25cm , glass funnel8” , glass funnel 3” , glass rods , glass sheet , glass slides , thermometer digital with probe ( 0 100° c ) , ( 0 200° c ) , ( 20° to 10° ) , ( 80° ) , glass beakerborosilicate , a ) 500 ml , b ) 250 ml , reagent storage bottle borosilicate , a ) 2 ltr , b ) 1 ltr. , c ) 500ml , blue cap glass bottles autoclavable borosilicate , a. ) 1000ml , b. ) 500 ml , c. ) 250 ml , d. ) 100 ml , test tube glass round bottom without rim borosilicate , a ) 18x150mm , b ) 15x125mm , c ) 12x100mm , d ) 12x75mm , e ) 150x15mm , test tube glass 10 ml screw capped , glass measuring cylinder borosilicate , a ) 500ml , b ) 1000 ml , c ) 250 ml , d ) 100 ml , e ) 50 ml , glass beads , glass beads , borosilicate screw cap glass bottle , borosilicate screw cap glass bottle , glass petridish 90mm borosilicate , c. consumable items , micropipette tips with filter , a. ) 10?l ( 96×10 ) , b. ) 20 ?l ( 96×10 ) , c. ) 100 ?l ( 96×10 ) , d. ) 200 ?l ( 96×10 ) , e. ) 300 ?l ( 96×10 ) , f. ) 1000 ?l ( 96×10 ) , disposablemicropipette tips without filter 100 ?l , sterile micropipette tips without filter 10 ?l , bar code stickers fot bactrology , eppendorf tubes 0.6 ml , eppendorf tubes 1.5 ml , eppendorf tubes 2 ml , 0.2 ml 8 pcr tube strips with cap , n 95 mask niosh certified , surgical triple layer mask , bamboo stick , wipes , ppe kit , gown , a. ) small , b. ) medium , c. ) large , d. ) xl , disposable gowns back open blue , disposable gowns back open white , disposable plastic lab coat ( m ) , disposable plastic lab coat ( l ) , disposable plastic lab coat ( xl ) , plastic disposable forceps , forceps ss 5 inch. , gloves nitrile powder free small , gloves medium nitrile powder free 6.5 size , gloves large nitrile powder free 7 size , shoe cover knee length , head cap , indicator tapesteam autoclavable , b. stearothermophilus ( no. of spores per strip 10 6 ) for steam sterilization at 1150c indicator tape ( autoclave ) , b. atrophaeus ( no.of spores indicator tape ( hot air oven ) , sanitizer ( 500ml ) with dispenser , falcon tube 50ml sterile , falcon tube 15mlsterile , screw capped cryo vial 1.5ml , screw capped cryo vial 2ml , screw capped cryo vial 1.8ml , screw cap storage vials 1.8ml , screw cap plain tube ( 12x75 mm ) , plain tube ( riya tube ) for sample dilution , plain sample collection tube 5ml double cap with clot activator , edta tube 5ml double cap , assay cups , assay tips , assay samplecups , gauze than , vaccutainerclot / edta / flouride / citrate / heparin , vaccutainer needle , parasep solvent free faecal parasitic concentrator , vtm with two swabs , zip lockbags size 8x4 , barcode sticker for hbv & hcv viral load and bacteriology , wash reagent , spray bottles , manualmicropipette variable volume autoclavable , a. ) 1 10 ?l , b. ) 0.5 10 ?l single channel , c. ) 10 100 ?l single channel , d. ) 5 50 ?l single channel , e. ) 50 200 2 200 ?l single channel , f. ) 100 1000 ?l single channel , g. ) 2 20 ?l multi channel 8 channel , h. ) 10 100 ?l multi channel 8 channel , discarding jars , abi real time pcr fastrctn tubes ( 8 tubes / strips ) each 0.1 ml , abi real time pcrfast rctn tubes ( 8 tubes / strips ) each 0.2 ml , abi fg optical caps for rtpcr ( 8 caps / strips ) each , pcr rack with cover , plastic racks ( 24 tubes racks ) , plastic racks ( 48 tubes racks ) , tough tags for ampoules 1.5 ml , cell culture plates ( 6 well ) ( tissue culture treated, sterile ) , abi sequencing plates ( 10 plates / pk ) , , abi adhesive covers for pcr plate ( 100 pcs ) , , ppe ( jump suits ) , serological pipette 5ml ( filter, sterile ) , u bottom microtitter plates , coolbox , pippette stands , mini coooler 20° for 1.5 ml tube ( 12 place ) , mini coooler 20° for 1.5 ml tube ( 48 place ) 32place , d. miscellaneous items , cotton roll 500 gms , cryovials racks , cryovial boxes , cryovial labels , gas burner, labortary vertical withcontrol knob , match box , washing brush for cleaning test tube , a ) 4 , b ) 6 , c ) 8 , regulator for gas , dustbin with lid and foot operated , a ) black colour , b ) blue colour , c. ) red colour , d. ) yellow colour , e. ) green colour , gas lighter , teasing needle , surgical blades no 22 sterile packed , scalpel & blade , thread rolls , flit pump , waste paper basket , nichrome wire 18 gauge , nichrome wire 21 gauge , aluminium tray with partition 12x18x4inch , jute thread for tying bundle , nichrome wire loop diameter 1.3 mm, double wound, caliberated to 1 ul ( .001 ml ) ( pack of 10 loop each ) , wire loop holder , readymade assorted loops 5 pack x 10 loops each , dustbin with perforated basket inside with lid ( 2 liter ) , dustbin with perforated basket inside with lid ( 15 liter ) , antibioticc zone measuring scale370x65 mm , spirit lamp cotton wick , spirit lamps , spotting sheet ( white paper ) , thermometer 0 to 1000c ( digital ) , thermometer 0 to 2000c ( digital ) , thermometer 200 c to 100 c ( digital ) , thermometer 800 c to 100 c ( digital ) , plastic slide box 4”x12” , slide tray ( metal ) , syringe filter 33 mm , syringe filter 10 ( 25mm diameter ) himedia 0.2mm filter for cell culture , falcon racks 50ml , falcon racks 15ml , parafilm roll...

Jawaharlal Nehru Medical College - Rajasthan

33551774 supply of micro lab items kits chemical reagent glassware 1 microbiology lab reagents / kits / chemical / glassware / polyware etc items year 2022 24 2 10% lactic acid solution 3 aerosol free tips 10 μl 4 aerosol free tips 20 μl 5 aerosol free tips 100 μl 6 aerosol free tips 200 μl 7 aerosol free tips 1000 μl ( 1x96 ) 8 agar agar media 9 agininine 10 albert stain a 125ml 11 albert stain b 125 ml 12 albert’s metachromatic stains kit 125 ml 13 alkaline peptone 14 aluminium foil 15 amikacin dose 30mcg 16 amino acid disc 17 amoxyclav 20 / 10mcg 18 ampicillin 10mcg 19 ampicillin / sulbactam 10 / 10mcg 20 ascospore agar 500 gm 21 autoclavable specimen bag ( yellow and red color beg ) 22x30 22 aztreonam 30mcg 23 azithromycin 15mcg 24 bacitracin 10 units 25 bhi supplemented w / 0.05% sps 20ml 26 bhi supplemented w / 0.05% sps 70ml 27 bile esculin hivegtm agar base / 100 gm / 500gm 28 bird seed agar 100 gm 29 bromocresol purple blue 500 gm 30 buffered glucose hivegtm broth 500gm 31 buffer hiveg tm peptone water 32 carbenicillin 100mcg 33 carbogen rpr 34 cefepime 30mcg 35 cefixime 10mcg 36 cefoperazone 75mcg 37 cefoperazone / sulbactam 75 / 10mcg 38 cefotaxime 30mcg 39 cefoxitin 30mcg. 40 cefoxitin cloxacillin 30 / 200 mcg. 41 ceftazidime 30 mcg 42 ceftazidime / clavulanic acid 30 / 10 mcg 43 ceftriaxone 30 mcg 44 cefuroxime 30 mcg 45 cephalothin 30mcg 46 chloramphenicol 30mcg 47 chocolate agar plate 1x50 48 ciprofloxacin 30mcg. 49 cled agar powder 50 cled agar w / browothymol blue plate 1x50 51 clindamycin 2mcg 52 colistin sulphate10mcg 53 cooked meat medium 54 corn meal agar 500gm 55 co trimoxazole 25mcg. 56 cryotubes ( 1.8 ml ) 57 cysteine tellurite agar base 500 gm 58 czapexdox agar ( granulated ) 500gm 59 dengue ns1 ( elisa ) 1x96 60 dengue igm ( elisa ) 1x96 61 deoxycholate citrate agar, hivegtm 500gm 62 dermato supplement 5vl 63 dermatophyte test media 500gm 64 dimethyl amino benzaldehyde anhydrous 100gm 65 dises for carbohydrate fermentation test dises 66 disposable loops carbohydrate 5x100 67 disposable wire 5x100 68 doxycycline hydrochloride 30mcg 69 erythromycin 15mcg 70 ethanol 500ml 71 filter paper rim 46 x 57 cm 72 ferric chloride 1x500 gm 73 fluconazole 25mcg. 74 gentamicin 10mcg 75 gentamicin disc 120 mcg. 76 grams stain kit 100 ml 77 hand sanitizer 500 ml ( pump / spray ) 78 haemoglobin powder 50 gm, 79 h2 o2 ( hydrogen peroxide ( 3% ) 500 ml ) 80 hbsag hbs ag 81 hcv tridot 1x100 82 hiv combaids rs advantage 1x96 83 hiv tridot 84 hi culture transport swab w / amies medium w / charcoal 85 hi mrsa tm confirmation agar base 500 gm 86 hydrochloric acid 87 imipenem 10 mcg 88 imipenem etda 10 / 750mcg 89 iodine resembled 500 gm 90 iso amyl alcohol 91 isopropyl alcohol 500 ml 92 lysine 100 gm 93 maccartney bottle screw tight 30 ml 94 macconkey agar 500 gm 95 malachite green powder 500 gm 96 malt extract agar base 500 gm 97 mannitol salt hiveg tm agar base 100 / 500gm 98 mc farland standard set 10 ml 99 medium 10 wilson and blairs bbs agar 100 meropenem 10mcg 101 methanol 500ml 102 microcentrifuge tube ( 1.5 ml ) 103 microscopic cover glass 22x50mm 10gm no. 01 104 micro cover glass square 20mm x 20 mm 105 micro slide 75 mm x 25mm ( 1x50 ) 106 micropipette variable volume range 100 1000ul 107 micropipette variable volume range 5 50ul 108 molecular grade ethanol 109 mr vp hiveg tm medium 2x100 110 nitrate discs 111 iso propyl alcohol 112 screw cap vial 2 ml 113 microcentrifuge tubes 1.5 ml 114 glass slide 115 spirit 500ml 116 pcr plates compatable to biorad cfx96 with sealing film 1x50 117 8 well strips 0.1 mlwith caps 1x120 118 tissue paper rolls 119 kiwipes lint free tissue paper 120 pipette variable volume 0.5 10μl 121 pipette variable volume 1 20μl 122 pipette variable volume 10 100μl 123 pipette variable volume 100 1000μl 124 multi channel pipette 8 channel 5μl 50μl 125 multi channel pipette 8 channel 30 μl 300μl 126 multi channel pipette 8 channel 100μl 1250μl 127 reagent trough v shape for multi channel pipette 128 viral transport media with swab 129 rt pcr kit swine flu ( h1n1 ) 130 reagent trough v shape for multi channel 100 131 moeller decor boxy lase hiveg broth base 132 mueller hinton hivegtm agar no. 2 500gm 133 nafcillin 30mcg 134 nutrient agar 500gm 135 nutrient broth 500 gm 136 nutrient hivegtm agar no. 02 500gm 137 of basal media 138 onpg 150 mcg 139 optochin ( 5mcg ) 140 ornithine 141 oxacillin 1mcg 142 oxacillin sodium salt monohydrate 5gm 143 parafilm m250 144 penicillin g 10 units disc 145 phenylanine agar 100gm 146 phenol red base 147 piperacillin / tazobactam30 / 6mcg 148 pipette tips, yellow 250 ml 149 plain vials 100 pc 150 polymyxin –b 100 unit 151 potassium hydroxide pallets 152 potassium dichromate 15x500 gm 500gm 153 potassium tillurite 1% ( 1ml / v ) 25 vials 5 / 25 ml 154 potassium dihydrogen phosphate anhydrous 155 potato dextrose agar 500 gm 156 polyester wipes 1x50 157 rhelax aslo 1x100 158 rhelax crp 1x100 159 rhelax rf 1x100 160 roberston cooked meat media 500gm 161 sabouraud dextrose agar 500 gm 162 sabouraud dextrose agar with chloramphenicol 500gm 163 sabouraud dextrose agar with chloramphenicol & cyclohexamide 100gm 164 sabouraud dextrose broth 500 gm 165 screw cap tubes with ‘o’ ring 166 scrub typhus igm ( elisa ) 1x96 167 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 168 selenite f broth ( t ) 169 sheep blood agar plate 1x50 170 spirit lamp 171 simmons critrate agar 100gm 172 sodium hypochlorite 4% 5lts. 173 sodium hypochlorite 5% 5lts. 174 sterile disposable petri plates 120 mm 175 sterile disposable petri plates 90 mm 176 sterile micro tube 2 ml with looped screw 177 sterile screw cap 10 ml 178 straight wire 179 syringe driven filter mse 180 stool o / b 181 sulphuric acid conc 500 ml 182 swab applicator in tube, plastic ( sterilized ) 5 or 6 individual pack 183 swab applicator plastic ( sterilized ) 6 individual pack 184 tcbs hiveg tm agar ( selective ) 500 gm 185 teicoplanin 30mcg 186 thermo rolls pack 187 tigecycline 15ml g 188 tissue paper rolls 189 tobramycine 10 ml g 190 triple sugar iron hivegtm agar 100gm 191 upt ( device / card ) test 1x100 192 urea hiveg tm agar 100 gm 193 urine / stool sample collection container made with nontoxic polypropylene. cap. 35ml. with screw cap. air tight 194 vancomycin 30mcg 195 vitamino growth supplements 5 vials 196 voriconazole vrc 25 ugm mlg 1x100 197 widal slide / tube 1x100 198 96 well microplate 1x50 199 96 well microplate certified to contain 0.005 eu / ml 1x100 200 xld hiveg tm agar 500 gm 201 xylene sulphur free 250 ml 202 zn stain solution 100 ml / 500 ml 203 platelia aspergillus ag ( bio rad ) 204 fungitell1, 3 beta d glucan ( fungitell kit ) 205 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

District Hospital - Rajasthan

33545252 supply of kits, chemical, reagents, glassware items 1 m1 10% lactic acid solution 2 m2 aerosol free tips 10 pl 3 m3 aerosol free tips 20 pl 4 m4 aerosol free tips 100 pl 5 ms aerosol free tips 200 pl 6 m6 aerosol free tips 1000 pl ( 1x96 ) 7 m7 agar agar media 8 m8. agininine albert stain a 125m1 9 m9 10 m10 albert stain 8 125 ml 11 m11 alberts metachromatic stains kit 12s ml 12 mu alkaline peptone 13 m13 aluminium foil 14 m14 amikacin dose 30mcg 15 m15 amino acid disc 16 m16 amoxyclav 20 / 10mcg 17 m17 ampicillin 10mcg 18 m18 ampicillin / sulbactam 10 / 10mcg 19 m19 ascospore agar soo gm 20 m20 autoclavable specimen bag ( yellow and red color bag; 22x30* 21 m21 aztreonam 30mcg 22 m22 azithromycln 15mcg 23 m23 bacitracin 10 units 24 m24 bill supplemented w / 0.05% sps 20m1 25 m25 bill supplemented w / 0.05% sps 70m1 26 m26 bile esculin hivegtm agar base / 100 gm / 500gm 27 m27 bird seed agar 100 gm 28 m28 bromocreso! purple blue soo gm 29 m29 buffered glucose hivegtm broth 500gm 30 m30 buffer hiveg tm peptone water 31 m31 ca rbenicillin 100mcg 32 m32 ca rbogen rpr 33 m33 cefepime 30mcg 34 m34 cefixime l0mcg 35 m35 cefoperazone 75mcg 36 m36 cefoperazone / sulbactam 75 / 10mcg 37 m37 ccfotaxime 30mcg 38 m38 cefoxitin 3omcg. 39 m39 cefoxitin cloxacillin 30 / 200 mcg. 40 m40 ceftazidime 30 mcg 41 m41 ceftazidime / clavulanic acid 30 / 10 mcg 42 ceftriaxone 30 mcg v. i. , 43 m43 cefuroxime 30 mcg 44 m44 ce halothm 30mc 45 m45 chloramphenicol 30mcg 46 m46 chocolate agar plate 1x50 47 m47 ciprofloxacin 30mcg 48 ma cled agar powder 49 m49 cled agar w / browothymol blue plate imo 50 m50 clindamycin 2mcg 51 m51 colistin sulphatelomcg 52 m52 cooked meat medium 53 m53 corn meal agar 500gm 54 m54 co trimoxazole 25mcg. 55 m55 cryotubes ( l8 ml ) 56 m56 cysceine tellurite agar base 500 gm 57 m57 czapexdox agar ( granulated ) 500gni 58 m58 dengue ns1 ( elisa ) 1x96 59 m59 dengue igm ( ehsa ) 1x96 60 m60 deoxycholate citrate agar, ilivegtm 500gm 61 m61 dermato supplement svl 62 m62 dermatophyte test media 500gm 63 m63 dimethyl amino benzaldehyde anhydrous 100gm 64 m64 dises for carbohydrate fermentation test dises 65 m65 disposable loops carbohydrate 5x100 66 m66 disposable wire 5x100 67 m67 doxycycline hydrochloride 30mcg 68 m68 erythromycin 15incit 69 m69 ethanol 500m1 70 m70 filter paper rim 46 x 57 cm 71 m71 ferric chloride lx500 gm 72 m72 fluconazole 25mcg. 73 m73 gentamicin 10mcg 74 m74 gentamicin disc 120 mcg. 75 m75 grams stain kr 100 ml 76 m76 hand sanitizer 500 ml ( pump / spray ) 77 m77 haemoglobin powder 50 gin, 78 m78 h2 02 ( hydrogen peroxide ( 3% ) 500 ml ) 79 m79 hbsag hbs ag 80 m80 hcv tridot 1x100 81 m81 hiv combalds rs advantage 1x96 82 m82 hiv tridot 83 m83 hi culture transport swab w / amies medium w / charcoal 84 m84 hi mrsa tm confirmation agar base 500 gm 85 m85 hydrochloric acid 86 m86 lmipenem 10 mcg 87 m87 imipenem vida 10 / 750mcg 88 m88 iodine resembled 500 gm 89 m89 iso amyl alcohol 90 m90 isopropyl alcohol soo ml 91 m91 lysine 100 gm a_ 92 m92 maccartney bottle screw tight 30 ml 93 m93 mact:onkey agar sod gm 94 m94 malachite green powder 500 gm 95 m95 malt extract agar base 500 gm 96 m96 mannitol salt hiveg tm agar base 100 / 500gm 97 m97 mc farland standard set 10 ml 98 m98 medium 10 wilson and b ] alrs bbs agar 99 m99 meropenem lonicg 100 m100 methanol 500m1 101 m101 microcentrifuge tube ( 1.5 ml ) 102 m102 microscopic cover glass 22x5omm 10gm no. 01 103 m103 micro cover glass square 20mm x 20 mm 104 m104 micro slide 75 mm x 25mni ( i x50 ) 105 m105 micropipette variable volume range 100 1000u1 106 m106 micropipette variable volume range 5 50u1 107 m107 molecular grade ethanol 108 m108 mr vp hiveg tm medium 2x100 109 m109 nitrate discs 110 m110 !so propyl alcohol 111 m111 screw cap vial 2 ml 112 m112 microcentrifuge tubes 1s ml, 113 m113 glass slide 114 m114 spirit 500m1 115 m115 pcr plates compatable to blorad cfx96 with sealing bin 1x50 116 m116 8 well strips 0.1 ml with caps 1x120 117 m217 tissue paper rolls 118 m118 kiwipes lint free tissue paper 119 m119 pipette variable volume 0.5 104 120 m120 pipette variable volume 1 204 121 m121 pipette variable volume 10 1000, 122 m122 pipette variable volume 100.10004 multi channel pipette 8 channel 54 5011 123 m123 124 m124 multi channel pipette 8 channel 30 4 300pl 125 m125 multi channel pipette 8 channel 100pl 12504 126 m126 reagent trough v shape for multi channel pipette 127 m127 viral transport media with swab 12.8 m128 rt pcr kit swine flu ( 111n1 ) 129 m129 reagent trough v shape for multi channel 100 130 m130 moeller decor boxy lase hiveg broth base 131 m131 mueller hinton ilivegtm agar no. 2 500gm 132 m132 nafcillin 30mcg 133 m133 nutrient agar 500gm 134 m134 nutrient broth 500 gm 135 m135 nutrient ilivegtm agar no.02 500gm 136 m136 of basal media 137 m137 onpg 150 mcg 138 m138 optochin ( 5mcg ) 139 m139 ornithine 140 m140 oxacillin lmcg 141 m241 oxacillin sodium salt monohydrate 5gm 142 m142 parafilm m250 143 m143 penicillin 0 10 units disc 144 m144 phenylanine agar 100gm phenol red base 145 m145 146 m146 piperacillin / tazobactam30 / 6mcg 147 m147 pipette tips, yellow 250 ml 148 m148 plain vials 100 pc 149 m149 polymyxin 13100 unit 150 m150 potassium hydroxide pallets 151 m151 potassium dichromate 15x500 gm 500gm 152 m152 potassium tillurite 1% ( 1mi / v ) 25 vials 5 / 25 ml 153 m1.53 potassium dihydropen phosphate anhydrous 154 m154 potato dextrose agar 500 gm 155 1 m155 polyester wipes lx50 156 m156 rhelax a51.0 lx1 00 157 m157 rhelax crp lx100 158 m158 rhelax rf lx100 159 m159 roberston cooked meat media 500gm 160 m160 sabouraud dextrose agar 500 gm 161 m161 sabouraud dextrose agar with chloramphenico! 500gm 162 m162 sabouraud dextrose agar with chloramphenicoi 84. cyclohexamide 100gm 163 m163 sabouraud dextrose broth 500 gm 164 m164 screw cap tubes with 0 ring 165 m165 scrub typhus 1gm ( elisa ) 1x96 166 m166 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 167 m167 selenite f broth ( t ) 168 m168 sheep blood agar plate lx50 169 m169 spirit lamp 170 m170 simmons critrate agar 100gm 171 m171 sodium hypochlorite 4% slts. 172 m177 sodium hypochlorite 5% 5lts. 173 m173 sterile disposable petri plates 120 mm 174 m174 sterile disposable petri plates 90 mm 175 m175 sterile micro tube 2 ml with looped screw 176 m176 sterile screw cap 10 ml 177 m177 straight wire 178 m178 syringe driven filter mse 179 m179 stool 0 / 13 180 m180 sulphuric acid conc 500 ml 181 m181 swab applicator in tube. plastic ( sterilized ) 5 or 6 individual pack 182 m182 swab applicator plastic ( sterilized ) 6 individual pack 183 m183 tcbs hiveg tm agar ( selective ) 500 gm 184 m184 teicoplan in 30mcg thernto roll pack 185 m185 186 m186 tigecycline 15ml g 187 m187 tissue paper rolls 188 _ m188 tobramycine 10 ml g , 189 m189 triple sugar iron hivegtm agar 100gm 190 m190 upt ( device / card ) test lx100 191 m191 urea hiveg tm agar 100 gm 192 m192 urine / stool sample collection container made with nontoxic polypropylene. cap. 35m1. with screw cap. air tight 193 194 m193 va neomycin 30mcg m194 vitamino growth supplements 5 vials 195 m195 voriconazole vrc 25 ugm mig 1x100 widal slide / tube lx100 196 m196 197 1 m197 96 well microplate 1x50 198 m198 m199 96 well microplate certified to contain 0.005 eu / ml 1x100 199 xld hiveg tm agar 500 gm 200 m200 xylene sulphur free 250 ml 201 m201 zn stain solution 100 ml / 500 ml 202 m202 platelia aspergillus ag ( bio kad ) 203 n1203 fungite111, 3 beta u glucan ( fungitell kit ) 204 m204 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

Department Of Medical Education - Rajasthan

33432025 supply of general items for tb / vrdl / rt pcr lab 1 absorbent paper roll 2 absorbent paper sheet 3 aluminum foil 4 autoclavable pp plastic racks for 96 places 5 bags, biohazard, ( transparent autoclavable ) 6 cetylpyridinium chloride ( cpc ) for biochemistry mw 358.0 1>98% 7 cold chain box ( 12 lit. ) , 8 cotton roll 9 diamond pencil 1o di sodium hydrogen phosphate 11 disposable head caps disposable lab gownspp ( large and 12 medium ) 13 disposable shoe cover disposable syringes 5 ml ( 22 & 24 14 gauge ) 15 dnase / rnase surface decontaminant 16 dropper bottle droppers, sterile, plastic 1 .5 ml, 17 graduated droppers, sterile, plastic 3.0 ml, 18 graduated, disposable 19 edta 20 ethunol 95% 21 filter paper 22 fluorescent staining kit for afb 23 formaldehyde 24 glass funnel 25 gloves nitrile, size s m l 2s gloves. latex size s m’ l 27 glycerol, 28 hydrochloric acid, fuming ( 37% ) 29 hydrogenperoxyde 30% 30 immersion oil laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for 31 pcr lab 32 laboratory thermometer 33 l asparagine 34 lint free soft tissue liquid dispensing wash bottle 35 plastic ( 500ml ) 36 u medium base powder ready mix 37 loop, disposable 10 i1 38 loopholder 39 loopholder rack 4o magnesium sulphate 41 malachite green 42 mask ( disposable surgical ) 43 mccartney bottle 15 ml 44 mccartney bottle 7 ml 45 mc farland standard set micro pipette stand pipette stands 46 for5pipettes , micropipette tips nuclease & pyrogen free & aerosol barrier ( 0.1 20iil ) maximum recovery / minimum retention 47 filtered, racked, sterile micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery / minimum retention filtered, raqked, sterile 48 ( i00 l000jil ) , micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery / minimum retention filtered, racked, sterle ( 49 2 200 ji l ) molecular grade ethanol 50 molecular grade isopropanol 51 52 n95 respirators ( niosh approved ) 53 na acetate n acetyl l cysteine ( nalc ) 54 powder 55 naphthyl ethylendiamine 56 needle destroyer 57 niacin strips 58 nichrome wire 59 nicotinamide 60 paraflim 61 pcr tubes flat snap cap 0.2 ml 62 pcr tubes strip wiih flat cap optical for rt pcr 0.2 ml 63 phenol, 64 plastic racks ( 15 ml tubes ) plastic racks for 15 ml conical 65 falcon tubes plastic racks for 2 ml mct, 66 autoclavable. plastic racks for 50 ml conical 67 falcon tubes plastic storage box for 0.2 ml pcr 68 tubes with lid plastic storage box with lid for 2 ml 69 cryovials i ox 10 7o potassium dihydrogen phosphate 71 potussium permanganate 72 sample collection container sterile 73 cryovials screw cap ( hinged ) mct tapered 74 ( 1.5ml ) 75 slide drying racks snap cap ( hinged ) mct tapered 76 ( 1.5 ml ) snap cap ( hinged ) mct round 77 bottom ( 2 ml ) 78 sodium chloride, naci 79 sodium hydroxide, naoh, 80 sodium hypochlorite solution 81 sodium nitrate 82 spnay botties spnaylde 500 ml 83 spray bottles plastic pp 250 ml 84 sputum container 85 staining bottle 86 staining rack 87 sterile blue tips bulk ( l000iil ) 88 sterile tips bulk ( l0ll ) , 89 sterile yellow tips bulk ( 10011l ) 90 sulfuric acid, concentrated 91 sulphanilamide 92 test tube rack pp for vtm tubes 93 tissue roll 94 torn iguet 95 tr maynesium di eitrgteu 96 tube, centrifuge, 15 ml with screw cap 97 tube, centrifuge, 50 ml with screw cap 98 tubes cryovial, sterile with screwcap. 2 ml 99 tubes reaction. 2 ml 100 universal bottle for cultures. 28 ml 101 water molecular biology grade 102 xylene 103 zinc powder 104 zn acid fast staining kit 105 autoclavable pp cryoboxes suitable for storage at 80 c 10 xi0 samples for2rnlcryovials, autoclavablepp racks for 1.5 ml 106 mct 48 samples ( 24 pieces ) ....

Jhalawar Medical College and SRG Hospital - Rajasthan

33421913 rate contract supply of general items for tb / vrdl / rt pcr labs at medical college and hospital jhalawar , microbiology dept. , absorbent paper roll , absorbent paper sheet , aluminum foil , autoclavable pp plastic racks for 96 places , bags, biohazard, ( transparent autoclavable ) , cetylpyridinium chloride ( cpc ) for biochemis mw 358.01>987% , cold chain box ( 12 lir ) , cofton roll , diamond pencil , di sodium hydrogen phosphate , disposable head caps , disposable iab gownspp ( large and medium ) , disposable shoe cover , disposable syringes 5 ml ( 22 & 24 gauge , dnase / rnase surface decontaminant , dropper bottle , droppers, sterile, plastic 1.5 ml, graduated , droppers, sterile, plastic 3.0 ml, graduated, disposable , edta , ethanol 95% , filter paper , fluorescent staining kit for afb , formaldehyde , glass funnel , gloves nitrile, size s m l , gloves, iatex size s m l , glycerol , hydrochloric acid, fuming ( 37% ) , hydrogenperoxyde 30% , immersion oil , laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for pcr lab , laboratory thermometer , l asparagine , lint free soft tissue , liquid dispensing wash bottle plastic ( 500m1 ) , lj medium base powder ready mix , loop, disposabte 10 pl , loopholder , loopholder rack , magnesium sulphate , malachite green , mask ( disposable surgical ) , mccartney bottle 15 mt , mccartney bottle 7 ml , mc farland standard set , micro pipette stand pipette stands for 5 pipttes , micropipette tips nuclease & pyrogen free & aerosol barrier ( 0.1 20p1 ) maximum recovery / lvlinim u m retention filtered racked, sterile , micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery / minimurt retention filtered, racked sterile ( 100 100ul ) , micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery / ivlinimum retention filtered, racked sterile ( 2 200ul ) , molecular grade ethanol , molecular grade isopropanol , n95 respirators ( niosh approved ) , na acetate , n acetyl l cysteine ( nalc ) powder , naphthyl ethylendiimine , needle destroyer , niacin strips , nichrome wire , nicotinamide , parafilm , pcr tubes flat snap cap 0.2 ml , pcr tubes strip with flat cap optical for rt pcr0.2 ml , phenol i , plastic racks ( 15 ml tubes ) , plastic racks for 15 ml conical falcon tubes , plastic racks for 2 ml mct, autoclavab le, , plastic racks for 50 ml conical falcon tubes , plastic storage box for 0.2 ml pcr tubes with lid , plastic storage box with lid for 2 ml cryovials 10x10 , potassium dihydrogen phosphate , potassium permanganate , sample collection container sterile , cryovials , screw cap ( hinged ) mct tapered ( 1.5ml ) , slide drying racks , snap cap ( hinged ) mct tapered ( 1.5 ml ) , cap ( hinged ) mct tapered ( 2 ml ) , sodium chloride, nacl , sodium hydroxide, naoh , sodium hypochlorite solution , sodium nitrate , spray bottles sprayldpe 500 ml , spray bottles plastic pp 250 ml , sputum container , staining bottle , staining rack , sterile biue tips butk ( 1000u1 ) , sterile tips butk ( 10ul ) , sterile yellow tips bulk ( l00ul ) , sulfuric acid, concentrated , sulphanilamide , test tube rack pp for vtm tubes , tissue roll , torniquet , tri magnesium di citrate , tube, centrifuge, 13 ml with screw cap , tube, centrifuge, 50 ml with screw cap , tubes cryovial, sterile with screwcap, 2 ml , tubes reaction, 2 ml , universal bottle for culturcs, 28 ml , water molecular biology grade , xylene , zinc powder , zn acid fast stainidg kit , autoclavable pp cryoboxes suitable for storage at 80 c 10 x10 samples for 2 mlcryovials , autoclavable pp racks for 1.5 ml mct 48 samples ( 24 pieces ) ...

Medical Health And Family Welfare - Rajasthan

33421680 supply of lab regents and x ray films in district saadat hospital at tonk ( annual contract ) 1 anti “a” 10 ml serum 2 anti “a 1” serum 3 anti “ab”serum 4 anti “abd” 10 ml serum polypack 5 anti “b” 10 ml serum polypack 6 anti “d” 10 ml serum polypack 7 anti humar serum coombs anti serum 8 aslotestkit 9 auto pipette tips1 ml blue1*1000 pkt 10 auto pipette tips1 ml blue1*500 pkt 11 auto pipette tips0.1 ml yellow 1*1000 pkt 12 blood sugar kit ( auto / manual ) 13 blood urea kit ( auto / manual ) 14 bovine albunium 22% 15 cbc print roll 16 cover slip for counting chamber 17 cover slipsper 10 gm 18 cpda bags350 ml 19 csf diluting fluid 20 dengue elisa ns1 21 dengue testantibody 22 dengue testantibody +antizan 23 distril water 24 e.c.g. paper roll 6 channal 25 ecg gel 26 ecg paper roll singal channel bpl 6108t 27 ecg paper roll 12 channel schiller at 102 ( 144 sheet pack ) 28 eosinphol fluid 29 esr stand 30 esr tube glass 31 esr tube plastic 32 filter paper 33 glass slide 34 glucometer strip codefree sd biosensor 35 h.b.pipette 36 h.c.v rapid card with positive & negative control & sensitivety & specific in litrature 37 hb meter 38 hb tubes round 39 hbs ag elisa ( 1*96 ) test 40 hbs ag rapid card test with positive & negative control & sensitivety & specific in litrature 41 hcv elisa ( 1*96 ) test 42 hiv elisa ( 1*96 ) test 43 hiv rapid card test with positive & negative control & sensitivety & specific in litrature 44 hiv tridot 45 jsb 1st500 46 jsb 2nd 500 47 k 3 edita tube 48 lancet 49 leisman stain 50 liq. paraffin 51 malaria card 1*50 antibody with positive & negative control & sensitivety & specific in litrature 52 malaria card 1*50 antigion with positive & negative control & sensitivety & specific in litrature 53 malaria card 1*50 antibody / antigion with positive & negative control & sensitivety & specific in litrature 54 malaria card + vdrl card combo with positive & negative control & sensitivety & specific in litrature 55 multistrix 56 n / 10hcl 57 pasture pipette ( glass ) 58 plastic analyzinf tube for semi auto analyzer 59 plastic test tube for blood collection 13*110mm 60 platelate fluid 61 urin pregnancy card with positive & negative control & sensitivety & specific in litrature 62 rbc fluid 63 rbc pipette 64 rheumatoid factor ( rf ) 65 s. albumin test kit 66 s. alkilinephosphate testkit ( semi auto analyeser ) kinetic 67 s. alkilinephosphate testkit ( semi auto analyeser ) kinetic 68 s. amylase test kit 69 s. calcium test kit 70 s. ck mb test kit 71 s. ck nac tast kit 72 s. ldh test kit 73 s. uric acid test kit 74 s.billirubin kit ( auto / manual ) 75 s.creatinine kit ( auto / manual ) 500 76 s.uric acid kit ( semi auto analyser ) ( semi auto analyeser ) kinetic 77 serum cholesterol kit ( auto / manual ) 78 serum cholesterol kit ( auto / manual ) 79 sgot 80 sgot 81 sgpt 82 sgpt 83 sodium citrate 3.8% liquid500 84 sodium hypo chloride soln 5 % 85 sonography gel 86 test tube 10*1 cm borocil 87 test tube 5*1 cm borocil 88 tissue paper 89 total colestrol test kit 90 total protine albumin globulinea:gratio ( semi auto analyeser ) kinetic 91 tournicate 92 transporastation tube / plain tube 93 tuberculin diluted 94 urine analyzer strip 95 urine contener50 ml 96 uristix glucose protein 97 usg photo paper roll upp 110s 98 vacutainer without vacume 5 ml purplecap 99 vacutainer without vacume 5 ml redcap 100 vacutainer without vacume 5 ml yellow cap 101 vdrl rapid card with positive & negative control & sensitivety & specific in litrature 102 vtm vial 103 wbc diluting liquid500ml 104 wbc pipette 105 wbc pipette 106 widal kit ( auto / manual ) 107 auto pipete ( 10micro let 50micro let ) 108 auto pipete ( 10micro let 200micro let ) 109 auto pipete ( 500micro let 1000micro let ) 110 esr tubes 111 h.b. meter ( digital ) 112 h.b. meter strips ( hemocue ) 113 sahali h.b. meter 114 dispo needle 24g. 115 transfer blood bag 350ml. 116 s.crp test kit 117 banded autiseptic plaster 118 eppendrop tube 119 capillary tube 120 prothrombine time kit 121 digital pipettes 1 20 μl 122 digital pipette 10 100 μl 123 digital pipette 100 – 500 μl 124 digital pipette 500 1000 μl 125 pipette stand 126 aerosol barrier pipette tips 0.5 20 μl 127 aerosol barrier pipette tips 10 200 μl 128 aerosol barrier pipette tips 100 1000 μl 129 digital multichannel micropipettes 5 50 μl 130 digital multichannel micropipettes 100 500 μl 131 1.5 ml eppendorfs ( micro centrifuge tubes ) 132 2 ml eppendorfs 133 optical pcr 8 strip tube with cap ( os 1 ml × 0.2 ml dna / rnase / pcr inhibition free ) compatible with biorad rt pcr machine 134 autoclavable yellow, red, black, blue biosafety bags with biosafety symbol 135 ethanol molecular grade 136 isopropanol molecuolar grade 137 hand sanitizer 138 lint paper ( kim wipe ) 139 micro pipette tips 1 10 μl 140 micro pipette tips 10 100 μl 141 micro pipette tips 100 1000 μl 142 cryo storage box with stand ampoules 80° c1.5 ml 143 cryo storage box with stand ampoules 80° c2 ml 144 alluminium foil paper roll 18 inch × 90 meter 145 reversible racks for microtubes ( 96 holes ) 146 falcon tube 20 ml 147 falcon tube 50 ml 148 parafin tape 149 paper towel 150 head cover 151 shoe cover 152 brown paper 153 full cover disposable gown 154 apron different color medium size full sleeves ( approx 5 color ) 155 nuclease free water 156 vtm storage rack 157 thermocol box 158 discarding jar ( glass made ) 159 himedia cled agar ( cystine lactose electrolyte deficient agar ) 160 sterile disposable petridishes 90mm 161 nichrome wire straight wire rod 162 sterile disposable 10 ml test tube 163 field stand a & b 164 methanol 165 semen diluting fluid 166 neubauer chammber 167 prolyte electrolyte ( na, k, cl fluid pack ) 168 prolyte electrolyte ( daily cleaner ) 169 prolyte electrolyte electrod 170 3 part cbc machine ( axiom 19 plus ) 171 diluent 172 detergent 173 conc. detergent 174 lyse 175 for fully automatic randox machine 176 albumin ( liquid ) bcg 177 alt ( gpt ) ( liquid ) mod. dgkc ( rx series ) 178 alk. phos. ( liquid ) amp ( ifcc ) ( rx series ) 179 ast ( got ) ( liquid ) mod ( ifcc ) ( rx series ) 180 amylase ( liquid ) eps ( rx series ) 181 bilirubin ( direct ) ( liquid ) jendrassik ( rx series ) 182 bilirubin ( total ) jendrassik ( rx series ) 183 calcium ( liquid ) ( mona reagent ) arsenazo ( rx series ) 184 choloestrol ( liquid ) chod pap 185 hdl cholestrol ( liquid ) clearance ( rx series ) 186 ldl cholestrol ( liquid ) clearance ( rx series ) 187 ck nac dgkc ( rx series ) 188 ck mb dgkc ( rx series ) 189 crp ( liquid ) immunoturb ( rx series 190 crr full range ( 0.1 160 ) mg / l ) l.e.i ( rx series ) 191 crp full range ( 0.1 160mg / l ) rx series 192 crp full range ( 0.1 160mg / l ) rx series 193 crp high sensitivity ( liquid ) l.e.i ( rx series ) 194 creatinine ( liuqid ) jaffe ( rx series ) 195 glucose ( liquied ) god pap ( rx series ) 196 ldh ( liquid ) 197 lactate color 198 ld pyruvate > lactate ( liquid ) mod. dgkc ( rx series ) 199 ld lactate > pyruvate ( liquid ) nad ( rx series ) 200 total protein ( liquid ( mono reagent ) biuret ( rx series ) 201 triglycerides ( liquid ) cpo pap ( rx series ) 202 uric aicd ( liquid ) color ( rx series 203 urea ( liquid ) kinetic ( rx series ) 204 calibration sera level 2 205 calibration sera level 3 206 hdl / ldl chloestrol calib. 207 ck mb control 208 ck mb calib. 209 crp calib. ( multi point ) liquid ) 210 crp high sensitivity control level 1 ( lilquid ) 211 crp high sensitivity control level 2 ( liquid ) 212 crp high sensitivity calib. series ( multi point, liquid ) 213 crp calib. series ( multi point, liquid ) 214 crp control level 2 ( liquid ) 215 crp control level 3 ( liquid ) 216 crp full range ( 0.1 160mg / l ) calib. series 217 human assayed multi sera level 3 218 human assayed multi sera level 2 219 specific protein calib. ( lqiuid ) undiluted sample assays 220 specific protein calib. ( lqiuid ) diluted sample assays 221 lipid control level 1 222 lipid control level 2 223 lipid control level 3 224 specific protein assayed control levlel 1 ( liquid ) 225 specific protein assayed control levlel 2 ( liquid ) 226 specific protein assayed control levlel 3 ( liquid ) 227 serum diluent water 228 wash solution no.1 rx3963 229 wash soluiton no.2 rx3962 230 c1 wash solution rx3973 231 acid wash solution ws3853 232 allurate cup 233 appenddrop tube 234 5 part cbc machine ( sfri ) 235 diluentsfri 236 quench sfri 237 cleair sfri 238 lysesfri 239 x ray film & consumable items 240 x ray film1*50 ( green base ) fujifilm 241 x ray film1*50 ( green base ) fujifilm 242 x ray film1*50 ( green base ) fujifilm 243 x ray film1*50 ( green base ) fujifilm 244 x ray film1*50 ( green base ) fujifilm 245 dental x ray film kodak 246 x ray developer for auto film processor rd 37 247 x ray fixer for auto film processorrf 34 248 x ray developer for manual 249 x ray fixer for manual 250 dry view film for dryview 6850 laser imeger carestream 251 dry view film for dryview 6850 laser imeger carestream 252 dry view film for dryview 6850 laser imeger carestream 253 dry view film for dryview 6850 laser imeger carestream 254 dry view film for prima t.m. with drypix plus fujifilm 255 dry view film for prima t.m. with drypix plus fujifilm 256 dry view film for prima t.m. with drypix plus fujifilm 257 dry view film for prima t.m. with drypix plus fujifilm 258 cassette for cr system for dryview 6850 laser imeger carestream 259 cassette for cr system for dryview 6850 laser imeger carestream 260 cassette for cr system for dryview 6850 laser imeger carestream 261 cassette for cr system for dryview 6850 laser imeger carestream 262 cassette for cr system for prima t.m. with drypix plus fujifilm 263 cassette for cr system for prima t.m. with drypix plus fujifilm 264 cassette for cr system for prima t.m. with drypix plus fujifilm 265 cassette for cr system for prima t.m. with drypix plus fujifilm 266 x ray cassette with push button 267 x ray cassette with push button 268 x ray cassette with push button 269 x ray cassette with push button 270 x ray cassette with push button 271 x ray intesifing screen kg8 272 x ray intesifing screen kg8 273 x ray intesifing screen kg8 274 x ray intesifing screen kg8 275 dental hangers 276 x ray hangers 277 x ray hangers 278 x ray hangers 279 x ray hangers 280 x ray hangers...

Medical Health And Family Welfare - Rajasthan

33349004 rate contract tender for supply of consumables item , acetic acid , calcium chloride fused , boric acid , hydrogen per oxide , hydrochloric acid , phospho molybdic acid , sudan ii , nitric acid , sulphuric acid , acetone , ammonium molybdate , di ammonium hydrogen phosphate , iso amyl alcohol , ammonium hydroxide solution , antimony ( iii ) chloride , ammonium ferric sulphate , acetonitrile , bismuth subnitrate , bromocresol green indicator ar , chloroform , carbon tetra chloride , petroleum ether 60 80 , phloroglucinol , phenol , paraffin liquid , resorcinol , sodium hydroxide pelletes , diethyl ether , fehling solution a , furfural , glycerol , xylene , methyleneblue solution indicator , methylorange indicator , fehling solution b , silver nitrate , di phenyl carbazide , petroleum ether 40 60 , phenopthaline indicator , cobalt sulphate , fast red ( allura red ) colour , alkali blue 6 b indicator , rosaniline acetate , zinc acetate , potassiumhydroxide , benzene , hexane , n heptane , potassium iodide , sudan i , sudan iii , sudan iv , sodium hydoxide solution , silica gel , toluene , furfuraldehyde , aluminum oxide ( al2o3 ) , tartrazine color , sunset yellow color fcf , carmosine color , ponceau 4rcolor , brilliant blue color , fast green fcf color , metanil yellow color , iodine monochloride ampules , ninhydrine , potassium chromate , potassium dichromate , starch soluble , sulphur powder , tri sodium citrate , ampules 0.1n sodium hydroxide of 6 , ampules 0.1n sodium thiosulphate of 6 , ampules 0.1n hydrochloric acid of 6 , ampules 0.1n silver nitrate of 6 , iodine crystal , sodium potassium tartrate , di methyle amino banzaldehyde , copper sulphate , potassium sulphate , edta powder , sodium carbonate , copper acetate , bromine ampule , carbon di sulphide , phenol , methyl red indicator , phenol red indicator , phenolphthalien indicator , eriochrome black t indicator , di mehtyel yellow , bromothymol blue indicator , bromophenol indicator , di mehtyel yellow colour , caramel colour , rhodamin b , amaranth colour , erythrosine colour , acid yellow colour , sucrose pure , acid orange ( orange grade ) color , butter yellow color , methanol ms optima grade , acetonitrilms optima grade , ethyl acetate ms optima grade , acetic acid ms optima grade , aluminum ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , antimony ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , arsenic ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , barium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , bismuth ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , cadmium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , calcium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , chromium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , copper ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , germanium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , gold ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , iron ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , lead ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , magnesium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , manganese ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , mercury ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , nickel ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , potassium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , rhodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , scandium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , selenium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , silver ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , sodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tellurium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tin ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , vanadium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , zinc ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , customized gc pesticide mix nist certified crm ( compound list enclosed ) , customizedlc pesticide mix nist certified crm ( compound list enclosed ) , curcumin nist certified crm ( 1000 mg / l ) , 37 component fame mixcrmfor fatty acid , vitamin a ( 1000 mg / l ) , vitamin d ( 1000 mg / l ) , vitamin b12 ( 1000 mg / l ) , vitamin b3 ( 1000 mg / l ) , vitamin c ( 1000 mg / l ) , potassium hydrogen phthalate , sodium carbonate , mustard oil , ground nut oil , potassium di chromate , sodium chloride , sucrose , oryzonol , argemone oil reference standard , castor oil reference standard , mineral oilreference standard , cotton seed oilreference standard , turmeric with lead chrome reference standard , potassium di chromate reference standard , potassium hydrogen phtallatereference standard , sodium carbonatereference standard , sodium chloridereference standard , sand particle size pass through 500 micron is seive size and retained on 180 micron is seive , standard is seive set ofaperture size size 4 mm, 3.35 mm, 1.70 mm, 1.0 mm with solid bottom pan each , vitamin a reference standard , nutrient brothw / 1%peptone , nutrient agar , mac conkey broth w / nurtral red , mac conkeys agar , plate count agar ( pca ) , bairedparkes agar medium , yeast extract dextrose chloramphenicol agar medium , potato dextrose agar , m r vp medium , bismuth sulphide agar medium , thermometer 0 to 1000c , cedar wood oil / immersion , forcepsss , tray plastic , kovacsindole reagent , grams stain kit , steam indicator tape , dry heat chemical process strips , stereothermophilus ampoule , disposable shoe cover , ph paper strips , autoclavable disposable bags , brown paper , uv lamp for sterilization , autoclavable micropipette ( 1000 fixed volume, 500 5000 variable volume, 50 200 microlitre , micropipette tip box , scissors small , labels and taps , aluminum foil , butter paper , hand gloves ( small and large ) , slippers , liquid soup solution for glassware washing 5 ltr pack , lens paper , beaker , beaker , beaker , beaker , beaker , burret , burret , butyrometer tube for milk testing , dropping bottle plastic , dropping bottle plastic , dropping bottle plastic , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , cover slip , condenser for rmset , crusible quartz without lid , diamond pencil , flask conical , flask conical , flask conical , flask conical , flask iodine stopper , funnel glass , funnel plastic , separating funnel , glass rod all type , rubber bulb medium size , rubber bulb size big , pipettes graduated , pipettes graduated , pipettes graduated , pipettes volumetric , pipettes volumetric , pipettes volumetric , pipettes volumetric , test tube with stopper , petri dish pair ( glass ) , volumetric pipette , caplliry tube , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , density bottle , soxhlet flask , glass beads , glass slide for microscopy , heating mantal net for 250ml , heating mantal net for 500ml , automatic tilt with 250ml bottle , automatic tilt with 250ml bottle , soxhletcondensor medium , aluminium dishes , reagent bottle , reagent bottle , reagent bottle amber coloured , reagent bottle amber coloured , mojonnier fat extraction tube , pipette stand plastic verticle , air condenser with joint 100cm , dean & stark apparatus 10.0ml , auto pippete sucker , suction flask , colum chomrplaingl, stpk for colour estimation , thermometer zeel , lactometerzeel , centrifuge tube glass with stopper , butyrometer tube aluminium stand , volatile oil clanveger type , lighter thanwater , desicator with cap , toungue ss , soxhlet clamps , with boss head , asbestosed wire gauge , mortar & pestal , volumetric flask ( rm reciever ) , membrane filtration assemboly with pump & filters , beaker , beaker , iodine flask , butyrometer key , butyrometer tube cork , filter paper sheet 1 ( 46*57cm ) , filter paper no. 1 diameter 125mm , filter paper no. 2 diameter 125mm , filter paper no. 4 diameter 125mm , filter paper no. 42 dimeter 125mm , centrifuge tubes ( pp tubes ) 50mlpkt , centrifuge tubes ( pp tubes ) 15mlpkt , nylon syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , ptfe syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , nitril gloves ( medium size ) , nitril gloves ( small size ) , brush for butyrometr test tube brush , tong 12 ss , spatulla 8 ss , auto sampler vials with cap and septa 1x100 , 100 1000 micro litre tips universal graduated ( 1x1000 ) , 10 100 micro litre tips , 1 5 ml tips ( 1x100 ) , tissue rolls , lens paper , disposable lab coat , non absorbant cotton roll500gm , nitrogen gas cylinder 47 litre ( 99.999% purity ) , argon gas cylinder47 litre ( 99.999% purity ) , helium gas cylinder47 litre ( 99.999% purity ) , hydrogen gas cylinder47 litre ( 99.999% purity ) , zero air gas cylinder47 litre ( 99.999% purity ) , membrane filter ( 0.45 ) um ( millipore ) , aluminum foil food grade ( extra hygiene ) rolls , tlc plate aluminium ( 20x20 cm ) , coloumn for vitamin analysis c 18 1.8?m, 2.1x100mm , coloumn for vitamin analysis c 18 2.6?m, 2.1x100mm , gc coloum 105 mtr. capillary tg 5ms, 105mtr. lenth x0.25 pore size for fatty acid profile , alpha. amylase 100 gm , sodium acetate500 gm , ammonium formate 100 gm , di potassium hydrogen phosphate 500 gm...

Indian Army - Rajasthan

33126371 annual price agreement of 187 mh fy 2022 23 annual price agreement for procurement of medicines for 187 mh fy 2022 23 , list iii lab reagents and chemical , pencil, marking glass. , acetic acidglacial ( analar ) , alcohol dehydrated , anti nuclear antibody elisa detection kit with 96 wells. , benedict solution, qualitative. , blood agar base, pack of 0.5kg , chloroform ar ( analytical grade ) , drabkins solution ( diluting solution for haemoglobin estimation by cyanmet haemoglobin method ) , fructose , glycerine ar ( glycerol ) , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , hiv antibody 1 & 2 detection elisa kit for 96 tests. , stain leishmans powder. , stain methylene blue , stain neutral red , sudan iii , xylene ( xylol pure ) , rapid card screening for hbv , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , serum, agglutinating, bact abortus monospecific , salmonella typhi o , salmonella typhi v , salmonella typhi h , salmonella paratyphi a.h , serum anti d for saline tube test , lieshmen stain ( ready to use ) , gram stain ( ready to use ) ( hi media ) , zn stain ( ready to use ) ( hi media ) , urine strip, bott of 100 strip 2sg ( siemens ) , multistrip 10sg , bott of 100 strips ( siemens ) , kit widal, 4 x 5 ml ( tulip ) , typhoid igm / igg, pkt of 100 ( j mitra ) , malaria ag ( j mitra ) , pkt of 50 , hcv tridot , pkt of 100 ( j mitra ) , vdrl ( kit of 30 ) ( ctk ) , ra factor ( tuylip / coral ) , esr tube ( ready to use ) , swab stick ( hi media ) , sterile urine container , kit micro protein ( 1x50 ) ( erba ) , petri dish ( disposable ) ( hi media ) , blood culture bottle aerobic ( ready to use ) , ( bactech ) , ph strip , biored level 1 , biored level 2 , hiv 1&2 ( rapid tridot ) 1x100 test ( j mitra ) , hiv 1&2 ( rapid sd card ) 1x30 test ( j mitra ) , antibiotic disc ampicillin, pkt of 250 ( hi media ) , antibiotic disc gentamycin, pkt of 250 ( hi media ) , antibiotic disc amikacin, pkt of 250 ( hi media ) , antibiotic disc ciprofloxacin, pkt of 250 ( hi media ) , antibiotic disc norfloxacin, pkt of 250 ( hi media ) , antibiotic disc nalidixic acid, pkt of 250 ( hi media ) , antibiotic disc nitrofurontoin, pkt of 250 ( hi media ) , antibiotic disc imipenem, pkt of 250 ( hi media ) , antibiotic disc vancomycin, pkt of 250 ( hi media ) , antibiotic disc co trimaxazole, pkt of 250 ( hi media ) , antibiotic disc cefixime, pkt of 250 ( hi media ) , antibiotic disc ceftazidime, pkt of 250 ( hi media ) , antibiotic disc clindamycin, pkt of 250 ( hi media ) , antibiotic disc piperacillin, pkt of 250 ( hi media ) , antibiotic disc optichin, pkt of 250 ( hi media ) , antibiotic disc polymixin b, pkt of 250 ( hi media ) , cover glass 22x40 ( blue star ) , cover glass 22x50 ( blue star ) , macckonkey broth double strenght ( hi media ) , pack of 0.5kg , hbsag sd card ( 1x100 test ) sd , distilled water , hcv sd card , pkt of 100 ( sd ) , hbsag tridot ( 1x100 test ) ( j mitra ) , easylyte plus solution pack na / k / cl ( medica ) , easylyte cleaning solution bott of 90ml ( medica ) , easylyte plus wash solution bott of 50ml ( medica ) , easylyte plus urine diluent bott of 500ml ( medica ) , clead agar ( hi media ) , pack of 0.5kg , mha agar ( hi media ) , pack of 0.5kg , blood agar base ( hi media ) , pack of 0.5kg , nutrient agar ( hi media ) , pack of 0.5 kg , semen diluenting fluid, bott of 500ml , erba diluent h 360, pack of 20 ltr , erba lyse h 360, bott of 500ml , erba h clean h 360, bott of 50ml , erba printer roll 55mm, h 360 , erba control h 360 , microscopic slide pack of 50 ( blue star ) , watman filter paper 125mm x 100 circle , kit rapid pap biofix spray ( biolab ) , kit lipase , 1 x 20ml ( erba ) , ab &d antisera ( 3 x 10ml ) , ependorf tube , acidh2so4 ( sulphuric acid ) , kit t3 detection elisa kit 96 tests ( calbiotech ) , kit t4 detection elisa kit 96 tests ( calbiotech ) , microtips ( 1 200ul ) , microtips ( 500 1000ul ) , erba wash ( 5x 20 ml ) , ethanol , tmppd , kit abst tobramycin disc, pkt of 250 ( hi media ) , kit abst colistin disc, pkt of 250 ( hi media ) , kit abst meropenam disc, pkt of 250 ( hi media ) , kit abst ceftrixone disc, pkt of 250 ( hi media ) , kit abst piptaz disc, pkt of 250 ( hi media ) , kit abst cefazolin disc, pkt of 250 ( hi media ) , kit abst cefotoxime disc, pkt of 250 ( hi media ) , kit abst linezolid disc, pkt of 250 ( hi media ) , kit abst penicillian disc, pkt of 250 ( hi media ) , duram tube , india ink , sda media , lj media , lpcb , blood culture castaneda , tubing kit set ( medica easylite ) , glass, cover, microscopic, square shape, 0.127 mm thick, side 22 mm, pkt of 14 g , micropipettes, tips for 1 200 ul , micropipettes, tips for 500 1000 ul , semi auto analyser, wash solution for , semi auto analyser, printing paper roll for , slide, microscope, thickness 1.15 to 1.35 mm size 75mm x 25 mm , acetone commercial , acid, sulphuricum ( sp. gravity 1.820 1.825 ) . , alcohol amyl , aluminium foils. , alcohol methyl , ( aso ) antistreptolysin o test latex agglutination principle, complete with control serum , cled agar ( with thymol blue ) , pack of 0.5kg , liquior formaldehyde 40% w / v , kit for estimation of hdl cholesterol ( 100 ml ) , hiv antibody 1 & 2 detection rapid test kit , keto diastix bott of 50 strips , kits for estimation of albumin , kits for estimation of cholestrol , kits for estimation of glucose , kits for estimation ofprotein , kits for estimation of urea , kits for estimation of uric acid , kits for estimation of creatinine , kits for estimation of alkaline phosphatase , kits for estimation of sgot ( ast ) , kits for estimation of sgpt ( alt ) . , macconkey agar , pack of 0.5kg , methylene blue , mueller hinton agar, pack of 0.5kg , prothrombin time reagents to give control of 10 14 secs , pttk reagent , sodium hypochlorite solution 10% , strips albumin and glucose bottle of 100 strips , tsi media / triple sugar iron agar, pack of 0.5 kg , kit for triglyceride estimation ( 100 ml ) , kit for ldl cholesterol by direct estimation , kit for estimation of bilirubin , kit for estimation of ggt ( gamma gluteryl transaminase ) ( 12 x 5 ml ) , kit for estimation of cpk mb ( 2.5 ml ) , kit for estimation of calcium ( 50 ml ) , kit for estimation of amylase ( 12 x 5 ml ) , kit for estimation of ldh ( 12 x 5ml ) , kit crp ( c reactive protein kit for 50 tests ) , pt reagent ( kit of 25 tests ) , serum haemaglutnating group a ( anti b monoclonal ) , serum haemagglutnating group b ( anti a ) monoclonal , serum heamaglutinating gp. o ( anti ab ) ( monoclonal ) ...

State Forensic Science Laboratory - Rajasthan

33052785 supply of stationery and misc. item envelope, laminated envelope, pencil, glass marking pencil, sharpner, eraser, marker pen, cd marker, ball pen, whightner, all pin, pen holder, stamp pad, stapler, stapler pin, punching machine, fevikol, gum bottle, chart sheet, pockerl, file tag, file lase, note pad, file cover, calculator, cd cover, register, candle, soap, hand wash liquid, sui, washing powder, pencil cell, paper cutter, plastic bucket, plastic tub, aluminum foil, mosquito electric machine, ret killer, lpg gas, plastic pipe, room lock, broom, etc....

Medical College - Rajasthan

33047950 rate contract for consumable and reagents for various rtpcr labs rate contract for consumable and reagents for various rtpcr labs , n 95 mask ( niosh certified ) , isopropanol molecular grade , nuclease free water molecular grade , rna zap [ rna kill ] , cool racks for pcr tube ( 0.2ml ) with temperature indicator , aluminium foil , vortex mixer for tubes , micro tips for 100 1000?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 10 100?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 2 10?l, low retentionrnase, dnase & pyrogen free sterile , micropipette tips lowretention filtered, rnase, dnase, pyrogen free, sterile 1 10?l , aluminium foil 72 meter , bottle top dispenser with bottle capacity 1 liter capcity 1 10ml , cryo storage card board box 100 wells with cover 2.0ml , discarding jar with swinging lid 5 liter with biosafety symbol , disposable sterile speciman collection swab dacron type , gown blue cloth back open full sleves , gown green cloth back open full sleves , gown red cloth back open full sleves , gown white cloth back open full sleves , hand sanitizer with dispensar to be attached to wall , lysol , micro titer pipette set variable volume 100 1000?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , micro titer pipette set variable volume 10 100?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , micro titer pipette set variable volume 5 50?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , micro titer pipette set variable volume 30 300?l. eight channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , microcentrifuge 8 tube rotor , microcentrifuge tube 1.5ml molecular grade sterile , pcr master mix with dntps, taq, mgcl 12, buffer 2000rnx , pcr thermo conductive rack for 96 pcr tubes , safety goggles , trough reservoir capacity 75ml polypropylene , wash bottle 500ml new type , ziploc bag 12x8 , ziploc bag 4x3 , ziploc bag 8x6 , manual multichannel micropipette variable volume autoclavable 100 300?l , eppendorf tube 1.5ml with screw caped self standing , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile 100 300?l...

Sms Medical College - Rajasthan

33046527 rate contract for consumable and reagents for various rtpcr labs ( nit 37 ) 1. n 95 mask ( niosh certified ) 2. !so propanol molecular grade 3. nuclease free water molecular grade 4. rna zap [ rna kill ] 5. cool racks for pcr tube ( 0.2m1 ) with temperature indicator 6. aluminium foil 7. vortex mixer for tubes 8. micro tips for 100 1000111, low retention rnase, dnase & pyrogen free sterile 9. micro tips for 10 100g1, low retention rnase, dnase & pyrogen free sterile 10. micro tips for 2 10g1, low retention rnase, dnase & pyrogen free sterile 11. micropipette tips lowretention filtered, rnase, dnase, pyrogen free, sterile 1 10g1 12. aluminium foil 72 meter 13. bottle top dispenser with bottle capacity 1 liter capcity 1 10m1 14. cryo storage card board box 100 wells with cover 2.0m1 15. discarding jar with swinging lid s liter with biosafety symbol 16. disposable sterile speciman collection swab dacron type 17. gown blue cloth back open full sieves 18. gown green cloth back open full sieves 19. gown red cloth back open full sieves 20. gown white cloth back open full sieves 21. hand sanitizer with dispensar to be attached to wall 22. lysol, 23. micro titer pipette set variable volume 100 1000g1. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50g1 and below volumes ensures deliver ) of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron 24. micro titer pipette set variable volume 10 100g1. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50g1 and below volumes ensures deliver ) of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron 25. micro titer pipette set variable volume 5 50g1. single channel fully autoclavable ce ivd certified. super blow out piston wit: volumes of 50g1 and below volumes ensures delivery of micro si drops. piston should be made up of rust free polyether imide / ultralight fortron 26. micro titer pipette set variable volume 30 300g1. eight charm ( fully autoclavable ce ivd certified. super blow out piston witl volumes of 50g1 and below volumes ensures delivery of micro si. drops. piston should be made up of rust free polyether imide / ultralight fortron 27. microcentrifuge 8 tube rotor 28. microcentrifuge tube 1.5m1 molecular grade sterile 29. pcr master mix with dntps, taq, mgci 12, buffer 2000rnx 30. pcr thermo conductive rack for 96 pcr tubes 31. safety goggles 32. trough reservoir capacity 75ml polypropylene 33. wash bottle 500m1 new type 34. ziploc bag 12x8 35. ziploc bag 4x3 36. ziploc bag 8x6 37. manual multichannel micropipette variable volume autoclavabl 100 300g1 38. eppendorf tube 1.5m1 with screw caped self standing 39. micropipette tips filtered, rnase free, dnasc free, pyrogen free, sterile 100 300g1...

Rajasthan Cooperative Dairy Federation Limited - Rajasthan

33024774 tender document for procurement of aluminium foil for 200 gm dahi cup / shrikhand cup 100 gm / aluminium foil for dahi matka jar 5 kg tender document for procurement of aluminium foil for 200 gm dahi cup / shrikhand cup 100 gm / aluminium foil for dahi matka jar 5 kg , rate statement , aluminium foil for 200 gm dahi cup / shrikhand cup 100 gm , aluminium foil for dahi matka jar 5 kg...

Department of School Education - Rajasthan

32996706 bids are invited for acetone , biurate reagent , ammonia solution , n butanol , di ethyl ether , glycerol , molish reagent , methylene blue , xylene , lens cleaning , formaldehyde , hydrogen per oxide , slide , cover slip , cover slips , dropper , beaker , specimen bottle , lancet , lancet pen , aluminum foil roll , capillary tubes , pricking needle , surgical cotton , rubbergloves , surgical mask , surgical gloves , polythene cover , neubaur chamber , sphygmomanometer , white tiles , brush , frog model , element , sponge , hydra , obelia , euglena , paramecium , virtual interactive dissectionsoftware , chart , chart , model total quantity : 677...

Indian Army - Rajasthan

32699441 procurement of expendable medical stores for 187 military hospital drugs , mdi salmeterol 50mcg + fluticasone 250mcg , polypropylene blue monofilament 1 / 2 circle rb 70cm, size 2 / 0 , syp levosalbutamol 1mg / 5 ml , bottleof 100 ml , abdominal drain kit size 20 fg , abdominal drain kit size 24 fg , abdominal drain kit size 28 fg , abdominal drain kit size 32 fg , abgel , absorbable surgical suture violet 1 / 2 circle , rb 20mm, size 3 / 0 , adenosine 3 mg / ml, 2 ml inj , adjustable arm pouch sling l / m / s , adult bain circuit , aluminium foil , ankle brace , ankle support , ansell non latex gloves s 7.5 , ascorbic acid 500 mg tab , bacillocid , bandage dvt stocking large , bandage dvt stocking medium , benzathine penicillin 6, 00, 00 unit inj , biological indicator for autoclave machine , bulb for laryngscope , cap primosa evening oil , cap probiotic ( multibacillary 4 or more organisms ) , chest drain system with trocar ( icd ) s 24 , chest drain system with trocar ( icd ) s 28 , chest drain system with trocar ( icd ) s 30 , chest drain system with trocar ( icd ) s 32 , closed wound suction system romovac 10 fg , closed wound suction system romovac 12 fg , closed wound suction system romovac 14 fg , closed wound suction system romovac 16 fg , closed wound suction system romovac 18 fg , collagen dressing , combined spinal epidural set 18 / 27 g , common cold tab ( antihistiminics + paracetamol 500 mg without pseudoephedrine ) , cord clamp , cotton wool, absorbent pkt of 500 gm , cream clobetasole + g , crutches elbow adjustable , cutacept , cvp manometer , deflazacort 6mg tab , dextrose 50%, 25 ml inj , dextrose inj 25%, 25 ml inj , dextrose monohydrate for oral use , diethylcarbamazine 50mg tab , disp bladeless trocar 10 mm , disp bladeless trocar 7 mm , disp needle s 26 g , disp skin marker , donepezil 5 mg tab , dressing, shell, compressed , drop vit d3 60k nanoshot ( dee 3 ) , pkt of 4 bottle , duram tube , ecg electrodes ( disposable ) , endo bag , endo loop , endoclip lt 200 , endoclip lt 300 , endoclip lt 400 , epidural set 18g , escitalopran 10 mg tab , feeding tube 08 fr , feeding tube 10 fr , folleys catheter s 14 , formoterol 12 mcg & fluticasone 250 mcg dry powder , fusidic acid cream 2% w / w 10 g tube , g dressing s 15 , g dressing s 25 , g dressing s 5 , gelofusion plasma substitute soln , glucosamine 250mg+ chondroitin sulphate 200 mg cap , guedel airway size 01 , guedel airway size 02 , haemacel infusion, bott of 500ml , heel pad , hiv kit for ot , hydrocolloid dressing , hydroquinone 2% tube of 50 gm , inj depomedrol 80 mg / 2ml , inj etomidate 2 mg / ml , inj neostigmine 5ml , inj triamcinalone ( kenacort ) 10mg , injection anti spasmodic each ml containing analgin 500mg p piperidino ethyoxy o carbmethoxy benzophenone hcl 2.0mg and diphenylpiperidinoethyl acetamide bromomethylate 0.02mg amp of 5ml , insulin disposable syringe 1ml , insulin highly purified human neutral40iu / ml, 10 ml inj , ipratropium bromide respirator soln 250 mcg / ml vial of 15ml , iron syp with vitamins each 5 ml containing ferrous fumarate 100mg folic acid ip 3mg & vit b12 10mcg , isapgol / ispaghula husk 3.5 gm , keto strips , ketorolac 10 mg tab , kit albumin ( erba ) , kit alkaline phosphate ( erba ) , kit calcium ( erba ) , kit prothrombin time ( siemens ) , kit creatinine ( ( erba ) , kit for estimation of amylase ( 12 x 5 ml ) ( erba ) , kit for estimation of bilirubin ( erba ) , kit mifepristone 200 mg + misoprostol 800 mg , kit total protein ( erba ) , kit urea ( erba ) , kits for estimation of cholesterol ( erba ) , kits for estimation of glucose ( erba ) , kits for estimation of sgot ( erba ) , kits for estimation of urea ( erba ) , kits for estimation of uric acid ( erba ) , keto strips , swab stick , petri dish , erba machine printer roll , knee cap large , knee cap medium , knee cap small , knife bard parker, blade size 1 fitting ( commercial no. 11 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no. 12 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no. 15 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no.10 ) packet of 6 , knife bard parker, blade size 2 fitting ( commercial no. 20 ) packet of 6 , knife bard parker, blade size 2 fitting ( commercial no.22 ) packet of 6 , l arginine sachet , lactic acid bacillus sachet , levosalbutamol + ipratropium bromide ( duolin ) respules , lidocaine spray , linear cutter reload unit blue cartidge for use with safety lock out 75mm , linear stapler 90mm reload unit heavy wire for use with variable staple height 1.5mm 2.5mm , lint absorbent, cotton , liquid formalin , loperamide 2mg tab , lot iorep , malaria antigen test card , mdi budesunide 200mcg , mesh prosthesis for hernia small polypropylene mesh size 6*11 cms. composite light wtmesh of polypropylene and polygalactin 910 / polygycolic acid, size 6 *11 cms , methylene blue , metoprolol 1 mg / ml, 5 ml inj , microgen d 125 , microtips 1 1000 ul , microtips 1 50 ul , monocryl polyglecaprone 25 4 / 0cutting needle , monocryl polyglecaprone 70cm, 3 / 0 , nifedipine retard 20 mg cap / tab , ns bott of 100 ml , oint heparin , oint luliconazole , ot pack , oxytocin 5 oxytocic units per 0.5ml, 0.5ml inj , paedia drip , paraformaldehyde tab for sterilisation of catheters , pcm suppository , pmo line 100 / 200cm , polyamidemonofilament size 1, 100 cm, 1 / 2 circle rb 40 mm , polyamidemonofilament size 2 / 0, 70 80 cm 3 / 8 circle reserve cutting 40 45 mm , polyamidemonofilament size 3 / 0, 70 80 cm, 3 / 8 circle reverse cutting 25 30 mm , polyamidemonofilament size 4 / 0, 40 50 cm, 3 / 8 circle cutting 15 20 mm , polyamidemonofilament size 5 / 0, 60 70 cm 3 / 8 circle cutting 15 20 mm , polydioxanone size 1, 1.5cms loop, 1 / 2 circlerb needle 50 55 mm , polydioxanone size 1, 90 cms, 1 / 2 circle needle 40 45 mm , polyglicaprone size 3 / 0, 70 75 cm, 1 / 2 circle rb 20 25mm , polypropylene blue monofilament 70 75 cm size 3 / 0, 3 / 8 circle reverse cutting 12 mm , polypropylene blue monofilament 70 75 cm size 4 / 0, 1 / 2 circle rb25 mm double needle , polypropylene blue monofilament 70 75 cm, size 1 / 0 3 / 8 circle reverse cutting, 12 mm , polypropylene blue monofilament 70 75 cm, size 2 / 0, 3 / 8 circle reverse cutting, 12 mm , polypropylene blue monofilament 70 75 cm, size 4 / 0, 3 / 8 circle reverse cutting, 12 mm , polypropylene mesh 15 x 15 cms, mesh prosthesis for hernia medium / polypropylene mesh, size 15cms*15 cms.composite light weight mesh of polypropylene and polygalactin910 / polygycolic acid size 15cms*15 cms , polypropylene mesh 6 cm x 11 cm ( box of 6 ) , pttk reagent ( siemens ) , mdi formoterol 6 mcg + budesonide 400mcg , r / c levosalbutamol + ipratropium bromide ( duolin ) , r / c salbutamol , resp salbutamol , respulesenterogermina , rifampicin 150mg cap , rotacap salmeterol 50mcg +fluticasone 250mcg , ryles tube s 14 , ryles tube s 16 , salbutamol 100 mcg + ipratropium 20 mcg inhaler , salbutamol 2.5mg + ipratropium 40mcg solution , salbutamol sulphate respirator solution 5mg / ml, vial of 15 ml , serratiopeptidase 10 mg tab , silicon folleys catheter s 16 [ transparent ] , silicon folleys catheter s 18 [ transparent ] , silicon gel dressing , silicon tubal ring , silk braided size 0 70 76 cm reverse cutting 3 / 8 circle needle 45 mm , silk braided size 1 / 0 70 76 cms taper cut 1 / 2 circle needle 25mm , silk braided size 1 / 0 reel 6 reels x 25 mtrs , silk braided size 2 / 0 reel 6 reels x 25 mtrs , silk braided size 2 / 0, 70 76 cm rb 3 / 8 circle needle 45mm , silk braided size 3 / 0, 70 76 cm cutting 3 / 8 circle needle 45mm , skin stapler with 35 / 55 stainless staples , slide microscope , soda lime , sofratulle , spinal needle s 25 g , spinal needle s 26 g , steristrip , streptokinase 15 lacs iu inj , suction catheter s 08 , suction catheter s 10 , surgeons masks , surgicel , suspensory scrotal , swab stick , synthetic absorabable polygalactin rapid absorption 2 / 0, 80 90 cms, 1 / 2 circle cutting , 30 40 mm double arm , synthetic absorbable polygalactin 910 / polyglycolic acid coated with polycaprolate size 1 / 0, 70 90 cms, 1 / 2 circle rb 20 25 mm , synthetic absorbable polygalactin 910 / polyglycolic acid coated with polycaprolate size 2 / 0, 70 90 cms, 1 / 2 circle rb 30 40 mm , syp ambroxol bott of 100 ml , syp b complex , syp disodium hydrogen ( alkasol ) , syp grilintus , syp ofloxacin + ornidazole , syrup calcium phosphate , tab alpha keto analouge , tab bilastine 20mg , tab biotin , tab cabergoline 0.25mg , tab clinidipine 10mg , tab dapagliflozin 10 mg , tab dynapar , tab estradiol 2mg ( progynova ) , tab flunarazin 10mg , tab hydroxyzine 25mg , tab isosorbide dinitrate 10mg , tab levocarnitine 500mg , tab lithium carbonate 300 mg , tab micronised purified flavonoid fraction 500mg ( daflon ) , tab n acetyl cystene 600mg , tab nebivilol 5mg , tab pantop + d , tab paracetamol 650 mg , tab rifaximin 440 mg , tab sertaline 50 mg , tab sodium valporate 500 mg cr , tab teneligliptin 20mg , tab terbinafine 250 mg , tab thyroxin sodium 75 mcg , tab topiramate 50mg , tab torsemide 10mg , tegaderm s 10 cm , thumb spica splint , tiotropium bromide 18 mcg & formoterol 12 mcg dry powder cap , r / c tiotropium bromide 18 mcg dry powder , tmppd , tracheostomy tube 6.5 mm , tracheostomy tube 7 mm , tramadol hcl 50 mg / ml inj , transparent anaesthesia face mask set of size 0, 1, 2, 3, 4, 5 , tube endo tracheal reinforced pvc size 2.5 with out cuff , tube endo tracheal reinforced pvc size 3.0 with out cuff , tube endo tracheal reinforced pvc size 3.5 with out cuff , tube endo tracheal reinforced pvc size 4.0 with out cuff , tube endo tracheal reinforced pvc size 4.5 withcuff , tube endo tracheal reinforced pvc size 7.5 withcuff , tubing kit , u drain size l & m , under water sealed drainage bag , urine container , urine strips ( protein + glucose ) , uro bag , usg printer paper roll , ventilator circuit for anaesthesia machine , vicryl 3 / 0, 20mm , vicryl 4 / 0, 20mm , vicryl no 1 ( rb ) , vicryl rapid no 1 ( rb ) , vitamin e 200 mg cap , volini spray , walker tripod , warfarin 5 mg tab , wrist guard with thumb support , zolpidem 10 mg tab...

Indian Army - Rajasthan

32575942 procurement of medicine => limited tab olanzapine 5mg , clonazepam 0.25 tab , insight doa 6.1 ( 10 test ) urine drug screen test , inj paliperidone palmitate 100 mg , tab trazodone 50 mg , intralipid 20% 500 ml ( intravenous fat emuli ) , arm siling pouch ( large ) , arm siling pouch ( medium ) , silicon gel heel pad , adhesive plaster microporus tape 1 box of 12 , adhesive plaster microporus tape 2 box of 6 , adhesive plaster microporus tape 3 box of 4 , abdominal binder 10 , aluminium foil , protein powder ensurefor dm pack of 1 kg , protein powder ensure pack of 1kg , mesna respules , inj ulinastatin 1 lakh iu , inj colistimethate sodium 2 million iu. , mistabron resp solution , inj reteplace 18 mg , inj dantrolene , inj daptomycin 350mg , activated charcoal 250mg tab , bacciloid soln , ventilator circuit compatible with philips respronics ventilator , t connector nebulizer kit , thermotrach , restraint , antibiotic coated central line tripple luman , disposable draw sheet 40x90 , niv mask compatible with respronic bipap machine , toomy syringe , tegaderm size medium ( 8..5x11.5 ) , tegaderm size large ( 10x12 ) , et tube holder , primapore wound dressing small , single straight thoracic trocar catheter size 28 , single straight thoracic trocar catheter size 32 , chest drain bag , feeding bags , closed suction post op drain with tubings in sterile pack consisiting of ballow unit connecting tube with clamp and y connector curved trochar attached to matching size catheter and spare catheter sizes 12 , comfeel dressing , glucose strips one touch select bott of 25 , accucheck glucostrip bott of 50 , glucostrips accucheck active bott of 50 strips...

Medical Health And Family Welfare - Rajasthan

31958466 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 100 t , aslo 100 t , crp 100 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristix 2 parameter 1 x 100 stp , multistix 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner cbc 3 part , abx minoclear cbc 3 part , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg horiba 20 l , abx lyse bio horiba 1 l , abx cleaner horiba 1 l , minocal calibrator horiba 2.0 ml , minotrol 16 twin pak ( 02l ) horiba 2.5 ml , minotrol 16 twin pack ( 2n ) horiba 2.5 ml , minotrol 16 twin pack ( 2h ) horiba 2.5 ml , minoclair horiba 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin total system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 biosystem , calibration solution c 2 biosystem , fluid pack c 3 biosystem , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 ( human ) 5x5 ml biosystem , control level –ii ( human ) 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuheck , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening , dilucel d cbc 5 part trivitron 20ltr , lycel dsp cbc 5 part trivitron 5 ltr , lyce cbc 5 part trivitron 3 litre , probe cleaner cbc 5 part trivitron 2x50 ml , control ( low, medium and high ) cbc 5 part 3x3 ml , field stain a and b each , truk solution ( glacier acetic acid + methyleneblus ) each , h e stain each , control level 3 ( human ) system pack biosystem , hydro cloric acid solution 100%for rotor washing solution 1x250 ml biosystem , nitric acid solution for rotor washing 1x250 ml biosystem , billuribin direct system pack erba...

Medical And Health Services - Rajasthan

31874581 lab regents kits & other item hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

31871865 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Rajasthan University Of Health Science - Rajasthan

31583020 chemicals reagents consumable items for department of microbiologywork list of annual rate contract for supply and installation of various chemicals & reagents & consumable items for department of microbiology sl. no. item description 1 electrical items : 2 absolute ethanol 3 acetone 4 afb (zn acid fast kit) 5 agar powder (bacteriological grade) 6 alberts stain 7 alkaline peptone water 8 anaerobic system envelope with palladium catalyst (gas pak) 9 alpha naphthol ar 10 aniline 11 anti hbc igm elisa kit 12 anti hbc (igm & igg) total test 13 anti hbe elisa test kit 14 hbeag elisa kit 15 anti hbs antibody elisa kit 16 hbs ag elisa kit 17 cytomegalovirus (cmv) igg elisa kit 18 cytomegalovirus (cmv) igm elisa kit 19 dengue ns1 antigen elisa kit 20 hav igm elisa kit 21 hcv igm elisa kit 22 hev igm elisa kit 23 ds dna elisa kit 24 ana elisa kit 25 herpes simplex virus (hsv 1 & 2) igg elisa kit 26 herpes simplex virus (hsv 1 & 2) igm elisa kit 27 rubella igg elisa kit 28 rubella igm elisa kit 29 toxoplasma igg elisa kit 30 scrb typhus igm ag elisa kit 31 toxoplasma igm elisa kit 32 biodegradable plasic bags (yellow, red, blue, black) 33 bleaching powder 34 blood agar base 35 blood culture bottle (adult) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. 36 brain heart infusion broth 37 cled media 38 conc. h2so4 39 corn meal agar 40 cover slips 22 x 22 mm 41 crp test kit 42 deionized water 43 dengue rapid test card along with ns1 antigen 44 deoxycholate citrate agar 45 di sodium hydrogen phosphate 46 discarding plastic buckets (yellow, red, blue, black) 20 litre 47 disposable individually packed centrifuge tube conical bottom capacity 50 ml 48 disposable polythene gloves 49 disposable sterile test tube with swab individually packed 50 dubos medium 51 ecoshield 52 edta powder 53 face mask 54 ferric chloride 55 filter paper box whartman no. 1, 12.5 cm circular 56 filter paper sheet whartman no. 1 57 fluid thioglycollate broth (anaerobic) with indicator 58 formalin pellets 59 glass marking pencils (red, white) 60 glass test tube 100 mm x 12 mm without rim 61 glass test tube 75 mm x 12 mm without rim 62 h2o2 (30%) 63 koh pellets 64 kovcks indole reagents 65 l arginine 66 l lysine mono dihydrochloride 67 lactophenol cotton blue solution 68 liquid paraffin 69 loeffler serum medium base bovine serum 70 lowenstein jensen medium 71 macconkey agar 72 macconkey broth 73 maltose 74 mannitol 75 mannitol salt agar 76 mccartney bottle 77 methyl red powder 78 microcentrifuge tube with cap capacity 2 ml 79 mr vp medium (glucose phosphate broth) 80 muller hinton agar 81 n acetyl l cysteine 82 n naphthyl ethylene diamine dihydrochloride 83 n,n,n,n tetra methyl p phenylenediamine dihydrochloride 84 nigrosin 10% 85 nutrient agar 86 oxidase disc 87 peptone water 88 perforated bucket (red, blue) 15 litre double bin 89 petridish glass 90 mm 90 petridish glass 75 mm 91 ph indicator strips 6.5 to 9 ph measurement 92 phenol 93 pottasium dihydrogen phosphate 94 pregnancy test card 95 ra factor kit 96 readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml 97 readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml 98 robertson cooked meat medium readymade 99 vdrl rapid test card 100 sabraud’s dextrose agar 101 selenite f broth bacteriological 102 sim agar 103 simmons citrate agar 104 sodium chloride 105 sodium hydroxide pellets 106 sodium hypochlorite solution 107 sterile autoclavable skirted plate 96 wells x 0.3 ml 108 sterile readymade plates of blood agar (90 mm size) 109 sterile readymade plates of macconkey agar (90 mm size) 110 sterile readymade plates of nutrient agar (90 mm size) 111 sterile storage vial 2 ml capacity 112 sterile storage vial 5 ml capacity 113 sterile transport medium (stuart medium) with test tube and swab individually packed 114 stool container with spoon 115 sulphanilamide 116 tcbs 117 triple layer mask 118 trypticase soya broth 119 tsi agar 120 urea agar base 121 viral transport medium 122 widal slide test 123 wilson and blair medium 124 xylene 125 xylose 126 resazurin powder 127 sterile readymade plates of dca (90mm size) 128 sterile readymade plates of tcbs (90mm ) 129 vancomycin powder 130 vencomycin disc 131 amikacin 30 µg 132 amoxycillin 30 µg 133 amoxyclav 20/10 µg 134 amphotericin b 135 ampicillin + sulbactum 136 azithromycin 15 µg 137 aztreonam 30µg 138 bacitracin (0.04 unit) 139 bile esculin disc 140 cefepime 30 µg 141 cefixime 5 µg 142 cefoperazone + sulbactum 75/10 µg 143 cefoperazone 75 µg 144 cefotaxime 30 µg 145 cefotetan 146 cefoxitin 30 µg 147 cefpirome 148 cefpodoxime 10 µg 149 ceftazidime + clavulanic acid 30/10µg 150 ceftazidime 30 µg 151 ceftriaxone 30 µg 152 cefuroxime 30 µg 153 cephalexin 30 µg 154 chloramphenicol 30 µg 155 ciprofloxacin 5 µg 156 clarithromycin 15 µg 157 clindamycin 2 µg 158 clotrimazole 159 colistin 160 cotrimoxazole 25 µg 161 cyclopirox 50 µg 162 dalfopristine 163 daptomycin 164 doripenam 10µg 165 doxycycline 30 µg 166 e strip for esbl detection 167 e strip for mbl detection 168 e strip oxacillin 169 ertapenam 10µg 170 erythromycin 10 µg 171 faropenam 172 fluconazole 25 µg 173 fosfomycin 200 µg 174 furazolidone 50 µg 175 fusidic acid 176 gentamicin 120µg 177 gentamicin 30µg 178 gentamycin 10 µg 179 griseofulvin 10 µg 180 hippurate 181 imipenam 10 µg 182 itraconazole 8 µg 183 kanamycin 184 ketoconazole 15 µg 185 levofloxacin 5µg 186 lincomycin 10 µg 187 linezolid 30 µg 188 meropenam 10 µg 189 miconazole 10 µg 190 moxalactum 191 nalidixic acid 30µg 192 netilmycin 30 µg 193 nitrofurantoin 300 µg 194 norfloxacin 10 µg 195 novobiocin 196 nystatin 197 ofloxacin 5 µg 198 onpg 199 optochin 200 oxacillin 1 µg 201 piperacillin + tazobactum 100/10 µg 202 piperacillin 100 µg 203 polymyxin b 30 units 204 pristinomycin 15µg 205 quinopristin 206 teicoplanin 30 µg 207 terbinafine 1 µg 208 tetracycline 30 µg 209 ticarcillin+clavulanic acid 75/10 µg 210 ticarcillin75µg 211 tigecyclin 15µg 212 tobramycin 10 µg 213 v factor 214 vancomycin 30 µg 215 voriconazole 1 µg 216 x + v factor 217 x factor 218 immersion oil 219 (occuet blood in stool ) kit hemoccult sensa aninophezone test 220 grams stain kit 221 hcv igmrapid card 222 sterile urine container single pack 223 culture loop (nicrome)1mm 24 gauge wire loop 224 culture loop (nicrome) 2mm24 gauge wire loop 225 cotton roll 226 disposable petri disc 90 mm 227 sterile disposable swab sticks with test tube 228 sterile disposable cotton swab (individual pack) 229 hbsag rapid test card 230 aluminium foil (72 meter) 231 rpr test kit 232 vaccutainer vial 4.5ml (serum activator without gel) 233 disposable plain tube 5ml (without cap) plastic 234 disposable plain tube 8ml (without cap) plastic 235 test tube stand 96 hole plastic 236 urea solu 40% 237 glass test tube 10ml 238 glass test tube 20 ml 239 aslo test kit 240 phenyl alanin agar 241 sulphide indole motility test (sim motility medium) 242 test tube holder bighole for 20ml test tube 243 disposable test tube 20ml ...

Jaipur Zila Dugdh Utpadak Sahakari Sangh Limited - Rajasthan

31308698 e tender for supply of aluminium foil for dahi cup 200 gm/400 gm at jaipur dairy. e tender for supply of aluminium foil for dahi cup 200 gm/400 gm at jaipur dairy. , aluminium foil for 200gm dahi cup , aluminium foil for 400gm dahi cup...

Sms Medical College - Rajasthan

31026062 rate contract for supply of consumable items for rtpcr lab n 95 mask (niosh certified) , isopropanol molecular grade , ethanol molecular grade , microcentrifuge tube 1.5ml rnase, dnase & pyrogen free , powder free nitrile glove medium , powder free nitrile glove large , cryo gloves medium size , powder free nitrile glove small , gloves latex large , gloves latex medium , gloves latex small , sodium hypochlorite 10% , yellow colored biosafety bag with biosafety symbol 30l , yellow colored biosafety bag with biosafety symbol 5l , red colored biosafety bag with biosafety symbol 30l , red colored biosafety bag with biosafety symbol 5l , black colored biosaety bag with biosafety symbol 30l , black colored biosaety bag with biosafety symbol 5l , nuclease free water molecular grade , cotton roll 500gm , surgical mask 3 play , pcr tube 0.2ml with caps , knee length gown disposable black open full sleves , shoe cover covering till knee , head cover , kim wips 100, 11.17x21.3cm , kim wips 500 37.33x42.16cm , micro centrifuge tube 0.5ml sterile , ppe jump suit with hand gloves and 2 pair shoe cover disposable , rna later [rna live] , rna zap [rna kill] , abro tape , cool racks for pcr tube (0.2ml) with temperature indicator , aluminium foil , discardingjar with swinging lid , mini coolers 20 degree , spray bottles , autoclavable transparent bmw bags 2 lt. capacity , 2% gluteraldehyde , screw capped serum storage vial 1.8 ml interal thread with silicon washer self standing and sterial , polycarbonate storage box 96 wells with stand ampoules 1.5 ml , pcr tube rack 1.5 ml , tissue roll (absorbent) , pcr tube 0.5ml , votrec mixer for tubes , absolute alcohol , aerosol free rnase ,dnase, sterile racked flter tips 0.5 10ul , aerosol free rnase ,dnase, sterile racked flter tips 1.0 10ul , aerosol free rnase ,dnase, sterile racked flter tips 100 1000ul , aerosol free rnase ,dnase, sterile racked flter tips 10 100ul , aerosol free rnase ,dnase, sterile racked flter tips 10 200ul , aerosol free rnase ,dnase, sterile racked flter tips 2.0 20ul , aerosol free rnase ,dnase, sterile racked flter tips 0.2 20ul , aerosol free rnase ,dnase, sterile racked flter tips 20 300ul , aerosol free filter tips 0.5 20 ?l , aerosol free filter tips 10 100 ?l , aerosol free filter tips 100 1000 ?l , micro titer pipette set variable volume 0.2–10 ?l fully autoclavable ce ivd certified , micro titer pipette set variable volume 10– 100 ?l fully autoclavable ce ivd certified , micro titer pipette set variable volume 100–1000?l fully autoclavable ce ivd certified , micro tips for 100 1000 ?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 10 100 ?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 2 10 ?l, low retention rnase, dnase & pyrogen free sterile , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 1 10ul , aluminium foil 72 meter , aspirator bottle with stopcock capcity 10 liters , autoclavable biosafety transparent bag 2l , bench protector size 32 x 460 cms , bottle top dispenser with bottle capcity 1 liter capacity 1 10ml , burner self ignating type or laminar air flow , cryo labels 33 x13 mm approx , cryo screw cap tubes with o ring molecular grade 1.8ml , cryo storage card board box 100 wells with cover 2.0ml , cryo storage polypropylene box 100 wells with cover 90c temp 1.8ml , cryo storage polypropylene box 81 wells with cover 90c temp 1.8ml , diamond marker , discardingjar with swinging lid 5 liter with biosafty symbol , disposable sterile specimen collection swab dracon type , distilled water , echoshield , face shields disposable , falcon tube 15ml sterile , falcon tube 50ml sterile , filter paper pkt no.1 12.5cms , filter paper sheet 46x57 cms , forcep pointed stainless steel 8 , goggles disposable fully covered broad , gown bluecloth back open full sleves , gown green cloth back open full sleves , gown red cloth back open full sleves , gown white cloth back open full sleves , hand sanitizer in dropping bottle 500ml , hand sanitizer with dispenser to be attached to wall , lab soakers size 16x20 pad , lint[ kim ]wips 145x200 mm , lint[ kim ]wips 380x600 mm , loop holder with nichrome wire , lysol , marker pen , micro amp optica 8 tube with cap and instrip type , micro pipette stand for 5 pipette , micro titer pipette set fixed volume 100?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 20?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 5?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 50?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 500?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 100 1000?l.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 1.0 10ul .single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 10 100ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 5 50ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 2 20ul.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 1 10ml . single channelfully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 5 50ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 30 300ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , microcentrifuge 8 tube rotor , microcentrifuge box with cover for 0.5ml with 100 wells , microcentrifuge box with cover for 1.5ml with 64 wells , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free0.5ml conical bottom , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free1.5ml conical bottom , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free2.0 ml conical bottom , microcentrifuge tube 1.5ml molecular grade sterile , microcentrifuge tube 2.0ml molecular grade sterile , mini cooler for pcr tube , optical pcr 8 tubes strip with cap (0.1ml) dnase/ rnase/ inhibition free) compatible with biorad rt pcr machine , parafilm 2x 250 , pcr cooler for 96pcr tube (0.2ml) 20c , pcr master mix with dntps, taq, mgci12, buffer 2000 rxns , pcr optical plate seal for 96 well plate , pcr plate non skirted low profile dnas rnaspyrogen free 96 well , pcr plate semi skirted low profile dnas rnaspyrogen free 96 well , pcr thermo conductive rack for 96 pcr tubes , pcr tube corbett type strip 100ul , pcr tube polypropylene 0.1ml low profile 8 well strip with cap , pcr tube polypropylene 0.2ml high profile 8 well strip with cap , pcr tube polypropylene 0.2ml low profile 8 well strip with cap , pcr tube polypropylene 0.2ml with caps , pcr tube polypropylene 0.5ml with caps , pcr tube rack 0.2 ml ,96 hole with cover , plastic cable lock tie type for discard bags disposable , polycarbonate storage box 96 wells with stand ampoules 1.5 ml , racks for falcon tubes 50ml , reversible racks for micro tubes and pcr tube with cover 96 holes , safety goggles , stop watch timer electronic , storage box 0.5ml (mct rack) , storage box 1.8ml (mct rack) , test tube plain 12x75mm , thermohygrometer digital , thermometer digital with probe for refrigerator , trough reservoir capacity 75 ml polypropylene , utility tray size 320x260 mm , utility tray size 360x310 mm , utility tray size 540x435 mm , vtm sampleracks for 120 tubes , vtm sampleracks for 62 tubes , vtm tube box 36 wells with cover , wash bottle 500ml new type , ziploc bags 12” x 8” , ziploc bags 4” x 3” , ziploc bags 8” x 6” , vtm with dacron swab (dacron swabs 2 nos. for each vtm tube) , manual multichannel micropipette variable volume autoclavable 100 300ul , eppendorf tube 1.5ml with screw capped self standing , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 100 300ul , tough tags for ampoules 1.5 ml...

Medical College - Rajasthan

31022922 rate contract for supply of consumable items for rtpcr labs rate contract for supply of consumable items for rtpcr labs , n 95 mask (niosh certified) , isopropanol molecular grade , ethanol molecular grade , microcentrifuge tube 1.5ml rnase, dnase & pyrogen free , powder free nitrile glove medium , powder free nitrile glove large , cryo gloves medium size , powder free nitrile glove small , gloves latex large , gloves latex medium , gloves latex small , sodium hypochlorite 10% , yellow colored biosafety bag with biosafety symbol 30l , yellow colored biosafety bag with biosafety symbol 5l , red colored biosafety bag with biosafety symbol 30l , red colored biosafety bag with biosafety symbol 5l , black colored biosaety bag with biosafety symbol 30l , black colored biosaety bag with biosafety symbol 5l , nuclease free water molecular grade , cotton roll 500gm , surgical mask 3 play , pcr tube 0.2ml with caps , knee length gown disposable black open full sleves , shoe cover covering till knee , head cover , kim wips 100, 11.17x21.3cm , kim wips 500 37.33x42.16cm , micro centrifuge tube 0.5ml sterile , ppe jump suit with hand gloves and 2 pair shoe cover disposable , rna later [rna live] , rna zap [rna kill] , abro tape , cool racks for pcr tube (0.2ml) with temperature indicator , aluminium foil , discardingjar with swinging lid , mini coolers 20 degree , spray bottles , autoclavable transparent bmw bags 2 lt. capacity , 2% gluteraldehyde , screw capped serum storage vial 1.8 ml interal thread with silicon washer self standing and sterial , polycarbonate storage box 96 wells with stand ampoules 1.5 ml , pcr tube rack 1.5 ml , tissue roll (absorbent) , pcr tube 0.5ml , votrec mixer for tubes , absolute alcohol , aerosol free rnase ,dnase, sterile racked flter tips 0.5 10ul , aerosol free rnase ,dnase, sterile racked flter tips 1.0 10ul , aerosol free rnase ,dnase, sterile racked flter tips 100 1000ul , aerosol free rnase ,dnase, sterile racked flter tips 10 100ul , aerosol free rnase ,dnase, sterile racked flter tips 10 200ul , aerosol free rnase ,dnase, sterile racked flter tips 2.0 20ul , aerosol free rnase ,dnase, sterile racked flter tips 0.2 20ul , aerosol free rnase ,dnase, sterile racked flter tips 20 300ul , aerosol free filter tips 0.5 20 ?l , aerosol free filter tips 10 100 ?l , aerosol free filter tips 100 1000 ?l , micro titer pipette set variable volume 0.2–10 ?l fully autoclavable ce ivd certified , micro titer pipette set variable volume 10– 100 ?l fully autoclavable ce ivd certified , micro titer pipette set variable volume 100–1000?l fully autoclavable ce ivd certified , micro tips for 100 1000 ?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 10 100 ?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 2 10 ?l, low retention rnase, dnase & pyrogen free sterile , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 1 10ul , aluminium foil 72 meter , aspirator bottle with stopcock capcity 10 liters , autoclavable biosafety transparent bag 2l , bench protector size 32 x 460 cms , bottle top dispenser with bottle capcity 1 liter capacity 1 10ml , burner self ignating type or laminar air flow , cryo labels 33 x13 mm approx , cryo screw cap tubes with o ring molecular grade 1.8ml , cryo storage card board box 100 wells with cover 2.0ml , cryo storage polypropylene box 100 wells with cover 90c temp 1.8ml , cryo storage polypropylene box 81 wells with cover 90c temp 1.8ml , diamond marker , discardingjar with swinging lid 5 liter with biosafty symbol , disposable sterile specimen collection swab dracon type , distilled water , echoshield , face shields disposable , falcon tube 15ml sterile , falcon tube 50ml sterile , filter paper pkt no.1 12.5cms , filter paper sheet 46x57 cms , forcep pointed stainless steel 8 , goggles disposable fully covered broad , gown bluecloth back open full sleves , gown green cloth back open full sleves , gown red cloth back open full sleves , gown white cloth back open full sleves , hand sanitizer in dropping bottle 500ml , hand sanitizer with dispenser to be attached to wall , lab soakers size 16x20 pad , lint[ kim ]wips 145x200 mm , lint[ kim ]wips 380x600 mm , loop holder with nichrome wire , lysol , marker pen , micro amp optica 8 tube with cap and instrip type , micro pipette stand for 5 pipette , micro titer pipette set fixed volume 100?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 20?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 5?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 50?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set fixed volume 500?l fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 100 1000?l.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 1.0 10ul .single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 10 100ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 5 50ul single channel .fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 2 20ul.single channel . fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 1 10ml . single channelfully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 5 50ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , micro titer pipette set variable volume 30 300ul eight channel fully autoclavable ce ivd certified .super blow out piston with volumes of 50ul and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide. , microcentrifuge 8 tube rotor , microcentrifuge box with cover for 0.5ml with 100 wells , microcentrifuge box with cover for 1.5ml with 64 wells , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free0.5ml conical bottom , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free1.5ml conical bottom , microcentrifuge tube (eppendorf) dnase, rnase and pyrogen free2.0 ml conical bottom , microcentrifuge tube 1.5ml molecular grade sterile , microcentrifuge tube 2.0ml molecular grade sterile , mini cooler for pcr tube , optical pcr 8 tubes strip with cap (0.1ml) dnase/ rnase/ inhibition free) compatible with biorad rt pcr machine , parafilm 2x 250 , pcr cooler for 96pcr tube (0.2ml) 20c , pcr master mix with dntps, taq, mgci12, buffer 2000 rxns , pcr optical plate seal for 96 well plate , pcr plate non skirted low profile dnas rnaspyrogen free 96 well , pcr plate semi skirted low profile dnas rnaspyrogen free 96 well , pcr thermo conductive rack for 96 pcr tubes , pcr tube corbett type strip 100ul , pcr tube polypropylene 0.1ml low profile 8 well strip with cap , pcr tube polypropylene 0.2ml high profile 8 well strip with cap , pcr tube polypropylene 0.2ml low profile 8 well strip with cap , pcr tube polypropylene 0.2ml with caps , pcr tube polypropylene 0.5ml with caps , pcr tube rack 0.2 ml ,96 hole with cover , plastic cable lock tie type for discard bags disposable , polycarbonate storage box 96 wells with stand ampoules 1.5 ml , racks for falcon tubes 50ml , reversible racks for micro tubes and pcr tube with cover 96 holes , safety goggles , stop watch timer electronic , storage box 0.5ml (mct rack) , storage box 1.8ml (mct rack) , test tube plain 12x75mm , thermohygrometer digital , thermometer digital with probe for refrigerator , trough reservoir capacity 75 ml polypropylene , utility tray size 320x260 mm , utility tray size 360x310 mm , utility tray size 540x435 mm , vtm sampleracks for 120 tubes , vtm sampleracks for 62 tubes , vtm tube box 36 wells with cover , wash bottle 500ml new type , ziploc bags 12” x 8” , ziploc bags 4” x 3” , ziploc bags 8” x 6” , vtm with dacron swab (dacron swabs 2 nos. for each vtm tube) , manual multichannel micropipette variable volume autoclavable 100 300ul , eppendorf tube 1.5ml with screw capped self standing , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile, 100 300ul , tough tags for ampoules 1.5 ml...

Medical And Health Services - Rajasthan

30684193 yearly contract for reagents in pathology lab under mnjy tender for pathology lab reagents under mnjy s. creatinine kit (for semi auto), s. glucose, s. creatinine kit (for semi auto), s. cholestrol kit (for semi auto), s. cholestrol kit (for semi auto), s. bilirubin t kit (for semi auto), s. bilirubin d kit (for semi auto), s. urea kinetic, urea berthlot (end point), urea berthlot (end point), s. sgot kit (for semi auto), s. sgpt kit (for semi auto), s. sgot kit (for semi auto), s. sgpt kit (for semi auto), s. alkaline phosphatage kit (for semi auto), s. total protien (for semi auto), s. albumin (for semi auto), s. ldh (for semi auto), s. ldh (for semi auto), s. amylase (for semi auto), s. amylase (for semi auto), s. uric acid (for semi auto), s. calcium kit (for semi auto), s. calcium kit (for semi auto), s. ck nac (for semi auto), s. ck mb (for semi auto), s. ck mb (for semi auto), s. triglyceride kit (for semi auto), s. triglyceride kit (for semi auto), hdl direct, s. hdl cholestrol ppt, biochemestry control, erba xl wash, chloride, gamma gt, gylocylate hemoglobin hba1c, lipase, phosphorus, cystatin c, csf protein test, hemocysteine, general items, afb stain (ready to use), autoclave tap 1 (thermopile spors), acetone liquid, aluminium foil, ayer spatulla disposable (sterile), absolute alcohal 99 %, adhesive tap 0.5 inch, aslo kit, anti abd, ahg (anti human globulin) vial, ahg (anti human globulin) vial, anti a1, acetic acid galcil 5%, buffer bottle, blotting paper sheet, bleeching powder, banedict solution, blood mixer, beakar glass, beakar glass, bovine albumin, bovine albumin, bovine albumin 22%, bovine albumin 22%, bd vaccutionor blood collection needle 21,22, blood collection tube for esr black cap 4 ml., capillary tube, chickengunia cards igg igm, crp kit, cover slip 22x60x.4 mm.(blue star,gem,top only), cover slip 22x50x.4 mm. .(blue star,gem,top only), cover slip 22x40x.4 mm. .(blue star,gem,top only), cover slip 20x25x.4 mm. .(blue star,gem,top only), cover slip 24x60x.4 mm (blue star,gem,top only), cover slip for neubauer chamber 1mm thick, copper sulphate powder, copper sulphate powder, copper sulphate powder, chloroscope with reagent, coplin jar, cell for gluometer, cover slip 18x18 mm (blue star,gem,top only), cell counter for dlc 8 key, clot activator vial red cap 4 ml., clot activator vial red cap 6 ml., diastix, disposable needle 22 mm, disposable needle 24 mm, disposable syringe 5 ml., disposable syringe 10 ml., disposable droper, disposable gloves 6, disposable gloves 6.5, disposable gloves 7, disposable gloves 7.5, dropping bottle plastick 100 ml., dropping bottl plastick 500 ml., dpx mount, diamond marker, drabkin’s solution and control solution, distilled water, dengue test kit ( ns1 igg igm combopack by rapid card test), dengue elisa test kit (ns1), dengue elisa test (igm), dengue rapid card ( igg, igm), esr fluid (sodium citrate), esr tube ( pippate) disposable, esr (pippate) glass with cap disposable, edta powder, eosin stain, ethylalcohol absolute, eosinophil diliuting fluid, field stain a, field stain b, forceps (simple), jsb stain i, jsb stain ii, flask glass (borosil), flask glass (borosil), fnac plunger, fixative for cyotology (99% methanol), filter paper, formaline, glass marking pencil (red), geimsa stain, geimsa stain, glycrine, gel activator vial 4 ml., gel activator vial 8 ml., hypochlorite 5% solution, hbsag rapid test cards, hb tube square, hb pippate, heamatoxyline mono hydrted ms reagent, hand sanitizer, hand sanitizer, k3 (cbc) vial double cap, k3 (cbc) vial single cap, koh solution, liquid parrafin, lugols iodine, leishmen’s stain, liquid cleaning agent for glass/plastic, liquid hand soap (savlon ), liquid hand soap (dettol), liquid hand soap (lifeboy), lancet, lens paper, multi stix, micro tips 5 20 ul, micro tips 200 μl, micro tips 1000 μl, micro glass slide 1.33mm (blue star,gem,top only), micro glass slide 1.25mm (blue star,gem,top only), micro glass slide76x26 mm (blue star,gem,top only), micro pippate fix volume 10μl, micro pippate fix volume 20μl, micro pippate fix volume 50μl, micro pippate fix volume 100μl, micro pippate fix volume 500μl, micro pippate fix volume 1000μl, micro pippate varible 10 100 μl, micro pippate varible 100 1000 μl, micro pippate stand plastick, macountoss, face mask disposable, new methehylne blue for reticulocyte stain, methehylne blue 1%, n/10 hcl, improved neubaurs chambar (counting chambar), nitric acid ( hno3), oil imersion lens, pt vials, pcv tube, papnaculer stain ready to use, plastic dropper, pasture pippate, propyle alcolhal, platelet diluting fluid, ppe kits, ph paper strip, prob cleaner for cbc machine accurex, paper roll for semi auto anaylser 4.5, reporting cbc paper roll 50mm x 20m, reporting cbc paper roll 57mm x 20m., reporting cbc paper roll 57mm x 10m., rubbur bulb b dropper, ra factor kit, rapid malaria test cards ( antigen), rapid malaria (antigan , antibody) combopack, sulphar powder, semiauto anylaser printer roll, sticker for sample vials, sample vial with cover 5 ml, sample vial with cover 10 ml., staining reactanguler beaker, staining rack, spirt lamp, test tube glass 3 inch (12x75) borosil, test tube glass 4 inch (12x100) borosil, test tube pvc 2 inch, test tube pvc 3 inch, test tube pvc 4 inch, test tube pvc 6inch, tlc fluid, tec fluid, trbc fluid, tissue paper roll, tourniquit, test tube stand plastic for 48tubes, test tube stand plastic for 100 tubes, trop t rapid test card, thromboplastin ( pt reagent), test tube cleaning brush, thermacol box, digital thermomater with sensor for regrigetor, tongue depresser disposble, urine pregnancy strips, urine pregnancy cards, uristicx, urine pots with label and cover 30 ml., urine anyalser paper roll 57mm x 10mtr, vdrl test kit, vdrl card, vdrl rapid test strip, vtm ( viral transport media), vacctuainer plane 4 ml., vacctuainer plane 8 ml., vacctuainer k2 edta 4 ml., vacctuainer k3 edta 4 ml., widal slide kits (4x5ml.), widal tube agglutation reagent, wbc diluting fluid, widal card, wintrobe tube esr, xylene, zeeper plastic 6 inch, zeeper plastic 8 inch, z n stain, pm kit for semi auto (statfax), pm kit for fully auto (randox), wash solution for fully auto (randox) i, wash solution for semi auto for fully auto_analyser, wash solution for fully auto (randox) ii, psa kit, psa kit (elisa method), calibartion sera leval 2 (randox), calibartion sera leval 3 (randox), aluminum ammonium sulphate hydarted, acetic a, glacial acetic a, ammonium hydride 1%, eosin yellow a, eosin yellow b, light green sf, potash alum, formal salile 5%, formal salile 10%, timer electronic, phyloxin, orange phosphotungesatic acid, slide cabinet (100 slide), slide staning bucket with handle, slide box, measuring cylinder glass and silikon 50 ml., measuring cylinder glass and silikon 100 ml., measuring cylinder glass and silikon 500 ml., measuring cylinder glass and silikon 1000 ml., hcv card (rapid test), esr cap (disposable) for glass tube 500,1000 cap, human assey multisera l 2 (randox), human assey multisera l 3 (randox), cuscos speculun, mask n 95, glucostrip for glucocare sence glucometer, glucostrip for bio sence glucometer, disposable pap smear kit, delivery disposable kit (cap, mask, aprine, shoescap ), deliverydisposablekit(cap,mask,aprine,shoescap,googles,bedsheet,kallispad babysheets etc.), yunkur suction set with fine tips suction canola, anit a, anit b, anti d, sargical mask 3 layer, lysol 50%, digital thermomater for refrigertor with display, sprayer bottle 500 ml./1000 ml., beakar glass 100 ml., covid 19 rapid card, pencil cell for glucometer/ timer, ketostx, paper roll for pt anaylser (116mmx20 mtr.), torrniquet belt, tubler (cotton material flexible), hiv rapid test card, gram stain, serum magnisium test kit, serum lithium test kit, csf protin test kit, csf chloride test kit, csf suger test kit, urine total protin test (24 hour) test kit, acid phosphatase test kit, accu chek glucometer strip, glucocare sence glucometer, bio sence glucometer, ggt test kit....

Shri Karan Narendra Agriculture University - Rajasthan

30683533 open tender for chemicals and glassware 1. i , 2 dichioroethane 2. 1 naphthol ar 3. 2 3 5 tn phenyl tetrazolium chloride ( flc ) 4. 2, 4 d 5. 2, 4 dinitro phenyl hydrazine ( dnph ) 6. 2, 6. dicholorophenol mdophenol 7. 30% hydrogen peroxide ar grade 8. 5 sulphosalicylic acid dihydrate ar 9, absolute alcohol absorbant cotton 10. 11. acetic acid 12. acetic acid glacial ar 13. acetocarmine solutions — 14. acetone — 15. acetone ( hplc grade ) 16. acetone ar ( special grade ) 17. acetone ar grade 18. activated charcoal 19. acid fuchsine 20. acrylamide 21. activated charcoal ar grade 22. agar powder ( bacteriological grade ) 23. almuniumm chloride = 24. aluminium chloride hexahydrate extrapure ar, 99% — 25. aluminium foil — — 26. ammonia buffer solution — 27. ammonia solution sp. gr 0.91 — 28. ammonium acetate ar grade — 29. ammonium chloride — 30. ammoniunn dihydrogen ortho phosphate fermous sulphate ammonium hexahydrates 31. 32. 33. ammoniurn inolytxttearjradee ammonium molybdate tetrahydrate extrapure 34. ammonium oxalate monohydrate 35. 36. ammonium oxilate ugeiulphate ( iya ammonium sulphate 37. 38. anhydrous sodium carbonate 39. anthorne reagent 40, anthrone ar 41. apron coat 42. ascorbate 43. ascorbic acid 44. azoxystrobin 45. 46. azosystrobn + hexaconazole azoxystrobin +tebuconazole 47. bacillus subtilis 48. bap 49. 50, 51. 52. bap solution barium chloride dihydrate barium chloride solution ( 10% ) barium sulphate — 53. beer extract ar grade 54. benomyle 55. bis acrylamide = 56. blitox 50% wp ( coc ) — s7. borex 58. boric acid ( powder ) 59. bovine serum albumin ( bsa ) 60. bromocresol blue indicator 61. bromocresol_green 62. — bromocresol purple sodium salt 63. bromophenol blue ( bpb ) 64. bromothymol blue indicator powder 65. bsa ( bovine serum ) 66. buffer ampule ( set of 6 ) 67. buffer tablet of ph ( 4.0 ) 68. buffer tablet of ph ( 7.0 ) 69. cadmium chloride monohydrate 70. calcium nitrate tetrahydrate 71. calcium carbonate ar grade 72. calcium chloride 99% extra pure — 73. calcium chloride dihydrate 74. calcium sulphate anhydrous 75. calcium sulphate dihydrate 76. captan 77. carbandzim+ mancozcb 78. carboxin 37.5% + thiram 37.5% ( vitavaxepower ) 79. carmine powder 80. castor oil 81. catechol extrapure 99% 82. cedar wood oil medium chloroform ( ethanol stabilized ) 83. 84. chloroform ( hplc grade ) 85. chlorothalonil 86. chiortetracycline hydrochloride 87. citric acid 88. clove oil 89. cobalt chloride hexahydrate ( coci2.6h20 ) 90. cobaltus chloride 91. cobaltus nitrate hexahydrate 92. concentrated sulpburic acid 93. coomassie brilient blue r250 94. copper sulfate pentahydrate ( cuso4.5h20 ) 95. copper sulphate 96. corn meal media 97. cotton blue _, i • flflb%.its 98. cxystal violet ar grade 99. ctab ( cetyl thmethylammonium bromnide ) m 100. czapek”s dox agar 101. d ( + ) ribose 102. darco g 60 ( activated charcoal ) 103. detergent 104. dextrose 105. d fructose a / r 106. di sodium hydrogen arsenate 107. dibasic sodium phosphate 108. diehylene ti i amine penta acetic acid ( dtpa ) ear.grade 109. diethyl ether ar ( stabilised ) 110. diethyline tr amine penta actic acid ( dtpa ) 111. difenconazole 112. dinmethyl sulfoxide ( dmso ) 113. 114. diphenylamine indicator di sodium hydrogen arsenate 115. disodium tetrachloropalladat ( na2pdcl4 ) 116. dntps mix ( 10 mm ) 117. edta ( ethylenediaminetetraacetic acid disodium salt dehydrate ) 118. ethanol hplc grade 119. ethidiumn bromide 120. ethyl alcohol 121. ethyl meihanesulfonate ( ems ) 122. ethylene alcohol 123. ethylene dia minetetraacetic acid jna2 edta ) eucalyptus oil ferric.chloride 124. 125. 126. ferrion indicator 127. ferrous ammonium sulphate ar grade 128. ferrous sulphate ( feso4, 7h20 ) ar 129. ferrous sulphate hypt 130. filter paper sheet i jv. i ituci paper o.iueel? 131. folin & ciocalteus phenol ( fcp ) reagent ar 132. folins uric acid 133. formaldehyde 134. fosetyl al 135. gallic acid pure, 98% ( 3, 4, 5 trihydroxybenzoic acid ) 136. glacial acetic acid 137. glucose ar grade 138. glutamic acid 139. glycerene 140. glycerol 141. glycine 142. gum acacia 143. haxen 144. hexaconazole 145. hexaconazole 4% + zincb 68% 146. hoaglands no. 2 basal salt mixture 147. huwasarn spray ( nanosilver & peroxide ) 148. hydrochloric acid 149. hydrochloric acid 0.5n aq. solution 150. hydrochloric acid lr hydrogen dichloroethan 151. 152. hydrogen peroxide 30% 153. hydrogen peroxide 6% 154. hydroguinone 155. hydroxyl amines ( ha ) 156. hydroxylamine hydrochloride 157. iaa 158. iaa solution 159. iba 160. iba solution 161. iodide crystals 162. iodine ar grade 163. iodine solution 1% w / v 164. iron sulphate iron tartrate isoamyl alcohol 165. 166. 167. isopropanol alcohol 168. kavach ( syngenta ) 169. kh2po4 170. laborine 171. lactic acid ar l ascorbic acid extrapure 172, 173. l glycine ( triglycine ) extrapure, 99% 174. linsecd oil 175. 176. linsced oil cake liquid nitrogen 177. l phenylalanine extrapure chr, 99% 178. l tyrosine for biochemistry 179. magnesium chloride 180. magnesium sulfate heptahydrate ( mgso4, 7h20 ) 181. malt agar 182. malts media 183. mancozeb 184. manganese sulfate monohydrate ( mnso4. h20 ) 185. manganese sulphate 186. manitol ar grade 187. martins mcdia 188. mercapto ethanol 189. mercuric chloride ar 190. metalaxyl m ( ridomil gold ) 191. metaphosphoric acid 192. methanol 193. methanol ( ar grade ) 194. methanol hplc grade 195. methionine 196. methyl blue indicator ar grade 197. methyl methanesulfonale ( mms ) 198. methyl orange indicator 199. methyl red indicator 200. mgcl2 201. molyclean ma 03 phosphate free 202. molysol ‘e’ ar 203. monobasic sodium phosphate 204. myclobutanil 205. n ( 1 naphthyl ) ethylene diamme hcl ( n ned ) 206. n n methylenebisacrylamide 207. n orthophosphoric acid 208. n propanol 209. n / 10 sodium hydroxide 210. na2co3 211. naa 212. naa solution 213. 214. 215. 212. naa solution 216. neem oil 217. nesseller reagent 218. nessler reagent ar grade 219. n hexane 99% ar 220. nicotinic acid 221 . ninhydrin ar ( 99% assay ) 222. nitric acid 223. nitro blue tetrazolium ( nbt ) 224. nutrient agar 225. nutrient agar readymade 226. oat meal media 227. 0 dianisidine methanol 228. orcinol 229. ortho pbosphodic acid 230. oxalic acid 231 . oxaloacetic acid / 232. p nitrophenyl sulphate naci nano2 naoh 233. pacelio uslilacinus 234. paraffin wax 235. pcnb ( pentachloromtrobenzene ) 236. pda readyinade 237. peg 6000 238. 239. peptone ar grade petroleum ether ( 60 1o0°c ) 240. petroleum elher 60 80c 241. phenophthalin indicator 242. phenol phenol crystalline extrapure ar 243. 244. phenol disalfonic acid 245. phenolphthalein indicator power 246. phosphoric acid 247. p nitrophenol phosphate ar grade 248. polyvenylpyrolidase 249. polyvinylpyrolidone ( pvp ) 250. potasium meta bi sulphite 251. potassium dicromnate 252. potassium hydroxide pellets — 253. potassium iodide 254. potassium acetate — 255. potassium chloride 256. potassium chromate ar 257. potassium dichromnate 258. — potassium dihydrogen phosphate 259. potassium femcyanide 260. potassium hydrogen sulphate 261. potassium iodide ( k! ) 262. potassium metabisuiphite 263. potassium oxalate potassium permanganate 264. 265. potassium permanganate ar grade 266. potassium permangnate 267. potassium sulphate 268. potassium titrate 269. potato dextrose brolh 270. pottassium hydroxide 85% ar pottassium nitrate 99% ar — propiconazole ( tilt ) 271. 272. 273. propineb ( antracol ) 70 w% 274. protein ladder marker ( mid range ) — 275. pyridoxine hc1 276. pyrogallol extrapure 277. rapd marker ( molecular markers different_series ) . 278. raxil ( bayer ) 279. resorcinol ar 280. rutin trihydrate pure 99% 281. saffranin 282. salicyclic acid 283. sesame oil 284. silver nitrate 285. sodium chloride 286. sodium acetate anhydrous 287. sodium acetate thhydrate 288. sodium arsanate 289. sodium azide 290. sodium benzoate 291. sodium bicarbonate 292. sodium chloride 293. — sodium chloride ar grade 294. sodium citrate 295. — sodium cobalt nitrite 296. sodium dthydrogen phosphate 297. — sodium dodicyl sulfate 298. sodium hydrogen carbonate ar 299. sodium hydroxide ar grade 300. sodium hydroxide extrapure ar 301. sodium hypochloride 302. sodium molybdate dihydrate ( na2moo42h2o ) 303. sodium nitrite 304. sodium phosphate 305. sodium potassium tartarate tetrahydrate 306. sodium silicate 307. sodium thiosuiphate 308. sodium tungstate dihydrate extrapure ar, _99% 309. stannous chloride dihydrate 310. streptocycline 311. streptomycin sulfate 312. sucrose 313. sulfex 315. suiphosalicylic acid 316. sulphuric acid 317. sulphuric acid 98% ar 318. tag buffer 319. taq polymerase ( su / pl ) 320. tebuconazole 321. temed 322. tergitol np 10 323. thiamine hcl 324. thiobarbituric acid 325. thiophanate methyl 7o% wp 326. toluene 327. total hardness indicator tablets 328. tri chioroacetic acid 329. trichoderma harzianum 330. tricyclozol8%+mancozeb62% 331. triethylamine ( tea ) 332. triphenyl formazan ( ipf ) ar grade 333. trishcl 334. triton x l00 335. universal indicator solution 336. v8 agar medium ( vinegar ) 337. vitavax power h2re338. wettable sulfur 339. xylene 340. yeast extract ar grade 341. zinc chloride 342. zinc oxide 343. zinc sulfate tetrahydrate ( znso4.4h20 ) 344. zinc sulphate heptahydrate 1. beaker ( graduated ) 25, 50, 100, 250, 500, 1000 ml capacity 2. bod bottle 125 ml, 300ml 3. reagent bottle reagent 100, 125, 250 ml 4. burettes 5otnl 5. conical flask graduated 50, 100, 150, 250, 500ml 6. conical flask standard ground mouth250, .500_ml 7. cotton ( in gm. ) 8. cover slip ( square ) 22 mm 9. cover slips ( round ) 22 mm 10. digestion flask 100 ml 11. dropping bottle 50 ml 12. dropping bottle 500 ml 13. filter paper ordinaryl2.5 cm ( 100 circle ) 14. filter paper sheet 15. filterpaperwhatmanno. 4112.5 cm ( 100 circles ) 16. funnel 17. glass road 18. glass tubes 19. kejldahl flask l0omi round bottom long nack 20. kejldahl flask 500ml round bottom long nack 21. laboratory tray plastic ordinary 22. measuring cylinder 50, 100, 250 ml capacity 23. measuring cylinder with pour out hexagonal base 1o0mi graduated — 24. measuring cylinder with pour out 25. measuring cylinder with pour out hexagonal base 250ml graduatcd 26. measuring cylinder with pour out hexagonal base 25ml graduated 27. measuring cylinder with pour out hexagonal base 500ml graduated 28. measuring cylinder with pour out hexagonal base soml graduated 29. measuring cylinder with pour out hexagonal base 5ml graduated 30. measuring mugs transparent 500 ml 31. micro pipette adjustable automatic 32. ocular micrometer 10mm with 100 divisions 33. permanent glass slide set of meiosis in plants 34. pemmanent glass slide set of mitosis in plants 35. permanent slide of all parts of root., leaf and_stem 36. _______ permanent slide of anatomy of dicot root 37. permanent slide of anatomy of dicot stem 38. permanent slide of anatomy of lear 39. pemmanent siide of anatomy of monocot.root 40. permanent slide of anatomy of monocot stem 41. pestle_&_mortal 42. petri culture dish 90 160 mm cover diameter 43. petri plates 5cm cover diameter 44. petri plates 10 cm cover diameter 45. petridish 46. pipette 1 ml graduated pipette 10 ml graduated pipette 2 ml graduated pipette 5 ml graduated 47. 48. 49, 50. plain slide 76x26 mm pre cleaned ready.for_use 51. reagent bottle 250rnl amber colour 52. reagent_bottle 500m1 53. reagent bottle 500ml amber colour 54. reagent bottles 125 ml 55. reagent bottlesl00 ml capacity 56. room themmometer in celsius 57. [ thermometer in celsius 58. round bottom flask 250 ml 59. slide storage tox for 25 pieces of slide 60. specimen glass jars ( 1 & 2 ltr. ) 6l stage micrometer ( l”x 3” ) 1 mm, 100 divisions 62. staining jar and rack for 24 pieces of slide 63. test tube 12 x 75 mm 64. test tube 15 x 125 mm test tube 16 x 16 x 16mm 65. 66. test_tube_25 x_100_mm 67. test_tube_25_x.200.mm 68. test tube stand 69. volumetric flask 1000 ml with stopper ( size 24 / 29 ) , flat bottom 70. volumetric flask 100ml with stopper ( size 14 / 23 ) , flat bottom 71. volumetric flask 250m1 with stopper ( size 14 / 23 ) , flat bottom 72. volumetric flask 25ml with stopper ( size_10 / 19 ) , _flat bottom 73. volumetric flask 50ml with stopper ( size 10 / 19 ) , flat bottom 74. wash bottle 500m1 75. watch glass 65 mm dia 76. watch glass 80 mm 77. whatmnan no.40 filter paper 78. graduate pipette 79. graduate pipette 80. graduate pipette 81. graduate pipette 82. filter paper whatman 42 83. m wash bottle 84. test tube stand 85. pipette stand 86. polylab polypropaline test tube stand 87. pipette filler 88. pipette filler 89. pipette filler 90. burette 91. burette stand 92. slides 93. cover slips 94. petri plates 95. inoculation nddle 96. volumetric flask 97. tissue paper roll 98. wide mouth reagent bottle graduated with screw cap ( 250 ml capacity. transperent ) 99. wide mouth reagent bottle, graduated with screw cap ( 500 ml capacity, transperent ) 100. wide mouth reagent bottle graduated with screw cap ( 1000 ml capacity, transperent ) 101. wide mouth reagent bottle graduated with screw cap ( 2000 ml capacity, transperent ) 102. wide mouth reagent bottle graduated with screw cap ( 250 ml capacity, amber colour ) 103. wide mouth reagent bottle graduated with screw cap ( 500 ml capacity, amber colour ) . 104. wide mouth reagent bottle graduated with screw cap ( 1000 ml capacity, _amber_colour ) 105. round bottom soxhiet flask 250 ml 106. rnd bottom soxhiet flask 500 ml i 107. beaker low form, heavy wall with double capacity scale, 250, 500, 1000 ml 108. brush beaker 109. brush bottle 110. burettes, 100 ml capacity, division 0.1 ill. burette brush 112. quartz crucible with lid, tolerance upto 2000oc 113. crucible holders 114. measuring cylinder with hexagonal base, cap. 5, 10, 25, 50, 100, 250, 500, 1000, 2000 ml. 115. flask volumetric with pp stoper, 20, 25, 50, 100, 200 250, 500, 1000, 2000 ml capasity 116. brush flask 117. test tube stand made of polypropylene & polycarbonate ( 3 tier ) 25 mm x 24 tubes, 25mm x 18, 25mm x 36, 32mm x 12 tubes 118. spatula, stainless steel, one end spoon & one end flat, 125 mm, 200mm, 300mm 119. forceps, straight fine points, 100, 200, 300mm size 120. micropipettes, fully autoclavable, uv, resistance, digital volume setting, .volume_range v vnuttic iauigc 121. 100 1000 ul ( 5 ul increment ) , 500 5000 ul ( 50 ul increment ) 122. funnel 75 mm 123. pipette 1 ml graduated 124. pipette 10 ml graduated 125. pipette 2 ml graduated pipette 5 ml graduated 126. 127. conical flask standard ground mouth 250 ml 128. conical flask standard ground mouth 500 ml 129. absorbant cotton 130. filter paper ordinary 12.5cm ( 100 circle ) 131. filter paper sbeet 132. filter paper whatman no. 41, 12.5 cm ( 100 circles ) 133. filter paper whatman no. 42, 12.5 cm ( 100 circles ) 134. glass road — 135, glass tubes ( 18xl50 ) 136. petriculture dish ( 90 160 mm diam. ) with cover 137. petn plates ( 10cm diam. ) with cover 138. petridish_ ( 9cm ) 139. room thermometer in celsius 140. whatman no. 40 filter paper 12.5 cm ( 100_in_pies ) 141. beaker ( graduated ) 100 ml 142. beaker ( graduated ) 250 ml 143. beaker ( graduated ) 500 ml 144. beaker ( graduated ) 1000 ml 145. bod bottle 125 ml 146. bod bottle 300 ml 147. burettes 50 ml 148. burettes_stand 149. conical flask graduated 50 ml 150. conical flask graduated 25 ml 151. conical flask graduated 100 ml 152. conical flask graduated 250 ml 153. conical flask graduated 500 ml 154. cover slip ( square ) 22 mm 155. digestion flask 100 ml 156. digestion flask 250 ml 157. kejdahl flask 100 ml round bottom long neck 158. kegdahl flask 500 ml round bottom lojnecko 159. laboratory tray ( plastic ) ordinary 160. measuring cylinder 50 ml — 161. measuring cylinder 100 ml 162. measuring cylinder 250 ml measuring cylinder 50 ml 164. measuring cylinder with pour out hexagonal base 500 nil graduated 165. measuring cylinder with pour out hexagonal base 10 ml graduated 166. measuring cylinder with pour out hexagonal base 25 ml graduated 167. measuring cylinder with pour out hexagonal base 50 ml graduated 168. measuring cylinder with pour out hexagonal base 5 ml graduated 169. mortar & pestle 170. porcelain dish 171. reagent bottle 250 ml amber colour 172. reagent bottle 500 ml amber colour a’ ;iel;5 ;g ( i i;i.; 174. soxlet apparatus — 175. volumetric flask 1000 ml with stopper ( size 24 / 29 ) , plate bottom 176. volumetric flask 100 ml with stopper ( size 14 / 23 ) , plate bottom 177. — volumetric flask 500 ml with stopper ( size 14 / 23 ) , plate bottom 1 7q — £1 1 luppel size 1’f / 23 ) , piate bottomm — volumetric flask 250 ml with stopper ( size 14 / 23 ) , plate bottom 179. — volumetric flask 25 ml with stopper ( size 10 / 19 ) , plate bottom 180. volumetric flask 50 ml with stopper ( size 10 / 19 ) , plate botton 181. cuvette 182. hote plate 183. cleaning brush 184. tilt measuring bottle 1 ml 185. —w.. tilt measuring bottle 2 ml 186. tilt measuring bottle 5 ml 187. 188. tilt measuring bottle 10 ml apron coat 189. hand gloves 190. labolene 191. cavity block 192. tele counter 193. slide box plastic 194. 195. glass slides nematode 196. 178. sieve set 197. non absorbent cotton 198. absorbent cotton 199. round bottom flask 200. round bottom flask 20i. scalpel 202. spint lamp 2o3. trial tag plastic, aluminun 204. trial sticks 205. rubber bands 206. parafihim tape 207. inoculation needle 208. experinental diary 209. steel grip ( 3 meter, 5 meter ) 210. coconut pit ‘345. tissue paper roll etc...

Medical And Health Services - Rajasthan

30683532 purchase of reagents hemoglobin tube ( round ) & squire ti .c pipettes i lemoglobin pipette [ sr tube frilter paper neubaurs chamber sahlis haemolobinomctcr ilc fluid n / j0 hcl giemsa stain i ueishman powdkr capillary iube bcnediect soln liguer anmonia tincture iodine 5% benzidine ( ir.5gram i lydmgcn peroxide glacial acctic acid sodium nitro prusside ammonium sulphate thx ) l soin / lobopol dropper sulphur powder liquid paraffin sodium citrate 3.8% sulphuric acid llarjum chloride soln, fouchets reagent ehrlichs reagent ____ cone. i ino 3 ( nitric ) acid total eosinophil count fluid semen diluting fluid gentian violet mehylene blue l.eishman stain formalin ammonia solution dpx haenatoxyl in ( mayer ) eosin absolute alcohol blood sugar kit s. cholestrol kit vdrl test strip soot sgpt s.enilirubin s.alkaline phusphatase s.alkaline phusphatase s. creatinine s. uric acid, s. triglyceride sild’ libs card cpk.mb. ( card test ) troponin l ( test card ) s.calcium s.li ) ll s.total protein s.albumin s.cpk mb s.cpk nac .m.i • i’uutnmji’mmi immi, 4 11s1’ 1wuu, l .. a ili1, control for [ ho chemestry multistix tourmiguet widal test kit ra factor asotitre crp test sheath for cell counter sfri ( countenders 80+ ) diluclair for cell counter sfrl ( coungendkr 80+ ) lysoglobin for cell counter ( sfri ) countender 80+ conroll for cell counter ( sfri ) countenders 80± diluent for cell counter ( sfri ) countender 80+ minidil lmg aiix lyse [ ho ajix ( ‘leaner minoclair, minotrol 16 ( 21 ) minorol 16 ( 2n ) minotrol 16 ( 211 ) minotrol calibrator d. syringe 3cc d. syringe 5cc i ) . syringe 10cc 1. ) . needle no. 22.23, 24 cell pack cell clean stromatolyser wil controll for cell counuer kx2 i sysmex methanol xvleneo sulphosalicylic acid 30% ( ovcr slip isflsuainl jshii disposable tips ( yellow ) disposable tips ( lllue ) 100 x microscope lcncc 45 x microscope lcnce microscope bulbs6v 20w ) centrifugal test tubes plastic test tubes without cap room thermomier strips for glucometer priming paper roll for cell counter sysmex printing paper roll for semi auuo analyser plastie test tube screw capped, plain vial lntratch catch no. 23, 24 d. gloves 61 / v and 7” sonography paper roll sonography gclly fcg paper roli ordinaiy _____ ecg paper roll for computerize ecg gell>’ x ray fixer 22.5 hr. x ray developer 22.5 ltr. dental x ray film dental film i folder ( cassete ) dental i fengar x ray film 14*17 x ray film 12 15 x ray film 10 l2 x ray film 8 10y edta k3 vial edta k3 tubes ihdta rube [ dta vial blood urea kit ( end paint ) , ( ilcometer sirips ( optinum ) _______________ cl.c2.c3 reagents for electrolyte estimation for cobas strips for glucometer digital i leanoglobinmeter with strips plain lube with rubber cap& safety cap fdta k3 tube vacutainer plan tube vacutainer microcuv cites for digital heamoglobinmeter l lb 3o1 ct scan fiims digital x ray film sxlo 1 ) igital x ray film 10x12 digital x ray film i lxl4 i .ead diveder lead apron floor chest stand plastic cup with cover ( lid ) for urine / stool lead number screw capped test tube plain fdta k ) tube with rubber cap and safety cap strips for glucomcter dengue test kit elisa vtm mcdia for swine flu, ppf ( personal protective equipment ) kit s. amvlase test kit citrited tubes for prathrombint inc blood urea test kit ( end paint ) bpl ecg paper roll 6108t mac grunwald stain borosil glass test tubs fluid pack na / k / cl 800m1 daily cleaning solution kit 52ml printer paper for electrolyte analyser electrolyte cantrol lnternal filling solution looml sodium electrode ppf ( personal protective equipment ) kit s. amvlase test kit citrited tubes for prathrombint inc blood urea test kit ( end paint ) bpl ecg paper roll 6108t mac grunwald stain borosil glass test tubs fluid pack na / k / cl 800m1 daily cleaning solution kit 52ml printer paper for electrolyte analyser electrolyte cantrol lnternal filling solution looml sodium electrode, potas5ium electrode chloride electrode s. calcium cpk mb cpk nac i ox microscope lense e piece microscope 5x magnirying hland lcnse ( large ) bleaching poideri eco paper roll ( 106mm width ) crptest 25 test d dimer25 test fertin25 test il 6 25 test disposable lancets plain tube with stopper d water 5 lt. dengue test kii ( rapid camd test ) lgm, jggnsi combopack uristix 10o strips cover slip ( longer for cytolosybiopsy ) tissne paper ecg paper roll 106 mm 20 mtr. sodi ivoochlonte snliiticrn, microglassslide 1x20 pregnancy test card printing paper roll for electrolyte analyser ) aluminium foil autoclave lndicator tape ( steam ) field stain a autoclave indicator tape ( steam ) rield stain b ciucose ( god pod ) iidl choiesterol with callbrator ldl choiesterol with calibrator triglycerides cholesterol ulreas creatinine enzymatic sgot el sgpt el bilirubin direct l3ilinubin_total uric acid albumin total protein calcium ( a ) alkaline phosphatase lipase xl, amylase ckombs ck nac gamma ot ldh p x l aso turbj latex with calibrator ( ita ) xl rf turbjlatex with calibrator ( ita ) xl crf turbitatex with calibrator ( ita ) crp control low, control l ( asoirf / crp ) control h ( aso / rr / crp ) erba norm erba norm erba path erba path xl multical erba autowash system pack xl autowash ac / al kit 4 channel ise cleaning sou lution 542 i 4 channel isli module reagent pack field stain a field stainb f lisa for scnub typhus elisa ror chichengunia elisa for hepatitis a n 95 mask gram stnin....

Medical Health And Family Welfare - Rajasthan

30672725 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

30672441 tender for pathology lab reagents under mnjy tender for pathology lab reagents under mnjy , specifictions of biochemistry kits for semi auto anaylser requied at dbh, churu , s. creatinine kit (for semi auto) , s. glucose , s. creatinine kit (for semi auto) , s. cholestrol kit (for semi auto) , s. cholestrol kit (for semi auto) , s. bilirubin t kit (for semi auto) , s. bilirubin d kit (for semi auto) , s. urea kinetic , urea berthlot (end point) , urea berthlot (end point) , s. sgot kit (for semi auto) , s. sgpt kit (for semi auto) , s. sgot kit (for semi auto) , s. sgpt kit (for semi auto) , s. alkaline phosphatage kit (for semi auto) , s. total protien (for semi auto) , s. albumin (for semi auto) , s. ldh (for semi auto) , s. ldh (for semi auto) , s. amylase (for semi auto) , s. amylase (for semi auto) , s. uric acid (for semi auto) , s. calcium kit (for semi auto) , s. calcium kit (for semi auto) , s. ck nac (for semi auto) , s. ck mb (for semi auto) , s. ck mb (for semi auto) , s. triglyceride kit (for semi auto) , s. triglyceride kit (for semi auto) , hdl direct , s. hdl cholestrol ppt , biochemestry control , erba xl wash , chloride , gamma gt , gylocylate hemoglobin hba1c , lipase , phosphorus , cystatin c , csf protein test , hemocysteine , general items , afb stain (ready to use) , autoclave tap 1 (thermopile spors) , acetone liquid , aluminium foil , ayer spatulla disposable (sterile) , absolute alcohal 99 % , adhesive tap 0.5 inch , aslo kit , anti abd , ahg (anti human globulin) vial , ahg (anti human globulin) vial , anti a1 , acetic acid galcil 5% , buffer bottle , blotting paper sheet , bleeching powder , banedict solution , blood mixer , beakar glass , beakar glass , bovine albumin , bovine albumin , bovine albumin 22% , bovine albumin 22% , bd vaccutionor blood collection needle 21,22 , blood collection tube for esr black cap 4 ml. , capillary tube , chickengunia cards igg igm , crp kit , cover slip 22x60x.4 mm.(blue star,gem,top only) , cover slip 22x50x.4 mm. .(blue star,gem,top only) , cover slip 22x40x.4 mm. .(blue star,gem,top only) , cover slip 20x25x.4 mm. .(blue star,gem,top only) , cover slip 24x60x.4 mm (blue star,gem,top only) , cover slip for neubauer chamber 1mm thick , copper sulphate powder , copper sulphate powder , copper sulphate powder , chloroscope with reagent , coplin jar , cell for gluometer , cover slip 18x18 mm(blue star,gem,top only) , cell counter for dlc 8 key , clot activator vial red cap 4 ml. , clot activator vial red cap 6 ml. , diastix , disposable needle 22 mm , disposable needle 24 mm , disposable syringe 5 ml. , disposable syringe 10 ml. , disposable droper , disposable gloves 6 , disposable gloves 6.5 , disposable gloves 7 , disposable gloves 7.5 , dropping bottle plastick 100 ml. , dropping bottl plastick 500 ml. , dpx mount , diamond marker , drabkin’s solution and control solution , distilled water , dengue test kit ( ns1 igg igm combopack by rapid card test) , dengue elisa test kit (ns1) , dengue elisa test (igm) , dengue rapid card ( igg, igm) , esr fluid (sodium citrate) , esr tube ( pippate) disposable , esr (pippate) glass with cap disposable , edta powder , eosin stain , ethylalcohol absolute , eosinophil diliuting fluid , field stain a , field stain b , forceps (simple) , jsb stain i , jsb stain ii , flask glass (borosil) , flask glass (borosil) , fnac plunger , fixative for cyotology (99% methanol) , filter paper , formaline , glass marking pencil (red) , geimsa stain , geimsa stain , glycrine , gel activator vial 4 ml. , gel activator vial 8 ml. , hypochlorite 5% solution , hbsag rapid test cards , hb tube square , hb pippate , heamatoxyline mono hydrted ms reagent , hand sanitizer , hand sanitizer , k3 (cbc) vial double cap , k3 (cbc) vial single cap , koh solution , liquid parrafin , lugols iodine , leishmen’s stain , liquid cleaning agent for glass/plastic , liquid hand soap (savlon ) , liquid hand soap (dettol) , liquid hand soap (lifeboy) , lancet , lens paper , multi stix , micro tips 5 20 ul , micro tips 200 ?l , micro tips 1000 ?l , micro glass slide 1.33mm (blue star,gem,top only) , micro glass slide 1.25mm (blue star,gem,top only) , micro glass slide76x26 mm (blue star,gem,top only) , micro pippate fix volume 10?l , micro pippate fix volume 20?l , micro pippate fix volume 50?l , micro pippate fix volume 100?l , micro pippate fix volume 500?l , micro pippate fix volume 1000?l , micro pippate varible 10 100 ?l , micro pippate varible 100 1000 ?l , micro pippate stand plastick , macountoss , face mask disposable , new methehylne bluefor reticulocyte stain , methehylne blue1% , n/10 hcl , improved neubaurs chambar (counting chambar) , nitric acid ( hno3) , oil imersion lens , pt vials , pcv tube , papnaculer stain ready to use , plastic dropper , pasture pippate , propyle alcolhal , platelet diluting fluid , ppe kits , ph paper strip , prob cleaner for cbc machine accurex , paper roll for semi auto anaylser 4.5 , reporting cbc paper roll50mm x 20m , reporting cbc paper roll57mm x 20m. , reporting cbc paper roll 57mm x 10m. , rubbur bulb b dropper , ra factor kit , rapid malaria test cards ( antigen) , rapid malaria (antigan , antibody) combopack , sulphar powder , semiauto anylaser printer roll , sticker for sample vials , sample vial with cover 5 ml , sample vial with cover 10 ml. , staining reactanguler beaker , staining rack , spirt lamp , test tube glass 3 inch(12x75) borosil , test tube glass 4 inch (12x100) borosil , test tube pvc 2 inch , test tube pvc 3 inch , test tube pvc 4 inch , test tube pvc 6inch , tlc fluid , tec fluid , trbc fluid , tissue paper roll , tourniquit , test tube stand plastic for 48tubes , test tube stand plastic for 100 tubes , trop t rapid test card , thromboplastin ( pt reagent) , test tube cleaning brush , thermacol box , digital thermomater with sensor for regrigetor , tongue depresser disposble , urine pregnancy strips , urine pregnancy cards , uristicx , urine pots with label and cover 30 ml. , urine anyalser paper roll 57mm x 10mtr , vdrl test kit , vdrl card , vdrl rapid test strip , vtm ( viral transport media) , vacctuainer plane 4 ml. , vacctuainer plane 8 ml. , vacctuainer k2 edta 4 ml. , vacctuainer k3 edta 4 ml. , widal slide kits (4x5ml.) , widal tube agglutation reagent , wbc diluting fluid , widal card , wintrobe tube esr , xylene , zeeper plastic 6 inch , zeeper plastic 8 inch , z n stain , pm kit for semi auto (statfax) , pm kit for fully auto (randox) , wash solution for fully auto (randox) i , wash solution for semi autofor fully auto_analyser , wash solution for fully auto (randox) ii , psa kit , psa kit (elisa method) , calibartion sera leval 2 (randox) , calibartion sera leval 3 (randox) , aluminum ammonium sulphate hydarted , acetic a , glacial acetic a , ammonium hydride 1% , eosin yellow a , eosin yellow b , light green sf , potash alum , formal salile 5% , formal salile 10% , timer electronic , phyloxin , orange phosphotungesatic acid , slide cabinet (100 slide) , slide staning bucket with handle , slide box , measuring cylinder glass and silikon 50 ml. , measuring cylinder glass and silikon 100 ml. , measuring cylinder glass and silikon 500 ml. , measuring cylinder glass and silikon 1000 ml. , hcv card (rapid test) , esr cap (disposable) for glass tube 500,1000 cap , human assey multisera l 2 (randox) , human assey multisera l 3 (randox) , cuscos speculun , mask n 95 , glucostrip for glucocare sence glucometer , glucostrip for bio sence glucometer , disposable pap smear kit , delivery disposable kit (cap, mask, aprine, shoescap ) , delivery disposable kit (cap, mask, aprine, shoescap,googles, bedsheet, kallispad babysheets etc.) , yunkur suction set withfine tips suction canola , anit a , anit b , anti d , sargical mask 3 layer , lysol 50% , digital thermomater for refrigertor with display , sprayer bottle 500 ml./1000 ml. , beakar glass 100 ml. , covid 19 rapid card , pencil cell for glucometer/ timer , ketostx , paper roll for pt anaylser (116mmx20 mtr.) , torrniquet belt, tubler (cotton material flexible) , hiv rapid test card , gram stain , serum magnisium test kit , serum lithium test kit , csf protin test kit , csf chloride test kit , csf suger test kit , urine total protin test (24 hour) test kit , acid phosphatase test kit , accu chek glucometer strip , glucocare sence glucometer , bio sence glucometer , ggt test kit...

Department Of Medical Education - Rajasthan

30502430 supply of solutions / kits / regents of mnjy solutions / kits / regents of mnjy hiv microelisa d.c.g.i.approved should have iv generation test kits with p24antigen, should have w.h.o. evauation including subgroup o+ recombinant protein gp120 c terminus,gp40, gp36, sensitivity and speciticity 98% 100% , hiv immuno comb d.c.g.i. approved, should have iv generation with p24 antigen. elisa based principle., hiv (rapid spot tridot) d.c.g.i.approved iv generation with p24antigen. result should be obtained 10 to 15 mt.should detect > 15 days after seroconversion, should have recombinant and syntheticpeptide. immunofiltration, immuno chromatographic lateral flow igg, igm, ig a specific to hivi, hiv2 , hbsag. microelisa d.c.g.i approved, iv generation should have recombinant antigen of core type, should have sensitivity and specificity 100 99% respectively. direct sandwitch prindiple or antigencapture, hbsag. card d.c.g.i approved, sensitivity 99.8% (0.5ng/ml) specifiticity 100% core antigen. antigen capture or sandwitch (core antigen) immuno cromatography or lateral flow., hcv microelisa d.c.g.i approved, fourth generation test for ns3, ns4, ns5 with core organic isrile, pbs organic france. s.d. , qualpro, hcv (hepatitis c) rapid d.c.g.i. approved, antibody detection on flow through technology kits should have based on, vdrl strip d.c.g.i. approved, 100% specificity 98% sensitivity, m.p. card antigen sensitivity 100 percent, specialicity 99.99 percent, immo any as sarduih preipipar with coated manodonal ab for anti pan 8per feeipar spu ( pld8 pav) feeipar spa (plph) ab, disposable test tube plastic transparent plastic size 12x75mm, e.c.g. roll single/multichannel , e.c.g. jelly , semi auto roll , c.b.c. roll 57mm*32m, tissue paper roll , bovine albumin, comb’s serum, blood bag tripple cpd sagm 450 ml iso 9002, blood bag tripple cpda 350ml iso 9002 , blood bag tripple cpd sagm350ml iso 9002 , blood cuture bottle disposable , culture petri dishes with wireloop disposable, culture tube disposable, culture antibiotic dishes full range , blood culture bottle with media , nutrient agar, mackomeky, peptone borth , muler hilton (m.h.) agar , clot activator vial with double cap 5ml, sodium citrate vial 2ml double cap, e.d.t.a. k 3 cbc double cap 5ml, di water standard manufacturer, nipple cum sample cups for fully autoanalizer, vacou containers k3 e.d.t.a. 5ml, glucometer, glucometer strip, uristicks, multisticks, hb pipette square, r.b.c. pipette with connecting tube, w.b.c. pipette with connecting tube, neuebar chamber silver line, capillary tube fir c.t. , e.s.r. tube c stand tube (glass tube) , cover slip small large , micro slide 76x26x1.15 m, filter paper , serological test good quality sensitivity 100% specificity 99%.8% with known value control/ caliberator, r.a. test , crp test, asl o test , ra tarbi, crp tarbi, aslo tarbi, widal test card, widal test, preg card sensitivity & specificity 100% (sensitivity 10mliu/ml.) recombinant flow (iii, iv generation) through technology , coreantigen (hbcag antibody) to detect igg, igm, iga antibody recombinant/ synthetic peptide., w b c dilution fluid , tec dilution fluid , seman dilution fluid , patlets dilution fluid , liesman stain , 3.8 % sodium cirate , n/10hcl , liquid parafin oil , giemosa stain , sulphur power , fou chest regent , e.s.r stand with tube of mnimum and type (everite top) 6 or 10 tubes (5 in number) everites top (glass pipeete), iodine sultion, xylene, blood suger auto analyzer kit, blood urea liq. , total protin , hdl direct, ck nac, ck mb, serum albumin, serum ldh, serum creatinine liq., serum bilirubin t&d, serum cholestrol direct, serum triglyceride , s.g.o.t., sgpt, serum amylase, serum alkalina phosphatase, serum uricacid, serum phiosphatase, serum calcium , striperer & sealer manual standard manufacturer, lancet (pricking needle) round shape with plastic top standard manufacturer, copper sulphate standard manufacturer, shakker & mixer for vdrl standard manufacturer, funnel standard manufacturer, anti abd 10 ml (monoclonal), anti ab , anti a 1 lactine , blood collection monitor with automated scale, semi auto analyzer standard manufacturer, anti hav igm. elisa kit, anti hev igm. eliasa, typhidot igm elisa, viral transport medium (v.t.m.) standard manufacturer, dengue igg/ igm rapid card sansitivity 95 percent span 96 percent cold moun mono linal anti ab fa igg and igm, ignittion tube , h2s strip test for water quality k 19 , stool sample container , stan (jsb i), stan (jsb ii), glass slide, keto dia sticks , torniquate belt , blue tips , yellow tips , urine container 30ml, grams stain , ziemsa powder , methenol , glycerin , handdis infacted/hand santizer , bandaid , vacutainer needle , gramstain , syring needle destroyer , thermometer range 0 1000c, , oxidase strip from himedia , ph strip , glase ( borosil) petriplate 90 mm , glase tube size 10 cm * 1.5 cm , conical flask size 250 ml , 500 ml , 1000 ml , micropipette size 5 – 50 microliter , micropipette 10 – 100 microliter , micropipette 100 – 1000 microliter micropiplate, spatula, aluminium foil , weiging paper , staining rod , staining bottle with dispenser , spirit lamp ss, mr reagent (methyl red reagent), fecl3 , sodium hypochlorite 10%, mackonkey broth (single strength) , mackonkey broth (double strength) , disposable sterilized petriplate , glase tube size 15 cm * 125 mm , conical flask size 500 ml , dettol dettol, scrub typhus elisa igm anti body (imbios), nutrient agar prepared plate, indole reagent (high media), isopropyl alchohal , rubber band (large size) , disposable syringe 2 ml , disposable syringe 3 ml, disposable syringe 5 ml, disposable syringe 10 ml, white tips (1000 micro ltr.) , sample collection bottle (water) narrow mounted natural boro cillicate glass, capacity 1000 ml , bgb medium (brilliant green bile borth medium) 1 kg., glass pipette size 1 ml with bubbles 2 nos. , glass pipette size 5 ml with bubbles 2 nos. , glass pipette size 10 ml with bubbles 2 nos. , auto clave chemical indicator , ortho tolidine soluton for residual chlorine , test tube stand 48 hole , h2s strip test for water quality (prepared bottle) , vdrl rotator, centrifuge machine 16 channel (for city dispensary), scrub typhgus rapid card test, chikanguniya rapid card test, chikanguniya igm elisa kit, dengue ns 1 elisa kit, dengue igg elisa kit, dengue igm elisa kit , esr pipette disposable, plain vial with colt activator double cap 5ml, coomb sera type of specific antibody anti d titre more than 512/1024 with specific , coomb sera type of specific antibody anti d titre more than 512/1024 with specific , swine flu safty kit , swine flu mask (n 95) , tripple layer mask , mackoneky agar , nutrient agar , alkaline peptone water , peptone water , salmonella shigella agar , sarbitol dextrose agar , sorbitol mackoneky agar , tripple sugar iron (tsi) agar , simmons citrate agar , cary blair medium , elisa reader washer standard manufacturer, xray film 12 x 15 blue base standard manufacturer, xray film 10 x 12 blue base standard manufacturer, xray film 8 x 10 blue base standard manufacturer, dental xray film standard manufacturer, sonography gelly jar 5 ltr. standard manufacturer, city scan film dry imaging 14 x 17 standard manufacturer, developer 22.5 ltr. standard manufacturer, fixer 22.5 ltr. standard manufacturer, other items (radiology) standard manufacturer, x ray screen 12x15 standard manufacturer, x ray screen 10x12 standard manufacturer, x ray screen 08x10 standard manufacturer, x ray hanger 12x15 standard manufacturer, x ray hanger 10x12 standard manufacturer, x ray hanger 08x10 standard manufacturer, half film blocker (divider), size (7x17) standard manufacturer, x ray screen with cassatte size 12x15 standard manufacturer, dry x ray film (dihl) (10*12), dry x ray film (dihl) 12x15 , dry x ray film (dihl) 14x17 , dry x ray film (dihl) 08x10 , singal blood bag 350 ml cpda, double blood bag 350ml cpda, transfer blood bag. ...

Shri Karan Narendra Agriculture University - Rajasthan

30409482 open tender for chemicals and glassware 1. 1,2 dichloroethane srl, qualig merck, sigin molichem, ranbaxy, ens, a, genetics, himedia, ranchem 2. 1 naphtholar 2 3 5 tn phenyl tetrazoliumn chloride (tic) 3. 4. 2,4 d 5. 2,4 dinitro phenyl hydrazine (dnph) 6. 2,6, dicholorophenol indophenol 7, 30% hydrogen peroxide ar grade 8. 5 sulphosalicylic acid dihydrate ar 9. absolute alcohol 10. absorbant cotton 11. acetic acid 12. acetic acid glacial ar 13. acetocarmine solutions 14. acetone 15. acetone (hplc grade) 16. acetone ar (special grade) 17. acetone ar grade 18. activated charcoal 19. acid fuchsine 20. acrylarnide 21. activated charcoal ar grade 22. agar powder(bacteriological grade) 23. almuniumn chloride 24. aluminium chloride hexahydrate extrapure ar, 99% 25. aluminium foil 26. ammonia buffer solution 27. ammonia solution sp. gr 0.91 28. ammonium acetate ar grade 29. ammonium chloride 30. ammonium dihydrogen ortho phosphate 72. calcium chloride 99% extra pure 73. calciun chloride dihydrate 74. calciun sulphate anhydrous 75. calcium sulphate dihydrate 76. captan 77. carbandzim+ mancozeb 78. carboxin 37.5% + thiram 37.5% (vitavax_power) 79. carmine powder 80. castor oil 81. catechol extrapure 99% 82. cedar wood oil medium 83. chloroform (ethanol stabilized) 84. chloroform (hplc grade) 85. chlorothalonil 86. chlortetracycline hydrochloride 87. citric acid 88, clove oil 89. — cobalt chloride hexahydrate (coci2.6h20) 90. cotaltus.chloride 91. nitrate hexahydrate 92. concentrated sulphuric acid 93. coomassie brilient blue r250 94. copper sulfate pentahydrate (cuso4.5h20) 95. copper sulphate 96. corm meal media 97. cotton blue 98. ciystal violet ar grade — 99. ctab (cetyl trimethylamxnonium bromide) 100, czapek”s dox_agar 101. d(+)ribose 102. darco g 6() (activated charcoal) detergent 104. dextrose 105. d fructose a/r 106. di sodium hydrogen arsenate — 107. dibasic sodium phosphate 108. diehylene tr i amine penta acetic acid (dtpa) ar grade 109. diethyl ether ar(stabilised) 110. diethyline tn amine penta actic acid (dtpa) hvdrxhloric acid hydruchloric acid 0.5n aq. solution 148. 149. 150. hydrochloric acid lr hydrogen dichioroethan hydrogen peroxide 30% 53. hydrogen peroxide 6% 54. hydroquinone m 55. hydroxyl amines (ha) hydroxylamine hydrochloride 157. iaa 158. iaa solution 159. iba 160. iba_solution 161. iodide crystals 162. iodine ar grade iodine solution 1% w/v iron sulphate 163. 164. 165. iron tartrate 166. isoamyl alcobol isopropanol_alcobol 167. 168. kavach (syngenta) 169. kh2po4 170. laborine 171. lacticacidar 172. l ascorbic acid extrapure 173. l glycine (triglycine) extrapure, 99% 174. linseed oil l phenylalanine extrapure chr, 99% l tyrosine for biochemistry magnesium chloride magnesium sulfate heptahydrate (mgso4. 71120) malt agar malts media mancozeb manganese sulfate munoh ir (mnso4.h20) manganese sulphate 77. 74. linseed oil 75. linseed oil cake 78. 79. 80. 181. 182. 183. 184. 185. 186, manitol ar grade 187. martin’s media 188. mercaptoethanol 233. pacelio uslilacinus 234. paraffin wax 235. pcnb (pentachloronitrobenzene) 236. pda readymade 237. peg 6000 238. peptone ar grade 239. petroleum ether (60 100°c) 240. petroleum ether 60 80c . 0 phenophthalin indicator phenol 241. 242. 243. phenol crystalline extrapure ar 244. phenol disalfonic acid 245. phcnolphthalein indicator power 246. phosphoric acid 247. p nitrophenol phosphate ar grade 248. polyvenylpyrolidase 249. polyvinylpyrolidone (pvp) 250. potasium meta bi sulphite 251. potassium dicromate 252. potassium hydroxide pellets 253. potassium_iodide 254. potassium acetate 255. potassium chloride potassium chromate ar 256. 257. potassium dichromate 258. potassium dihydrogen phosphate 259. potassium ferricyanide 260. potassium hydrogen sulphate 261. potassium iodide (ki) 262. potassium metabisuiphite . potassium_oxalate 263. 264. potassium permanganate 265. potassium permanganate ar grade 266. potassium permangnate 267. potassium sulphate 268. potassium titrate . r potato dextrose broth 269. 270. pottassium hydroxide 85% ar 271. pottassium nitrate 99% ar 272. propiconazole (tilt) 273. propineb (antracol) 70 w% 274. protein ladder marker (mid range) 275. pyridoxine hc1 comp sulphuric acid sulphuric acid 98% ar 319. tag polymnerase (su/pi) 320. tebuconazole 321. temed 322. tergitol np 10 323. thiamine hcl 324. thiobarbituric_acid 325. thiophanate methyl 70% wp 326. toluene 327. total hardness indicator tablets — 328. tri_chloroacetic.acid 329. trichoderma harzianum 330. oncyclozol 8% + mancozeb 62% 331. triethylamine (tea) 332. triphenyl formazan (tpf) ar grade 333. tnishcl 334. triton x 100 335. universal indicator solution 336. v8 agar rnedium(vinegar) 337. vitavax.power 338. wettable_sulfur 339. xylene 34o. yeast extract ar grade 341. zinc chloride 316. 317. 318. taq buffer 342 zinc oxide 341. zinc chloride 342. zinc oxide — 343. zinc sulfate tetrahydrate (znso4.4h20) 344. zinc sulphate heptahydrate table: 2. list of glasswares s.n. glats ares s1 1. beaker (graduated)25, 50,100, 250, 500, 1000 ml capacity b b la 2. bod bottle 125 ml, 300ml 3. reagent bottle reagent 100, 125,250 ml 4. 5. burettes 50ml conical flask graduated 50,100, ugn cn cnnwi0 37. permanent slide of anatomy of dicot s _____ stem ______ 38. penmanent slide of anatomy of leaf 5 39. permanent slide of anatomy of monocot root 5 40. permanent slide of anatomy of monocot stem 5 3 40 50 41. pestle & mortal 42. petri culture dish 90 160 mm cover diameter — 43. petri plates 5cm cover diameter 44. petri plates 10 cm cover diameter 201 101 45. petndish 46. pipette 1 ml graduated 101 47. pipette 10 ml graduated 25 48. pipette 2 ml graduated pipette 5 ml graduated plain slide 76x26 mm pie cleaned ready for use reagent bottle 250ml amber colour reagent bottle 500ml 101 101 49. 50. 10 51. 10 10 52. 53. reagent bottle 500ml anber colour 10 54. reagent bottles 125 nil 10 55. reagent bottlesl00 ml capacity 60. specimen glass jars (1 & 2 hr.) 61. stage micrometer (1”x 3”) 1 mm, 100 divisions 62. staining jar and rack for 24 pieces of slide 63. testtube12xl5mm 64. test tube_15 x_12s mm 65. testtube16x 16xu16mm? 66. test tube 25 x 100 mm 67. test tube 25 x 200 mm 68. test_tube_stand 69. volumetric flask 1000 ml with stopper (size 24/29), flat bottom 7u. volumetric flask l0oml with stopper (size 14/23), flat bottom 71. volumetric flask 250ml with stopper (size 14/23), flat bottom 72. volumetric flask 25ml with stopper (size_10/19),_flat bottom 73. volumetric flask 50inl with stopper 107. 108. beaier low form, heavy wall with double capacity scale, 250, 500, 1000 ml brush beaker 109. brush bottle 110. 111. burettes, 100 ml capacity, division 0.1 burettebrush 112. quartz cnucible with lid, tolerance upto 2000oc 113. crucible holders 114. measuring cylinder with hexagonal base, cap. 5, 10, 25, 50, 100,250, 500, 1000,200o.ml. 115. flask volumetric with pp sloper, 20, 25, 50, 100, 200 250, 500, 1000, 2000 ml capasity 116. brush flask 117. 118. test tube stand made of polypropylene & polycarbonate (3 tier) 25 mm x 24 tubes, 25mm x 18,25mnix36, 32mmrx 12 tubes spatula, stainless steel, one end spoon & one end flat, 125 mm, 200mnmn, 300mm forceps, straight fine points, 100, ‘m1v 1fl(h..... 119. 120. micropipettes, fully autoclavable, uv, resistance, digital volume setting, volume range 121. 100 1000 ul (5 ul increment), 500 5000 ul_(50_ul_increment) 122. funnel 75 mm — 123. pipette 1 ml graduated 124. pipette 10 ml graduated 125. pipette 2 ml graduated — 126. pipette 5 nil graduated 127. conical flask standard ground mouth 250 ml 128. conical flask standard ground mouth 500 ml 129. absorbant cotton 130. filter paper ordinary 12.5 cm (100 circle) — 131. filter paper sbeet 132. filter paper whatman no. 41, 12.5 cm (100 circles) 133. filter paper whatman no. 42, 12.5 cm(loocircles)174. soxlet apparatus 175. volumetric flask 1000 ml with stopper (size 24/29), plate bottom 176. volumetric flask 100 ml with stopper (size 14/23), plate bottom 177. volumetric flask 500 ml with stopper (size 14/23), plate bottom 178. volumetric flask 250 ml with stopper (size 14/23), plate bottom 179. volumetric flask 25 ml with stopper (size 10/19), plate bottom 180. volumetric flask 50 ml with stopper (ie 10/19), plate bottom 181. cuvette 182. hote plate 183. cleaning brush 184. tilt measuring bottle 1 ml 85. tilt mneasuring bottle 2 ml 187. tilt measuring bottle 10 ml 188. apron coat 189, 1 land_gloves 190. labolene 191. cavity block 192. tele counter 193. [ slide box plastic ina i f’i..... _e 194. glass slides 195. nematode counting disc 196. sieve set 197. non absorbent cotton 198. absorbent cotton 199. round bottom flask 200. round bottom flask 201. scalpel 202, pint lamp 203. trial tag plastic, aluminum 204. trial sticks 205. rubber bands 206. parafilim tape 207. inoculation needle 208. experimental diary 209. steel grip(3 meter, 5 meter) 210. coconut pit tissue paper roll etc 10 56. room thermometer in celsius 5 2 57. thermometer in celsius j 58. round bottom flask 250 ml 59. slide storage box for 25 pieces of 10 siide ...

Department of Agricultural Research and Education - Rajasthan

30290439 bids are invited for tri reagent (trizol) 25 ml , single spin rna cleanup kit 50 rxn , dl lactic acid 500 ml , trypan blue 5 gm , phenol solution (equilibrated with te) 100 ml , phenol:chloroform:isoamyl alcohol 100 ml , nuclease free water 1 ltr , diaminobenzidine (hplc) 1 gm , ultrasonicators (4 ltr) 300x150x100 mm , qualitative filter papers 125 mm , ptfe syringe filters (0.2 µm) 25 mm , seed germination paper 460 x 285 mm , tissue culture bottle 400 ml , dry bath incubator led display , block for 20 micro centrifuge tubes 1.5 ml tubes , self sealing polybags. 3 x 4 inch , self sealing polybags, 4 x 6 inch , laboratory spatula. 6 polypropylene , laboratory spatula, 6 one side spoun , laboratory spatula 8 one side arrow , tissue culture bottle jar 400 ml , magenta box 65 x 65 x 100 mm , plastic storage box 3400 ml , measuring beaker (jug) 500 ml , measuring beaker (jug), 1000 ml , measuring beaker (jug). 2000 ml , moisture proof storage bottle, 500 ml , moisture proof storage bottle 1000 ml , drying rack 20 pegs , pestel and mortar 100 mm , self sealing polybags 6 x 8 inch , staining box 225 x 225 x 50 mm , mechanical timer 1 pcs , tissue paper 200 x 205 mm , aluminium foil 1 kg , acrylic seed displayer small , acrylic seed displayer, big , tissue roll 25 meter , vermiculite 25 kg , cryo box with hinged cap 4 pcs , digital thermohygrometer 2 pcs , test sieves 1.18 mm , test sieves, 1.70 mm , test sieves. 2.00 mm , test sieves,. 2.80 mm , grain moisture meter 1 , test sieves., 3.35 mm total quantity : 1...

General Administration Department - Rajasthan

30267146 supply of kirana ( grocery ) items on rate contract basis for the period of one year 1. whole wheat atta (premium quality/branded) 5 kg. 2. makka atta (premium quality/branded) per kg. 3. bajra atta (premium quality/branded) per kg. 4. refine veg oil. (premium quality) 5 ltr. 5. groundnut oil (premium quality) 1 ltr. 6. desi ghee (premium quality) per ltr. 7. rice basmati (premium quality) per kg. 8. papad (bikaji) fny[k qk@ckrphr 400 gm. 9. papad (bikaji) iklikl 400 gm. 10. besan (premium quality) per kg. 11. maida (premium quality/branded) per kg. 12. suji (premium quality/branded) per kg. 13. toor dal regular (standard quality) per kg. 14. urad mogar (standard quality) per kg. 15. urad dal chilka (standard quality) per kg. 16. urad whole (standard quality) per kg. 17. moong chilka (standard quality) per kg. 18. moong mogar (standard quality) per kg. 19. red masoor (standard quality) per kg. 20. dal chana (standard quality) per kg. 21. kabuli chana (standard big size) per kg. 22. kala chana sabut (standard big size) per kg. 23. rajma red (standard big size) per kg. 24. sevaiyan (roasted) – 200 gm. per pkt. 25. badi mangodi masala 500 gm. 26. sugar (premium quality/branded) 1 kg. 27. gud (jaggery) per kg. 28. tata salt per kg. 29. saindha namak 100 gms. per pkt. 30. kala namak 100 gms. per pkt. 31. sounf big per kg. 32. sounf small (lucknowi) per kg. 33. garam masala whole per kg. supply of kirana (grocery) items on rate contract basis 19 34. garam masala powder (mdh) per kg. 35. coconut powder (premium quality) per kg. 36. khus khus (premium quality) per kg. 37. mishri cutting per kg. 38. elaichi chhoti (cardamom) per kg. 39. mdh red chili powder per kg. 40. mdh dhaniya powder per kg. 41. mdh amchoor powder per kg. 42. mdh termeric powder per kg. 43. mdh chat masala (100 gms.) per pkt. 44. mdh kasauri methi (100 gms.) per pkt. 45. mdh chana masala (100 gms.) per pkt. 46. mdh chicken masala (100 gms.) per pkt. 47. mdh meat masala (100 gms.) per pkt. 48. mdh rajma masala (100 gms.) per pkt. 49. mdh kitchen king (100 gms.) per pkt. 50. catch black pepper (100 gms.) per pkt. 51. mdh black pepper (100 gms.) per pkt. 52. catch white pepper (100 gms.) per pkt. 53. mdh white pepper (100 gms.) per pkt. 54. ramdev hing (100 gms.) per pkt. 55. sabut hing (100 gms.) per pkt. 56. azavayan per kg. 57. catch table salt (100 gms.) per packet 58. kaju tukdi per kg. 59. kishmish per kg. 60. pista cutting per kg. 61. badam cutting (mamra) per kg. 62. rye per kg. 63. melon seeds per kg. 64. kesar premium per 1 gm. pack 65. jeera per kg. 66. red chilly whole per kg. 67. amchoor sabut (white) per kg. 68. dhaniya whole per kg. 69. ajeno moto packet per 100 gm 70. phool makhana (rajbogh) per 250 gm 71. edible soda per 100 gm 72. kalonji per kg. 73. dana methi per kg. 74. imli whole (without seeds) per kg supply of kirana (grocery) items on rate contract basis 20 75. anardana per kg 76. soyabean mangori packet per 200 gm 77. fruit jam kissan per 500 gm 78. kellogs corn flakes packet per 475 gm 79. green tea bag 25 bag/packet per pkt. 80. red lable tea (tetra pack) per kg. 81. lipton green label tea (packet) per kg 82. taj tea begs (packet) 100 bag per pkt. 83. kissan tomato ketchup per kg. 84. maggi tomato ketchup per kg. 85. red chilly sauce (premium quality/branded) 700 gm. 86. green chilly sauce (premium quality/branded) per 300 gms. 87. nescafe classic coffee (jar) per 50 gm 88. sugar cubes (premium quality/branded) per 500 gm 89. sugar free (small) per pkt. 90. mix veg pickle (premium quality/branded) per kg. 91. biscuits (monaco) 150gm per packet 92. biscuits (good day) 150gm per packet 93. biscuits (dark fantasy/chocofills) 75gm. per packet 94. custard powder per 500 gm 95. corn flour per 500 gm 96. fruit cocktail tin per 850 gm 97. frozen peas (premium quality/branded) per kg. 98. poha per kg. 99. clean film (fresh wrap) per 72 mtr. 100.aluminum foil (premium quality/branded) per 72 mtr. 101.tooth pick (premium quality/branded) per pkt. 102.bikaneri bhujiya 400gm. (bikaji/ haldiram) per packet 103.bikaneri bhujiya 1 kg. (bikaji/ haldiram) per packet 104.ground nut (kachhi) per kg. 105.mustard oil (premium quality) per. ltr. 106.vinegar (500 ml btl) per btl. 107.soya sauce (200 ml btl) ...

Rajasthan University Of Health Science - Rajasthan

30259092 chemicals reagents consumable items for department of microbiology chemicals reagents consumable items for department of microbiology , electrical items : , absolute ethanol , acetone , afb ( zn acid fast kit ) , agar powder ( bacteriological grade ) , alberts stain , alkaline peptone water , anaerobic system envelope with palladium catalyst ( gas pak ) , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbc ( igm & igg ) total test , anti hbe elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , hbs ag elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , dengue ns1 antigen elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , ds dna elisa kit , ana elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , dengu igm elisa kit , chikungunya igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , bleaching powder , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , brain heart infusion broth , cled media , conc. h2so4 , corn meal agar , cover slips 22 x 22 mm , crp test kit , deionized water , dengue rapid test card along with ns1 antigen , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable individually packed centrifuge tube conical bottom capacity 50 ml , disposable polythene gloves , disposable sterile test tube with swab individually packed , dubos medium , ecoshield , edta powder , face mask , ferric chloride , filter paper box whartman no. 1, 12.5 cm circular , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , glass marking pencils ( red, white ) , glass test tube 100 mm x 12 mm without rim , glass test tube 75 mm x 12 mm without rim , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , lactophenol cotton blue solution , liquid paraffin , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey agar , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , microcentrifuge tube with cap capacity 2 ml , mr vp medium ( glucose phosphate broth ) , muller hinton agar , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , ra factor kit , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , vdrl rapid test card , sabraud’s dextrose agar , selenite f broth bacteriological , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile storage vial 2 ml capacity , sterile storage vial 5 ml capacity , sterile transport medium ( stuart medium ) with test tube and swab individually packed , stool container with spoon , sulphanilamide , tcbs , triple layer mask , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxycillin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , azithromycin 15 ?g , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefepime 30 ?g , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpirome , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamicin 30?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , levofloxacin 5?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , norfloxacin 10 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , tobramycin 10 ?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , grams stain kit , hcv igmrapid card , sterile urine container single pack , culture loop ( nicrome ) 1mm 24 gauge wire loop , culture loop ( nicrome ) 2mm24 gauge wire loop , cotton roll , disposable petri disc 90 mm , sterile disposable swab sticks with test tube , sterile disposable cotton swab ( individual pack ) , hbsag rapid test card , aluminium foil ( 72 meter ) , rpr test kit , vaccutainer vial 4.5ml ( serum activator without gel ) , disposable plain tube 5ml ( without cap ) plastic , disposable plain tube 8ml ( without cap ) plastic , test tube stand 96 hole plastic , urea solu 40% , glass test tube 10ml , glass test tube 20 ml , aslo test kit , phenyl alanin agar , sulphide indole motility test ( sim motility medium ) , test tube holder bighole for 20ml test tube , lugols iodine solution , plastic scurbber , test tube washing brush , disposable test tube 20ml...

State Forensic Science Laboratory - Rajasthan

30252674 supply of consumables items for lab name of items , adhesive tape double sided , adhesive tape double sided , adhesive tape usp , air bubble line paper envelope , air bubble line paper envelope , air freshners spray for lab. , aluminium foil , ash less filters grade 40 , ash less filters grade 41 , ash less filters grade 42 , big towel (turkish towel) , biomedical polybags , biomedical waste container with lid , biomedical waste container with lid with trolley , blood lenset , blue epoxy coated racks , bottle opener , brush for washing test tube , brushes washing stain less steel nylon bristles cleaning brushes , bucket plastic , bucket plastic , bucket plastic , bucket with lid , capillary tubes for tlc , card reader , cavity slide , chlorpyriphos , cloth mesh line envelope , cloth mesh line envelope , co2 type fire extingusher (isi) , cockroach killer , cork no. 4, 5 , cotton roll , cryo babies/cryo tags , deoderising pearls , detergent powder , disinfectant wipes , disposable bouffant cap , disposable bouffant cap , disposable examinationnitrile gloves , disposable examination latex gloves , disposable examination nitrilegloves , disposable examinationlatexgloves , disposable examination latex gloves , disposable examination nitrile gloves , disposable hair cap , disposable surgical latex gloves , dissecting cushing thumb forceps 178mm , dissecting tissue forceps 11 4cm , dissecting tissue forceps 20 cm , dna isolation kit for all type of forensic exhibits , dranex wastepipe sink cleaner , dropper , dropper , dropper , dust pan , electric heater , enameled tray , face mask with nose pin (pack of 100) , face mask(pack of 100) , face mask 2ply (double ply face mask) (pack of 100) , face mask 2ply (double ply face mask) (pack of 100) , face mask n95 (pack of 100) , first aid box , floor mat/door mat , floor wiper , floor wiper , gas regulator , glass plate , glass plate , glass rod solid , glass rods solid , glass rods solid , glazed porcelain mortar , glazed porcelain pestles , glucose test strip for urine test , hand sanitizer , hand sanitizer , hand sanitizer , harpic , hazard communication tablets with dispenser , heater blower , heating element for water bath , heating element for water bath , heating element for water bath , heating element with plate for hot plate , helmet with face shield (fire and explosive cases) , hit spray for exhibit room , kinwip tissue papers , lab coat , lab soaker role , label stickers , ld apron , liquid soap , liquid soap , liquid soap , lock , lock , lock , lock 7 lever at least , lock 7 lever at least , magnifier glass with handle , magnifier glass with light , match box , mechinical sprayer sanitization , melting point apparatus , metal neddle holder with needle , metallic scale , metallic scale , metallic scale , metallic tray , metallic tray , micro probe length 152mm , microscopic cover glass slip , microscopic cover glass slip , microscopic glass slides , microscopic glass slides , mirror cleaner , mosquito repellantmachine , mosquito repellantrefill , rat kill , n 95 particulate respirators , naphthalene balls , napkin , napkin tissue papper , non woven pp crown , non woven pp gown , ordinary filter paper , ot absorbent towel , ot absorbent towel , ot hand towel , packing thread (thick cotton) , paint remover , paper holder clips , paper hole punching machine , patient id labels addressograph , paydan (jute) , paydan (jute) , pen drive , pen drive , pen drive , pen drive , pen drive , pen with tungston carbide tip , pencil cell , pencil cell , phenyl , plaster of paris , plastic basket , plastic basket , plastic basket , plastic dust bin , plastic dustbin with lid , plastic sprayer head , plastic spray bottle , plastic stool , plastic tray , plastic tub , plastic tub , polythene pouchzip lock , polythene pouchzip lock , porcelain dishes , porcelain dishes , ppe kit , paper shredder , rechargeable cell , rechargeable cell , retort clamps with bosh head , retort stand (heavy duty) , room spray sandle/rose/lavander , rough long handled porcelain pestles , rough porcelain mortar , safe handle , safety face shield , safety goggles uv light , sample container,pp/hdpe , scissor with iron plastic handle , scissors (heavy duty) , scissors (heavy duty) , scissors with brass handle , scissors with plastic handle , scissors with plastic handle , self adhesive labels , sewing machine needle , sewing machine oil , sewing machine thread white , shaving blades , shoe cover disposable (ts pbb) , shoe cover disposable (ts nwb) , shoe cover non woven , single burner gas stove , sleeper rubber chappals , sleeper rubber chappals , sleeper rubber chappals , sleeper rubber chappals , small napkins , soap , soap , sodium hypochlorite , spatulas , spatulas , sprayer (plastic) , sprayer (plastic) , sprayer (metallic) , stainless steel (pointed ) forceps(heavy duty) , stainless steel (pointed ) forceps(heavy duty) , stainless steel (pointed ) forceps(heavy duty) , stainless steel (pointed ) forceps(heavy duty) , stainless steel (pointed ) forceps(heavy duty) , stainless steel crucible tongs(heavy duty) , stainless steel crucible tongs(heavy duty) , stainless steel crucible tongs(heavy duty) , stainless steel filter holder , stainless steel forcep (bent pointed) , stainless steel forcep (flat tip) , stainless steel gas tubing , stainless steel nuts for fitting of gas tubing 1/8” , stainless steel scissors with flat ends , stainless steel scissors with flat ends , stainless steel scissors with pointed ends , steel scriber , steel scurber , sterile ear buds for blood test (ear buds) , sterile omni swab , surgical blade , surgical blade holder , surgical gloves , surgical gloves , surgical gloves , surgical gloves , syringe disposable , syringe disposable , syringe disposable , table top elevated desk , temperature resistant hand gloves fore arm size , test tube brushes , thread packing (thick cotton) , three prong beaker tongs , tissue paper roll , tongs (metallic) , tongs (metallic) , tongs (metallic) , towel , traceable balance spatula , transfer pipete brush , transparent pvc tubing , transparent pvc tubing , traymetallic point coated , traymetallic point coated , traymetallic point coated , wash bottleplastic , washing powder (surf) , watch glass , water glass , water jugs , water pvc pipe , water pvc pipe , wet wipes , yarn role , yellow envelope , yellow envelope...

Medical College - Rajasthan

30223279 consumable items for covid lab consumable items for covid lab , consumable item for covid lab , aerosol free tips dna, rna free molecular grade sterile, in box of 96 ( i ) 0.1 10 ul, , aerosol free tips dna, rna free molecular grade sterile, in box of 96 ( ii ) 0.5 20 ul, , aerosol free tips dna, rna free molecular grade sterile, in box of 96 ( iii ) 10 200 ul, , aerosol free tips dna, rna free molecular grade sterile, in box of 96 ( iv ) 100 1000 ul , autoclavable yellow & red, black & blue coloured biosafety bags with biosafety symbol , ethanolmolecular grade , isopropanol molecular grade , lint paper ( kim wipe ) 280 sheet 4.4 x 8.4 , micro centrifuge tubes 1.5 ml molecular grade, sterile , micro centrifuge tubes 2.0 ml molecular grade, sterile , nuclease eliminator for rna / r nase / d nase zap , powderfree nitrile gloves small / medium / large , cryo storage box 96wells with stand ampoules 85 c temp 1.5ml & 2.0 ml , cryoscrew cap tubes with o ring molecular grade 1.8 ml, sterile , screw cap serum storage vials 1.8 mlmolecular grade, sterile , aluminium foil paper roll18 inchx 90 meter , reversible racks for micro tubes 96 hole , paper towel 6x 6 ( 100 nos ) , paraffin sample packing tap 2 x250 , falcon tube 15 ml , falcon tube 50 ml , filter paper sheet 46 x 57 cms , nuclease free water , micro pipette stand , pcr cooler , microamp fast reaction optical tubes with cap strip ( 8 tubes / strip ) 0.1 ml, pcr compatible dna / rnase / pcr inhibitors free for bio rad cfx96 & 96 touch model , vtm storage rack50 hole ( 15ml tube ) , plastic tube stand rack 96 hole for 5 ml tube , plastic apron disposable , disposable airtight goggle , vtm viral transport media...

Government Hospital - Rajasthan

30183736 supply of consumables items for covid lab aerosol free tips dna rna free molecular grade sterile autoclavable yello red black blue color biosafety bags with symbol , ethanol molecular grde , isopropanol molecular grade , lint paper , micro centrifuge tubes , nuclease elminator for rna rnase d nase zap , powder free nitrile gloves , cryo storage box , with stand ampoules 96wells , cryo screw cap tubes with o ring molecular sterile , screw cap serum storage , aluminum foil paper roll , reversible racks for micro tubes , paper towel , paraffin sample packing tap, falcon tube , filter paper sheet , nuclease free water , micro pipette stand , pcr cooler ,microamp fast reaction opticaltubes with cap strip , vtm storage rack , plastic tube stand rack plastic apron disposabler , disposable airtiht goggle , vtm viraltransport media etc ...

General Administration Department - Rajasthan

30126930 supply of kirana ( grocery ) items on rate contract basis for the period of one year 1. whole wheat atta (premium quality/branded) 5 kg. 2. makka atta (premium quality/branded) per kg. 3. bajra atta (premium quality/branded) per kg. 4. refine veg oil. (premium quality) 5 ltr. 5. groundnut oil (premium quality) 1 ltr. 6. desi ghee (premium quality) per ltr. 7. rice basmati (premium quality) per kg. 8. papad (bikaji) fny[k qk@ckrphr 400 gm. 9. papad (bikaji) iklikl 400 gm. 10. besan (premium quality) per kg. 11. maida (premium quality/branded) per kg. 12. suji (premium quality/branded) per kg. 13. toor dal regular (standard quality) per kg. 14. urad mogar (standard quality) per kg. 15. urad dal chilka (standard quality) per kg. 16. urad whole (standard quality) per kg. 17. moong chilka (standard quality) per kg. 18. moong mogar (standard quality) per kg. 19. red masoor (standard quality) per kg. 20. dal chana (standard quality) per kg. 21. kabuli chana (standard big size) per kg. 22. kala chana sabut (standard big size) per kg. 23. rajma red (standard big size) per kg. 24. sevaiyan (roasted) – 200 gm. per pkt. 25. badi mangodi masala 500 gm. 26. sugar (premium quality/branded) 1 kg. 27. gud (jaggery) per kg. 28. tata salt per kg. 29. saindha namak 100 gms. per pkt. 30. kala namak 100 gms. per pkt. 31. sounf big per kg. 32. sounf small (lucknowi) per kg. 33. garam masala whole per kg. supply of kirana (grocery) items on rate contract basis 19 34. garam masala powder (mdh) per kg. 35. coconut powder (premium quality) per kg. 36. khus khus (premium quality) per kg. 37. mishri cutting per kg. 38. elaichi chhoti (cardamom) per kg. 39. mdh red chili powder per kg. 40. mdh dhaniya powder per kg. 41. mdh amchoor powder per kg. 42. mdh termeric powder per kg. 43. mdh chat masala (100 gms.) per pkt. 44. mdh kasauri methi (100 gms.) per pkt. 45. mdh chana masala (100 gms.) per pkt. 46. mdh chicken masala (100 gms.) per pkt. 47. mdh meat masala (100 gms.) per pkt. 48. mdh rajma masala (100 gms.) per pkt. 49. mdh kitchen king (100 gms.) per pkt. 50. catch black pepper (100 gms.) per pkt. 51. mdh black pepper (100 gms.) per pkt. 52. catch white pepper (100 gms.) per pkt. 53. mdh white pepper (100 gms.) per pkt. 54. ramdev hing (100 gms.) per pkt. 55. sabut hing (100 gms.) per pkt. 56. azavayan per kg. 57. catch table salt (100 gms.) per packet 58. kaju tukdi per kg. 59. kishmish per kg. 60. pista cutting per kg. 61. badam cutting (mamra) per kg. 62. rye per kg. 63. melon seeds per kg. 64. kesar premium per 1 gm. pack 65. jeera per kg. 66. red chilly whole per kg. 67. amchoor sabut (white) per kg. 68. dhaniya whole per kg. 69. ajeno moto packet per 100 gm 70. phool makhana (rajbogh) per 250 gm 71. edible soda per 100 gm 72. kalonji per kg. 73. dana methi per kg. 74. imli whole (without seeds) per kg supply of kirana (grocery) items on rate contract basis 20 75. anardana per kg 76. soyabean mangori packet per 200 gm 77. fruit jam kissan per 500 gm 78. kellogs corn flakes packet per 475 gm 79. green tea bag 25 bag/packet per pkt. 80. red lable tea (tetra pack) per kg. 81. lipton green label tea (packet) per kg 82. taj tea begs (packet) 100 bag per pkt. 83. kissan tomato ketchup per kg. 84. maggi tomato ketchup per kg. 85. red chilly sauce (premium quality/branded) 700 gm. 86. green chilly sauce (premium quality/branded) per 300 gms. 87. nescafe classic coffee (jar) per 50 gm 88. sugar cubes (premium quality/branded) per 500 gm 89. sugar free (small) per pkt. 90. mix veg pickle (premium quality/branded) per kg. 91. biscuits (monaco) 150gm per packet 92. biscuits (good day) 150gm per packet 93. biscuits (dark fantasy/chocofills) 75gm. per packet 94. custard powder per 500 gm 95. corn flour per 500 gm 96. fruit cocktail tin per 850 gm 97. frozen peas (premium quality/branded) per kg. 98. poha per kg. 99. clean film (fresh wrap) per 72 mtr. 100.aluminum foil (premium quality/branded) per 72 mtr. 101.tooth pick (premium quality/branded) per pkt. 102.bikaneri bhujiya 400gm. (bikaji/ haldiram) per packet 103.bikaneri bhujiya 1 kg. (bikaji/ haldiram) per packet 104.ground nut (kachhi) per kg. 105.mustard oil (premium quality) per. ltr. 106.vinegar (500 ml btl) per btl. 107.soya sauce (200 ml btl) ...