Department Of Atomic Energy - Rajasthan

37852527 bids are invited for with super soft aluminium foil reusable insulation with binder less fiber mat , tape with super soft aluminium foil reusable insulation with special high temperature and tape total quantity : 914...

Jhalawar Medical College and SRG Hospital - Rajasthan

37822348 tender for rate contract for general items for vrdl / rtpcr lab at medical college and hospital jhalawar 1 microbiology 2 absorbent paper roll 3 absorbent paper sheet 4 aluminum foil 5 autoclavable pp plastic racks for 96 places 6 bags, biohazard, (transparentautoclavable 7 cetylpyridinium chloride (cpc) for bioch emistry mw 358.01>98% 8 cold chain box (12 lit.) 9 cotton roll 10 diamond pencil 11 di sodium hydrogen phosphate 12 disposable head caps 13 disposable lab gownspp (large and medium) 14 disposable shoe cover 15 disposable syringes 5 ml (22 & 24 gauge) 16 dnase/rnasesurface decontaminant 17 dropper bottle 18 droppers, sterile, plastic 1.5 ml, graduated 19 droppers, sterile, plastic 3.0 ml, graduated,disposable 20 edta 21 ethanol 95% 22 filter paper 23 fluorescent staining kit for afb 24 formaldehyde 25 glass funnel 26 gloves nitrile, size s m l 27 gloves, latex size s m l 28 glycerol 29 hydrochloric acid, fuming (37%) 30 hydrogenperoxyde 30% 31 immersion oil 32 laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for pcr lab 33 laboratory thermometer 34 l asparagine 35 lint free soft tissue 36 liquid dispensingwash bottle plastic (500ml) 37 lj medium base powder ready mix 38 loop, disposable 10 µl 39 loopholder 40 loopholder rack 41 magnesium sulphate 42 malachite green 43 mask (disposable surgical) 44 mccartney bottle 15 ml 45 mccartney bottle 7 ml 46 mcfarland standard set 47 micro pipette stand pipette stands for 5 pipettes 48 micropipette tips nuclease& pyrogen free & aerosol barrier (0.1 20µl) maximum recovery/minimum retentionfiltered, racked, sterile 49 micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery/minimum retentionfiltered, racked, sterile (100 1000µl) 50 micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery/minimum retentionfiltered, racked, sterile( 2 200µl) 51 molecular grade ethanol 52 molecular grade isopropanol 53 n95 respirators (niosh approved) 54 na acetate 55 n acetyl l cysteine (nalc) powder 56 naphthyl ethylendiamine 57 needle destroyer 58 niacin strips 59 nichrome wire 60 nicotinamide 61 parafilm 62 pcr tubes flat snap cap 0.2 ml 63 pcr tubes strip with flat cap optical for rtpcr 0.2 ml 64 phenol 65 plastic racks (15 ml tubes) 66 plastic racks for 15 ml conical falcon tubes 67 plastic racks for 2 ml mct, autoclavable, 68 plastic racks for 50 ml conical falcon tubes 69 plastic storage box for0.2 ml pcr tubes with lid 70 plastic storage box with lid for 2 mlcryovials 10x10 71 potassium dihydrogen phosphate 72 potassium permanganate 73 sample collection container sterile 74 cryovials 75 screw cap(hinged) mct tapered(1.5ml ) 76 slide drying racks 77 snap cap (hinged) mct tapered(1.5 ml ) 78 snap cap (hinged)mct roundbottom (2 ml ) 79 sodium chloride, nacl 80 sodium hydroxide, naoh 81 sodium hypochlorite solution 82 sodium nitrate 83 spray bottles sprayldpe 500 ml 84 spray bottles plastic pp 250 ml 85 sputum container 86 staining bottle 87 staining rack 88 sterile blue tips bulk (1000µl) 89 steriletips bulk (10µl) 90 sterile yellow tips bulk (100µl) 91 sulfuric acid, concentrated 92 sulphanilamide 93 test tube rack pp for vtm tubes 94 tissue roll 95 torniquet 96 tri magnesium di citrate 97 tube, centrifuge, 15 ml with screw cap 98 tube, centrifuge, 50 ml with screw cap 99 tubes cryovial, sterile with screwcap, 2 ml 100 tubes reaction, 2 ml 101 universal bottle for cultures, 28 ml 102 water molecular biology grade 103 xylene 104 zinc powder 105 zn acid fast staining kit 106 autoclavable pp cryoboxes suitable for storage at 80 c 10 x10 samples for 2 ml cryovials 107 autoclavable pp racks for 1.5 ml mct 48 samples (24 pieces) ...

State Forensic Science Laboratory - Rajasthan

37689208 tender for supply of lab items 2 adhesive tape double sided 3 adhesive tape double sided 4 adhesive tape usp 5 air bubble line paper envelope 6 air bubble line paper envelope 7 air freshners spray for lab. 8 aluminium foil 9 ash less filters grade 40 10 ash less filters grade 41 11 ash less filters grade 42 12 big towel ( turkish towel ) 13 biomedical polybags 14 biomedical waste container with lid 15 biomedical waste container with lid with trolley 16 blood lenset 17 blue epoxy coated racks 18 bottle opener 19 brush for washing test tube 20 brushes washing stain less steel nylon bristles cleaning brushes 21 bucket plastic 22 bucket plastic 23 bucket plastic 24 bucket with lid 25 capillary tubes for tlc 26 card reader 27 cavity slide 28 chlorpyriphos 29 cloth mesh line envelope 30 cloth mesh line envelope 31 co2 type fire extingusher ( isi ) 32 cockroach killer 33 cork no. 4, 5 34 cotton roll 35 cryo babies / cryo tags 36 deoderising pearls 37 detergent powder 38 disinfectant wipes 39 disposable bouffant cap 40 disposable bouffant cap 41 disposable examinationnitrile gloves 42 disposable examination latex gloves 43 disposable examination nitrilegloves 44 disposable examinationlatexgloves 45 disposable examination latex gloves 46 disposable examination nitrile gloves 47 disposable hair cap 48 disposable surgical latex gloves 49 dissecting cushing thumb forceps 178mm 50 dissecting tissue forceps 11 4cm 51 dissecting tissue forceps 20 cm 52 dna isolation kit for all type of forensic exhibits 53 dranex wastepipe sink cleaner 54 dropper 55 dropper 56 dropper 57 dust pan 58 electric heater 59 enameled tray 60 face mask with nose pin ( pack of 100 ) 61 face mask ( pack of 100 ) 62 face mask 2ply ( double ply face mask ) ( pack of 100 ) 63 face mask 2ply ( double ply face mask ) ( pack of 100 ) 64 face mask n95 ( pack of 100 ) 65 first aid box 66 floor mat / door mat 67 floor wiper 68 floor wiper 69 gas regulator 70 glass plate 71 glass plate 72 glass rod solid 73 glass rods solid 74 glass rods solid 75 glazed porcelain mortar 76 glazed porcelain pestles 77 glucose test strip for urine test 78 hand sanitizer 79 hand sanitizer 80 hand sanitizer 81 harpic 82 hazard communication tablets with dispenser 83 heater blower 84 heating element for water bath 85 heating element for water bath 86 heating element for water bath 87 heating element with plate for hot plate 88 helmet with face shield ( fire and explosive cases ) 89 hit spray for exhibit room 90 kinwip tissue papers 91 lab coat 92 lab soaker role 93 label stickers 94 ld apron 95 liquid soap 96 liquid soap 97 liquid soap 98 lock 99 lock 100 lock 101 lock 7 lever at least 102 lock 7 lever at least 103 magnifier glass with handle 104 magnifier glass with light 105 match box 106 mechinical sprayer sanitization 107 melting point apparatus 108 metal neddle holder with needle 109 metallic scale 110 metallic scale 111 metallic scale 112 metallic tray 113 metallic tray 114 micro probe length 152mm 115 microscopic cover glass slip 116 microscopic cover glass slip 117 microscopic glass slides 118 microscopic glass slides 119 mirror cleaner 120 mosquito repellantmachine 121 mosquito repellantrefill 122 rat kill 123 n 95 particulate respirators 124 naphthalene balls 125 napkin 126 napkin tissue papper 127 non woven pp crown 128 non woven pp gown 129 ordinary filter paper 130 ot absorbent towel 131 ot absorbent towel 132 ot hand towel 133 packing thread ( thick cotton ) 134 paint remover 135 paper holder clips 136 paper hole punching machine 137 patient id labels addressograph 138 paydan ( jute ) 139 paydan ( jute ) 140 pen drive 141 pen drive 142 pen drive 143 pen drive 144 pen drive 145 pen with tungston carbide tip 146 pencil cell 147 pencil cell 148 phenyl 149 plaster of paris 150 plastic basket 151 plastic basket 152 plastic basket 153 plastic dust bin 154 plastic dustbin with lid 155 plastic sprayer head 156 plastic spray bottle 157 plastic stool 158 plastic tray 159 plastic tub 160 plastic tub 161 polythene pouchzip lock 162 polythene pouchzip lock 163 porcelain dishes 164 porcelain dishes 165 ppe kit 166 paper shredder 167 rechargeable cell 168 rechargeable cell 169 retort clamps with bosh head 170 retort stand ( heavy duty ) 171 room spray sandle / rose / lavander 172 rough long handled porcelain pestles 173 rough porcelain mortar 174 safe handle 175 safety face shield 176 safety goggles uv light 177 sample container, pp / hdpe 178 scissor with iron plastic handle 179 scissors ( heavy duty ) 180 scissors ( heavy duty ) 181 scissors with brass handle 182 scissors with plastic handle 183 scissors with plastic handle 184 self adhesive labels 185 sewing machine needle 186 sewing machine oil 187 sewing machine thread white 188 shaving blades 189 shoe cover disposable ( ts pbb ) 190 shoe cover disposable ( ts nwb ) 191 shoe cover non woven 192 single burner gas stove 193 sleeper rubber chappals 194 sleeper rubber chappals 195 sleeper rubber chappals 196 sleeper rubber chappals 197 small napkins 198 soap 199 soap 200 sodium hypochlorite 201 spatulas 202 spatulas 203 sprayer ( plastic ) 204 sprayer ( plastic ) 205 sprayer ( metallic ) 206 stainless steel ( pointed ) forceps ( heavy duty ) 207 stainless steel ( pointed ) forceps ( heavy duty ) 208 stainless steel ( pointed ) forceps ( heavy duty ) 209 stainless steel ( pointed ) forceps ( heavy duty ) 210 stainless steel ( pointed ) forceps ( heavy duty ) 211 stainless steel crucible tongs ( heavy duty ) 212 stainless steel crucible tongs ( heavy duty ) 213 stainless steel crucible tongs ( heavy duty ) 214 stainless steel filter holder 215 stainless steel forcep ( bent pointed ) 216 stainless steel forcep ( flat tip ) 217 stainless steel gas tubing 218 stainless steel nuts for fitting of gas tubing 1 / 8” 219 stainless steel scissors with flat ends 220 stainless steel scissors with flat ends 221 stainless steel scissors with pointed ends 222 steel scriber 223 steel scurber 224 sterile ear buds for blood test ( ear buds ) 225 sterile omni swab 226 surgical blade 227 surgical blade holder 228 surgical gloves 229 surgical gloves 230 surgical gloves 231 surgical gloves 232 syringe disposable 233 syringe disposable 234 syringe disposable 235 table top elevated desk 236 temperature resistant hand gloves fore arm size 237 test tube brushes 238 thread packing ( thick cotton ) 239 three prong beaker tongs 240 tissue paper roll 241 tongs ( metallic ) 242 tongs ( metallic ) 243 tongs ( metallic ) 244 towel 245 traceable balance spatula 246 transfer pipete brush 247 transparent pvc tubing 248 transparent pvc tubing 249 traymetallic point coated 250 traymetallic point coated 251 traymetallic point coated 252 wash bottleplastic 253 washing powder ( surf ) 254 watch glass 255 water glass 256 water jugs 257 water pvc pipe 258 water pvc pipe 259 wet wipes 260 yarn role 261 yellow envelope 262 yellow envelope...

University of Rajasthan - Rajasthan

37663529 supply of chemical, glassware and consumable , at botany department, uor, jaipur , chemical items : , acetone extrapure , 99% , biotin extrapure , 99% , boric acid extrapure ar, 99% , calcium chloride ( fused ) pure , 90 % 95% , calcium chloride dehydrate extrapure ar , 99.5% , calcium nitrate tetrahydrateextrapurear , acs , 99% , chloroform extrapure , 99% , coomasiebrillant blue for molecular biology , cooper sulphate extrapure ar , 99.5% , cooper sulphate pentahydrateextrapure ar , acs , cooper sulphate.7h2o , cupic chloride extrapure ar , acs exiplus, , dichlorimethaneextrapure ar , 99.5% , diethyl ether extrapure ar , 99.5% , dimethyl sulfoxideextrapure ar, 99.5% , dipotassium hydrogen phosphate extrapure ar, 99.5% , dimethyl sulfoxide ( sigma aldich ) , dipotassium phosphate extrapure ar , 99.5% , ethanol ( pack of 20 ) , hplc –grade methyl tertiary butyl ether ( mtbe ) for hplc, 99.5% , isoamyl alcohol extrapure ar, 99% , magnesium sulphate hepatahydrateextrapure ar, 99% , manganese ( ii ) chloride tetrahydrateextrapure ar 99% , manganese bi chloride , methanol extrapure ar, 99.8% , monopotassium phosphate , n hexane pure, 99% , petroleum ether ( 40 60*c ) extrapure ar , petroleum ether ( 60 80*c ) extrapure ar , petroleum ether ( 80 100*c ) extrapure ar , phenol extrapure ar, 99.5% , phosphoric acid extrapure ar , acs, 85% , potassium chloride extrapure ar, 99.5% , potassium hydrogen phosphate extrapure ar, 99.5% , potassium hydroxide extrapure ar, 85% , potassium nitrate , sodium bicarbonate extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , vitamin –b1 , ethidium bromide , for molecular biology , tris , free base, for molecular biology , n, n, n, n cetyltrimethyl ammonium bromide , rm 4867 , muller hinton agar ( mha ) himedia , polyvinylpyrrolidone ( pvp ) k 30 , agarose , silica gel 60 120 mesh , silica gel self –indicating , deionized water , taq polymerase ( 1 unit / ul ) , rnase a ( dnase free ) 20mg / ml , 1kb ladder dna , bromophenol blue extrapure ar , 10x tbe , gelelectrophoresis power supply , vortexmixture , 20*c pcr minicoler , 96 places , 0.2 capacity , 20* c minicoler with gel filled cover 32 places , 1.5 ml capacity , dntp mix , 100ml ( 25mm each ) , 1000ul , cytokinin , auxin , gibbrellic acid , acetic anhydride , triton x100 , lactic acid , aneline blue , toluidere blue , acetocarmine , basic fuschine , litmus milk , fast green , gluteraldehyde , osmium tetraoxide , yeast extract mannitol ( yem ) , mannitol , agar , ms medium prepared murashige&skoog medium w / cacl2 , vitamins & mes ; w / o surose& agar , gold nano particles dispersion ( spherical ) ( au20 ) , 0.05mg / ml citrale. 0.1mm in pbs , zinc oxide nano powder type i , silver nanoparticals dispersion ( spherical ) ( ag20 ) 0.02mg / ml in citrate 5mm , graphene platelet nano powder ( gpn type i ) , cupic oxide nano powder , carbon nano tubes multiwalled , twin 20 , potato dextrose agar , potato detose broth , sabrourauddetoxe agar , yeast extract powder , bushellhaas broth , parafilm m roll 125’ lx4w , plant dna isolation kit , chloroplatinic acid hexahydrate , ethyl cellulose , 1 butyle 3 methylelimidazolium iodide , 4 tert butyl pyridine ( tbp ) , guanidiniumthiocyanate , valenonitrile chemical , dye solar cell sample , terpineol , titanium ( iv ) oxide , fto , ti nanoxide , iodolyte pn 50 , iodolyte z 150 , lithium iodide , silica gel for column , hexane >95% , 1 –octadecene , oleylamine , glassware items : , test tube ( culture ) without rim 15ml [ 9910007 ] , test tube ( culture ) without rim 20ml [ 9910008 ] , test tube ( culture ) without rim 30ml [ 9910010 ] , 10x tbe [ ml011 ] , pcr minicooler 20°c, 96 place, 0.2ml capacity [ 525110 ] , pcr minicooler 20°c, 32 place, 1.5ml capacity [ 526030 ] , round bottom flask 250ml [ 4260021 ] , autoclave bages 12x24 [ 550022 ] , autoclave indicator tape 075x500 [ 680000 ] , beaker 1000ml [ 1000d29 ] , beaker 100ml 1000d16 ] , beaker 2000ml [ 1000d30 ] , beaker 250ml [ 1000d21 ] , beaker 500ml [ 1000d24 ] , beaker 50ml [ 1000d12 ] , bod bottles 300ml [ 1250022 ] , burette boroflow 50ml [ 2122012 ] , cell spreader 3cm , cover glass 22x22 [ 9115s02 ] , culture petri dish s line 100x15 [ 3165077 ] , culture petri dish s line 100x20 [ 3165a77 ] , culture petri dish s line 150x25 [ 3165081 ] , eppendrof tube 2ml [ 500020 ] , round bottom flask 1000ml [ 4260029 ] , round bottom flask 100ml [ 4260016 ] , round bottom flask 250ml [ 4260021 ] , roudn bottom flask 2000ml 4260030 ] , glass spreader [ 9865683 ] , round bottom flask 500ml [ 4260024 ] , flask erlenmeyer, conical, narrow mouth 50ml [ 4980012 ] , flask erlenmeyer, conical, narrow mouth 100ml [ 4980016 ] , flask erlenmeyer, conical, narrow mouth 250ml [ 4980021 ] , flask erlenmeyer, conical, narrow mouth 500ml [ 4980024 ] , flask erlenmeyer, conical, narrow mouth 1000ml [ 4980029 ] , flask erlenmeyer, conical, narrow mouth 2000ml [ 4980030 ] , funnel 50mm [ 6140065 ] , funnel 100mm [ 6140077 ] , glass rod 7x150 [ 9850107 ] , glass rod 9x150 [ 9850109 ] , glass rod 9x305 [ 9850409 ] , glass rod 7x305 [ 9850407 ] , glass spreader 6x150mm l shaped [ 9865683 ] , incoulatingnichrome wire loop with insulated hadle 2mm long [ la650 ] , incoulatingnichrome wire loop with insulated hadle 4mm long [ la014 ] , measuring cylinder 100ml [ 3022016 ] , measuring cylinder 10ml [ 3022006 ] , measuring cylinder 250ml [ 3022021 ] , measuring cylinder 25ml [ 3022009 ] , measuring cylinder 50ml [ 3022012 ] , measuring cylinder 5ml [ 3022005 ] , measuring tape ( high quality ) 5 m , microcentrifuge tube 1.5ml [ 500010 ] , micropipette single channel variable volume 0.2 2ul [ lhc37112002 ] , micropipette single channel variable volume 0.5 10ul [ hc37112005 ] , micropipette single channel variable volume 2 20ul [ lhc37112008 ] , micropipette single channel variable volume 10 100ul [ lhc37112020 ] , micropipette slides 76x26x1 [ 9100p02 ] , micro tip box 200 1000ul [ 524059 ] , microtips 0.5 10ul [ 521050 ] , microtips 2 200ul [ 521014 ] , microtips 200ul [ 521014 ] , microtips 200 1000ul [ 521020 ] , micrtips 5 10ul [ 521050 ] , parafilm 2 wide [ 380010 ] , petridish 80x15mm [ 3165072 ] , petridish 90x15mm [ 3165a75 ] , pipette stand box 6 pipette stand with drawer , pipette tips 10ul 521100 ] , pipette tips 20ul [ 521108 ] , pipette tips 100ul [ 521101 ] , pipette tips 200ul [ 521101 ] , pipette tips 1000ul 521103 ] , pipette measuring ( mohr type ) , class a 5ml [ 7060p05 ] , pipette measuring ( mohr type ) , class a 10ml [ 7060p06 ] , pipette measuring ( mohr type ) , class a 25ml [ 7060p09 ] , quartz cuvettes , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles ( graduated with screw cap and pouring ring ) 1000ml [ 1501029 ] , reagent bottles amber ( graduated with screw cap and pouring ring ) 1000ml [ 1519029 ] , reagent bottles amber ( graduated with screw cap and pouring ring ) 1000ml [ 1519029 ] , reagent bottles amber ( graduated with screw cap and pouring ring ) 1000ml [ 1519029 ] , reagent bottles amber ( graduated with screw cap and pouring ring ) 1000ml [ 1519029 ] , schott bottles 1000ml , schott bottles 250ml , schott bottles 500ml , screw cap storage bottles 2000ml [ 1501030 ] , separating funnel 250ml [ 6402021 ] , spatulla ( chattawayspatulla, big spoomspatulla one end flat and one end spoon ) , glass sprayer for tlc , stirrer 7x150mm [ 9850107 ] , stirrer 9x150mm [ 9850109 ] , test tube stand ( plastic, 19 and 25 holes assorted ) [ 202040 ] , test tube 12x100mm [ 9800u03 ] , test tube 15x150mm [ 9800u05 ] , test tube 25x150mm [ 9800u08 ] , test tube 32x200mm [ 9800u10 ] , blotting paper a3 ( 1pkt ) , tong for beaker , tong for flask , tubes culture, media, round bottom, with pp screw cap and liner capacity 50ml [ 9900012 ] , tubes culture, media, round bottom, with pp screw cap and liner capacity 50ml [ 9900012 ] , tubes culture, media, round bottom, with pp screw cap and liner capacity 50ml [ 9900012 ] , volumetric flask 50ml [ 5641012 ] , volumetric flask 100ml [ 5641016 ] , volumetric flask 200ml [ 5641020 ] , volumetric flask 500ml [ 5641024 ] , volumetric flask 1000ml [ 5641029 ] , whatman filter paper round grade no. 1 size 110mm , blotting paper , glass quvette , quartz cuvettes , falcon tube 15ml sterile [ 500021 ] , glass tube with pp screw cap 30ml flat bottom [ 9910010 ] , glass tube with pp screw cap 30ml amber flat bottom [ 9911010 ] , glass tube with pp screw cap 10ml amber flat bottom [ 9901006 ] , glass tube with pp screw cap 10ml rflat bottom [ 9900006 ] , borosil 1000ml chromatography column with stopcock, 6100068 , borosil 500ml chromatography column with stopcock & sintered disc, 6101064 , borosil 450ml plain chromatography column with glass stopcock, 6100063 , borosil 200ml plain chromatography column with glass stopcock, 6100060 , borosil 200ml buchner funnel with sintered disc, porosity grade: 5, 3606920 , borosil 1000ml 34 / 35 joints round bottom short neck boiling flask, 4380d29 , laboratory retort stand lab support stand with a burette clamp and 1 flask ring clamps , burette stand with finger clamp , borosil 47mm glass filter holder, 5350029 , borosil 1000ml heating mantle, gme010 , lab porcelain mortar and pestle ( 60mm , 80mm, 100mm , 130 mm 160mm ) set , generic tlc silica plate aluminium ( 25 sheets 20*20cm ) , rectangula tlc chamber ( 20*20cm ) , microtip boxes medical grade virgin polypropylen empty tipbox 1000m ( borosil ) bgt 01000 etr , dionized water otds ( dm wster ) 5l , microtip box for microtip of 2 200 ml , air tight jar ( tupperware ) 10 kg , air tight jar ( tupperware ) 5.5l , air tight jar ( tupperware ) 2.5 lit , air tight jar ( tupperware ) 1.1l , air tight jar ( tupperware ) 500 ml , air tight jar ( tupperware ) 250ml , aluminium foil ( pkt ) ( 72 mt ) , binder clips small size ( pkt ) , bottle brush ( set ) , brown tape 2 inch , cello tape dispenser ( small ) , cing film plastic wrap ( 300 meter ) , colourfullpens ( uniball ) , compartment metal mesh desk organizer , computer mouse , desk organizer drawer , diary spiral , dustbin ( 50 liter ) with pedal , megnatic white board dusterwith spring marker holder , apsara non dust eraser ( pkt ) , extension cord with power switch , fevicol ( 200g ) , feviquick , fevistick , index file ( lever arch box file ) no.40 , laminated cobra files , glue , hand towel ( 13x21 inch ) , hot glue gun , silicon heat resistant microwave hand gloves , blue nitrile handglove ( rubber ) pkt ( size m ) , size ( l ) , handgloves ( autoclave ) pair , toshiba canvio partner 1 tb external hard disk drive hdd , highlighter multicolour ( pkt of 5 , interactive digital board ( samsung ) , key holder , laptop bags , cadyce ca 6ucwc 60w 6 port usb wall charger with quick charge and usb c port , m seal , notice board ( 3x2 ft. ) , paper cutter , document plastic folder with push and lock , document file folder , pen drive ( 16 gb ) hp , pencil ( pkt ) apsera , pens ( pack of 6 ) ( uniball ) , permanent marker ( pack of 12 ) , permanent marker ( big ) blue+black , kensington k33374 wireless presenter with red laser pointer ( black ) , 3x4 inch transparent self adhesive plastic pouch bag for packing / storage, pack of 500 , box pouches , victorex oxo biodegradable packing material, 4 inch ( 100 mm ) , 100 meters length per unit, pack of 3 , power extension cord , printer rim , register , rubber band pkt ( big + small ) , scale ( 12 inch ) pkt , scales ( 6 inch ) pkt , scissor ( big ) , scissor ( small ) , scotch brite sponge , pencil sharpener pkt , sketch pens ( doms ) pkt , correction pen , stamp pad , stamp pad ink ( blue ) camel , sticky notes set , stock register , strapler ( big ) , strapler ( small ) , strapler pin pkt ( 24x6 ) , strapler pin pkt no. 10 , tissue paper ( pkt ) 100 pcs , tissue rolls ( pkt ) 225 meter , u clips ( pkt ) , vim bar , cello tape roll 2inch , cello tape roll 1inches , punching machine no 480 , punching machine no 600 , wireless headphone with mice oneplus , l folder , brown tape roll 2inch , rubber band pkt ( 200 gms ) , duster cloth , wet wipes , black tape water proof , double sided tape ( 1 inch ) , double sided tape ( 2 inch ) , silicon tape double sided for wall waterproof grip tape 3 metre length , transparent box with 36 grid , transparent box for storage pack of 5 different size , durocell aaa bettery ( pack of 10 ) , duracell ultra aa ( pack of 10 ) , lock small harrison , lock big harrison t 26 , door close ozone silver scissor aram overhead=en 1 2 ( nsk=580 estd ) , lock small harrison , lock big harrison t 26 , door close ozone silver scissor aram overhead=en 1 2 ( nsk=580 estd ) , pen hauseaerox pack of 50 ball pen...

University of Rajasthan - Rajasthan

37649967 supply of chemical, glassware and consumable woody plant media, nutrient broth, acetone, ethanol, vim liquid, aluminum foil large, autoclavable polybags, pet ether, filer paper, zip bags, rutin, lanosterol, copper sulphate at botany department, uor....

Department Of Local Bodies - Rajasthan

37647338 supply of open gym, kids play equipment, cctv, sound system installation work at raja kothi park, hanumangarh town 1 health walker specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing 1 nos 32520 32520.00 inr thirty two thousand five hundred & twenty only 2 sit up bench specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing 1 nos 39285 39285.00 inr thirty nine thousand two hundred & eighty five only 3 mini sky specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing 1 nos 33345 33345.00 inr thirty three thousand three hundred & forty five only 4 dual ski stepper specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing 1 nos 39285 39285.00 inr thirty nine thousand two hundred & eighty five only 5 big turning wheel specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing 1 nos 28230 28230.00 inr twenty eight thousand two hundred & thirty only 6 triple twister specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing 1 nos 32520 32520.00 inr thirty two thousand five hundred & twenty only 7 power push specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing 1 nos 77895 77895.00 inr seventy seven thousand eight hundred & ninety five only 8 rower specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing 1 nos 33345 33345.00 inr thirty three thousand three hundred & forty five only 9 leg press specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing 1 nos 42750 42750.00 inr forty two thousand seven hundred & fifty only 10 cross trainer specifications main pipe dia 127.mm thickness 3 mm base plate dai 200 mm thickness 10 mm 1 nos 34995 34995.00 inr thirty four thousand nine hundred & ninety five only thickness 3 mm base plate dai 200 mm thickness 10 mm powder coating gi pipe nbc bearing size 1370 x660x1755xmm 11 providing and installation of climber: providing and fixing of climber required area is 0.6m x 2.5m with total height2m from ground level.the pure polyester powder coating (over baked) done on the pipe extend the life of equipments and seating capacity is 2 6 childrens and age limit 4 12 years. 1 nos 44590 44590.00 inr forty four thousand five hundred & ninety only 12 providing and installation of sea saw : providing and fixing of climber required area is 2m x 0.9mx0.6m with total height .6m from ground level.the pure polyester powder coating (over baked) done on the pipe extend the life of equipments 1 nos 31300 31300.00 inr thirty one thousand three hundred only 13 providing and installation of swings : providing and fixing of swings required area of 3m x 1.5mx2m and total height of 2m.the pure polyester powder coating (over baked) done on the pipe extend the life of equipments with rubber/dumlop belt for capacity of 2 childrens of 4 12 years. 1 nos 58400 58400.00 inr fifty eight thousand four hundred only 14 providing and installation of economy slides : providing and fixing of slides with arae of 3mx0.7m and safe play area of 4mx1m. platform height of 1.83m , has capacity of 4 8 childrens of 3 12 years.the pure polyester powder coating over baked) done on the pipe extend the life of equipments. 1 nos 78700 78700.00 inr seventy eight thousand seven hundred only 15 supply , drawing and testing of outdoor singlemode [ 9 micron ] glass fiber optic cable as per latest ammendments of tia /eia 568b.3 , gr 409 core / ul listed nec 770 standards in existing ms/pvc conduits/ slotted channels with ferruling at both ends for identification 4 fiber 1800 mtr 120 216000.00 inr two lakh sixteen thousand only 16 supply, drawing and testing of 4 pair, 23 awg solid bare copperwire insulated with pvc, category 6a , ftp (foiled twisted pair),100 ohm impedance, indoor cable as per latest ammendments ofansi/tia/eia 568 , the copper conductors should be balancedtwisted in pairs, unscreened and aluminum foil sheilding ofindividual pairs protected by a low smoke zero halogen (lszh) jacket. certified performance in a 4 connectorconfiguration upto100 mtrs channel requirements & transmission frequencies up to500 mhz. cable should support ethernet 10gbase t according tothe standards. in existing ms/pvc conduits/casing cappingincluding making connections to information outlets and patchpanels with jack & ferruling at both ends for identification withnecessary tools for punching, stripping, crimping and testing etc asrequired complete in all respect. all as per pre approved byengineer in charge. for additional technical parameters of products/work 915 mtr 67 61305.00 inr sixty one thousand three hundred & five only 17 supplying and drawing fr pvc insulated & unsheathed flexible copper conductor isi marked (is:694) of 1.1 kv grade and approved make in existing surface or recessed conduit/casing capping including making connections etc. as required 2 x 2.5 sq.mm 300 mtr 42 12600.00 inr twelve thousand six hundred only 18 steel work in built up tubular trusses including cutting, hoisting fixing in position and applying a priming coat of approved steel primer,welded and bolted including special shaped washers etc. complete. electric resistance or induction butt welded tubes. 3000 kg 139.5 418500.00 inr four lakh eighteen thousand five hundred only complete. electric resistance or induction butt welded tubes. 19 providing corrugated g.s. sheet roofing including vertical/ curved surface fixed with polymer coated j or l hooks, bolts and nuts 8 mm iameter with bitumen and g.i. limpet washers or with g.i. limpet washers filled with white lead and including a coat of app roved steel primer and two coats of approved paint on overlapping of sheets complete upto any pitch in horizontal/ vertical or curved surfaces) excluding the cost of purlins, rafters and trusses and includingcutting to size and shape wherever required 0.80mm thick with zinc coating not less than 275gm/m² 100 sqm 982 98200.00 inr ninety eight thousand two hundred only 20 s&f following sizes (dia.) of isi marked medium duty pvc conduit along with accessories in surface / recessed using saddles, clamps, fastener as required including cutting the wall, covering conduit and making good the same as required.25 mm 1450 mtr 42 60900.00 inr sixty thousand nine hundred only 21 supply , installation, testing and comissioning of wall mounted communication rack with glass doors, handles ,lock , top and bottom cable entries, supports for mounting rack on wall , cable managers, one fan, equipment mounting hardware, power supply box for supplying power to switches, fans etc along with earth continuity kit, mcb, indicator, moulded power supply cable 1 nos 15000 15000.00 inr fifteen thousand only 22 earth work in excavation in foundation, trenches etc. including dressing of sides and ramming of bottoms, including getting out the excavated material, refilling after laying pipe/ foundation and disposal of surplus excavated material at a lead upto 50m suitable site as per direction of engineer for following depths, below natural ground / road top level. in all types soils/ saturated soil such as moorum, sand, sandy silt, clay, black cotton soil, kankar, etc. depth upto 1.5 m 650 cum 210.5 136825.00 inr one lakh thirty six thousand eight hundred & twenty five only 23 providing, installation, testing and commissioning of online ups system, single phase 230 v, 50 hz with 2 hour backup smf battery bank as per specification 3 kva 1 nos 123716 123716.00 inr one lakh twenty three thousand seven hundred & sixteen only 24 standard 19 rack cabinet (double bay rack) with telescopic slides, overload protection, power distribution box, cooling fans, dust filters & pneumatic plumbing to accommodate analyzer, calibrator & accessories 2 nos 137691 275382.00 inr two lakh seventy five thousand three hundred & eighty two only 25 p & f double ball bearing capacitor start ceiling fan of approved make complete with regulator and other accessories as required. (for estimation purpose only) 1050 mm sweep 3 each 1621 4863.00 inr four thousand eight hundred & sixty three only 26 executive medium back revolving office chair providing & fixing of executive medium back revolving chair having 2 each 9570 19140.00 inr nineteen thousand one hundred & providing & fixing of executive medium back revolving chair having forty only following specification : seat/back, assembly: the seat/back are made up of 12mm thick hot pressed plywood, upholstered with fabric and moulded polyurethane foam. the back foam is designed with contoured lumbar support for extra confort. back size :520mm (w) × 580mm (h) seat size :460mm (w) ×470nn (d) overall height : 1080mm polyurethane foam : the polyurethane foam is moulded with density = 45+2kg/m3 upholstery : fabrick/leatherette arm rests: the one piece of armrest in d shape made up of polypropylene sample and color to be approved by engineer incharge forty only 27 computer table(900x750mm) providing and fixing of staff clerk room tablemade out of 18mm ply isi bwp waterproof and acidproof and equalant make and 1mm thick mica at top and inside, front having combination pattern the top thick 38mm and top edge teak wood biding decorative one sight box with drawer and shutter locking arrangement 1 nos. key board tray or cpu arrangement with channel & self shutter complete melamine polish sample and color to be approved by engineer incharge. 1 each 12000 12000.00 inr twelve thousand only 28 sitc of air cooled split type air conditioners complete with indoor unit(idu), out door unit (odu), surface / concealed copper refrigerant piping with insulation (ep foam pipe section) upto 3 mtr (idu to odu), copper power cable upto 4 mtr (idu to odu), r 22/r410 refrigerant, remote, suitable for 400/230v +10% of 50 hz ,1 /3 phase ac supply capable of performing cooling, dehumidification, air circulation of following capacity with scroll / reciprocating / rotary 1.5 tr with 3 star rating of bee 1 each 58795 58795.00 inr fifty eight thousand seven hundred & ninety five only 29 supply, fixing and testing of following capacity iso certified company made wall mounted stabilizer having output voltagevariation from 200 v to 250 v(+/ 5%) with input voltage variation from 170 v to 260 v, time delay facility from 2 to 4 minute and high cutoff at 270 v with providing of 16 amp plug top making connection etc complete in all respect. nabl accredeated / cpri/ erda lab testing reports with oem certificate must submitted to engineer in charge 5 kva 1 each 3845 3845.00 inr three thousand eight hundred & forty five only 30 supply & fixing ms powder coated stand suitable for 1.0/1.5/ 2.0 toutdoor type of split ac. all as per pre approved by engineer icharge. for additional technical parameters of products/ work refer annexure a attached with this bsr . 1 each 1055 1055.00 inr one thousand &fifty five only 31 supply , installation, testing and comissioning of wall mounted push button station for ahu/air washers made out from powder 1 each 2478 2478.00 inr two thousand four hundred & push button station for ahu/air washers made out from powder seventy eight only quoted crca sheet of 16 swg , illuminated on/off push button including making connections etc as required complete in all respect. all as per pre approved by engineer in charge. for additional technical parameters of products/ work , refer annexure a attached with this bsr . seventy eight only 32 cctv cemera supply installation testing and commissioning of · 8 mp, 1/3” cmos image sensor, low illuminance, high image definition,outputs 8 mp (2560 × 1440)@25/30fps, max. supports,8 mp (2688 × 1520)@20 fps,h.265 coding, high compression ration, low bit rate,built in ir led, max ir distance: 30 m ,roi, smart h.264/h.265, flexible coding, applicable to various,bandwidth and storage environments,rotation mode, wdr, 3d dnr, hlc, blc, digital watermarking, applicable to various monitoring scenes,intelligent detection: intrusion, tripwire,abnormality detection: motion detection, video tempering, no ,12v dc/poe power support,ip67 protection grade make:cpplus/pelco/bosch/panasonic 15 nos 21950 329250.00 inr three lakh twenty nine thousand two hundred & fifty only 33 supply installation testing and commissioning of 4 mp wdr 45x ir network ptz camera 250 mtr. 1/2.8” 4 mp cmos image sensor, max. 50/60fps@1080p,powerful 45x optical zoom and 16x digital zoom wdr(120db), color: 0.005lux@f1.6;b/w: 0.0005lux@f1.6; 0lux@f1.6 (ir on), tripwire, intrusion, abandoned/missing, face detection, heat map, tracking trigger event motion detection, video tampering , scene changing, network disconnection, ip address conflict, illegal access, storage anomaly, auto tracking yes, 2d/3d dnr, day/night(icr), eis, defog, roi, agc, awb, blc, hlc,up to 300 presets, auto scan, 8 tour, 5 pattern, auto pan,ir range of 250 mtr.,360° endless pan rotation, built in 7/2 alarm in/out, ip67, ik10, sd card, poe+ product should ce, fcc, ul, rohs, bis certified. make:cpplus/pelco/bosch/panasonic 2 nos 98500 197000.00 inr one lakh ninety seven thousand only 34 supply installation, testing and commissioning of 32 channel ip camera input,h.265/h.264/mjpeg dual codec decoding,max 320 mbps incoming bandwidth,up to 8ch@1080p(4ch@h.265+4ch@h.264) realtime live view,up to 12mp resolution preview&playback,2hdmi/1 vga simultaneous video output,8/16 channel synchronous realtime playback, grid interface,support multi brand network cameras: dahua, arecont vision, axis, bosch, brickcom, canon, cp plus, dynacolor, honeywell, panasonic, pelco, samsung, sanyo, sony, videotec, vivotek and etc. ,onvif version 2.4 conformance,3d intelligent 1 nos 96800 96800.00 inr ninety six thousand eight hundred only vivotek and etc. ,onvif version 2.4 conformance,3d intelligent positioning with dahua ptz camera,support 8 sata hdds up to 64 tb, 4 usb(2 usb3.0), support face detaction .product should ce, fcc, ul, rohs, bis certified. make:cpplus/pelco/bosch/panasonic 35 supply and installation of surveillance hdd 4tb 4 nos 9890 39560.00 inr thirty nine thousand five hundred & sixty only 36 supply installation and testing commissioning of smart 55 led monitor, full hd led display,2 x hdmi port,1 x vga port,2 x usb port, inbuilt media player should be as per oem for web browser & file sharing compatibility through ip, external controlrs232c(in/out) thru stereo jack, rj45,contrast ratio 4000;1,response time 8 ms, brightness 350 cd/m2 20 watt built in speaker, viewing angle 178° x 178°,wall mount for display:, movable arm wall mount with 45° left / right movement, external media player compatible for above if required safety & emc certifications.make;lg 1 nos 69000 69000.00 inr sixty nine thousand only 37 4 meter pole for mouting cctv cameras and suitable mounting accessories with camera mouting arm, with foundation as per engineer in charge 10 nos 9950 99500.00 inr ninety nine thousand five hundred only 38 8 meter pole for mouting cctv cameras and suitable mounting accessories with camera mouting arm with foundation as per engineer in charge 2 nos 18950 37900.00 inr thirty seven thousand nine hundred only 39 supply installation and testing commissioning of 8 port 10/100mbps +2 uplink gigabit all 8 10/100/1000 ports support ieee802.3af/at standards,2 gigabit sfp fiber port for sfp module,ai extend: 1 8 port rate down to 10mbps, but the transmission distance up to 250 meters,ai vlan: isolating ports 1 8 from each other, suppress network storms effectively and,ai poe detect pd, power failure and restart dead equipment .all asscessoires ,tape rolls. 12 nos 18850 226200.00 inr two lakh twenty six thousand two hundred only 40 wire for camra light 1 mm multistand copper cable 1700 mtr 14.5 24650.00 inr twenty four thousand six hundred & fifty only 41 supply , installation, testing and comissioning of ip 66 rated junction box suitable for the power supply box for supplying power to switches, fans etc along with earth continuity kit, mcb, indicator, moulded power supply cable . 12 nos 4600 55200.00 inr fifty five thousand two hundred only 42 supply ,installation and testing of indoor 1 pair singlemode [ 9 micron ] glass fiber optic patch cords of three mtr length as per latest ammendments of tia /eia 568b.3 and iec 794 standard specifications including st ii / sc/lc/mt rj/pc connectors at both ends as per requirements. 12 nos 800 9600.00 inr nine thousand six hundred only 43 invertor ups 1100 va with battery 2 nos 19950 39900.00 inr thirty nine thousand nine hundred only 44 supply of 24 port giga switch with sfp 1 nos 19500 19500.00 inr nineteen thousand five hundred only 45 supply installation testing & commissioning of 1000 base sx, sfp, mmf, lc connector, multimode fiber giga module 10 nos 17454 174540.00 inr one lakh seventy four thousand five hundred & forty only 46 sound system supply installation testing and commissioning of · rack mounted pa mixer 1500 watts ac & 12v dc operation,power output 1500w rms/1800w ,input channels 1 mic,1 aux,1 line in,freq.resp. 60 15,000hz, bass: ±10db at 100hz, treble: ±10db at 10khz speaker outputs 2ω, 4ω, 70v & 100v,power supply ac: 220 240v 50/60hz brand ahuja/hitoneboss 1 nos 98500 98500.00 inr ninety eight thousand five hundred only 47 supply installation testing and commissioning of audio player , power inputs line stereo 500mmv (thd<1.0%) ,dp player with usb,sd,fm,mmc with remote control + usb recorder with wireless mic 1 nos 9500 9500.00 inr nine thousand five hundred only 48 supply installation testing and commissioning of garden speakers ,water resistant ,poly proplene spaekers,20 watts ,15/10/5w on 100v line,frequency response 60 20,000 hz,spl 90 db ahuja/hitoneboss 35 nos 9950 348250.00 inr three lakh forty eight thousand two hundred & fifty only 49 supply , installation, testing and comissioning of 12u wall mounted communication rack with glass doors, handles ,lock , top and bottom cable entries, supports for mounting rack on wall , cable managers, one fan, equipment mounting hardware, power supply box for supplying power to switches, fans etc along with earth continuity kit, mcb, indicator, moulded power supply cable 1 nos 17850 17850.00 inr seventeen thousand eight hundred & fifty only 50 3.0 meter pole for mouting speakers and suitable mounting accessories , cupler and cc foundation with ms plate (200 x 200) , 50 mm dia wight paint for speaker with foundation as per engineer in charge 35 nos 4750 166250.00 inr one lakh sixty six thousand two hundred & fifty only 51 making connecion of speaker as pole with all assaciry and wire etc complete 35 nos 400 14000.00 inr fourteen thousand only 52 wire for speker light 1 mm multistand copper cable 1900 mtr 18.5 35150.00 inr thirty five thousand one hundred & fifty only 53 providing & laying p.v.c. sheathed cable cable 1.5 sqmmm 2 core copper speaker cable round, wire size 100/40,100 wires in each core of 40 guge,copper,insulation: pvc ,jacket: soft pvc type: 2 core 1.5mm speaker cable conductor resistance: 13.3 ohm/km insulation resistance: 20 mohm x km operating voltage: max 50/75 v ac/dc/ approved temperature range: 10 + 70 degrees centigrade ...

Department Of Local Bodies - Rajasthan

37549355 tender for utensils supply work for iry 2023 24 1 gas furnace 2 chapati baking gas stove 3 aluminum foil cover 4 water holder 5 ice tray 6 vegetable donation 3 in 1 7 tasla 8 the world 9 serving spoon 10 steel bucket = 11 , bhojan thali 4 in 1 2 12 glasses of water 13 water tank 100 liters 14 dustbin...

Medical Health And Family Welfare - Rajasthan

37421256 to purchase pathology lab reagents under the mukhymantri nishulk janch yojna ( mnjy ) , s. creatinine kit ( for semi auto ) , s. glucose , s. creatinine kit ( for semi auto ) , s. cholestrol kit ( for semi auto ) , s. cholestrol kit ( for semi auto ) , s. bilirubin t kit ( for semi auto ) , s. bilirubin d kit ( for semi auto ) , s. urea kinetic , urea berthlot ( end point ) , urea berthlot ( end point ) , s. sgot kit ( for semi auto ) , s. sgpt kit ( for semi auto ) , s. sgot kit ( for semi auto ) , s. sgpt kit ( for semi auto ) , s. alkaline phosphatage kit ( for semi auto ) , s. total protien ( for semi auto ) , s. albumin ( for semi auto ) , s. ldh ( for semi auto ) , s. ldh ( for semi auto ) , s. amylase ( for semi auto ) , s. amylase ( for semi auto ) , s. uric acid ( for semi auto ) , s. calcium kit ( for semi auto ) , s. calcium kit ( for semi auto ) , s. ck nac ( for semi auto ) , s. ck mb ( for semi auto ) , s. ck mb ( for semi auto ) , s. triglyceride kit ( for semi auto ) , s. triglyceride kit ( for semi auto ) , hdl direct , s. hdl cholestrol ppt , biochemestry control , erba xl wash , chloride , gamma gt , lipase , phosphorus , cystatin c , csf protein test , hemocysteine , afb stain ( ready to use ) , autoclave tap 1 ( thermopile spors ) , acetone liquid , aluminium foil , ayer spatulla disposable ( sterile ) , absolute alcohal 99 % , adhesive tap 0.5 inch , aslo kit , anti abd , ahg ( anti human globulin ) vial , ahg ( anti human globulin ) vial , anti a1 , acetic acid galcil 5% , buffer bottle , blotting paper sheet , bleeching powder , banedict solution , blood mixer , beakar glass , beakar glass , bovine albumin , bovine albumin , bovine albumin 22% , bovine albumin 22% , bd vaccutionor blood collection needle 21, 22 , blood collection tube for esr black cap 4 ml. , capillary tube , chickengunia cards igg igm , crp kit , cover slip 22x60x.4 mm. ( blue star, gem, top only ) , cover slip 22x50x.4 mm. . ( blue star, gem, top only ) , cover slip 22x40x.4 mm. . ( blue star, gem, top only ) , cover slip 20x25x.4 mm. . ( blue star, gem, top only ) , cover slip 24x60x.4 mm ( blue star, gem, top only ) , cover slip for neubauer chamber 1mm thick , copper sulphate powder , copper sulphate powder , copper sulphate powder , chloroscope with reagent , coplin jar , cell for gluometer , cover slip 18x18 mm ( blue star, gem, top only ) , cell counter for dlc 8 key , clot activator vial red cap 4 ml. , clot activator vial red cap 6 ml. , diastix , disposable needle 22 mm , disposable needle 24 mm , disposable syringe 5 ml. , disposable syringe 10 ml. , disposable droper , disposable gloves 6 , disposable gloves 6.5 , disposable gloves 7 , disposable gloves 7.5 , dropping bottle plastick 100 ml. , dropping bottl plastick 500 ml. , dpx mount , diamond marker , drabkin’s solution and control solution , distilled water , dengue test kit ( ns1 igg igm combopack by rapid card test ) , dengue elisa test kit ( ns1 ) , dengue elisa test ( igm ) , dengue rapid card ( igg, igm ) , esr fluid ( sodium citrate ) , esr tube ( pippate ) disposable , esr ( pippate ) glass with cap disposable , edta powder , eosin stain , ethylalcohol absolute , eosinophil diliuting fluid , field stain a , field stain b , forceps ( simple ) , jsb stain i , jsb stain ii , flask glass ( borosil ) , flask glass ( borosil ) , fnac plunger , fixative for cyotology ( 99% methanol ) , filter paper , formaline , glass marking pencil ( red ) , geimsa stain , geimsa stain , glycrine , gel activator vial 4 ml. , gel activator vial 8 ml. , hypochlorite 5% solution , hbsag rapid test cards , hb tube square , hb pippate , heamatoxyline mono hydrted ms reagent , hand sanitizer , hand sanitizer , k3 ( cbc ) vial double cap , k3 ( cbc ) vial single cap , koh solution , liquid parrafin , lugols iodine , leishmen’s stain , liquid cleaning agent for glass / plastic , liquid hand soap ( savlon ) , liquid hand soap ( dettol ) , liquid hand soap ( lifeboy ) , lancet , lens paper , multi stix , micro tips 5 20 ul , micro tips 200 ?l , micro tips 1000 ?l , micro glass slide 1.33mm ( blue star, gem, top only ) , micro glass slide 1.25mm ( blue star, gem, top only ) , micro glass slide76x26 mm ( blue star, gem, top only ) , micro pippate fix volume 10?l , micro pippate fix volume 20?l , micro pippate fix volume 50?l , micro pippate fix volume 100?l , micro pippate fix volume 500?l , micro pippate fix volume 1000?l , micro pippate varible 10 100 ?l , micro pippate varible 100 1000 ?l , micro pippate stand plastick , macountoss , face mask disposable , new methehylne bluefor reticulocyte stain , methehylne blue1% , n / 10 hcl , improved neubaurs chambar ( counting chambar ) , nitric acid ( hno3 ) , oil imersion lens , pt vials , pcv tube , papnaculer stain ready to use , plastic dropper , pasture pippate , propyle alcolhal , platelet diluting fluid , ppe kits , ph paper strip , prob cleaner for cbc machine accurex , paper roll for semi auto anaylser 4.5 , reporting cbc paper roll50mm x 20m , reporting cbc paper roll57mm x 20m. , reporting cbc paper roll 57mm x 10m. , rubbur bulb b dropper , ra factor kit , rapid malaria test cards ( antigen ) , rapid malaria ( antigan , antibody ) combopack , sulphar powder , semiauto anylaser printer roll , sticker for sample vials , sample vial with cover 5 ml , sample vial with cover 10 ml. , staining reactanguler beaker , staining rack , spirt lamp , test tube glass 3 inch ( 12x75 ) borosil , test tube glass 4 inch ( 12x100 ) borosil , test tube pvc 2 inch , test tube pvc 3 inch , test tube pvc 4 inch , test tube pvc 6inch , tlc fluid , tec fluid , trbc fluid , tissue paper roll , tourniquit , test tube stand plastic for 48tubes , test tube stand plastic for 100 tubes , trop t rapid test card , thromboplastin ( pt reagent ) , test tube cleaning brush , thermacol box , digital thermomater with sensor for regrigetor , tongue depresser disposble , urine pregnancy strips , urine pregnancy cards , uristicx , urine pots with label and cover 30 ml. , urine anyalser paper roll 57mm x 10mtr , vdrl test kit , vdrl card , vdrl rapid test strip , vtm ( viral transport media ) , vacctuainer plane 4 ml. , vacctuainer plane 8 ml. , vacctuainer k2 edta 4 ml. , vacctuainer k3 edta 4 ml. , widal slide kits ( 4x5ml. ) , widal tube agglutation reagent , wbc diluting fluid , widal card , wintrobe tube esr , xylene , zeeper plastic 6 inch , zeeper plastic 8 inch , z n stain , psa kit , psa kit ( elisa method ) , aluminum ammonium sulphate hydarted , acetic a , glacial acetic a , ammonium hydride 1% , eosin yellow a , eosin yellow b , light green sf , potash alum , timer electronic , slide cabinet ( 100 slide ) , slide staning bucket with handle , slide box , measuring cylinder glass and silikon 50 ml. , measuring cylinder glass and silikon 100 ml. , measuring cylinder glass and silikon 500 ml. , measuring cylinder glass and silikon 1000 ml. , hcv card ( rapid test ) , cuscos speculun , mask n 95 , glucostrip for glucocare sence glucometer , glucostrip for bio sence glucometer , disposable pap smear kit , anit a , anit b , anti d , sargical mask 3 layer , lysol 50% , digital thermomater for refrigertor with display , sprayer bottle 500 ml. / 1000 ml. , beakar glass 100 ml. , covid 19 rapid card , pencil cell for glucometer / timer , ketostx , paper roll for pt anaylser ( 116mmx20 mtr. ) , torrniquet belt, tubler ( cotton material flexible ) , hiv rapid test card , gram stain , serum magnisium test kit , serum lithium test kit , csf protin test kit , csf chloride test kit , csf suger test kit , urine total protin test ( 24 hour ) test kit , acid phosphatase test kit , accu chek glucometer strip , glucocare sence glucometer , bio sence glucometer , ggt test kit , x press glucometer , x press glucometer strip , glucometer spark , glucometer spark strip , control d glucometer , control d glucometer strip...

Government Medical College - Rajasthan

37370637 tender for supply of reagent and consumables for hla lab 2 kit consumbales for immucor luminex system installed in hla lab 3 hla a sso typing kit 4 hla b sso typing kit 5 hla drb sso typing kit 6 hla dpa1 / b1 typing kit 7 hla dqa1 / b1 typing kit 8 hla dr345 typing kit 9 hla c sso typing kit 10 costar 96 well thermal cycler plates 11 costar polyethylene sealing tape 12 streptavidin pe ( 85 ul @ 0.85ul / test ) 13 corning strip tubes and caps 14 pra screen class i & class ii 15 pra class i ab 16 pra class ii ab 17 single antigen class i 18 single antigen class ii 19 singe antigen mic a kit 20 kir typing kit or similar 21 non hla antibody kit 62 pannal antibodies 22 c1q screening kit / c 3d 23 dsa ( lysate based crossmatch ) kit 24 filter plates for dsa 25 aluminum sealers 26 sheath fluid 20l 27 kit for immucor luminex 28 terrasaky trays 29 rabbit compliment 30 positive control 31 negative control 32 eosin dye / fluorescence dye 33 lymphocyte separation medium 34 rpmi 1640 35 paraffin liquid light 36 formaline 37 glass beads ( 3 to 5 mm ) 38 other 39 digital dry bath 24 holes for 12 mm tubes +5ºc above ambient to 100ºc maximum heating power 12w microprocessor control with digital performance. available with buzzer alarm 40 dna extraction kit 41 edta vails 42 heparine vails 9ml. 43 plane vails 44 ethanol 500 ml. 45 microcentrifuge tube ( 1.5 ml. ) 46 microcentrifuge tube ( 0.5 ml. ) 47 dna diluent 500 ml. 48 neuclear free water 500 ml. 49 15 ml. conical tube with cap ( marking in tube ml ) 50 15 ml. tube with cap ( marking in tube ml ) 51 15 ml tube stand plastic with transprant cover 52 50 ml tube stand plastic with transprant cover 53 1.5 ml tube stand plastic with transprant cover 54 pcr tube stand plastic with transprant cover 55 pcr tube 8 strip ( packing 125 strips ) 56 pcr caps 8 strip ( packing 125 strips ) 57 tips filter 200 ul 58 tips filter 10 ul 59 tips 1000 ul 60 tips filter 100 ul 61 optical plate sealer 62 pcr tube tray ( co star ) 63 pcr pad gel 64 distill water 65 micro centrifuge machine micro centrifuge with 12x1.5 / 2.0ml & pr strip rotor head, speed 15000 rpm 66 red cell lying reagent 67 pc for cdc pcr & nc for cdc 68 rabbit compliment cups 69 oil lig parafilm 500 ml 70 2 ml marked droppers ( packing 100 droppers ) 71 eosin 5% himedia 125 ml 72 round filter paper grade 1 125 mm x 100 circles 73 formaline 500 ml 74 hamilton syring single channel 1 ul disp. 75 hamilton multichannel syring 5 ul disp. 76 aluminium foil 9meter 77 powder free gluoves m&l 78 dsa screening test with mic qualitative 79 taq polymerase 80 hla b 27 kit ssp 81 hla for celiac diease 82 powder agar 500gm 83 etheliun bromide 25gm 84 hla kit abdr ssp 10 test 85 electrophorasis unit 96 well cell size 9.2x25.5x5.6 cm gel tray size – 7x7 cm, 7x10 cm ( od ) ( wxl ) ready agarose – 8 12 2x8 well base buffer volume – 270 ml 86 calibrator luminax immucore 1kit...

Department Of Local Bodies - Rajasthan

37268773 tender for purchase of utensils of indra rasoi 1.01 gas furnace 1.02 , chapati oven 1.03 , aluminum foil lid aluminum foil lid , aluminum foil lid aluminum foil lid water holder 4 barfi tea vegetable donation tasla 7 | the world spoon ( serving spoon ) 9 steel bucket 10 food thali 4 in 1 11 , glasses of water 12 , water tank 100 liters 13 14 dustbin 15 |vartan stand 16 vegetable stand cooler 10 liters 3 in 1...

Private Company - Rajasthan

37090647 tender for purchase milk, milk products, indian vegetables, indian fruits, english vegetables, english fruits, fresh chicken, frozen chicken, mutton, eggs, fish & sea food, indian grocery ( pulses, whole spices & miscellaneous provision items), dry fruits, imported provision, south indian provision, pickles & mouth fresheners, bakery products, frozen food, fresh noodles, office stationary, fresh flowers, cleaning & kitchen supply (cling film, aluminum foil, gloves & other cleaning supply), chemicals, charcoal & wood, breads & cookies, indian sweets, catering equipment, ice cubes/nice block, industrial salt, pest control tender forms are available at cashier office, le meridien jaipur, number 1, riico kukas, delhi road, jaipur 302028. starting from 3rd april 2023 between 10:00am to 4:30pm all days...

Medical Health And Family Welfare - Rajasthan

36934140 supply of reagents and other lab items biochemistry reagents for semi auto analyzer ( erba chem plus 5 &accurex at 112 plus ) , autopure – albumin ( method bcg , makerendox / erba / accurex / transasia / siemens / labmat ) , alkaline phosphatase ( method p npp dea buffer, make rendox / erba / accurex / transasia / siemens / labmat ) , amylase ( method gal g2 α – cnp , makerendox / erba / accurex / transasia / siemens / labmat ) , bilirubin direct ( method jendrassik & grof , makerendox / erba / accurex / transasia / siemens / labmat ) , bilirubin total ( method jendrassik & grof , makerendox / erba / accurex / transasia / siemens / labmat ) , bun / urea ( method gldh – kinetic , makerendox / erba / accurex / transasia / siemens / labmat ) , calcium arsenazo ( method arsenazo iii , makerendox / erba / accurex / transasia / siemens / labmat ) , ldh ( method pyruvate – lactate, makerendox / erba / accurex / transasia / siemens / labmat ) , cholesterol ( method chod pod, makerendox / erba / accurex / transasia / siemens / labmat ) , creatinine ( method jaffe kinetic, makerendox / erba / accurex / transasia / siemens / labmat ) , glucose ( method god pod, makerendox / erba / accurex / transasia / siemens / labmat ) , sgot ( ast ) ( method ifcc, makerendox / erba / accurex / transasia / siemens / labmat ) , sgpt ( alt ) ( method ifcc, makerendox / erba / accurex / transasia / siemens / labmat ) , total protein ( method biuret, makerendox / erba / accurex / transasia / siemens / labmat ) , triglycerides ( method gpo pod, makerendox / erba / accurex / transasia / siemens / labmat ) , uric acid ( method uricase, makerendox / erba / accurex / transasia / siemens / labmat ) , cknac ( method uv kinetic, makerendox / erba / accurex / transasia / siemens / labmat ) , ckmb ( method uv kinetic, makerendox / erba / accurex / transasia / siemens / labmat ) , hdl cholesterol direct ( method direct, homogenious, makerendox / erba / accurex / transasia / siemens / labmat ) , ldl cholesterol direct ( method direct, homogenious, makerendox / erba / accurex / transasia / siemens / labmat ) , aslo reagent ( quantative ) , crp reagent ( quantative ) , ra reagent ( quantative ) , serology reagents, vaccutainor 5 ml with gel, vaccutainor 2 ml k3 edta, vaccutainor 5 ml clot activator, vaccutainor 2ml clot activator, vaccutainor 2 ml plasma floride, vaccutainor 2 ml sodium citrate, vaccutainor holder, vaccutainor needle, vaccutainor 2ml with gel, disposable esr system attached flexible vaccum pressure, valve, suitable stand for esr system ( s.no. 108 ) , micro tips for 20 μl low retention rnas, dnas with, pyrogen free sterile, micro tips for 100 μl low retention rnas, dnas with, pyrogen free sterile, micro tips for 1000 μl low retention rnas, dnas with, pyrogen free sterile, fogger solution ( contains alkly dimethyl ethylbenzyl, ammonium chloride benzalkonium chloride ) , fogger solution ( contains silver nitrate 0.1 %w / v &, hydrogen peroxide 10% w / v, zipper bag ( size: 6x3 ) , zipper bag ( size: 12x6 ) , cpd blood bag holding cassette for refrigeration and, handling with 24 holes in b ottom for air circulation in all five, colours, digital thermometer for ilr / freeze, ppe kit ( contains cover gown, three layer mask, , goggles, gloves 7.5, shoe cover ( ?kqvuksa ls dqn uhps, rd½, bio waste bag ) , disposable plastic gown for use in labor room, mortuary, and emergencies ) , digital bp instrument with charger, urin analyser paper roll, ptinr neoplastin reagent 5 ml, steel ball control for ptinr analyser, ptinr pippete, ptinr quvettee, blood gas analyzer model no. cobos b 121 ds fy, , jhtsuvl, heparin, cobos c1 csllibration solution 1st ( make cobas b 121 ) , cobos c2 csllibration solution 2nd ( make cobas b 121 ) , cobos c3 fluid pack ( make cobas b 121 ) , reagents required for stego pt machine, steel ball for start 4 by stego, neoplastine 2ml for start 4 by stego, quvette for start 4 by stego, syringe for finpep for start 4 by stego, sodium citrate 3.2% vial for p.t., printer for elisa reader, dotmatrix printer supported to elisa reader rayto, fluid pack na / k / cl, daily cleaning solution, electrolyte control, printer pap, sprit swab, disposable test tube, disposable sodium citrate 3.8% vial 2ml for esr test, test tubes without rim borosilicate, 20 x 150 mm, autoclavable caps for above test tubes, test tubes without rim borosilicate, 16 x 150 mm, autoclavable caps for above test tubes, test tubes without rim borosilicate, 12 x 150 mm, autoclavable caps for above test tubes, burette borosilicate 50 ml, burette stands, measuring cylinders graduated, 10 ml, measuring cylinders graduated, 100ml, measuring cylinders graduated, 500 ml, measuring cylinders graduated, 1000 ml, petridishes, 15 x 90 mm borosilicate, universal bottles, 28 ml, mccartney bottles, 28 ml, funnels glass, diameter 100 mm, stem 50 mm, buchner flasks, 1 liter, beakers, borosilicate / pyrex, 1000 ml, beakers, borosilicate / pyrex, 500 ml, beakers, borosilicate / pyrex, 250 ml, beakers, borosilicate / pyrex, 2000 ml, conical flasks ( erlenmeyer ) , pyrex 100 ml, conical flasks ( erlenmeyer ) , pyrex 500 ml, conical flasks ( erlenmeyer ) , pyrex 1000 ml, conical flasks ( erlenmeyer ) , pyrex 2000 ml, volumetric flasks, grade a, 500 ml, volumetric flasks, grade a, 250 ml, volumetric flasks, grade a, 10 ml, pipettes, 1ml with 0.1 ml graduations grade a, pipettes, 2 ml with 0.1 ml graduations grade a, pipettes, 5 ml with 0.5 graduations grade a, pipettes, 10 ml with 1 ml graduations grade a, glass bottles with polypropylene ( autoclavable ) screw caps, , 500 ml, glass bottles with polypropylene ( autoclavable ) screw caps, , 1000 ml, glass bottles with polypropylene ( autoclavable ) screw caps, , 2000 ml, durham tubes 50 x 7.5 mm, cotton wool non absorbent, weighing boats, plastic 1 ¾ 5 boxes, weighing boats, plastic 3 5 / 16 5 boxes, vacutainer 5 ml with gel, vacutainer 5 ml plain ( clot activator ) , multichanel pippette, brushes for bottle washing 40 cm, anti hav igm elisa kit 96 test, anti hev igm elisa kit 96 test, dengue ns1 antigen elisa 96 test, dengue igm elisa 96 test, dengue igg elisa 96 test, chikunguniya igm elisa 96 test, scrub typhus igm elisa 96 test, widal typhidot elisa 96 test, mackonkey agar, nutrient agar 500 gm, alkeline peptone water 500 gm, cary blair medium 500 gm, multen hinton agar 500 gm, salmonella shigella agar ( ss agar ) 500 gm, sorbital mackonkey agar 500 gm, sabrot dextose agar 500 gm, triple suger iron ( tsi ) agar, nicrome loop 4 mm, microtip10 100μl, 1000 pcs, microtip 100 1000μl, 500 pcs, nicrome loop 2 3 mm, sprit lamp s.s., sterilised dispo. petri plate 50 pcs, antibiotic disk positive, antibiotic disk negative, potassium dihydrogen phosphate, peptone, sodium chloride, potassium dichromate ( gpr ) , conc. sulphuric acid ( gpr ) , aluminium foil, agar, plate count agar, yeast and mold agar, chlortetracycline hydrochloride, tartaric acid, brilliant green bile broth 2%, ec medium, tryptone, mrvp test reagent, koser citrate medium, n amyl alcohol ( for kovacs reagent ) , conc. hydrochloric acid ( for kovacs reagent ) , baird parker agar, trypticase soy broth, sodium pyruvate, brain heart infusion broth, coagulase plasma, ethylene diamine tetracetate, mannitol, paraffin oil, catalase test reagents, lactose broth, trypticase soy broth, tetrathionate broth, bismuth sulphite agar, triple sugar iron agar, simmons citrate agar, urea broth ( base ) , malonate broth ( base ) , lysine desoxycholate broth ( base ) , potassium cyanide broth ( base ) , phenol red, dulcitol, glucose, lactose, macconkey agar, brain heart infusion broth, salmonella polyvalent somatic ( o ) antigen 1 ampoule, salmonella polyvalent somatic ( h ) antigen 1 ampoule, ethanol 500 ml, crystal violet, grams iodine, acetone, safranine, carbol fuschin 1 percent, methylene blue 0.5 percent, sulphuric acid 25 percent, amies transport medium with charcoal, falcon tube 50 ml, sterile swab stick with plastic tube, atcc stains, macforland staanderd set, leptospira igm elisa test, chrom agar uti, albert stain a and b, blood culture bottle paediatric, blood culture bottle adult, water testing material, brilliant green broth, macconkey broth, eosin methylene blue agar, h2s media standard ( concn. 20x ) , water bottle glass 30 ml, durham tubes 20x 7.5 mm, pipettes, 1ml with 0.1 ml graduations grade a, pipettes, 2 ml with 0.1 ml graduations grade a, diluent, detergant, control high, control low, control normal etc...

Rajasthan University Of Veterinary And Animal Sciences - Rajasthan

36334561 establishment of bsl 3 laboratory on turnkey basis. , supply ahu • capacity: 3500 cfm • 25 mm , • double skin ahu complete with mixing box, cooling coil, and fan, volume control dampers for supply, fresh air, and fresh air filter. • static pressure ( mm wg ) 100 • construction – 28 mm puf moulded double skin detachable panels • structural extruded spl alloy al profiles filled with puf • panel external skin 0.6 mm pre plasticised sheet • panel internal skin 0.6 mm plain gi sheet • insulation material / thickness 25mm thick puf with 45kg / m3 density • fan make & type nicotra / kruger make didw backward curve centrifugal fan • fan wheel size & no. of fans rdh 315r #1 • fan speed in rpm – 2381, critical fan speed in rpm – 3100 • fan outlet velocity in mps 8.68 • motor • drive arrangement taper lock pulleys for fan & motor both • type of balancing / test procedure statically & dynamically / amca tested , • type of vibration isolators rubberized mounts • filters provision pre filters & hepa filters • coil type cooling coil • coil surface area sq. ft 6.11 • no. of. coil rows 6 • face velocity across the coil 491 • coil specification 1 / 2 od 27swg copper & 36 swg ai fin at fpi • canvass srf make flexible fire retardant canvass • hardware galvanized, • operation wt ( kgs ) aprox – 240 , exhaust ahu • capacity: 4500 cfm • double skin ahu complete with mixing box, volume control dampers for return, fresh air • static pressure ( mm wg ) 100 • construction 28mm puf moulded double skin detachable panels • structural extruded spl alloy al profiles filled with puf • panel external skin 0.6 mm pre plasticised sheet • panel internal skin 0.6 mm plain gi sheet • insulation material / thickness 25mm thick puf with 45kg / m3 density • fan make & type nicotra / kruger make didw backward curve centrifugal fan • fan wheel size & no. of fans rdh 315r #1 • fan speed in rpm – 2381 • critical fan speed in rpm – 3100 • fan outlet velocity in mps 8.68 • motor • drive arrangement taper lock pulleys for fan & motor both • type of balancing / test procedure statically & dynamically / amca tested • type of vibration isolators rubberized mounts • filters provision pre filters, hepa filters hardware etc , ahu control panel , ducting: ventilation ducting will be made out of minimum 22 gauge gi sheet, exhaust duct from the lab to the ahu will be 22 gauge gi duct. all the ventilation ducting including return air riser will be leak proof. insulation material with nit rile foam / crosslinkedpolyethylenematerial ( aluminum foil insulation ) , condensing unit: supply and installation of condensing unit with 8.5 tr capacity including, gas, copper tubing, drier & expansions valves etc , treated fresh air unit – 5 tr , dampers: galvanised steel volume controlled damper, opposed / parallel blade dampers are used to carry out a rough air system balance with closer control being carried out at the individual grilles or diffusers. , supply & return air grillsmoc: crca powder coated, 1.2 mm thick with perforation , supply hepa filter box type :box type, media :ultra clean glass fibre paper imported, casing:m.s. powder coated, retention:0.3 micron, efficiency:99.97%, pressure drop:25 mm of w.c. size: 450 x 450 x 75 mm , bibo filter unit , virus burnout system , ceiling panel: modular ceiling: modular ceiling will be made for clean room application, pre engineered 50 mm thick puf panels with pcgi sheets with puf insulation of minimum 38 40 kg / m3. both surfaces should be power coated 0.47 mm thick pcgi sheet and will be installed along the outer walls, partitions and false ceiling to create an impervious shell which is fully sealed. , modular wall:modular wall will be made for clean room application, pre engineered 50 mm thick puf panels with pcgi sheets with puf insulation of minimum 38 40 kg / m3. both surfaces should be power coated 0.47 mm thick pcgi sheet and will be installed along the outer walls, partitions and false ceiling to create an impervious shell which is fully sealed. , modular wall:80 mm wall panel with return air riser , covings: extruded aluminum anodized r75 clip on type ( male & female connectors ) covings for entire wall to wall & wall to ceiling joints , modular clean room door flush door finishes shall be 50 mm thick 1.2mm thick pcgi sheet suitable to fix on 50 mm thick wall panel with provisions for double glazing glass for all door and hardware like push plate.puf panels will be with pcgi sheets, powder coated on both sides and puf insulation of minimum 38 40 kg / m3. concealed hardware for fixingofdoor frames, door closure, sshinges, ss doorhandle, ssball bearing butt hinges, automatic drop seal, concealed tower bolt for the double door, both sides lock and key arrangement etc , size: ( single door ) 1000 x 2100 mm biosaftey doors , size: ( double door ) 1200 x 2100 mm biosafty doors , size: ( single door ) 1000 x 2100 mm metallic doors , differential pressure gauge supply, installation of dwyer make magnehelic pressure gauges 0 – 10 mm for monitoring differential room pressures , epoxy flooring: flooring shall be of 6 mm of industrial epoxy including screed compound for adhesion with bubble free perfect smooth finishing completed into two steps: hardening and smoothening. epoxy used for this application will be self leveling and clean room compatible. , epoxy coving , door interlocking system , dynamic pass box: moc : ss 304 size: 2’ x 2’ x 2’ , door, interlocking system, hepa filter, pre filter, motor blower, uv light, fluorescent lamp etc , dunk tank: moc : ss 304 size: 2’ x 2’ x 2’ , door, interlocking system, etc. , electricals: for the purpose of energizing the bsl laboratory facility all the electrical fittings and fixtures in the laboratories areas shall be suitable for clean room application and shall be sealed. , shed work for ahu & ac , uv lamp , led lights , split ac 1 tr, with stabilizer, copper tubing etc , split ac 1.5 tr, timer control with stabilizer, copper tubing etc , garment storage cabinet: a garment storage cabinet that can be locked shall be provided in the change rooms for each lab worker. the garment storage cabinets shall be in ss304 , dimension: 4’ x 1.5’ x 5’ ( moc: crca powder coated ) , elbow operated tap with ss sink unit , emergency shower: emergency shower with eye wash , laboratory chairs , fire detection & alarm system: fire detection and alarm system will be provided for the entire bsl 3 laboratory facility to detect any eventual case of fire in the building. , fire extinguishers 2 kg , epabx system ( intercom facility ) : telephone instrument facility to be provided between microbiologist / staff room , cctv surveillance system with 8 dvr and storage capacity with monitor and 8 cctv cameras in the bsl iii, ante and change rooms , lan wiring and connectivity with sockets to be provided at strategic locations in the bsl facility , uninterrupted power supply system: for interlocking system, fire panel, cctv etc ( 5 kva ) , uninterrupted power supply system for bio safety cabinet ( 3 kva ) , drain: all liquid drain coming out from the laboratory will be connected to a single drain with back flow prevention , bio safety cabinet: class ii type a2 size: 4’ x 2’ x 2’ ( w x d x h ) moc: crca powder coated , effluent collection tank: 500 l each , decontamination process tank: 500 l each , 125 kva diesel generator set specification ( minimum and tentative capacity subject to approval by incharge ) ...

Sms Medical College - Rajasthan

36126940 supply of various reagents for biochemistry department 1. ethanol 2. nedlitmuspaper 3. blue litmus paper 4. copper sulphate 5. creatinfne ar 6. sodhimdthydrogen orthophosphate 7. copperacetate 8. ammonium molybdate 9. potassium dihydrogen phosphate 10 0il ( vegetable ) sltr. 11 ] benzoic acid — 12 benzidine 13 chlorophenol red 14 ammonium snlphate — 15 3oyabean (urease) — powder 16 sodium citrate — 17 1 butanol (n butyl — alcohol0 18 ammonium chloride — 19 iodine — 20 sodium arsenate — 21 sodium sulphate — 22 tissue paper roil — 23 aluminum foil i 24 whatmann filter paper . (cellulose) no. 1 for chromatography — ...

Shree Karan Narendra Agriculture University - Rajasthan

36053823 rate contract for chemicals for 2022 23 and 2023 24 1 1, 2 dichloroethane 2 1 naphthol ar 3 2 3 5 tri phenyl tetrazolium chloride ( ttc ) 4 2, 4 d 5 2, 4 dinitro phenyl hydrazine ( dnph ) 6 2, 6, dicholorophenol indophenol ( dcip ) 7 30% hydrogen peroxide ar grade 8 5 sulphosalicylic acid dihydrate ar 9 absolute alcohol 10 absorbant cotton 11 acetic acid glacial ar 12 acetocarmine solutions 13 acetone 14 acetone ( hplc grade ) 15 acetone ar ( special grade ) 16 acid fuchsine 17 acrylamide 18 activated charcoal ar grade 19 agar powder ( bacteriological grade ) 20 almunium chloride 21 aluminium chloride hexahydrate extrapure ar, 99% 22 aluminium foil 23 ammonia solution sp. gr 0.91 24 ammonium acetate ar grade 25 ammonium chloride 26 ammonium dihydrogen ortho phosphate 27 ammonium ferrous sulphate hexahydrates 28 ammonium molybdate ar grade 29 ammonium molybdate tetrahydrate extrapure 30 ammonium oxalate monohydrate 31 ammonium persulphate ( aps ) 32 ammonium sulphate 33 anhydrous sodium carbonate 34 anthorne reagent ( 2 n ) 35 anthrone ar 36 apron coat 37 ascorbate 38 ascorbic acid 39 azoxystrobin 40 azoxystrobin + hexaconazole 41 azoxystrobin +tebuconazole 42 bacillus subtilis 43 bap 44 bap solution 45 banzyl adenine 46 barium chloride dihydrate 47 barium sulphate 48 beef extractar grade 49 benomyle 50 bis acrylamide 51 blitox 50% wp ( coc ) 52 borex 53 boric acid ( powder ) 54 bovine serum albumin ( bsa ) 55 brassinolids 56 bromocresol blue indicator 57 bromocresol green 58 bromocresol purple sodium salt 59 bromophenol blue ( bpb ) 60 bromothymol blue indicator powder 61 buffer ampule ( setof 6 ) 62 buffer tablet of ph ( 4.0 ) 63 buffer tablet of ph ( 7.0 ) 64 cadmium chloride monohydrate 65 calciumnitrate tetrahydrate 66 calcium carbonate ar grade 67 calcium chloride 99% extra pure 68 calcium sulphate anhydrous 69 calcium sulphate dihydrate 70 captan 71 carbandzim+ mancozeb 72 carboxin 37.5% + thiram 37.5% ( vitavax power ) 73 carmine powder 74 castor oil 75 catechol extrapure 99% 76 cedar wood oil medium 77 chloroform ( ethanol stabilized ) 78 chloroform ( hplc grade ) 79 chlorothalonil 80 chlortetracycline hydrochloride 81 citric acid 82 clove oil 83 cobalt chloride hexahydrate ( cocl2.6h2o ) 84 cobaltus chloride 85 cobaltus nitrate hexahydrate 86 sulphuric acid ( h2so4 ) 87 coomassie brilient blue r250 88 copper sulfate pentahydrate ( cuso4.5h20 ) 89 copper sulphate 90 corn meal media 91 cotton blue 92 crystal violet ar grade 93 ctab ( cetyl trimethylammonium bromide ) 94 czapek”s dox agar 95 d ( + ) ribose 96 darco g 60 ( activated charcoal ) 97 liquid detergent ( lab garade ) 98 dextrose 99 d fructose a / r 100 di sodium hydrogen arsenate 101 dibasic sodium phosphate 102 diehylene tri amine penta acetic acid ( dtpa ) ar grade 103 diethyl ether ar ( stabilised ) 104 diethyline tri amine penta actic acid ( dtpa ) 105 difenconazole 106 dimethyl sulfoxide ( dmso ) 107 diphenylamine indicator 108 di sodium hydrogen arsenate 109 disodium tetrachloropalladate ( na2pdcl4 ) 110 dntps mix 111 edta ( ethylenediaminetetraacetic acid disodium salt dehydrate ) 112 ethanol hplc grade 113 ethidium bromide 114 ethyl alcohol 115 ethyl methanesulfonate ( ems ) 116 ethylene alcohol 117 ethylenediaminetetraacetic acid ( na2edta ) 118 eucalyptus oil 119 ferric chloride 120 ferrion indicator 121 ferrous ammonium sulphate ar grade 122 ferrous sulphate ( feso4.7h2o ) ar 123 ferrous sulphate hypt 124 filter paper sheet 125 folin & ciocalteu’s phenol ( fcp ) reagent ar 126 folins uric acid 127 formaldehyde 128 fosetyl al 129 gallic acid pure, 98% ( 3, 4, 5 trihydroxybenzoic acid ) 130 glacial acetic acid 131 glucose ar grade 132 glutamic acid 133 glycerene 134 glycerol 135 glycine 136 gum acacia 137 n haxen 138 hexaconazole 139 hexaconazole 4% + zineb 68% 140 hoagland’s no. 2 basal salt mixture 141 huwasam spray ( nanosilver & peroxide ) 142 hydrochloric acid 143 hydrochloric acid 0.5n aq. solution 144 hydrochloric acid lr 145 hydrogen dichloroethan 146 hydrogen peroxide 30% 147 hydrogen peroxide 6% 148 hydroquinone 149 hydroxyl amines ( ha ) 150 hydroxylamine hydrochloride 151 iaa 152 iaa solution 153 iba 154 iba solution 155 iodide crystals 156 iodine ar grade 157 iron sulphate 158 iron tartrate 159 isoamyl alcohol 160 isopropanol alcohol 161 jasmonic acid 162 kavach ( syngenta ) 163 kh2po4 164 labolene 165 lactic acid ar 166 l ascorbic acid extrapure 167 l glycine ( triglycine ) extrapure, 99% 168 linseed oil 169 linseed oil cake 170 l phenylalanine extrapure chr, 99% 171 l tyrosine for biochemistry 172 magnesium chloride 173 magnesium sulfate heptahydrate ( mgso4.7h20 ) 174 malt agar 175 malts media 176 mancozeb 177 manganese sulfate monohydrate ( mnso4.h20 ) 178 manganese sulphate 179 manitol ar grade 180 martin’s media 181 mercaptoethanol 182 mercuric chloride ar 183 metalaxyl m ( ridomil gold ) 184 metaphosphoric acid 185 methanol 186 methanol ( ar grade ) 187 methanol hplc grade 188 methionine 189 methyl blue indicator ar grade 190 methyl methanesulfonate ( mms ) 191 methyl orange indicator 192 methyl red indicator 193 mgcl2 194 molyclean ma 03 phosphate free 195 molysol ‘e’ ar 196 monobasic sodium phosphate 197 myclobutanil 198 n ( 1 naphthyl ) ethylene diamine hcl ( n ned ) 199 n n methylenebisacrylamide 200 n orthophosphoric acid 201 n propanol 202 naa 203 naa solution 204 neemoil 205 nesseller reagent 206 nessler reagent ar grade 207 n hexane 99% ar 208 nicotinic acid 209 ninhydrin ar ( 99% assay ) 210 nitric acid 211 nitro blue tetrazolium ( nbt ) 212 nutrient agar 213 nutrient agar readymade 214 oat meal media 215 o dianisidine 216 orcinol 217 oxalic acid 218 oxaloacetic acid 219 p nitrophenyl sulphate 220 pacelio uslilacinus 221 paraffin wax 222 pcnb ( pentachloronitrobenzene ) 223 pda readymade 224 peg 6000 225 peptonear grade 226 petroleum ether ( 60 1000c ) 227 petroleum ether 60 80c 228 phenophthalin indicator 229 phenol ( 2n ) 230 phenol crystalline extrapure ar 231 phenol disalfonic acid 232 phenolphthalein indicator powder 233 phosphoric acid 234 p nitrophenol phosphate ar grade 235 polyvinylpyrolidone ( pvp ) 236 potasium meta bi sulphite 237 potassiumdicromate 238 potassiumhydroxide pellets 239 potassiumiodide 240 potassium acetate 241 potassium chloride 242 potassium chromate ar 243 potassium dichromate 244 potassium dichromate 245 potassium dihydrogen phosphate 246 potassium ferricyanide 247 potassium hydrogen sulphate 248 potassium iodide ( ki ) 249 potassium metabisulphite 250 potassium oxalate 251 potassium permanganate ar grade 252 potassium permangnate 253 potassium sulphate 254 potassium tartrate 255 potato dextrose broth 256 pottassium hydroxide 85% ar 257 pottassium nitrate 99% ar 258 propiconazole ( tilt ) 259 propineb ( antracol ) 70 w% 260 protein ladder marker ( mid range ) 261 pyridoxine hcl 262 pyrogallol extrapure 263 rapd marker ( molecular markers different series ) . 264 raxil ( bayer ) 265 resorcinol ar 266 rutin trihydrate pure 99% 267 saffranin 268 salicyclic acid 269 sesame oil 270 silver nitrate 271 sodiumchloride 272 sodium acetate anhydrous 273 sodium acetate trihydrate 274 sodium arsanate 275 sodium azide 276 sodium benzoate 277 sodium bicarbonate 278 sodium chloride 279 sodium chloride ar grade 280 sodium citrate 281 sodium cobalt nitrite 282 sodium dihydrogen phosphate 283 sodium dodicyl sulfate 284 sodium hydrogen carbonate ar grade 285 sodium hydroxide ar grade 286 sodium hydroxide extrapure ar 287 sodium hypochloride 288 sodium molybdate dihydrate ( na2moo42h20 ) 289 sodium nitrite 290 sodium phosphate 291 sodium potassium tartarate tetrahydrate 292 sodium silicate 293 sodium thiosulphate 294 sodium tungstate dihydrate extrapure ar, 99% 295 stannous chloride dihydrate 296 streptocycline 297 streptomycin sulfate 298 sucrose 299 sulfex 300 sulphailamide 301 sulphosalicylic acid 302 sulphuric acid 303 sulphuric acid 98% ar 304 taq buffer 305 taq polymerase ( su / pl ) 306 tebuconazole 307 temed 308 tergitol np 10 309 thiamine hcl 310 thiobarbituric acid 311 thiophanate methyl 70% wp 312 toluene 313 total hardness indicator tablets 314 tri chloroacetic acid 315 trichoderma harzianum 316 tricyclozol 8% + mancozeb 62% 317 triethylamine ( tea ) 318 triphenyl formazan ( tpf ) ar grade 319 tris hcl 320 triton x 100 321 universal indicator solution 322 v8 agar medium ( vinegar ) 323 vitavax power 324 wettable sulfur 325 xylene 326 yeast extract ar grade 327 zinc chloride 328 zinc oxide 329 zinc sulfate tetrahydrate ( znso4.4h20 ) 330 zinc sulphate heptahydrate...

Ministry of Skill Development And Entrepreneurship - Rajasthan

35902054 bids are invited for cosmetic items mse aluminium foil , developer , hair color base color , hair conditioner , hair donuts , hair gel , hair mask , hair rollers , hair serum , hair shampoo , hair shinning spray , hair spa kit , hair spray hard , hair straighting kit , jura pins , perm and paper wraps rolls , perming lotion and neutralizer , highlight caps or frosting caps , hair perming wooden rollers , blonder , dye bowl , heena powder , rubber bands , bob pins , acrylic nail kit , nail polish , nail tip box , gel nail kit , towel , manicure bowls , bowl , bleach , cleansing milk , face massage gel , d tan pack , face pack , face scrub , facial tissue , gouse packet , massage cream , parafeen wax , thermoherb mask , veg peel powder , makeup base palate , hd foundation , base coat and top coat , countoring stick , makeup highlighter palate , body paints pallete , loose powder , shimer powder , pan cake , eye brow filler palette , eye pencil , eye shadow palate , gel eye liner , kajal , lip liner , lipisticks , make up fixer , acetone , moisturiser , gulabari , hydrogen peroxide , toner , two way gel , dettol , body massage oil , cotton roll , eyebrow thread box , talc powder , wax rollon with applicator , wax , wax applicator or knife , wax strips , surgical gloves , pedicure salt , dye brush , pack brush , hand towel total quantity : 2582...

Medical College - Rajasthan

35894048 rate contract for disposable and glassware for pathology department , b. disposable & glassware , micro cover slip 22x50 mm no. 0 smooth edges made ofglass , glass slides; size 76x26x1.35 mm with ground edges one end frosted glass slide isi marked , sample required for approval. , surgical blade no. 22, 23, 24 should have sharp cutting edge , disposable gloves – rubble size 6 sterile surgical gloves, latex sterile surgical gloves made oflatex gloves should be according to the specifications of bis ( bureau of indian standards ) . it should fit in anatomic shape of hand for relaxed fit and prevention of fatigue. roughened surface on grip area. size embossed for easy identification. thinner wall at finger tips for better sensitivity. curved finger. sample required for approval. , disposable gloves – rubble size 6.5 sterile surgical gloves, latex sterile surgical gloves made oflatex gloves should be according to the specifications of bis ( bureau of indian standards ) . it should fit in anatomic shape of hand for relaxed fit and prevention of fatigue. roughened surface on grip area. size embossed for easy identification. thinner wall at finger tips for better sensitivity. curved finger. sample required for approval. , disposable gloves – rubber size 7 sterile surgical gloves, latex sterile surgical gloves made oflatex gloves should be according to the specifications of bis ( bureau of indian standards ) . it should fit in anatomic shape of hand for relaxed fit and prevention of fatigue. roughened surface on grip area. size embossed for easy identification. thinner wall at finger tips for better sensitivity. curved finger, sample required for approval. , disposable gloves – rubber size 7.5 sterile surgical gloves, latex sterile surgical gloves made oflatex gloves should be according to the specifications of bis ( bureau of indian standards ) . it should fit in anatomic shape of hand for relaxed fit and prevention of fatigue. roughened surface on grip area. size embossed for easy identification. thinner wall at finger tips for better sensitivity. curved finger, sample required for approval. , disposable tissue paper roll , filter paper wattman no. ‘0’46”x57” inch sheets , coupling jar 10 slides plastic with cap , disposable plastic cassette with lids, yellowcolour for tissue processing, sample required for approval. ( small biopsy ) , disposable plastic cassette with lids, white / off white colour for tissue processing, sample required for approval. ( surgical and autopsy ) , disposable plastic cassette with lids, blue colour for tissue processing, sample required for approval. ( gynae biopsies ) , index card , disposable face mask with highquality elastic , face mask n95 high quality niosh , test tube ( 10 ml ) plastic with cap 10.5 cm x 1.1 cm , test tubeplastic with cap 7 cm x 1 cm , rectangular museum jar with cover, lids and inner plates made of borosil glass with coverslip inside glass plate ( 250x250x120 mm ) , rectangular museum jar with cover made of borosil glass with coverslip inside glass plate ( 250x150x100 mm ) , rectangular museum jar with cover made of borosil glass with coverslip ( 220x195x80 mm ) , glass putty , silicon jelly gun ( tube ) , wbc pipette ( borosilicate ) , rbc pipette ( borosilicate ) , hb pipette , hb tubes ( round / square shape ) , wintrobe’s tube , urinometer complete set , neubaur counting chamber ( bright ) , funnel plastic 2” , funnel plastic 4” , disposable plastic dropper 2 ml , disposable plastic dropper 5 ml , lens cleaning paper , plastic test tube stand of 12 holes big universal combi rack for test tubes 30120, 17, 12 mm tube , westergren tube glass , disposable plastic bag autoclavable for biomedical waste cap 50 kg yellow , disposable plastic bag autoclavable for biomedical waste cap 25 kg yellow , disposable plastic bag autoclavable for biomedical waste cap 50 kg red , disposable plastic bag autoclavable for biomedical waste cap 50 kg blue , disposable plastic bag autoclavable for biomedical waste cap 25 kg blue , disposable plastic bag autoclavable for biomedical waste cap 50 kg black , disposable plastic bag autoclavable for biomedical waste cap 25 kg black , beaker borosil glass 1000 ml , beaker borosil glass 500 ml , beaker borosil glass 250 ml , borosilicate test tubes glass 6” ( 1x100 ) , borosilicate test tubes glass 4” ( 1x100 ) , borosilicate test tubes glass 3” ( 1x100 ) , aluminium foil 72 meter , disposable gown for autopsy and histopathology ( 1x1 ) , wash bottle made of ldpe plastic with delivery tube. it should be made of chemically resistant low density polyethylene, flexible with screw cap ( 500 ml ) , wash bottle made of ldpe plastic with delivery tube. it should be made of chemically resistant low density polyethylene, flexible with screw cap ( 125 ml ) , reagent bottles borosil cap 500 ml , reagent bottles borosil cap 1 lit , falcon tube 10 ml sterile , staining glass jar for 20 25 slides , borosil thermometer , conical flasks 5 lit with flat bottom borosilicate 5 lit , flasks graduated 1ltr ( 1000 ml ) borosil, flat bottom. capacity engraved on the flasks , dropping bottle with tube plastic , staing hangars.s for 25 30 slide , plastic slide box cap – 100 slides , plastic slide box cap – 50 slides , plastic dustbin cap – 10 lit with foot opener , marker pen with pointer , test tube holder for 15 tube – 20 holes for small and big , diamond pencil , glass marking pencil ( red ) , block dibba ( card board box for biopsy ) , low profile microtome blades , high profile microtome blades , slide tray ( wooden 30 slides ) , slide tray ( aluminum 20 slides ) , plastic slide box ( cap – 100 slides ) , plastic slide box ( cap – 50 slides ) , gross station ( wooden ) 22’x28’ inch , sticker for test tube and slides 2x3 cm , filter paper wattmanno ‘1’ ( 12 cm ) ( 1x100 ) , beaker borosilicate glass 25 ml , beaker borosilicate glass 100 ml , disposable gown for autopsy and histopathology ( single pack ) 1x1 , reagent bottles borosil with cap 250 ml , measuring cylinder borosil 1000 ml , measuring cylinder borosil 500 ml , measuring cylinder borosil 100 ml , measuring cylinder borosil 25 ml , bottle opener , funnel plastic 4” , funnel plastic 2” , dropper plastic 5 ml , dropper plastic 2 ml , lens cleaning paper , cytotek filter paper , hematocytometer coverslip , westergren’s tube , wintrobe’s tube , sprin lamp glass , esbach’s albunometer , dropping bottle plastic 125 ml , borosilicate test tube glass 15 ml , borosilicate test tube glass 10 ml , glass coplin staining jar 50 ml , tube stand 36 tubes , falcon tube stand 15 ml, 50 ml , falcon tube 15 ml, 50 ml , humid slide staining chamber ( 46x25x4 ) dark lid and body for light sensitive stains 24 slides cap , glass bottle with cap airtight borosil 1000 ml , glass bottle with cap airtight borosil 500 ml , glass bottle with cap airtight borosil 250 ml , glass bottle with cap airtight borosil 100 ml , dropping bottleborosil 500 ml , dropping bottle 250 ml , slide mailer ( box ) 5 slides , spring file a4 size , 2d ring binder file a4 size , ace files cardboard lever archbox , plastic drawer cabinet 2x2 , pipette stand ( round ) , ph meter probe , butter paper 4x4 , round brush for washing , flat paint brush no.6 , flat paint brush no. 12 , spray bottle 1 liter , spatula small and long , micropipette tips yellow 1x1000 , cover slip ( 8x8mm ) , glass petridish 75mm , cover slips 4x4mm...

Sms Medical College - Rajasthan

35876333 rate contract for disposable and glassware for pathology department disposable gloves rubble size 6.5 sterile surgical gloves, latex sterile surgical gloves made of latex glovcs should be according to the specifications of bis (bureau of indian standards). it should fit in anatomic shape of hand for relaxed fit and 1. micro cover slip 22x50 mm no. 0 smooth edges made or glass 2. glass slides: size 76x26x1 .35 mm with ground edges one end frosted ghss slide isi marked. sample required for approval. 3. surgical blade no. 22,23,24 should have sbarp cutting edge 4, disposable gloves — rubble size 6 sterile surgical gloves, latex . sterile surgical gloves made of latex gloves sbould be according to the specifications of bis (bureau of indian standards). it should fit in unatomic shape of hand for relaxcd fit and prevention of fatigue. roughened surface on grip area. size embossed for easy identification. thinner wall at finger tips for better sensitivity. curved finger. sample required for approval. . r 5. 6. disposable gloves — rubber size 7 sterile surgical gloves, latex sterile surgical gloves made of latex gloves i — — — — 7. disposable gloves rubber size 7.5 sterile surgical gloves, latex sterile surgical gloves made of latex gloves should be according to the specifications of bis (bureau of indian standards). it should fit in anatomic shape of hand for relaxed rit and prevention of fatigue. roughened surface on grip area. size embossed for easy identification. thinner wall at finger tips for better sensitivity. curved finger, sample _ required for approval. 8. disposable tissue paper roll 9. filter paper wattman no. ‘0’ 46”x57” inch sheets 10. coupling jar 10 slides plastic wiih cap i1. disposabie plastie cassette with lids, yellow colour for tissue processing, sample required for approval. (small biopsy) i2. disposable plastic cassette with iids, white! off white colour for tissue processing, sample requlred for approval. (surgical and .. autopsy) 13. disposable plastic cassette with lids, blue colour for tissue processing, sample required ror approval. (gynae biopsies) 14. index card 15. disposable face mask with high quality elastic 16. pace mask n95 high quality niosh 17. test tute (i0 ml) plastic with cap 10.5 cmnx 1.1 cm 18. test tube plastic with cap 7 cm x 1 cm i9. rectangular museum jar with cover, lids and inner plates made of borosil glass witt coverslip inside glass plate ._e.... (2s0x250x120mm) 20. rectangular museum jar with cover made of borosii glass with coverstip inside glass plate . (25oxl5oxioomm) 21. rectangular museum jar with cover made of borosil glass with coverslip . (220x195x80 mn) 22.2 . glass putty 23. silicon jelly gun (tube) — 24. wbc pipette (borosilicate) 25. rbc pipette (borosilicate) 26. hbpipette 27.? 1 lb tubes (round? squnre shape) 28. wintrobe’s tube 29. urinometer complete set 30. neubaur counting chamber (bright) 31. funnel plastic 2” 32. funnel plastic 4” 33. disposable plastic dropper 2 ml 34. disposable plastic dropper 5 ml 35. lens cleaning paper 36. plastic test tube stand of 12 holes big universal combi rack for test tubes 30i20,17,12 mm tube 37. westergren tubc glass 38. disposable plastic bag autoclnvable for biomedical waste cap 50 kg yellow 39. disposable plastic bag autoclavable for biomedical waste cap 25 kg yellow 40. disposable plastic bag autoclavable for biomedical waste cap 50 kg red 41. disposable plnstic bag autoclavable for bionedical waste cap so kg blue 42. disposable plastic bag autoclavable for biomedical waste cap 25 kg blue 43. disposable plastic bag autoclavable for biomedical waste cap 50 kg black 44. disposable plastic bag autoclavable for biomedical waste cap 25 _._e.._ kg black 45. beaker i3orosil glass 1000 ml 46. beaker borosil glass 500 ml 47. — beater borosil glass 250 ml 48. borosilicate test tubes glass 6” ..___.._ (ixloo) (6’x y4’) 49. borosilicate test tutes glass 4” ________ (lxi0o) 50. borosilicate test tubes glass 3” _.___.. (ixi0o) 51. aluminium foil 72 meter 52. disposable gown for autopsy and histopathology (ixi) 53. wash bottle made or ldpe plastic with delivery tube. it should be made or chemically resistant low density polyethylene, — flexible with screw cap (500 ml) 54. wash bottle made of ldpe plastic with delivery tube. it should be made of chemically resistant low density polyethylene, flexible with screw cap (125 ml) 55. reagent bottles borosil cap 500 ml 56. reagent bottles borosil cap 1 lit 57. falcon tube.10.ml.steriie 58. staining glass jar for 20 25 siides 59. borosil thermometer 60. conical flasks 5 lit with nlat bottom borosilicate 5 lit 61. flasts graduated i hr (i000 ml) borosil, flat bottom. capacity engraved on the flasks 62. dropping bottle with tube plastic 63. staing [langars.s for 25 3 0 slide 64. plastic slide box cap— 100 slides 65. plastic slide box cap 50 slides 66. plastic dustbin cap 10 lit with foot opener 67. marker pen with pointer 68. test tube holder for 15 tube —20 holes for small and big 69. diamond pencil 70. glass marking pencil (red) 71. block dibba (card board box for biopsy) 72. low profile microtome blades 73. high profile microtome blades 74. slide tray (wooden 30 slides) 75. slide tray (aluminum 20 slides) 76. plastic slide box (cap — 100 slides) 77. plastic slide box (cap 50 slides) 78. gross station (wooden) 22x28’ inch . 79. sticker for test tube and slides 2x.3 cm 80. filter paper wattman no ‘1’ (12 cm) (lx 100) 81. beaker borosilicate glass 25 ml 82. beaker borosilicate glass 100 ml 83. disposable gown for autopsy and histopathology (single pack) _______ lxi 84. reagent bottles borosil with cap 250 ml 85. measuring cylinder borosil 1000 ml 86. measuring cylinder borosil 500 ml .. 87. measuring cylinder borosil 100 ml 88. measuring cylinder borosil 25 ml 89. bottle opener 90. funnel plastic 4” 91. funnel plastic 2” _ 92. dropper plastic 5 ml 93. dropper plastic 2 ml 94. lens cleaning paper 95. cytotek filter paper .._ 96. hernatocytometer coverslip 97. westergren’s tube 98. wintrobes tube 99. spin lamp glass __._____________ 100. esbachs albunonieter .....__________ 101. dropping bottle plastic 125 ml 102. borosilicate test tube glass 15 ml ____________ 103. borosilicate test tube glass 10 ml 104. glass coplin staining jar 50 ml 105. tube stand 36 tubes 106. falcon tube stand 15 ml, 50 ml 107. falcon tube 15 ml, 50 ml 108. humid slide staining chamber r46x2rx4) dark lid and body for _______._ light_sensitive_stains_24_slides_cap 109. glass tottle with cap airtight borosii 1000 ml 110. glass bottle with cap airtight borosil 500 ml — 111. glass bottle with cap airtight borosil 250 ml 112. glass bottle with cap airtight borosil 100 ml 1m133 dropping bottle borosil s00 ml 114. dropping bottie 250 ml ii5. siide_mailer.(box)_5.slides ...._....__ 116. spring file a4 size _......_...__ 117. 2d ring binder file a4 size 118. ace_files_cardboard.lever_archbox 119. plastic drawer cabinet 2x2 120. pipette stand (round) 120. pipette stand (round) 121. ph meter probç 122. butter paper 4x4 123. round brush for washing 124. flat paint brush no.6 125. fiat paint brush no. 12 126. spray bottle 1 liter 127. spatula small and long 128. micropipette tips yellow ixl000 129. cover slip (8x8mm) 130. glass petridish 75mm 131. coverslips4x4mm etc ...

North Western Railway - Rajasthan

35678891 auction sale of scrap u/s aluminum with heavy attachment of rubber, fiber, steel, plastic, glass and ferrous such as non ac window frame, sign board, rope wire, foot rest, bulb cap,aluminium foil signaling/ diesel/ c & w part and fittings of sorts and sizes. loading by purchaser. weighment on weighbridge. location: bin no. 103...

Medical Health And Family Welfare - Rajasthan

35614217 tender for working of food items in ng hospital bhilwara , gehu ka aata , daliya , chawal basmati , mung ki dal chhilke vali , sugar , desi ghee , vegitable oil , gud , glucose biscuit 250 gm , cotton wet string mop , phool jhadu , nareli jhadu , hand wash soap 60 gm , cloth washing powder , utensiles cleaning powder , aluminum foil paper 9 meter , mineral water bottle 500ml , spices , lal mirch pisi hui , haldi pisi hui , dhaniya pisa hua , namak pisa hua , jeera , vegerable for the month of july to october , bhindi , taroi , tinda , ganwarphali , semphali , nimbu , ghiya , aloo , vegerable for the month of november to february , matar , hari methi , palak , chandloi , muli , gajar , adark , shaljam , nimbu , gobhi , hara dhaniya , aloo , karamkalla / patta gobhi , vegerable for the month ofmarch to june , tarkakdi , hara pyaj , podina , ghiya , lal tamatar , aloo , nimbu , palak , bengan , pyaj...

Sms Medical College - Rajasthan

35494316 supply of kits and consumables ( cat no 23 ) il 6 human proquantum immunoassy kit, tnf alpha human proquantum immunoassy kit, aluminum foil paper....

Department Of Local Bodies - Rajasthan

35378627 tender for director pensioners pensioners welfare department regional furniture other vikas work 4 nit 30 2 providing and fixing anodized aluminium work ( anodizing to be got done from approved anodizer ) for doors, windows, ventilators and partition with extruded built up standard tubular and other sections of approved make confirming to is : 733 and is : 1285 anodised transparent 81 dyed to required shade according to is : 1868. ( minimum anodic coating of grade ac 15 ) , fixed with rawl plugs and screws or with fixing clips, or with expansion hold fasterners including necessary filling up of gas at junctions, at top, bottom and sides with required pvc / neoprene felt etc.; aluminium section shall be smooth, rust free, straight, mitred and jointed mechanically wherever required including cleat angle aluminium snap beading for glazing / paneling, c.p. brass / stainless steel screws, al. tower bolt & al. handle & al. aldrop etc. all complete as per architectural drawings and the directions of engineer in charge. ( glazing and paneling to be paid for separately ) . 3 providing and fixing glazing in aluminium door, window, ventilator shutters and partitions etc. with pvc / neoprene gasket etc. complete as per the architectural drawings and the directions of engineer in charge ( cost of aluminium snap beading shall be paid in basic item ) . with tinted glass panes of 5.0 mm thickness ( weight not less than 13.75 kg. / sqm ) . 4 providing and fixing aluminium composite panel 5 mm thick by using 0.5 mm thick aluminium foil and 5 mm thick reflactive glass ( sand bobbin ashi india or equivalent ) and framing of 2 mm thick aluminium section of 50 x 50 mm size silicon & glazing tap etc. complete up to iiirdfloor, pattern as approved by engineer in charge. 5 plaster on new surface on walls in cement sand mortar 1 : 3 including racking of joints etc. complete fine finish. 20 mm thick 6 providing and applying white cement based putty over plastered surface to prepare the surface even and smooth complete birla / j.k. / nerolac or iso. as per direction of engineer in charge. 7 wall painting with plastic emulsion paint of approved brand and manufacture to give an even shade : two or more two coats on new work including preparation of base with primer, putty, lippy complete in all respect. 8 providing visitors chairs medium back premium leatherite chair hight adjustment gas lift 5 prong chrome plated steel base fitted with lock type twin wheel castors for easy movement. steel arm rest with leatherite covering. single seat and back cushioned with high density foam and upholstered in leatherite torsion bar mechanism of approved design complete as per architect design and drawing approved by engineer in charge. 9 providing wooden table for reception counters / officers chambersof approved design with 19mm solid core board isi marked water proof and 1mm thick mica at top and inside, front having combination pattern with metalic laminate as per design and drawing of architect as per design and drawing approved by engineer in chargetable with 8 length 2 width and 26 height as per design of architect ( counter top area to be measured for payment ) ...

Department of Agricultural Research and Education - Rajasthan

35158451 bids are invited for srl brand only supply dimethyl sulphoxide for molecular biology , methanol gc hs for ovi residual solvent analysis , boric acid extra pure ar , edta disodium salt solution , tris buffer superior for molecular biology , ethanol extra pure , aluminum foil paper fresh wrap , white colour blotting sheet total quantity : 23...

Rajasthan State Pollution Control Board - Rajasthan

34797233 rate contract for chemicals, glass wares and other lab items under namp sodium hydroxide sodium arsenite sulphanilamide ( melting point 16s 167° c ) neda hydrogen peroxide 30% phosphoric acid 85% sodium nitrite ( 97 % or greater ) mercuric chloride sodium chloride edta disodiurn salt suplhamicacid formaldeyde pararosaniline chloride hydrochloric acid iodine potassium iodine, flasks volumetricwith interchangeable glass stopper, class a fiasks volumetric with interchangeable glass stopper, class a nessler tube with graduation ( borosil ) mmr nessler tube with graduation ( borosil ) flasks volumetric with lnterchangeable glass stopper, class a flasks volumetric with interchangeable glass stopper, class a flasks volumetric with interchangeable glass stopper, class a pipettes ( volumetric ) , graduated, schellbach, ( seriological type ) class as graduation division 0.01 ml with calibration certificate pipettes ( volumetric ) , graduated, schelibach, ( seriological type ) class as graduation division 0.01 ml with calibration certificate reagent bottles, plain clear glass graduated with screw cap reagent bottles, plain clear glass graduated with screw cap bottles, amber glass graduated with screw caps cap pipettes, graduated, schellbach, graduation division 0.01 ml with pipettes, graduated, schellbach, graduation division 0.01 ml with ( seriological type ) class as calibration certificate ( seriological type ) class as calibration certificate bottles, amber glass graduated with screw caps cap, pipette aid sucker 10 ml bottle top dispenser 1 10 ml forcep 200 mm spatula ( s& lsize ) wash bottles ( 500m l ) coolling box ( small ) nessler tube stand having capacity 50 ml &s10o ml tubes silica l.gel_ ( in_gel.type ) pipette stand vertical ( 28 pipettes ) narrow mount bottle ( medical grade ldpe confirming to usp class vi ) ( 60 ml ) amber narrow mount bottle ( medical grade hope confirming to usp class vi ) ( 60 ml ) narrow mount bottle ( medical grade ldpe confirming to usp class vi ) ( 500 ml ) amber narrow mount bottle ( medical grade hdpe confirming to usp class vi ) ( 500 ml ) injection ( 10 ) extension cord with power plug cloth for cleaning machine rds cover apron, test tube cleaner brush first aid kit labelling tape ( cryo tags ) markers tissue roll liquid glassware cleaner hand towels normal filter paper register data sheet file filter paper envelop ( for pm 2.5 ) filter paper envelop ( for mp 10 ) screw.kit gloves ( l size ) aluminum foil, etc....

Indian Army - Rajasthan

34754576 procurement of medicines , drugs , polypropylene blue monofilament 1 / 2 circle rb 70cm, size 2 / 0 , abdominal drain kit size 20 fg , abdominal drain kit size 24 fg , abdominal drain kit size 28 fg , abdominal drain kit size 32 fg , hemostatic sponge gelatin 80 mm long, 50mm broad 10 mm thick , absorbable surgical suture violet 1 / 2 circle , rb 20mm, size 3 / 0 , adjustable arm pouch sling l / m / s , adult bain circuit , aluminium foil , ankle brace , ankle support , ansell non latex gloves s 7.5 ( brand specific ) , biological indicator for autoclave machine , bulb for laryngscope , chest drain system with trocar ( icd ) s 24 , chest drain system with trocar ( icd ) s 28 , chest drain system with trocar ( icd ) s 30 , chest drain system with trocar ( icd ) s 32 , closed wound suction system romovac 10 fg , closed wound suction system romovac 12 fg , closed wound suction system romovac 14 fg , closed wound suction system romovac 16 fg , closed wound suction system romovac 18 fg , combined spinal epidural set 18 / 27 g , cord clamp , crutches elbow adjustable , cvp manometer , disp bladeless trocar 10 mm , disp needle s 26 g , disp skin marker , duram tube , ecg electrodes ( disposable ) , endoclip lt 200 , epidural set 18g , feeding tube 10 fr , folleys catheter s 14 , g dressing s 15 , g dressing s 25 , g dressing s 5 , guedel airway size 01 , guedel airway size 02 , haemacel infusion, bott of 500ml , heel pad , hiv ppe kit for ot , keto diastix bottle of 50 strips , petri dish , erba machine printer roll , knee cap large , knee cap medium , knee cap small , knife bard parker, blade size 1 fitting ( commercial no. 11 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no. 12 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no. 15 ) packet of 6 , knife bard parker, blade size 1 fitting ( commercial no.10 ) packet of 6 , knife bard parker, blade size 2 fitting ( commercial no. 20 ) packet of 6 , knife bard parker, blade size 2 fitting ( commercial no.22 ) packet of 6 , lint absorbent, cotton , liquid formalin , malaria antigen test card ( mitra ) , methylene blue , microgen d 125 , microtips 1 1000 ul , microtips 1 50 ul , monocryl polyglecaprone 25 4 / 0cutting needle , monocryl polyglecaprone 70cm, 3 / 0 , ns bott of 100 ml , ot pack large gamma irradition sterlised consisting of: operating go , paedia drip , paraformaldehyde tab for sterilisation of catheters , pcm suppository , pressure monitoring line 100 cm / 200cm ( male / female ) , polyamidemonofilament size 1, 100 cm, 1 / 2 circle rb 40 mm , polyamidemonofilament size 2 / 0, 70 80 cm 3 / 8 circle reserve cutting 40 45 mm , polyamidemonofilament size 3 / 0, 70 80 cm, 3 / 8 circle reverse cutting 25 30 mm , polyamidemonofilament size 4 / 0, 40 50 cm, 3 / 8 circle cutting 15 20 mm , polyamidemonofilament size 5 / 0, 60 70 cm 3 / 8 circle cutting 15 20 mm , polydioxanone size 1, 1.5cms loop, 1 / 2 circlerb needle 50 55 mm , polyglicaprone size 3 / 0, 70 75 cm, 1 / 2 circle rb 20 25mm , polypropylene blue monofilament 70 75 cm size 3 / 0, 3 / 8 circle reverse cutting 12 mm , polypropylene mesh 15 x 15 cms, mesh prosthesis for hernia medium / polypropylene mesh, size 15cms*15 cms.composite light weight mesh of polypropylene and polygalactin910 / polygycolic acid size 15cms*15 cms , polypropylene mesh 6 cm x 11 cm ( box of 6 ) , naso gastric tube adult 100cm long 14g , naso gastric tube adult 100cm long 16g , silicon folleys catheter s 16 [ transparent ] , silicon folleys catheter s 18 [ transparent ] , silicon gel dressing , silk braided size 0 70 76 cm reverse cutting 3 / 8 circle needle 45 mm , silk braided size 1 / 0 reel 6 reels x 25 mtrs , silk braided size 2 / 0 reel 6 reels x 25 mtrs , silk braided size 2 / 0, 70 76 cm rb 3 / 8 circle needle 45mm , silk braided size 3 / 0, 70 76 cm cutting 3 / 8 circle needle 45mm , skin stapler with 35 / 55 stainless staples , suction catheter s 08 , suction catheter s 10 , surgicel , suspensory scrotal , swab stick , synthetic absorabable polygalactin rapid absorption 2 / 0, 80 90 cms, 1 / 2 circle cutting , 30 40 mm double arm , synthetic absorbable polygalactin 910 / polyglycolic acid coated with polycaprolate size 2 / 0, 70 90 cms, 1 / 2 circle rb 30 40 mm , spinal needle s 25 g , steristrip , tegaderm s 10 cm , thumb spica splint , tracheostomy tube 6.5 mm , tracheostomy tube 7 mm , transparent anaesthesia face mask set of size 0, 1, 2, 3, 4, 5 , tube endo tracheal reinforced pvc size 2.5 with out cuff , tube endo tracheal reinforced pvc size 3.0 with out cuff , tube endo tracheal reinforced pvc size 3.5 with out cuff , tube endo tracheal reinforced pvc size 4.0 with out cuff , tube endo tracheal reinforced pvc size 4.5 withcuff , tube endo tracheal reinforced pvc size 7.5 withcuff , u drain size l & m , under water sealed drainage bag , vicryl 3 / 0, 20mm , vicryl 4 / 0, 20mm , vicryl no 1 ( rb ) 90 cm , silk no 1 cutting body , monocryl polyglecaprone 70cm, 3 / 0 cutting body , vicryl rapid no 1 round body , synthetic absorbable polygalactin 910 / polyglycolic acid coated with polycaprolate size 1 / 0, 70 90 cms, 1 / 2 circle rb 20 25 mm , polypropylene blue monofilament 70 75 cm size 1 3 / 8 circle cutting body 12 mm , polypropylene blue monofilament 70 75 cm, size 1 / 0 3 / 8 circle , round body12 mm , glutaraldeyde 2% aqueous soln with activator , propofol 1% or 10mg / ml, 10 ml inj ( neon ) , tube plastic mount connection. , endotracheal tube cuffed 4.0 mm , apparatus anaesthitic face maskwith air cushion transparent size 0 infant , apparatus anaesthetic facemask with air cushiontransparent size 1paediatric , apparatus anaesthetic face mask ( anitistatic ) with aircushion ( transparent ) size 2 medium , apparatus anaesthetic face mask ( antistatic ) with, air cushion ( transparent ) size 3 adult with valve , apparatusanaesthetic face mask ( antistatic ) withair cushion ( transparent ) size 4 , multi coloured surgical skin marker, scrub resistant fd&c dyes colour: red, blue, green, black, gentian violet , sofratule / soframycin paraffin gauze ( box of 10 ) , linear stapler , linear cutter , dressing collagen wound management, size 8 x 14 , bacillocid , laryngoscope cells for battery aa , laryngoscope cell 1.5 vdia13 mm and length 51 mm for torch , disp bladeless trocar 7 mm , endo loop , gelofusion plasma substitute soln , inj etomidate 2 mg / ml , polypropylene blue monofilament 70 75 cm, size 2 / 0, 3 / 8 circle reverse cutting, 12 mm , silk braided size 1 / 0 70 76 cms taper cut 1 / 2 circle needle 25mm , endo bag , ipratropium bromide respirator soln 250 mcg / ml vial of 15ml , mesh prosthesis for hernia small polypropylene mesh size 6*11 cms. composite light wtmesh of polypropylene and polygalactin 910 / polygycolic acid, size 6 *11 cms , polypropylene blue monofilament 70 75 cm size 4 / 0, 1 / 2 circle rb25 mm double needle , polypropylene blue monofilament 70 75 cm, size 1 / 0 3 / 8 circle reverse cutting, 12 mm , sofratulle , dressing, shell, compressed , hydrocolloid dressing , collagen dressing , lot iorep , polypropylene blue monofilament 70 75 cm, size 4 / 0, 3 / 8 circle reverse cutting, 12 mm , uro bag , urometer , usg printer paper roll , ventilator circuit for anaesthesia machine , i gel size 3 , i gel size 4 , jackson rees paediatric circuit , anaesthesia face mask inflatable size 0, 1, 2, 3 , colostomy set of bag / skin adhesive , inj tenectaplase 40 mg , inj alteplase 50 mg , kit albumin ( erba ) , kit alkaline phosphate ( erba ) , kit calcium ( erba ) , kit prothrombin time ( siemens ) , kit creatinine ( ( erba ) , kit for estimation of amylase ( 12 x 5 ml ) ( erba ) , kit for estimation of bilirubin ( erba ) , kit total protein ( erba ) , kits for estimation of cholesterol ( erba ) , kits for estimation of glucose ( erba ) , kits for estimation of sgot ( erba ) , kits for estimation of urea ( erba ) , kits for estimation of uric acid ( erba ) , pttk reagent ( siemens ) , urine container , urine strips ( protein + glucose ) , kit ckmb ( erba ) , kit for triglyceride estimation ( 100 ml ) ( erba ) , kit fsh detection elisa kit 96 tests ( calbiotech ) , kit lh detection elisa kit 96 tests ( calbiotech ) , kit lipase ( erba ) , kit prolactin detection elisa kit 96 tests ( calbiotech ) , kit sgpt ( erba ) , kit t3 detection elisa kit 96 tests ( calbiotech ) , kit t4 detection elisa kit 96 tests ( calbiotech ) , kit testosterone detection elisa kit 96 tests ( calbiotech ) , kit tsh detection elisa kit 96 tests ( calbiotech ) , slide microscope , soda lime , erba h lyse 360 ( erba ) , hcv rapid ( tridot ) , test hiv rapid ( tridot ) , sperm wash media , solution pack ( na, k & cl ) ( medica ) , erba diluent h 360 , erba h clean , kit hdl cholesterol ( erba ) , kit ldh ( erba ) , kit ggt ( erba ) , kit hbsag tridot , kit hcv tridot , kit vdrl , kit crp ( qualitative ) , kit ra factor , kit aso , kit widal , typhi dot igg igm , esr western green tube , kit microprotein , erba control h 360 , kit vit d , stool for ocult blood rapid card , antisera ab & d ( 3 x 10 ml ) meril , microscopic slide pkt of 50 ( blue star ) , distilled water , kit erba wash 5 x 20 ml , cover slip 22 x 50 ( blue star ) , ependorf tube , ethanol , methyl alcohol , acetone , macconkey broath double strength high media ( pack og 500 gm ) , cled agar pack of 500 gm ( hi media ) , mha agar pack of 500 gm ( hi media ) , blood agar base pack of 500 gm ( hi media ) , macconkey agar ( pack og 500 gm ) , antibiotics disc ampicillin pack of 250 disc ( hi media ) , antibiotics disc gentamycin pack of 500 disc ( hi media ) , antibiotics disc ciprofloxacin pack of 500 disc ( hi media ) , antibiotics disc norfloxacin pack of 500 disc ( hi media ) , antibiotics disc nitrofurantoin pack of 500 disc ( hi media ) , antibiotics disc imipenam pack of 500 disc ( hi media ) , antibiotics disc vancomycin pack of 500 disc ( hi media ) , antibiotics disc co trimazole pack of 500 disc ( hi media ) , antibiotics disc cefixime pack of 500 disc ( hi media ) , antibiotics disc ceftazidime pack of 500 disc ( hi media ) , antibiotics disc clindamycin pack of 500 disc ( hi media ) , antibiotics disc polymixin b pack of 500 disc ( hi media ) , blood culture bott ready to use , east lyte plus wash soln bott of 50 ml ( medica ) , east lyte plusclaening soln bott of 50 ml ( medica ) , watman filter paper size 1500 mm , sulphuric acid ( specific gravity 1.828 1.825 ) , acid amyl alcohol , glucosamine 250mg+ chondroitin sulphate 200 mg cap , mdi formoterol 6 mcg + budesonide 400mcg , r / c levosalbutamol + ipratropium bromide ( duolin ) , r / c salbutamol , respulesenterogermina , rifampicin 150mg cap , rotacap salmeterol 50mcg +fluticasone 250mcg , salbutamol 100 mcg + ipratropium 20 mcg inhaler , salbutamol sulphate respirator solution 5mg / ml, vial of 15 ml , serratiopeptidase 10 mg tab , streptokinase 15 lacs iu inj , syp ambroxol bott of 100 ml , syp b complex , syp disodium hydrogen ( alkasol ) , syp ofloxacin + ornidazole , syrup calcium phosphate , tab alpha keto analouge , tab bilastine 20mg , tab biotin , tab cabergoline 0.25mg , tab clinidipine 10mg , tab dapagliflozin 10 mg , tab dynapar , tab estradiol 2mg ( progynova ) , tab flunarazin 10mg , tab isosorbide dinitrate 10mg , mdi salmeterol 50mcg + fluticasone 250mcg , syp levosalbutamol 1mg / 5 ml , bottleof 100 ml , adenosine 3 mg / ml, 2 ml inj , ascorbic acid 500 mg tab , cap primosa evening oil , cap probiotic ( multibacillary 4 or more organisms ) , common cold tab ( antihistiminics + paracetamol 500 mg without pseudoephedrine ) , kit mifepristone 200 mg + misoprostol 800 mg , cream clobetasole + gentamycin , deflazacort 6mg tab , dextrose monohydrate for oral use , donepezil 5 mg tab , escitalopran 10 mg tab , formoterol 12 mcg & fluticasone 250 mcg dry powder , fusidic acid cream 2% w / w 10 g tube , l arginine sachet , lactic acid bacillus sachet , levosalbutamol + ipratropium bromide ( duolin ) respules , lidocaine spray , nifedipine retard 20 mg cap / tab , metoprolol 1 mg / ml, 5 ml inj , oint heparin , oint luliconazole , oxytocin 5 oxytocic units per 0.5ml, 0.5ml inj , tab levocarnitine 500mg , tab lithium carbonate 300 mg , tab micronised purified flavonoid fraction 500mg ( daflon ) , tab n acetyl cystene 600mg , tab nebivilol 5mg , tab pantaprazole 40 mg + domperidone 10 mg , tab paracetamol 650 mg , tab rifaximin 440 mg , tab sertaline 50 mg , tab sodium valporate 500 mg cr , tab teneligliptin 20mg , tab terbinafine 250 mg , tab thyroxin sodium 75 mcg , tab topiramate 50mg , tab torsemide 10mg , tiotropium bromide 18 mcg & formoterol 12 mcg dry powder cap , r / c tiotropium bromide 18 mcg dry powder , vitamin e 200 mg cap , diclofenac spray bott of 100 gm , walker tripod , warfarin 5 mg tab , wrist guard with thumb support , zolpidem 10 mg tab , cotton wool, absorbent pkt of 500 gm , syp grilintus , tramadol hcl 50 mg / ml inj , diethylcarbamazine 50mg tab , salbutamol 2.5mg + ipratropium 40mcg solution , tmppd , cotton wool, non absorbent pkt of 500g , magnesium sulphate 50% w / v inj , tab levodopa + carbidopa110 mg cr , endotracheal tube cuffed 7.5 mm , inj methotrexate 15 mg , 1 ml , inj rabies immunoglobilin 100iu / ml , pcm suppositories , resp asthalin ( cipla ) , dextrose 50%, 25 ml inj , dextrose inj 25%, 25 ml inj , povidone iodine gargle 2% , tab mesalamine 1.2gm , ethambutol 200mg tab , tetanus toxoid, purified absorbed rubber capped, vial of 5 ml ( 10 doses ) , human diploid cell rabies vaccine , calcium carbonate 500 gm tab , gauze surgical open wove 60 cm wide, pkt of 18 mtr , gauze surgical, open wove, unmedicated : 60 cm x 3 metres packet , heamatinic tab / cap containing ferrous fumarate vit b 12 folic acid and vit c, strength: 300mg, 1.5mg, 75mg min , human chorionic gonadotrophin 2000 iu inj ( hcg 2000iu ) , hydroxyprogesterone caproate 500 mg / 2 ml ( amp of 2 ml ) inj , infusion paracetamol 10mg / ml , bott of 100ml , inhaler salmetrol 50mcg + fluticasone 250mcg , human chorionic gonadotrophin 10000 iu inj ( hcg 1000iu ) , inj hmg 75iu , mdi budesunide 200mcg , mdi salbutamol , pregnancy card , rifampicin 450mg + isonex 300mg combination cap , sodium hypochlorite 5% , tab chlorzoxazone 500mg + diclofenac 50mg+ pcm 500mg ( cipzox ) , tab efavirenz 600mg , tab etoricoxib 90 mg , tab levetiracetam 500mg , tab neurobion forte , tab nitrofurontoin 100mg , tab trypsin+ chemotrypsin , vildagliptin 50 mg tab , cap multivitamin , tab ticagrelor 90 mg , glucostrip morepen , clotrimazole 1% w / v ip+ lignocaine 2% w / v ip ear drop bott of 10ml , nicorandil 10 mg tab , formoterol 6 mcg and budesonide 200 mcg cfc free mdi , oint hydroquinine + tretrition + mometasone , iron succinate / fractionate dextran 100 mg inj ( epo ) , arm sling pouch s large , corn cap , tab acelofenac 100 mg + paracetamol 325 mg , syp mifenamic acid + paracetamol , tab sodium bicarbonate 500 mg , tab ranalozine 500 mg , tab febuxostat 40mg , pioglitazone hydrochloride 15 mg tab , tab gliclazide 60mg xr , tab letrozole 5 mg , tab itopride 50mg , inh budesonide 400 mcg , tab rosuvastatin 10 mg , e / d moxifloxacin + dexamethasone , r / c duolin , tab azithromycin 500mg , tab pirfenidone 200 mg , tab racecodotril 100 mg , tab bisoprolol 5 mg , kitmifepristone + misoprostol , pad abdominal swab 25 x 25 cm with tape 30 cm , pad abdominal swab 40 x 25 cm with tape, 30 cm , bandage dvt stocking small , bandage dvt stocking medium , bandage dvt stocking large , adhesive plaster microfoam tape 3 inches box of 4 , adhesive plaster microfoam tape 4 inches box of 3 , bandage crepe: 10 cm , bandage, open woven compressed 2.5 cm x 4 metres , bandage open wove uncompressed: 6 cm x 4 metres , bandage open wove uncompressed 10 cm x 4 metres , antacid gel each 5ml containing dried aluminium hyroxide gel ip 250mg, magn esium hydroxide nf 250mg and methyl polysiloxane 50mg ( as per nfi bott of 400 ml ) , bandage open woven for plaster of paris 10cmx5m , syp paracetamol 162.5 mg+ ibuprofen 100 mgbott of 60 ml , disposable gown , phytomenadione ( vit k ) 1 mg / 0.5ml inj , tramadol hc 50 mg / ml inj , mdi beclomethasone + salbutamol , mdi budecort 200mcg , mdi budecort 400mcg , r / c salbutamol , r / c tiotoproium bromide , r / c formeterol + budesonide 200 mcg , r / c formeterol + budesonide 400 mcg , r / c ipratorium bromide , tab acamprostate 333 mg , cough sedative syp each 5 ml containing chlorpheniramine maleate 2.5mg guiaphenesin 100mg noscapine 15mg sodium citrate 60mg in flavoured base bott of 100 ml , cremaffin white each 15 ml containing milk of magnesia 11.25 ml, liq paraffin 3.75ml bottle of 170 ml , alprazolam0.25 mg tab , tab zolpidem 10 mg , tab nimesulide 100 mg , inj thiamine 100mg / ml, 2ml amp , antispasmodic cap containing dicyclomine hcl 10mg, dextroprop oxyphen hcl 65mg acetaminophen ip 400mg , thiopentone inj of 0.5 g without water for injection , tab rabeprazole 20mg , oint miconazole , tab strepsils , band aid , tab thyroxin 25mcg , tab thyroxin 125mcg , tab rabeprazole 20 mg+ domperidone 10 mg , syptixylix , syp montelukast + levocetrizine , syp n cold , syp spasmonil , syp chorpheniramine maleate and phenylephrine , syp paracetamol + mefanemic acid , pencil cell aa , pencil cell aaa , ecg paper roll a4 size , bain circuit paed , bain circuit adult , syp megnakof ls , drop vit d3 60k nanoshot ( dee 3 ) , pkt of 4 bottle , calamine lotion , u drain male incontinence device made of soft, light weight latex sheath size large35 mm. , u drain male incontinence device made of soft, right weight latex sheath size medium 30 mm. , ketoconazole shampoo , syp neeri , tab dasatinib 50 mg , tab bosenten 62.5 mg , metronidazole inj for iv use. each ml containing metronidazole ip 500mg per bott of 100 ml , ranitidine hcl50 mg, 2 ml inj , ondansetron 8 mg tab , hydrogen peroxide solution , foleys balloon catheter 2 way, silicon16 g , foleys ballon catheter 2 way 14g , foleys ballon catheter 2 way 12g , prednisolone 5 mg tab , oint povidone iodine , tab pregablin 75mg + methylcobalamine 1500mcg , bandage triangular , inj n acetyl cystene , deriva bpo gel , syp power gel , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bottle of 120ml , pancreatin microspheres 150mg cap , isoxsuprine 10mg tab , mirtazapine 15 mg tab , venlafaxine 37.5mg tab , benzathine penicillin 6, 00, 00 unit inj , ls belt s medium , ls belt s large , ls belt s xl , dengue test , tab dihydrogesterone 10 mg , lot sun screen , lot liquid paraffin , protein powder , inj denosumab 120 mg , tab vildagliptin 50 mg + metformin 1 gm , tab vildagliptin 50 mg + metformin 500 mg , tab tadalafil 10 mg , tab duloxetine20 mg , tab fluoxetine 50 mg , tab sitagliptin 50 mg + metformin1 gm , tab eplerenome 25 mg , tab levosulpride 25 mg , knee brace s large , knee cap s medium , knee cap s large , tab baclofen 10 mg , hydroquinone 2% tube of 50 gm , inj depomedrol 80 mg / 2ml , inj neostigmine 5ml , inj triamcinalone ( kenacort ) 10mg , insulin disposable syringe 1ml , insulin highly purified human neutral40iu / ml, 10 ml inj , iron syp with vitamins each 5 ml containing ferrous fumarate 100mg folic acid ip 3mg & vit b12 10mcg , isapgol / ispaghula husk 3.5 gm , ketorolac 10 mg tab...

Medical College - Rajasthan

34652403 rate contract for kits and consumables for rtpcr lab , ethanol molecular grade , iso propanol molecular grade , nuclease free water molecular grade , rna zap [ rna kill ] , cool racks for pcr tube ( 0.2ml ) with temperature indicator , aluminium foil , vortex mixer for tubes , micro tips for 100 1000?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 10 100?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 2 10?l, low retentionrnase, dnase & pyrogen free sterile , micropipette tips lowretention filtered, rnase, dnase, pyrogen free, sterile 1 10?l , aluminium foil 72 meter , bottle top dispenser with bottle capacity 1 liter capcity 1 10ml , cryo storage card board box 100 wells with cover 2.0ml , discarding jar with swinging lid 5 liter with biosafety symbol , disposable sterile speciman collection swab dacron type , gown blue cloth back open full sleves , gown green cloth back open full sleves , gown red cloth back open full sleves , gown white cloth back open full sleves , hand sanitizer with dispensar to be attached to wall , lysol , micro titer pipette set variable volume 5 50?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , microcentrifuge 8 tube rotor , microcentrifuge tube 1.5ml molecular grade sterile , safety goggles , trough reservoir capacity 75ml polypropylene , wash bottle 500ml new type , ziploc bag 12x8 , ziploc bag 4x3 , ziploc bag 8x6 , manual multichannel micropipette variable volume autoclavable 100 300?l , eppendorf tube 1.5ml with screw caped self standing , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile 100 300?l...

Sms Medical College - Rajasthan

34632156 rate contract for kits and consumables for rtpcr lab ( nit 71 ) i. ethanol molecular grade 2. so propanol molecular grade 3 nuclease free water molecular grade 4 rna zap [ rna kim 5 cool racks for pcr tube ( 0.2m1 ) with temperature indicator 6. aluminium foil 7. vortex mixer for tubes 8. micro tips for 100 1000p1, low retention rnase, dnase & pyrogen free sterile 9•micro tips for 10400p1, low retention rnase, dnase & pyrogen free sterile 10, micro tips for 2 10p1, low retention rnasc, dnase & pyrogen free sterile 11. micropipette tips lowretention filtered, rnase, dnase, pyrogen free, sterile 1 10p1 12 . aluminium foil 72 meter 13. bottle top dispenser with bottle capacity 1 liter eapcity 1 10m1 14, cry° storage card board box 100 wells with cover 2.0m1 15. discarding jar with swinging lid 5 inter with biosafety symbol 16, disposable sterile speciman collection swab dacron type 17. gown blue cloth back open full sieves 18, gown green cloth back open full sieves 19 . gown red cloth back open full sieves 20 . gown white ciotti back open full sieves 21. hand sanitizer with dispensar to be attached to wall, 22. lysol — 23 micro titer pipette set variable volume 5 50a1. single channel fully autoclavable ce iva certified. super blow out piston with volumes of 50111 and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron 24 . microcentrifuge 8 tube rotor 25. microcentrifuge tube 1.5m1 molecular grade sterile 26. safety goggles 27 . trough reservoir capacity 75mi polypropylene 28. wash bottle 500m1 new type 29. ziploc bag i2x8 30. ziploc bag 4x3 31. ziploc bag 8x6 32. manual multichannel micropipette variable volume autoclavable 100 3000 33. eppendorf tube i.5m1 with screw coped self standing 34. micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile 100 300u1...

Department Of Atomic Energy - Rajasthan

34626493 bids are invited for permacel make reusable thermal insulation pad gengard p 504t size: 60cm x 7.2 mtr x 25 mm thick (q3) , permacel make p 12 (plasmask) aluminium foil size 100 mm (w) x 20 mtr (l) (q3) total quantity : 120...

University of Rajasthan - Rajasthan

34398433 supply of chemicals, reagents, lab accessories, glassware supply of chemicals, reagents, lab accessories, glassware and plasticware at department of zoology, university of rajasthan, jaipur , chemical items : , ( ± ) jasmonic acid, analytical standard , ( ± ) ? lipoic acid , ( bcl2 ) mouse monoclonal ab , ( cad ) mouse monoclonal ab , ( caspase 3 ) mouse monoclonal ab , ( caspase 7 ) mouse monoclonal ab , ( gaad45 ) mouse monoclonal ab , ( icad ) mouse monoclonal ab , ( nfk betap65 ) mouse monoclonal ab , ( parp ) mouse monoclonal ab , 0.02m iodine / h2o / pyr / thf, , 0.25% trypsin edta solution 1x , 1 chloro 2, 4 dinitrobenzene , 1 chloro 2, 4 dinitrobenzene , 1 kb dna ladder , 1 naphthyl acetate , 1, 1, 3, 3 tetramethoxypropane , 1, 2 dichloro 4 nitrobenzene , 1, 2 dichloroethane ( anhydrous, 99.8% ) , 1, 2 epoxy 3 ( p nitrophenoxy ) propane , 10 mm dntps , 10 x phosphate buffered saline tween 20 ( pbst ) , 100 bp dna ladder , 10x pcr buffer ( optimized for routine pcr with mgcl2 included ) , 10x phosphate buffered saline ( pbs ) , 10x tae , 10x tbe , 10x tbs , 1 methyl 2 phenylindole , 1 nitroso naphthol reagent ( 1 nitroso 2 naphthol ) , 2 naphthol , 2 naphthyl acetate , 2 nessler reagent , 2, 4dinitrophenyl hydrazine ( dnph ) , 2, 2 azino bis ( 3 ethylbenzothiazoline 6 sulfonic acid ) diammonium salt , 2, 2 diphenyl 1 picryl hydrazyl hydrate , 2, 4 dichloro 1 nitrobenzene , 2, 4 dinitrophenol , 2 amino 2 hydroxymethyl propane 1, 3 diol ( tris ) , 2 deoxy d ribose , 2 mercaptoethanol , 2 thiobarbituric acid ( tba ) , 3, 3, 5, 5 tetramethyl benzidine ( tmb ) , 3, 6 dimethyle 1, 4 dioxane 2, 5 dione ( lactide ) , 4 ( trifluoromethyl ) styrene , 4, 6 diamidino 2 phenylindole dihydrochloride ( dapi ) , 5, 5 dithiobis ( 2 nitro benzoic acid ) extrapure ( dtnb ) , 6e10 anti amyloid plaque ( mouse monoclonal ) , 6ohda , 70% bleach , 7fb anti hsp 70 ( rat monoclonal ) , 8ohdg standard , absolute alcohol , absolute ethanol , abts ( 2, 2’ azino bis ( 3 ethyl benzo thiazoline 6 sulfonic acid ) , acetic acid , acetic acid glacial , acetic anhydride , acetone for hplc & uv spectroscopy, , acetonitrile ( acn ) , acetyl acetone , acetyl thiocholine iodide , ache ( acetylcholinesterase human ) , acid phosphatases , acid red 66 / biebrich scarlet dye , acridine orange , acrylamide , active charcoal , adenosine triphosphate , agar powder, bacteriological grade , agar agar , agarose , agarose gel elution kit , agarose low eeo , aif mouse monoclonal ab , alarmar blue hs , alexa fluor plus dye conjugates of phalloidin , alkaline and acid phosphatases kits , alkaline copper solution , alkaline copper sulphate solution ( lowry reagent ) , alloxan monohydrate , alpha keto glutaric acid , alpha naphthol , alpha naphthylamine solution , aluminium ammonium sulphate dodecahydrate , aluminium chloride hexahydrate , aluminium potassium sulphate dodecahydrate , amarnath ( acid red 27 ) , ammonia buffer solution , ammonium 1 anilionaphthalene 8 sulphonate , ammonium acetate , ammonium alum , ammonium buffer solution , ammonium chloride , ammonium ferrous sulphate hexahydrate , ammonium hydrogen difluoride , ammonium hydroxide 30% , ammonium molybdate , ammonium molybdate tetrahydrate , ammonium oxalate , ammonium per chlorate , ammonium persulphate , ammonium purpurate , ammonium sulphate , amoxycillin , aniline blue ( water soluble ) ( methyl blue ) , aniline citrate , annexin v : fitc apoptosis detection kit , ansa , anthrone , anti bcl 2 , anti caspase 8 , anti caspase 9 , anti catalase ( h 9 ) ( mouse monoclonal ) , anti cd3e ( clone 145 2c11 ) , percp cy5.5 , anti cyclin antibody , anti gapdh , anti heamagglutinin ( rabbit polyclonal ) , anti ly 6g / ly 6c gr1 ( clone rb6 8c5 ) , v450 , anti poly qib , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 2 ( a 2 ) ( mouse monoclonal ) , anti ? amyloid 1 42 ( mouse monoclonal ) , anti caspase 3 , anti caspase 3 , anti cd19 ( clone 1d3 ) , bb515 , anti chk1 antibody , anti p53 , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 1 ( a 2 ) ( mouse monoclonal ) , anti tyrosine hydroxylase , anti tyrptophan hydroxylase , anti gamma h2ax ( phospho ser139 ) , aripiprazole , arsenomolybdic acid , ascorbic acid , atropine , aurum chloride , bacillus selective supplement , bacoside a , bacterial dna extraction kit , barium chloride , bax mouse monoclonal ab , bca kit , bche ( butyrylcholinesterase ) , bcip red / nbt solution b ( nbt solution ) , bees wax pure , benedicts reagent , benzene , benzene , benzoic acid , benzyl alcohol , beta actin monoclonal antibody ( 15g5a11 / e2 ) , beta naphthol , beta tubulin , beta cyfluthrin , beta tubulin ( f1 ) , mouse monoclonal , bibasic potassium phosphate ( anhydrous ) , bibasic potassium phosphate ( tri hydrate ) , bibasic sodium phosphate ( anhydrous ) , bicinchoninic acid bca , biebrich scarlet , bifenthrin , bird seed agar ( staib’s media ) , bis acrylamide , bismark brown , blood agar , borate buffer ( 20x ) ( amine free ) , borate buffer reagent , boric acid , bouvin’s fixative , bovine serum albumin , bovine serum albumin ( heat shock fraction ) , bradford reagent , brewers yeast powder , bromelain from pineapple stem , bromocresol green ( bcg ) , bromophenol blue , buffer tablets ph – 4 , buffer tablets ph – 6 , buffer tablets ph – 7 , buffer tablets ph 9.2 , butanol , butyl carbitol acetate , butylatedhydroxytoluene ( bht ) , butyrylthiocholine iodide , bw284c51 1, 5 bis ( 4 allyldimethylammoniumphenyl ) pentan 3 one dibromide , ca and mg free phosphate buffer , ca and mg free phosphate buffered saline ( pbs ) , cacl2 , cacl2•2h2o , cacodylic acid , cadmium chloride monohydrate, , caffeic acid , caffeine anhydrous powder , calcium carbonate , calcium chloride dihydrate , calcium citrate tribasic tetrahydrate , calcium hydroxide , calcium sulphate dihydate , caprylic acid , carbolfuschin , carbon tetrachloride , carboxyfluroscein diacetate , carboxymethyl cellulose sodium salt, medium viscosity ( cmc ) , carrageenan , catalase assay kit , catechol , cdk 2 mouse monoclonal ab , c dna kit , c dna synthesis kit , cedar wood oil , cefotexine , cefoxitin , cellulose powder , cereium chloride , cerium oxide nanopowder , cerium sulphate , cesium carbonate , cetyltrimethyl ammonium bromide ( ctab ) , chickpea , chitosan , chloramphenicol , chloramphenicol antibiotics strips , chloro 2, 4 dinitrobenzene , chloroform , chlorogenic acid , cholesterol , ciprofolxacin , citrate buffer ( ph 4.5 ) , citric acid , citric acid anhydrous , citric acid monohydrate , coenzyme a hydrate , colchicine , collagenase type i , collagenase type iv , comasssie brilliant blue g 250 , comasssie brilliant blue r 250 , comet assay kit , congo red acs , copper sulphate ( anhydrous ) , copper ( ii ) sulfate pentahydrate , coumarin , creatinine anhydrous, , croton oil , cupric sulphate pentahydrate , curcumin , cuso4.5h2o , cyclin a mouse monoclonal ab , cyclophosphamide ( cp ) , cytochrome c , czapek dox agar , czapek –malt agar , d fructose , d ( + ) xylose , dab ( 3, 3 diaminobenzidine ) , d aspartic acid , dcf da dichlorodihydro fluorescein diacetate , dcip stock dye solution ( 2, 6 dichloroindophenol sodium salt hydrate ) , deoxy d ribose , deoxynucleotide set, 100 mm , deuterium oxide , developer , dextrose anhy. , d glucose , di ethyl ether stabilized , di methyl sulphoxide , di sodium tartarate ( purified ) , di thiothritol ( dtt ) , dichloromethane ( dcm ) , dichlorvos , diethyl ether , diethyl p nitrophenyl phosphate ( paraoxon ) , diethyl pyrocarbonate ( depc ) , diethylenetriaminepentaacetic acid ( dtpa ) , dimethyl sulphoxide ( dmso ) , dinitrophenyl hydrazine , diosgenin , diosmin , diphenylamine indicator , direct blue 6 , disodium hydrogen phosphate ( anhydrous ) , disodium hydroxide , dithiobis 2 nitrobenzoic acid , dl dithiothreitol ( dtt ) , d limonene , dmba ( 7, 12 diethylbenz anthracene ) , dmem hg , dna gel loading dye ( 6x ) , dna isolation kit , dnase i , dntp solutions set, contains 100 mm each of datp, dctp, dgtp, dttp , dodecane , dog biscuits , dopamine , doxorubicine , dpph ( 2, 2 diphenyl 1 picryl hydrazyl hydrate ) , dpx , drabkins solution , dragendorft reagent , dry yeast powder , ecl western blotting substrate , ecori and hindiii double digest , ecori / hind iii double digest ladder , ecorii and hindiii double digest , ecosanei , edta , edta anticoagulase human plasma , edta disodium salt dihydrate , egta , eicosane , ellman’s reagent , emb agar , emb broth , eosin , eosin b , eosin yellow ( water soluble ) , eosinophilic diluting fluid , epichlorhydrin , epirubicin hydrochloride , eriochrome black t , eriochrome black t ( practical grade ) , erythromycine , escherichia coli atcc 25922 , escherichia coli atcc 35218 , etbr solution , ethanol , ethidium bromide , ethyl acetate , ethyl alcohol , ethyl methanesulfonate , ethylene diamine , ethylene glycol , eudragit l 100 ( poly ( methacrylic acid co methyl methacrylate ) ) , eugenol , ezassay tbars estimation kit for lipid peroxidation , ezcountmtt cell assay kit , fast blue b salt , fecl3 , fehling solution a , fehling solution b , ferric alum indicator , ferric chloride , ferric oxide ( gamma ) nanopowder ( iron ( iii ) oxide ( gamma ) , ferric sulfate hydrate , ferric thiocynite , ferrous ( ironii ) sulphate heptahydrate , ferrous amonium sulphate , ferrous chloride tetrahydrate , ferrous sulphate dried , ferrous sulphate , ferrozine monosodium , ferrozine , ferulic acid , fetal bovine serum , fish food , fixer , folin & ciocalteus phenol reagent , folin denis reagent for the determination of phenols , follicle stimulating hormone ( fsh ) , formaldehyde , formalin solution, neutral buffered, 10% , formic acid , fructose –d ( ) bacteriology , fungal broth w / low ph , g3272 100g , gaba ( g amino butyric acid ) , gabase from pseudomonas fluorescens , galangin , gallic acid , gel extraction kit , gene ruler tm 100 bp dna ladder , gene ruler tm 50 bp dna ladder , gentamycine , giemsa stain , giemsa stain, modified solution , glacial acetic acid , glucose , dextrose , glutamic acid , glutaraldehyde , glutaraldehyde ( em grade ) , glutathione oxidized ( gssg ) , glutathione peroxidase cellular activity assay kit , glutathione reduced ( gsh ) , glutathione reductase , gluthione peroxidase , gluthione s transferase , glycerin , glycerol , glycogen , goat anti mouse igg hrp conjugated , goat anti rabbit igg hrp congugated , goat anti mouse igg ( h+l ) cross adsorbed secondary antibody, biotin , goat anti mouse igg ( h+l ) secondary antibody, hrpconjugated , goat anti mouse igg antobody, hrp conjugate , gold chloride hydrate ( tetrachloroauric acid ) , gold nanoparticles , gram staining kit , grams iodine, stabilized , graphite , gries reagent , griess reagent , gst , guanidine hydrochloride , haematoxylin , hayemis solution , hba1c diagnosis kit , hematoxylin monohydrate , heneicosana , hentriacontanol , hepes buffer , hepes sodium salt , heptachlor, analytical standard, 1, 4, 5, 6, 7, 8, 8 heptachloro 3a, 4, 7, 7a tetrahydro 4, 7 methanoindene , heptane , hesperidin , hexadacane , hexane , high molecular weight protein marker ( 10–250 kd ) , high salt nutrient agar , hind iii , miniprepplasmid extraction kit , pcr productpurification kit , histosec pastilles , hoechst dye , honey , anti rabbit hrp conjugated igg concentrate , hsp 70 mouse monoclonal ab , hstf 1mouse monoclonal ab , human butyrylcholinesterase , human butyrylcholinesterase , hydrazine hydrate solution , hydrochloric acid concentrate , hydrochloric acid 1n aq. solution , hydrochloric acid 4n aq. solution , hydrochloric acid sq , hydrogen peroxide , hydroxyl amine hydrochloride , hygromycin b , il 1 beta polyclonal antibody , il 6 polyclonal antibody , imidazole sq , mitochondrial superoxide indicator, for live cell imaging , iodine monochloride , iron nanoparticles , iron chloride anhydrous , iron oxide ( ii and iii ) nanoparticle , iron–dextran , isoamyl alcohol , isopropanol ( ipa ) , isopropyl ? d 1 thiogalactopyranoside , i ?ß mouse monoclonal ab , kampferol , kanamycin , kanamycin sulfate , kcl , kh2po4 , klebsiella pneumoniae subsp. pneumoniae atcc700603 , koh , kovac reagent , l ascorbic acid , laccase enzyme from agaricusbisporus , lb growth media with nacl , l citrulline , ldh kit , lead ( ii ) acetate trihydrate , lead nitrate , lead ( ii ) nitrate , l glutathione reduced ( g l glutamyl l cysteinyl glycine, gsh ) , lh elisa kit ( rat ) 1 , lindane , linoleic acid , linolenic acid , lipopolysaccharides from escherichia coli o111:b4 , lippopolysaccharide e coli o55: b5 , liquid nitrogen , lithium chloride , lithium citrate tribasic tetrahydrate , l malate dehydrogenase ( l mdh ) , l methionine , low molecular weight protein marker ( 14–97 kd ) , lowry reagent , ludox hs 40 colloidal silica , luminal , luria bertani agar, modified , luteinizing hormone ( lh ) elisa kit ( rat ) , luteolin , lysozyme , l ? phosphatidylcholine , mab 22c10 anti neuronal , macconkey agar , magnesium acetate tetrahydrate , magnesium carbonate , magnesium chloride anhydrous , magnesium chloride hexahydrate ( mgcl2•6h2o ) , magnesium sulphate ( anhydrous ) , magnesium sulphate heptahydrate , malachite green , malaoxon , malic acid , malon di aldehyde tetra buty lammonium salt , malt extract powder , manganese ( ii ) sulphate monohydrate , manganous sulphate monohydrate , mannitol salt agar , mayer’s reagent , melamine , mercuric chloride , mercuric oxide red , mercuric sulphate , metformin hydrochloride ( analytical standard ) , methanol , methyl methanesulfonate ( mms ) , methyl orange indicator , methyl para hydroxyl benzoate , methyl red indicator powder , methyl red solution , mgcl2 ( 25 mm ) , mgcl2 anhydrous , mgso4•7h2o , middlebrook 7h10 agar base , middlebrook 7h9 agar base , middlebrook 7h9 broth base , minimum essential medium ( with earles salts, neaa l glutamine without nahco3 ) , modified skim milk agar , molisch reagent , molybdic acid , monbasic potassium phosphate , mono sodium phosphate , monobasic sodium phosphate , monoclonal ab ( mapk2 ) , monoclonal anti caspase 7 , monoclonal anti ? actinantibody produced in mouse , m phosphoric acid , mptp , mr vp broth ( methyl red voges proskauer ) , mr vp medium , mtt cell assay kit , mueller hinton agar , mueller hinton broth , mueller hinton hiveg™ agar , mueller hinton hiveg™ broth , multivitaplex , muroxide indicator , n acetyl neuraminic acid , n heptane , n, n, n, n tetramethyl ethylenediamine ( temed ) , n, n methylene bisacrylamide ( bis acrylamide ) , na2hpo4; sodium phosphate dibasic ( na2hpo4 ) / disodium hydrogen phosphate , n acetyl 5 hydroxytryptamine , nad , nadh ( nicotinamide adenine dinucleotide ) , nadp , nadph , naringin , nbt , n butyl alcohol , nde i restriction enz , nde i restriction enzyme , neophytadiene , n ethyl n nitrosourea ( enu ) , n hexane , nigrosin , nile red , ninhydrin , nipagin ( methyl p hydroxy benzoate ) , nitric acid concentrated , nitro blue tetrazolium chloride ( nitro bt ) ( nbt ) , nitrocellulose blotting membrane , nitrotetrazolium blue chloride , nitrous acid , n nitrosodimethylamine , nonide p 40 , nuclease free water , nucleospintriprep, mini kit, for dna, rna and protein purification kit , nutrient agar , nutrient broth , nystatin , octacosanol , octadecane , octopamine , o dianisidine tetrazotized , oil immersion , oleic acid , olive oil , ongp broth , orange g , orthophosphoric acid , osmium tetroxide 4% solution , oxalic acid , oxaloacetic acid , p21 mouse monoclonal ab , p53 mouse monoclonal ab , palladium acetate , papaya seed , paraffin wax pellets ( type 1 56 58 ) , paraffin wax white soft pure , paraffin wax ( 60 62o c ) , para formaldehyde , para nitrophenyl acetate , paraquat dichloride or methyl viologen , pca ( protocatechulic acid ) , pcna mouse monoclonal ab , p coumaric acid , pcr core kit , pcr kit , pcr purification kit , peg , penicillin / streptomycin / amphotericin b solution , pentacosane , pentobarbital ( anesthesia ) , peptone water , perchloric acid ( about 60% ) , petroleum ether , phenazine methosulphate=90% ( uv ) , phenol , phenol crystalline , phenol red , phenol:chloroform:isoamyl alcohol mixture , phenoldisulphonic acid , phenolpthalein indicator , phenylmethane sulphonyl fluoride ( pmsf ) , phosphate buffer ( ph 7.4 ) , phosphate buffer ph 7.0 , phosphate buffer saline , phosphate buffer, ph 8.0 , phospholipid kit , phosphoric acid , phosphotungstic acid hydrate , phusion polymerase , phytol , picric acid , piperine , plasmid dna miniprep purification kit , platinum direct pcr universal master mix , poly ( ethylene glycol ) ( mn 400 ) , poly vinyl alcohol , polyacrylamide , polyethyleneglycol , polypeptide 22 amino acid , polyvinylpolypyrrolidone ( pvpp ) , polyvinylpyrrolidone commercial ( pvp k 30 ) , ponceau 2r, certified / acid red 26 , ponceau s staining solution , potassium acetate , potassium bromide , potassium chloride , potassium citrate , potassium dichromate , potassium di hydrogen phosphate , potassium ferricyanide , potassium hexacyanoferrate ( k2fe ( cn6 ) ( rt ) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium oxalate , potassium permanganate , potassium persulphate , potassium persulphate ( potassium peroxodisulfate ) , potassium phosphate buffer ( 7.2 ) , potassium phosphate dibasic ( k2hpo4 ) , potassium phosphate monobasic anhydrous , potassium sulphate , potassium tungstate , potato dextrose agar , potato dextrose broth , pre stained molecular weight protein marker , primer 18 25 nucleiotide , propidium iodide , propionic acid , protease inhibitor , protease inhibitor cocktail , protein carbonyl content assay kit , protein estimation kit , protein extraction kit , protein marker , proteinase k solution ( 20 mg / ml ) , pthalic anhydrite , pvdf ( 0.45 pore size ) , pvdf hydrophilic membrane diameter: 47mm, pore size: 0.45 ?m, individuall , pyrene , pyridine , pyrithiamine hydrobromide , pyrogallol , pyrophosphate buffer , quechers kit , quercitin , rapamycin antibiotic strips , ras gap mouse monoclonal ab , rat anti cd11b ( clone m1 / 70 ) , apc , reduced glutathione , resazurin dye , resorcinol , restore western blot stripping buffer , riboflavin , rifampicin , rifamycin solution , ripa lysis and extraction buffer , rivastigmine , rna isolation kit , rna zap , rnase ( ribonuclease a from bovine pancreas ) , rnase a solution ( 20 mg / ml ) , rnase inhibitor , rpmi 1640 , rt pcr kit , rutin trihydrate , sabouraud dextrose agar , sabouraud dextrose broth , safranin , salicylic acid , saponin , saponin quillaja sp. , sds , secondary antibody , serotonin , sgot kit , sgpt kit , silica coloumn grade , silica gel , silica gel 60 120 mesh ( 125 250 mm ) , silicon dioxide , silver nanoparticles 10 nm , silver nitrate , silver nanoparticles powder type ii , silver sulphate , silver sulphate , silver nanoparticles, 10 nm , simmon citrate agar , sinapic acid , sperm processing media , skim milk powder , sm agar , sod assay kit , sodim octyl sulfphate , sodium acetate , sodium acetate buffer ( 5.0 ) , sodium alginate , sodium arsenate , sodium arsenate heptahydrate , sodium azide , sodium beta glycerophosphate , sodium bicarbonate , sodium bisulphate , sodium carbonate anhydrous , sodium chloride , sodium citrate ( anhydrous ) , sodium citrate tribasic dihydrate , sodium carbonate , sodium diethyl dithiocarbamate , sodium dihydrogen phosphate anhydrous , sodium fluride , sodium glycerophosphate , sodium hydrogen phosphate , sodium hydrogen sulphate , sodium hydroxide pellets , sodium hypochlorite solution , sodium lauryl sulphate , sodium meta bisulphate , sodium meta periodate , sodium metaperiodic acid , sodium nitrate , sodium nitrite ( nano2 ) , sodium nitro prusside dihydrate , sodium nitropruside , sodium octane sulphate , sodium perchlorate , sodium phosphate buffer , sodium phosphate buffer ( 7.2 ) , sodium phosphate dibasic ( dihydrate ) , sodium phosphate dibasic anhydrous , sodium phosphate monobasic , sodium phosphate monobasic anhydrous , sodium potassium tartarate , sodium potassium tartarate tetrahydrate , sodium pyruvate , sodium sulphate , sodium sulphite , sodium tartrate , sodium tetrahydridoborate , sodium thiosulphate , sodium tripolyphosphate ( tpp ) , sodium tungstate , soya lecithin ( 30% ) , sperm morphology test hitech solutions pack size 50 test kit 2 , spirit , ss agar ( salmonella shigella agar ) , standard laccase enzyme ( sigma laccase from rhus vernicifera or trametes versicolor ) , stannous chloride dihydrate , starch hydrolysed molecular grade ( potato starch pure ) , streptavidine horse radish peroxidase conjugate , streptomycin , streptomycin sulphate , streptozotocin , styrene oxide , succinate , succinate dehydrogenase assay kit , sucrose , sulfuric acid , sulfuric acid pure , sulphanilic acid, 0.8% , superoxide dismutase ( sod ) , sybr green dye , sybr green master mix , t4 dna ligase , tannic acid , taq dna polymerase , taqman fast advanced master mix, no ung , taqman fast advanced master mix, no ung , tartaric acid , tba ( 2 thiobarbituric acid ) , temed , terrific broth ( tb media ) , testosterone elisa kit , tetra decane , tetra ethyl ortho silicate , tetracontane 1, 40 diol , tetracycline , tetracycline hydrochloride , tetraethyl orthosilicate , tetrahydrofuran , tetraisopropylpyrophosphoramide , tetramethylethylenediamine ( temed ) , tetra n butylammonium decatungstate , tetrasodium pyrophosphate anhydrous ( tspp anhydrous ) , thiamine hydrochloride ( b1 ) , thiamine pyrophosphate , thiodiglycol solution , thiourea , thymoquinone , tin ( ii ) 2 ethylehexanoate ( stannous octoate ) , titan one tube rt pcr kit , tnf alpha polyclonal antibody , tofacitinib , toluene dried , toluene for hplc & uv spectroscopy, , tptz ( 2, 4, 6 tripyridyl s triazine ) 2, 4, 6 tris ( 2 pyridyl ) s triazine , trehalose , tri reagent , tri sodium citrate dihydrate , tributyrin , trichloro acetic acid ( tca ) , , trichloro silane , trichloroacetic acid , triethylamine , trigonelline hydrochloride ( analytical standard ) , triple sugar iron agar ( tsi ) , triple sugar iron agar suitable for microbiology, nutriselect plus , tris acetate salt , tris base , tris sds buffer ( ph 6.5 ) , tris borate , tris buffer, 1.0 m, ph 8.0, , tris buffer, 100 mm, ph 7.4 , tris hcl , tris hcl buffer , tris edta buffer solution , tris hcl , tritonx 100 , tritrack dna loading dye ( 6x ) , trizol reagent , trolox ( 6 hydroxy 2, 5, 7, 8 tetramethylchroman 2 carboxylic acid ) , trypan blue , trypsin 2x , trypton broth , tryptophan deaminase activity reagent , tunel assay kit , tween 20 , tween 80 , tyramine , urea , urea agar base ( christensen ) , urea agar , vancomycin , vancomycin antibiotic strips , vanillin , victoria blue b dye , victoria blue dye , vitamin e , water, pcr grade , x gal ( 5 bromo 4 chloro 3 indolyl ? d galactopyranoside , xantphos , xylan from beechwood , xylene , xylene cyanol ff , xylene rectified , yeast ( dry granules ) , yeast extract powder , zinc sulphate heptahydrate , ? ketoglutaric acid , ? mercapto ethanol , ? asarone , ? carotene , ? nicotinamide adenine dinucleotide disodium salt ( reduced ) ( ? nadh.na2, dpnh.na2 ) , ? tubulin ( f1 ) , mouse monoclonal , glassware items : , b.o.d. bottles ( 300ml ) , b.o.d. bottles ( 60ml ) , beaker ( 500ml ) , beaker ( 600ml ) , beaker 10ml , beaker 250ml , beaker 50ml , beaker 5ml , beaker 1000ml , beaker 100ml , beaker low formwith spout ( 1000ml ) , beaker low formwith spout ( 100ml ) , beaker low form with spout ( 250ml ) , beaker low formwith spout ( 500ml ) , beaker low formwith spout ( 50ml ) , blood collection vials ( pink ) , blood collection vials edta , blood collection vials plain , blood collection vials ( dark green ) , blood collection vials ( grey, sodiumfluoride ) , boiling tube ( 10ml ) , boiling tube ( 20ml ) , brown reagent bottles with lid 100 ml , brown reagent bottles with lid 1000ml , brown reagent bottles with lid 250 ml , brown reagent bottles with lid 500 ml , brown reagent bottles with lid 50ml , transparent reagent bottles with lid 100 ml , transparent reagent bottles with lid 1000ml , transparent reagent bottles with lid 250 ml , transparent reagent bottles with lid 500 ml , transparent reagent bottles with lid 50ml , burette stand with finger clamp , burettes 10 ml , burettes 100 ml , burettes 25 ml , burettes 50ml , burettes ( 1000ml ) , centrifuge tubes, sturdy tip 50ml , centrifuge tubes, sturdy tip 15ml , cod bottle , conical flask, transparent ( 1000ml ) , conical flask, transparent ( 100ml ) , conical flask, transparent ( 500ml ) , conical flask, transparent ( 250ml ) , conical flask, amber ( 250ml ) , conical flask with screw cap 1000 ml , conical flask with screw cap 250ml , conical flask with screw cap 500 ml , cover slips 22x22 , cover slips 22x50 , culture petri dish ( 80mm* 15mm ) , culture petri dish ( 50mm*12mm ) , culture petri dish ( 150mm* 20mm ) , culture tube with cap ( 10ml ) , culture tube with cap ( 30ml ) , culture tube with cap ( 5ml ) , cuvette ( glass ) 1 ml , cuvette ( glass ) 2ml , cuvette ( glass ) 3ml , cuvette ( glass ) 3.5ml , cuvette ( quartz ) 1 ml , cuvette ( quartz ) 2ml , cuvette ( quartz ) 3 ml , desiccator vacuum 200ml , desiccators ( glass ) , 300mmx344mm , desiccators ( amber ) , distillation unit , dropping bottles with dropper & rubber teat 60 ml , dropping bottles with dropper & rubber teat 30 ml , dropping bottles with dropper & rubber teat amber 60 ml , dropping bottles with dropper & rubber teat amber 30 ml , drying trays 404 x 257 x 61 , durham tube , erlenmeyerconical narrow mouth flask 100 ml , erlenmeyerconical narrow mouth flask 500 ml , erlenmeyerconical narrow mouth flask 250 ml , erlenmeyerconical wide mouth flask 1000 ml , erlenmeyerconical wide mouth flask 250 ml , erlenmeyerconical wide mouth flask 500 ml , erlenmeyerconical flask with screw cap 500 ml , erlenmeyerconical flask with screw cap 250 ml , erlenmeyer conical flask 100 ml , evaporating dish ( 1500ml ) , evaporating dish ( 165 ml ) , evaporating dish ( 3000ml ) , extraction apparatus ( soxhlet apparatus ) 250ml , flask ( cell culture t 25 ) , flask ( cell culture t 75 ) , conical flask 250ml , flask ( volumetric flask 50ml ) , flask ( volumetric flask 100ml ) , flask ( volumetric flask 200ml ) , flask ( volumetric flask 250ml ) , flask ( volumetric flask 500ml ) , flask ( volumetric flask 1000ml ) , flask ( volumetric flask 10ml ) , flask ( volumetric flask 25ml ) , flat bottom flask 100ml , flat bottom flask 250ml , flat bottom flask 500ml , flat bottom flask 50ml , gel staining dish , glass dropper 25cm , glass funnel25mm , glass funnel35mm , glass funnel 50mm , glass funnel 75mm , glass funnel100mm , funnel, powder, 60mm diameter , glass dropping funnel 250ml , glass filtration assembly , glass l shaped spreader , glass mortar and pestle , glass slides , glass soxhlet apparatus5000 ml , glass soxhlet apparatus3000 ml , glass soxhlet apparatus1000 ml , glass soxhlet apparatus500 ml , glass soxhlet apparatus250 ml , glass soxhlet apparatus200 ml , glass stirrer , glass vials borosil with cork ( 25 mm×100 mm ) , insect killing jars 500ml , low form beaker without spout50 ml , low form beaker without spout 100 ml , low form beaker without spout 1000 ml , low form beaker without spout 25 ml , low form beaker without spout 250 ml , low form beaker without spout 500 ml , measuring cylinder 25ml , measuring cylinder 5ml , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 500ml , measuring cylinder 50ml , measuring cylinder 1000ml , measuring cylinders with i / c stopper ( 10 ml ) , measuring cylinders with i / c stopper ( 100 ml ) , measuring cylinders with i / c stopper ( 25 ml ) , measuring cylinders with i / c stopper ( 250 ml ) , measuring cylinders with i / c stopper ( 50 ml ) , microscope glass slide 75x26x1 , microscopic glass slide ( double frosted ) , microscopic glass slide ( plain ) , mortar pestle 250ml , mortar pestle 500ml , mortar pestle agate , neubauer chamber , petri dish size 150x20mm , petri dish size 200x15 mm , petri dish size 80x17mm , petriplates 50 x 17mm , petriplates 150 x 20mm , petriplates 200 x 20mm , petriplates 80x 17mm , petriplates 100x 15mm , petriplates 53x 15mm , petriplates 83x 15mm , serological pipettes 1ml , serological pipettes 5ml , serological pipettes – 10 ml , serological pipettes – 15 ml , serological pipettes – 25 ml , pipettes volumetric ( 10 ml ) , pipettes volumetric ( 15 ml ) , pipettes volumetric ( 25 ml ) , plates with cavities ( 105 x 55 x 5mm ) , reagent bottle 100ml , reagent bottle 50ml , reagent bottle 1000 ml , reagent bottle 250 ml , reagent bottle 500 ml , round bottom flask 100ml , round bottom flask 250ml , round bottom flask500ml , round bottom flask 50ml , reagent bottle amber 500 ml , reagent bottle amber 1000 ml , separating funnel stand holder , separating funnel with glass stopcock, 50ml , separating funnel with glass stopcock, 100ml , microscopic slides with frosted double side , slide staining jars ( glass coplin ) , specimen tube ( glass ) size 50x15mm , specimen tube ( glass ) size 75x25mm , syringes 1 ml , test tube 25x200mm ( 70ml ) , test tube 15x150mm ( 15ml ) , test tube 16x150mm ( 20ml ) , test tube30ml , test tube ( 13 ml ) , test tube ( 20 ml ) , test tube ( 8 ml ) , test tube with rim 15 ml , test tube with screw cap ( 30 ml ) , test tubes without rim 25 ml , thermometer , thermometer with case , tooled necked bottle 250ml , tooled necked bottle 500ml , tooled necked bottle amber 250 ml , tooled necked bottle amber 500 ml , tube for culture collection, 16*75mm, 5ml , vials ( 10 ml, amber & clear ) , vials ( 10 ml, normal glass ) , vials injection ( 2.0 ml ) , watch glass 100 mm , watch glass 125 mm , watch glass 150 mm , watch glass 75 mm , lab accessories and plasticware , 5 ml facs tube , 96 well plates , absorbent paper / blotting paper , agarose gel casting tray , agate mortar and pestle set ( 500g ) , aluminium foil , aluminium seal ( 65mm ) , apron ( medium size ) , autoclavable bags 19”x24” , autoclavable bags 24”x36” , autoclavable bags 8”x12 , autoclavable disposable bags , autoclave tape , beaker tongs , biohazard bags , blood collection tubes 3ml , blotting sheets , blunt forceps 130mm , bottle top dispenser ( 1.0 10 ml ) , brushes ( think and thick both ) , burette clamps double , burette clamps single , burette stand , burette stand ( plastic ) , butter paper , carboy with stop cock ( 20 lit ) , cell culture dish 100x20 mm , cell culture dish 60x50mm , cell culture flask 25cm2 , cell strainer , centrifuge tube rack , centrifuge tubes 15ml , centrifuge tubes 50ml , centrifuge tubes 20ml , co2 anesthetizing pad , co2 cylinder 4 litres , co2 mice sacrifice chamber , conical bottom amber centrifuge tube , conical bottom tube , conical centrifuge tube rack 50ml , conical centrifuge tube rack for 15ml centrifuge tubes , coplin jar , cork no. 8 , corks no. 10 , corks no. 11 , corks no. 9 , cotton roll absorbent cotton , cotton roll non absorbent , cryo box ( 1.5 & 2.0 ml ) , cryo preservation vials , cryo tags , cryo tubes , cryogenic storage box , cryovial box , culture petri dish 150mm×20mm ( diameter*height ) , culture petri dish size : 50 x 12 mm ( diameter*height ) thickness : 1.2 mm , culture petri dish size 80mm×15mm ( diameter*height ) , curved forceps130mm , curved needle ( 130mm ) , curved needle ( 43mm ) , dialysis bag , disposable lab coatsmall , disposable lab coat large , disposable lab coat medium , disposable pipettes 1 ml , disposable pipettes 10 ml , disposable pipettes 5 ml , disposable steel surgical blade , syringe 20 ml , dissecting scissors 4.5 , dissecting scissors 5 , dissecting tray with wax 30x25x5 , dissection kit , draining tray , dropper , dropping bottle 120 ml , dropping bottle 60 ml , drosophila culture tubes , drosophila culture vials , drying rack ( 20 pegs ) , dust bin 12 lit. , edta blood collection tube 3 ml , electronic pipette controller , embryo collection cage , enamel bowl , enamel bowl 6.75 x 6.75 x 3.25 , enamel bowl 8.5 x 8.5 x 5 , enamel tray , enamel tray 30 x 35 , enamel tray 60 x 45 , falcon tubes ( 15ml ) , falcon tubes ( 50ml ) , filter paper , filter units 0.2 micron , flip cap centrifuge tube volume : 15ml , flip cap centrifuge tube volume : 50ml , floating microtube rack , forceps pointed forceps, pointed dissecting, 5”, , forceps pointed forceps, pointed dissecting, 6” , forceps ptfe blunt forceps, ptfe, blunt end, 4”, , funnel , glass / teflon potter homogenizers ( 15 ml capacity ) , gloves ( nitrile ) m ( 8 9 ) , gloves ( nitrile ) s ( 7 8 ) , gloves ( nitrile ) xs ( 6 7 ) , gloves nitrile ambi powder free s ( 6 7 ) 3 gm; , glovesnitrile ambi powder free s ( 6 7 ) 3 gm; , goggles & spectacles anti fog pk12 , hand pipette aid , hazardous waste bags ( red bags ) , hazardous waste bags ( yellow bags ) , ice bucket 4.5 l , ice cold pack , ice tray laboratory 500 ml , incubation tray , inoculating loop ( 10?lx 70mm ) , insulin syringe volume: 1.0 ml , l shaped spreader , lab retort stand 50cm lab retort stand holder laboratory flask condenser glassware support ring & clamp set , ldpe plastic wash bottles 500 ml , lens cleaning oil , lens cleaning paper , magnetic beads , magnetic stirrer bar : 6 x10 mm , magnetic stirrer bar 8× 14 mm , magnetic stirrer bar 8× 22mm , magnetic stirrer bar 9.5× 14 mm , magnetic stirrer rod , measuring cylinders ( plastic ) 100 ml , measuring cylinders ( plastic ) 1000 ml , measuring cylinders ( plastic ) 500 ml , medical syringe 5 ml , metal wire loop , mice restrainers , micro centrifuge tube –1.5ml , micro centrifuge tube ( 0.5 ml ) , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tubes2.7 ml , micro pestle , micro spoon and spatula weighing set , micro spoon and spatula weighing set 130mm , micro tip box ( 1000?l ) , micro tip box ( 100?l ) , micro tip box ( 10?l ) , micro tip box ( 200?l ) , micro tip box 250?l , micro tip box 500?l , micro tips ( 0.2?l 10?l ) , micro tips ( 200?l ) , micro tips ( 200?l 1000?l ) , micro tips 0.2 10 micro litre ( pcr ) , micro tube box ( 0.2 ml ) , fast optical 96 well reaction plate, 0.1 ml , optical 8 cap strips , micropestle , micropipette ( 0.2 2 ?l ) , micropipette ( 100 1000 ?l ) , micropipette ( 10 100 ?l ) , micropipette ( 1 10 ?l ) , micropipette 0.5 10?l , micropipette 0.5 2 micro litre ( pcr ) , micropipette 2 20 micro litre , micropipette stand with drawer , micropipettes stand for 12 micropipette , micropipettes stand for 5 micropipette, , micropipettes stand for 6 micropipette, , micropipettes stand for 3 micropipet , microwave gloves , mini cooler ( 20°c ) , mini cooler ( 0°c ) , mortar and pestle , multi dispenser pipettes 1 ml , multi dispenser pipettes 10 ml , multi dispenser pipettes 25 ml , multi dispenser pipettes 5ml , multiple purpose stand , muslin cloth , needles 18g*1 inch , needles 18g*1.5 inch , needles 21g*1.5 inch , needles 22g*1.5 inch , needles 16g*1.5 inch , needles 24g*1 inch , needles 26g*0.5 inch , nichrome loop , nichrome loop holder , one end flat and one end spoon spatula 6 inch , one end flat and one end spoon spatula 8 inch , oral gavage 304 grade, 1 inch. , oral gavage for mice , oral gavage for mice ( 16 size ) , oral gavage for mice ( 22 size ) , ordinary filter paper 46x56 , para film dispenser , para film roll m size , para film roll 125 lx4w , para film stand , pcr mini cooler , pcr tube 0.5 ml , pcr tube box , pcr tube tray , pcr tubes ( 0.2ml ) , pcr tubes ( 0.5ml ) , ph meter ( pen ) , ph strips , ph test strips ( paper ) 1 5 , ph test strips ( paper ) 4 5 , ph test strips ( paper ) 6 14 , ph test strips ( paper ) 7 9, 11 , pin vice 60mm , pin vice steel, approximately 90 mm, to hold insect pin with dia 0 0.40mm , pipette bulb up to 100 ml , pipette mate , pipette pumps 100 5000?l , pipette pumps 10ml , pipette pumps 25ml , pipette pumps 2ml , pipette stand for 12 pipettes ( horizontal ) , pipette suction gun , plastic boxes l × w × h 129 mm × 75 mm × 59 mm , plastic clear transparent box 100 ml , plastic clear transparent box 200ml, , plastic clear transparent box 50 ml, , plastic clear transparent box 500 ml , plastic clear transparent box 5kg , plastic clear transparent box 1kg , plastic clear transparent box 2kg , plastic conical flask 250 ml , pointed forceps 130mm 5 inch , pointed forceps 130mm 6 inch , pointed scissors 130mm 4.5 inch , polymethylpentene beaker 10 ml , polymethylpentene beaker 100 ml , polymethylpentene beaker 1000 ml , polymethylpentene beaker 250 ml , polymethylpentene beaker 50 ml , polymethylpentene beaker 500 ml , polypropylene cages for mice ( 290 x 220 x 140mm ) , polypropylene cages for rat ( 410 x 282 x 150mm ) , powder funnel 60mm , powder funnel 70mm , powder funnel 80mm , powder funnel 90mm , powder funnel 100mm , puncture proof container for disposing hazardous bag , rack for micro tube , real time pcr tubes , real time pcr tubes ( 0.2ml ) , round magnetic stirrer bar with pivot ring ( assorted ) , safety mask ply mask premium blend meltblown filter , safety maskn95 mask ( ffp2 ) with 6 layer filtration; , sample bags 12x17cm pocket:12x15x4 , sample bags size: 4”*6” , sample bags size: 6”*13” , sample bags size:9”*18” , sample bottle 10 ml , sample bottle 50 ml , sample container 60 ml , sample vials ( 3ml ) , scalpel 6 inch , scalpel 10 inch , scientific dissecting kit , sealing tape for 96 well plates , self standing centrifuge tube ( 50ml ) , serological pipettes 10 ml , serological pipettes 5 ml , shed net size 30x50 feet , six well cell culture plate , slide boxes , slide stands , spatulaointment spatula , spatula chattaway , spatula micro chattaway , spatula one end flat and one end spoon ( 8inch and 6 inch ) , spatula pointer spatula , spatula spoon , stainless steel stackable electro polished top grill for rat cage410 x 282 x 150mm , stand for centrifuge tubes , stand for drying tubes , sterilization syringe filter ( 0.2?m ) , straight needle 130mm , surgical blade , surgical gloves , surgical mask , surgical needles , synthetic polymer fibre thread , syringe , syringe 1ml tb , syringe 2ml , syringe 5ml , syringe filter 0.45?m , syringe filter 0.22?m , syringe filter ( 25mm ) , syringe filter ( 47mm ) , syringe filter blue colour , syringe filter red colour , syringe filter yellow colour , teasing needle bent , teasing needle straight , test tube holder stainless steel cross pattern small, , test tube holder large , test tube holder medium , test tube peg rack , test tube sponges , test tube stand 60 hole for 16mm tube , test tube stand 25x200mm test tube , test tube stands , tissue culture flask with filter cap sterile ( t 25 ) , tissue culture flask with filter cap sterile ( t 75 ) , tissue culture petri dish sterile ( 35mm ) , tissue culture pipette controller , tissue roll , tongs for beakers & flasks12 inches , tongs for beakers & flasks stainless steel, 10 inches , toothpick , trays , triangular tripod 210x150mm , tubes culture round bottom, reusable10ml , tubes culture round bottom, reusable20ml , tubes culture round bottom, reusable5ml , tubes rack , tubes, amber culture media, round bottom, reusable10ml , tubes, amber culture media, round bottom, reusable5ml , tubes, culture media, flat bottom10ml , tubes, culture media, flat bottom20ml , tubes, culture media, flat bottom5ml x50 , n66 nylon 6, 6 membrane ( 0.2?m filter ) 25mm , n66 nylon 6, 6 membrane ( 0.2?m filter ) 47mm , utility tray 360 x 310 x 130 , utility tray 540 x 435 x 130 , utility tray ( 320x260x70 ) , uv safety goggles , vertical pipette rack , wash bottle ( 150ml ) , wash bottle 250ml , wash bottle 500ml , waste bin medium , waste bin small , water bottle for rats and mice, 150 ml capacity , water drinking bottle for rat cages 250ml , wax dissection tray , whatman filter papers 46x56 , whatman filter paper no. 42 , whatmann filter paper 110mm , wide mouth bottle 30 ml , wide mouth bottle 60 ml , wire gauze ( w=12.5cm, l=12.5cm ) , zero size net...

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Sms Medical College - Rajasthan

33641597 rate contract for disposable and glassware and consumable and miscellaneous items ( nit 48 ) i. aluminium foil — 2. autoclavable borosil screw capped tubes 5ml 3. autoclavable borosil screw capped tubes1 omm 4. autoclavable petridish sample required 5. disposable gloves ( non sterile in pack of 25 to 50 pairs ) b a ) size 6.5 b ) size 7 c ) size 7.5 d ) size 8 6. centrifuge plastic test tubes with cap sterile 4, ’ 7. coplin jar with lid ( rectangular pvc ) 8. sterile disposable, polystyrene, optically clear, petridishes 9omm x15mm ( 4” ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment z aa £ 9. sterile disposable swab sticks individual ipacked size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expjry sample required to be supplied in installment_ 10. sterile disposable swab st1ck wth test tubes individually packed size ( 150 mmx 12mm ) , sterulized by gamma radlation with date of manufacture & exp1ry sample required 11. sample racks ( 96 slois / rack ) 12x75 mm tube 12. disposable stool sample coniainer with spatula 13. plastic discard container with lid and sieve 14. disposable autoclave bag a ) red 30l b ) yellow30l 15. transparentbag30l a ) red _15l b ) yellow.i5mlb 16. c ) transparent bag 15 l 17. disposable bag a. ) black 30l plastic basket ( jali ) autoclavable—small 18. a ) medium 7”x7”x7” b ) large 9”x9”x9” 19. 20. plastic pipe for water supply / 2 inch plastic trays i y2’ xi wx 6” 21. i plastic trays for reagent bottles 22. plastic dropper a ) b ) big 23. tissue paper rolls 100 meter 24. tie 8” long for lying plastic bags — 25. syringe needle sterile disposable . _... a ) 10ml b ) 2nml — c ) 5ml 26. disposable test tube with screw cap and label, individually packed, sterilized by gamma radiation with date of manufacture & expiry _.... sample require! ) a ) 1onmlr _ b ) 5ml — 27. steriledisposa [ 3le container wide mouth individually packed supplied in installment ( for sputum, urine ) without spoon 30 ml self standmng, sterilized by gamma radiation — 28. test tube stand 29. microtitre polystyrene plate of 96 round bottom wells with lid, individually packed sterilized by gamma radiation with date of manufacture & expiry sample required 30. nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plast1c shaft with breakable point about .._. i5cmnlong !—m 31. plain vial for blood collection 5ml — 32.. microcentrifuge tube ( 1.8 ml molecular biology grade ) 33. tooth pick...

Medical College - Rajasthan

33634349 rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department , a. disposable items , aluminium foil , autoclavable borosil screw capped tubes 5ml , autoclavable borosil screw capped tubes 10ml , autoclavable petridish sample required , disposable gloves ( non sterile in pack of 25 to 50 pairs ) , a ) size 6.5 , b ) size 7 , c ) size 7.5 , d ) size 8 , centrifuge plastic test tubes with cap sterile4” , coplin jar with lid ( rectangular pvc ) , sterile disposable, polystyrene, optically clear, petridishes 90mm x15mm ( 4 ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab sticks individual packed size ( 150 mmx 12mm ) , sterilized by gamma radiationwith date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab stick wth test tubes individually packed size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expiry sample required , sample racks ( 96 slots / rack ) 12x75 mm tube , disposable stool sample container with spatula , plastic discard container with lid and sieve , disposable autoclave bag , a ) red30 l , b ) yellow 30 l , transparent bag 30l , a ) red15 l , b ) yellow 15 l , c ) transparent bag 15 l , disposable bag , a. ) black 30l , plastic basket ( jali ) autoclavable—small , a ) medium 7”x7”x7” , b ) large 9”x9”x9” , plastic pipe for water supply ½ inch , plastic trays 1 ½’ x1 ½’x 6” , plastic trays for reagent bottles , plastic dropper , a ) small , b ) big , tissue paper rolls 100 meter , tie 8” long for lying plastic bags , syringe needle sterile disposable , a ) 10 ml , b ) 2 ml , c ) 5 ml , disposable test tube with screw cap and label, individually packed , sterilized by gamma radiationwith date of manufacture & expiry sample required , a ) 10 ml , b ) 5 ml , steriledisposable container wide mouth individually packedsupplied in installment ( for sputum, urine ) without spoon 30 ml self standing, sterilized by gamma radiation , test tube stand , a ) 6” , b ) 4” , microtitre polystyrene plate of 96 round bottom wells with lid , individually packedsterilized by gamma radiationwith date of manufacture & expiry sample required , nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plastic shaft with breakable point about 15 cm long , plain vial for blood collection 5ml , microcentrifuge tube ( 1.8 ml molecular biology grade ) , tooth pick , b. glassware items , borosilicate glass cover slips, size 22x22mm no.0 10gms x 26100pkt , durhams tube ( 2cm ) , dark brown reagent dropping bottle with glass deopper and rubber treat 125ml borosil , dark brown reagent bottle with screwcap 250ml , dark brown reagent bottle with screwcap 1 liter , flask conical flat bottom ( long neck ) with graduation ( borosilicate ) , a ) 5000ml , b ) 2000ml , c ) 3000ml , d ) 1000ml , e ) 500 ml , f ) 250 ml , g ) 100ml , cell culture flasks ( 25 ml ) , ( treated, sterile, vented ) with filter cap 25cm , glass funnel8” , glass funnel 3” , glass rods , glass sheet , glass slides , thermometer digital with probe ( 0 100° c ) , ( 0 200° c ) , ( 20° to 10° ) , ( 80° ) , glass beakerborosilicate , a ) 500 ml , b ) 250 ml , reagent storage bottle borosilicate , a ) 2 ltr , b ) 1 ltr. , c ) 500ml , blue cap glass bottles autoclavable borosilicate , a. ) 1000ml , b. ) 500 ml , c. ) 250 ml , d. ) 100 ml , test tube glass round bottom without rim borosilicate , a ) 18x150mm , b ) 15x125mm , c ) 12x100mm , d ) 12x75mm , e ) 150x15mm , test tube glass 10 ml screw capped , glass measuring cylinder borosilicate , a ) 500ml , b ) 1000 ml , c ) 250 ml , d ) 100 ml , e ) 50 ml , glass beads , glass beads , borosilicate screw cap glass bottle , borosilicate screw cap glass bottle , glass petridish 90mm borosilicate , c. consumable items , micropipette tips with filter , a. ) 10?l ( 96×10 ) , b. ) 20 ?l ( 96×10 ) , c. ) 100 ?l ( 96×10 ) , d. ) 200 ?l ( 96×10 ) , e. ) 300 ?l ( 96×10 ) , f. ) 1000 ?l ( 96×10 ) , disposablemicropipette tips without filter 100 ?l , sterile micropipette tips without filter 10 ?l , bar code stickers fot bactrology , eppendorf tubes 0.6 ml , eppendorf tubes 1.5 ml , eppendorf tubes 2 ml , 0.2 ml 8 pcr tube strips with cap , n 95 mask niosh certified , surgical triple layer mask , bamboo stick , wipes , ppe kit , gown , a. ) small , b. ) medium , c. ) large , d. ) xl , disposable gowns back open blue , disposable gowns back open white , disposable plastic lab coat ( m ) , disposable plastic lab coat ( l ) , disposable plastic lab coat ( xl ) , plastic disposable forceps , forceps ss 5 inch. , gloves nitrile powder free small , gloves medium nitrile powder free 6.5 size , gloves large nitrile powder free 7 size , shoe cover knee length , head cap , indicator tapesteam autoclavable , b. stearothermophilus ( no. of spores per strip 10 6 ) for steam sterilization at 1150c indicator tape ( autoclave ) , b. atrophaeus ( no.of spores indicator tape ( hot air oven ) , sanitizer ( 500ml ) with dispenser , falcon tube 50ml sterile , falcon tube 15mlsterile , screw capped cryo vial 1.5ml , screw capped cryo vial 2ml , screw capped cryo vial 1.8ml , screw cap storage vials 1.8ml , screw cap plain tube ( 12x75 mm ) , plain tube ( riya tube ) for sample dilution , plain sample collection tube 5ml double cap with clot activator , edta tube 5ml double cap , assay cups , assay tips , assay samplecups , gauze than , vaccutainerclot / edta / flouride / citrate / heparin , vaccutainer needle , parasep solvent free faecal parasitic concentrator , vtm with two swabs , zip lockbags size 8x4 , barcode sticker for hbv & hcv viral load and bacteriology , wash reagent , spray bottles , manualmicropipette variable volume autoclavable , a. ) 1 10 ?l , b. ) 0.5 10 ?l single channel , c. ) 10 100 ?l single channel , d. ) 5 50 ?l single channel , e. ) 50 200 2 200 ?l single channel , f. ) 100 1000 ?l single channel , g. ) 2 20 ?l multi channel 8 channel , h. ) 10 100 ?l multi channel 8 channel , discarding jars , abi real time pcr fastrctn tubes ( 8 tubes / strips ) each 0.1 ml , abi real time pcrfast rctn tubes ( 8 tubes / strips ) each 0.2 ml , abi fg optical caps for rtpcr ( 8 caps / strips ) each , pcr rack with cover , plastic racks ( 24 tubes racks ) , plastic racks ( 48 tubes racks ) , tough tags for ampoules 1.5 ml , cell culture plates ( 6 well ) ( tissue culture treated, sterile ) , abi sequencing plates ( 10 plates / pk ) , , abi adhesive covers for pcr plate ( 100 pcs ) , , ppe ( jump suits ) , serological pipette 5ml ( filter, sterile ) , u bottom microtitter plates , coolbox , pippette stands , mini coooler 20° for 1.5 ml tube ( 12 place ) , mini coooler 20° for 1.5 ml tube ( 48 place ) 32place , d. miscellaneous items , cotton roll 500 gms , cryovials racks , cryovial boxes , cryovial labels , gas burner, labortary vertical withcontrol knob , match box , washing brush for cleaning test tube , a ) 4 , b ) 6 , c ) 8 , regulator for gas , dustbin with lid and foot operated , a ) black colour , b ) blue colour , c. ) red colour , d. ) yellow colour , e. ) green colour , gas lighter , teasing needle , surgical blades no 22 sterile packed , scalpel & blade , thread rolls , flit pump , waste paper basket , nichrome wire 18 gauge , nichrome wire 21 gauge , aluminium tray with partition 12x18x4inch , jute thread for tying bundle , nichrome wire loop diameter 1.3 mm, double wound, caliberated to 1 ul ( .001 ml ) ( pack of 10 loop each ) , wire loop holder , readymade assorted loops 5 pack x 10 loops each , dustbin with perforated basket inside with lid ( 2 liter ) , dustbin with perforated basket inside with lid ( 15 liter ) , antibioticc zone measuring scale370x65 mm , spirit lamp cotton wick , spirit lamps , spotting sheet ( white paper ) , thermometer 0 to 1000c ( digital ) , thermometer 0 to 2000c ( digital ) , thermometer 200 c to 100 c ( digital ) , thermometer 800 c to 100 c ( digital ) , plastic slide box 4”x12” , slide tray ( metal ) , syringe filter 33 mm , syringe filter 10 ( 25mm diameter ) himedia 0.2mm filter for cell culture , falcon racks 50ml , falcon racks 15ml , parafilm roll...

Jawaharlal Nehru Medical College - Rajasthan

33551774 supply of micro lab items kits chemical reagent glassware 1 microbiology lab reagents / kits / chemical / glassware / polyware etc items year 2022 24 2 10% lactic acid solution 3 aerosol free tips 10 μl 4 aerosol free tips 20 μl 5 aerosol free tips 100 μl 6 aerosol free tips 200 μl 7 aerosol free tips 1000 μl ( 1x96 ) 8 agar agar media 9 agininine 10 albert stain a 125ml 11 albert stain b 125 ml 12 albert’s metachromatic stains kit 125 ml 13 alkaline peptone 14 aluminium foil 15 amikacin dose 30mcg 16 amino acid disc 17 amoxyclav 20 / 10mcg 18 ampicillin 10mcg 19 ampicillin / sulbactam 10 / 10mcg 20 ascospore agar 500 gm 21 autoclavable specimen bag ( yellow and red color beg ) 22x30 22 aztreonam 30mcg 23 azithromycin 15mcg 24 bacitracin 10 units 25 bhi supplemented w / 0.05% sps 20ml 26 bhi supplemented w / 0.05% sps 70ml 27 bile esculin hivegtm agar base / 100 gm / 500gm 28 bird seed agar 100 gm 29 bromocresol purple blue 500 gm 30 buffered glucose hivegtm broth 500gm 31 buffer hiveg tm peptone water 32 carbenicillin 100mcg 33 carbogen rpr 34 cefepime 30mcg 35 cefixime 10mcg 36 cefoperazone 75mcg 37 cefoperazone / sulbactam 75 / 10mcg 38 cefotaxime 30mcg 39 cefoxitin 30mcg. 40 cefoxitin cloxacillin 30 / 200 mcg. 41 ceftazidime 30 mcg 42 ceftazidime / clavulanic acid 30 / 10 mcg 43 ceftriaxone 30 mcg 44 cefuroxime 30 mcg 45 cephalothin 30mcg 46 chloramphenicol 30mcg 47 chocolate agar plate 1x50 48 ciprofloxacin 30mcg. 49 cled agar powder 50 cled agar w / browothymol blue plate 1x50 51 clindamycin 2mcg 52 colistin sulphate10mcg 53 cooked meat medium 54 corn meal agar 500gm 55 co trimoxazole 25mcg. 56 cryotubes ( 1.8 ml ) 57 cysteine tellurite agar base 500 gm 58 czapexdox agar ( granulated ) 500gm 59 dengue ns1 ( elisa ) 1x96 60 dengue igm ( elisa ) 1x96 61 deoxycholate citrate agar, hivegtm 500gm 62 dermato supplement 5vl 63 dermatophyte test media 500gm 64 dimethyl amino benzaldehyde anhydrous 100gm 65 dises for carbohydrate fermentation test dises 66 disposable loops carbohydrate 5x100 67 disposable wire 5x100 68 doxycycline hydrochloride 30mcg 69 erythromycin 15mcg 70 ethanol 500ml 71 filter paper rim 46 x 57 cm 72 ferric chloride 1x500 gm 73 fluconazole 25mcg. 74 gentamicin 10mcg 75 gentamicin disc 120 mcg. 76 grams stain kit 100 ml 77 hand sanitizer 500 ml ( pump / spray ) 78 haemoglobin powder 50 gm, 79 h2 o2 ( hydrogen peroxide ( 3% ) 500 ml ) 80 hbsag hbs ag 81 hcv tridot 1x100 82 hiv combaids rs advantage 1x96 83 hiv tridot 84 hi culture transport swab w / amies medium w / charcoal 85 hi mrsa tm confirmation agar base 500 gm 86 hydrochloric acid 87 imipenem 10 mcg 88 imipenem etda 10 / 750mcg 89 iodine resembled 500 gm 90 iso amyl alcohol 91 isopropyl alcohol 500 ml 92 lysine 100 gm 93 maccartney bottle screw tight 30 ml 94 macconkey agar 500 gm 95 malachite green powder 500 gm 96 malt extract agar base 500 gm 97 mannitol salt hiveg tm agar base 100 / 500gm 98 mc farland standard set 10 ml 99 medium 10 wilson and blairs bbs agar 100 meropenem 10mcg 101 methanol 500ml 102 microcentrifuge tube ( 1.5 ml ) 103 microscopic cover glass 22x50mm 10gm no. 01 104 micro cover glass square 20mm x 20 mm 105 micro slide 75 mm x 25mm ( 1x50 ) 106 micropipette variable volume range 100 1000ul 107 micropipette variable volume range 5 50ul 108 molecular grade ethanol 109 mr vp hiveg tm medium 2x100 110 nitrate discs 111 iso propyl alcohol 112 screw cap vial 2 ml 113 microcentrifuge tubes 1.5 ml 114 glass slide 115 spirit 500ml 116 pcr plates compatable to biorad cfx96 with sealing film 1x50 117 8 well strips 0.1 mlwith caps 1x120 118 tissue paper rolls 119 kiwipes lint free tissue paper 120 pipette variable volume 0.5 10μl 121 pipette variable volume 1 20μl 122 pipette variable volume 10 100μl 123 pipette variable volume 100 1000μl 124 multi channel pipette 8 channel 5μl 50μl 125 multi channel pipette 8 channel 30 μl 300μl 126 multi channel pipette 8 channel 100μl 1250μl 127 reagent trough v shape for multi channel pipette 128 viral transport media with swab 129 rt pcr kit swine flu ( h1n1 ) 130 reagent trough v shape for multi channel 100 131 moeller decor boxy lase hiveg broth base 132 mueller hinton hivegtm agar no. 2 500gm 133 nafcillin 30mcg 134 nutrient agar 500gm 135 nutrient broth 500 gm 136 nutrient hivegtm agar no. 02 500gm 137 of basal media 138 onpg 150 mcg 139 optochin ( 5mcg ) 140 ornithine 141 oxacillin 1mcg 142 oxacillin sodium salt monohydrate 5gm 143 parafilm m250 144 penicillin g 10 units disc 145 phenylanine agar 100gm 146 phenol red base 147 piperacillin / tazobactam30 / 6mcg 148 pipette tips, yellow 250 ml 149 plain vials 100 pc 150 polymyxin –b 100 unit 151 potassium hydroxide pallets 152 potassium dichromate 15x500 gm 500gm 153 potassium tillurite 1% ( 1ml / v ) 25 vials 5 / 25 ml 154 potassium dihydrogen phosphate anhydrous 155 potato dextrose agar 500 gm 156 polyester wipes 1x50 157 rhelax aslo 1x100 158 rhelax crp 1x100 159 rhelax rf 1x100 160 roberston cooked meat media 500gm 161 sabouraud dextrose agar 500 gm 162 sabouraud dextrose agar with chloramphenicol 500gm 163 sabouraud dextrose agar with chloramphenicol & cyclohexamide 100gm 164 sabouraud dextrose broth 500 gm 165 screw cap tubes with ‘o’ ring 166 scrub typhus igm ( elisa ) 1x96 167 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 168 selenite f broth ( t ) 169 sheep blood agar plate 1x50 170 spirit lamp 171 simmons critrate agar 100gm 172 sodium hypochlorite 4% 5lts. 173 sodium hypochlorite 5% 5lts. 174 sterile disposable petri plates 120 mm 175 sterile disposable petri plates 90 mm 176 sterile micro tube 2 ml with looped screw 177 sterile screw cap 10 ml 178 straight wire 179 syringe driven filter mse 180 stool o / b 181 sulphuric acid conc 500 ml 182 swab applicator in tube, plastic ( sterilized ) 5 or 6 individual pack 183 swab applicator plastic ( sterilized ) 6 individual pack 184 tcbs hiveg tm agar ( selective ) 500 gm 185 teicoplanin 30mcg 186 thermo rolls pack 187 tigecycline 15ml g 188 tissue paper rolls 189 tobramycine 10 ml g 190 triple sugar iron hivegtm agar 100gm 191 upt ( device / card ) test 1x100 192 urea hiveg tm agar 100 gm 193 urine / stool sample collection container made with nontoxic polypropylene. cap. 35ml. with screw cap. air tight 194 vancomycin 30mcg 195 vitamino growth supplements 5 vials 196 voriconazole vrc 25 ugm mlg 1x100 197 widal slide / tube 1x100 198 96 well microplate 1x50 199 96 well microplate certified to contain 0.005 eu / ml 1x100 200 xld hiveg tm agar 500 gm 201 xylene sulphur free 250 ml 202 zn stain solution 100 ml / 500 ml 203 platelia aspergillus ag ( bio rad ) 204 fungitell1, 3 beta d glucan ( fungitell kit ) 205 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

District Hospital - Rajasthan

33545252 supply of kits, chemical, reagents, glassware items 1 m1 10% lactic acid solution 2 m2 aerosol free tips 10 pl 3 m3 aerosol free tips 20 pl 4 m4 aerosol free tips 100 pl 5 ms aerosol free tips 200 pl 6 m6 aerosol free tips 1000 pl ( 1x96 ) 7 m7 agar agar media 8 m8. agininine albert stain a 125m1 9 m9 10 m10 albert stain 8 125 ml 11 m11 alberts metachromatic stains kit 12s ml 12 mu alkaline peptone 13 m13 aluminium foil 14 m14 amikacin dose 30mcg 15 m15 amino acid disc 16 m16 amoxyclav 20 / 10mcg 17 m17 ampicillin 10mcg 18 m18 ampicillin / sulbactam 10 / 10mcg 19 m19 ascospore agar soo gm 20 m20 autoclavable specimen bag ( yellow and red color bag; 22x30* 21 m21 aztreonam 30mcg 22 m22 azithromycln 15mcg 23 m23 bacitracin 10 units 24 m24 bill supplemented w / 0.05% sps 20m1 25 m25 bill supplemented w / 0.05% sps 70m1 26 m26 bile esculin hivegtm agar base / 100 gm / 500gm 27 m27 bird seed agar 100 gm 28 m28 bromocreso! purple blue soo gm 29 m29 buffered glucose hivegtm broth 500gm 30 m30 buffer hiveg tm peptone water 31 m31 ca rbenicillin 100mcg 32 m32 ca rbogen rpr 33 m33 cefepime 30mcg 34 m34 cefixime l0mcg 35 m35 cefoperazone 75mcg 36 m36 cefoperazone / sulbactam 75 / 10mcg 37 m37 ccfotaxime 30mcg 38 m38 cefoxitin 3omcg. 39 m39 cefoxitin cloxacillin 30 / 200 mcg. 40 m40 ceftazidime 30 mcg 41 m41 ceftazidime / clavulanic acid 30 / 10 mcg 42 ceftriaxone 30 mcg v. i. , 43 m43 cefuroxime 30 mcg 44 m44 ce halothm 30mc 45 m45 chloramphenicol 30mcg 46 m46 chocolate agar plate 1x50 47 m47 ciprofloxacin 30mcg 48 ma cled agar powder 49 m49 cled agar w / browothymol blue plate imo 50 m50 clindamycin 2mcg 51 m51 colistin sulphatelomcg 52 m52 cooked meat medium 53 m53 corn meal agar 500gm 54 m54 co trimoxazole 25mcg. 55 m55 cryotubes ( l8 ml ) 56 m56 cysceine tellurite agar base 500 gm 57 m57 czapexdox agar ( granulated ) 500gni 58 m58 dengue ns1 ( elisa ) 1x96 59 m59 dengue igm ( ehsa ) 1x96 60 m60 deoxycholate citrate agar, ilivegtm 500gm 61 m61 dermato supplement svl 62 m62 dermatophyte test media 500gm 63 m63 dimethyl amino benzaldehyde anhydrous 100gm 64 m64 dises for carbohydrate fermentation test dises 65 m65 disposable loops carbohydrate 5x100 66 m66 disposable wire 5x100 67 m67 doxycycline hydrochloride 30mcg 68 m68 erythromycin 15incit 69 m69 ethanol 500m1 70 m70 filter paper rim 46 x 57 cm 71 m71 ferric chloride lx500 gm 72 m72 fluconazole 25mcg. 73 m73 gentamicin 10mcg 74 m74 gentamicin disc 120 mcg. 75 m75 grams stain kr 100 ml 76 m76 hand sanitizer 500 ml ( pump / spray ) 77 m77 haemoglobin powder 50 gin, 78 m78 h2 02 ( hydrogen peroxide ( 3% ) 500 ml ) 79 m79 hbsag hbs ag 80 m80 hcv tridot 1x100 81 m81 hiv combalds rs advantage 1x96 82 m82 hiv tridot 83 m83 hi culture transport swab w / amies medium w / charcoal 84 m84 hi mrsa tm confirmation agar base 500 gm 85 m85 hydrochloric acid 86 m86 lmipenem 10 mcg 87 m87 imipenem vida 10 / 750mcg 88 m88 iodine resembled 500 gm 89 m89 iso amyl alcohol 90 m90 isopropyl alcohol soo ml 91 m91 lysine 100 gm a_ 92 m92 maccartney bottle screw tight 30 ml 93 m93 mact:onkey agar sod gm 94 m94 malachite green powder 500 gm 95 m95 malt extract agar base 500 gm 96 m96 mannitol salt hiveg tm agar base 100 / 500gm 97 m97 mc farland standard set 10 ml 98 m98 medium 10 wilson and b ] alrs bbs agar 99 m99 meropenem lonicg 100 m100 methanol 500m1 101 m101 microcentrifuge tube ( 1.5 ml ) 102 m102 microscopic cover glass 22x5omm 10gm no. 01 103 m103 micro cover glass square 20mm x 20 mm 104 m104 micro slide 75 mm x 25mni ( i x50 ) 105 m105 micropipette variable volume range 100 1000u1 106 m106 micropipette variable volume range 5 50u1 107 m107 molecular grade ethanol 108 m108 mr vp hiveg tm medium 2x100 109 m109 nitrate discs 110 m110 !so propyl alcohol 111 m111 screw cap vial 2 ml 112 m112 microcentrifuge tubes 1s ml, 113 m113 glass slide 114 m114 spirit 500m1 115 m115 pcr plates compatable to blorad cfx96 with sealing bin 1x50 116 m116 8 well strips 0.1 ml with caps 1x120 117 m217 tissue paper rolls 118 m118 kiwipes lint free tissue paper 119 m119 pipette variable volume 0.5 104 120 m120 pipette variable volume 1 204 121 m121 pipette variable volume 10 1000, 122 m122 pipette variable volume 100.10004 multi channel pipette 8 channel 54 5011 123 m123 124 m124 multi channel pipette 8 channel 30 4 300pl 125 m125 multi channel pipette 8 channel 100pl 12504 126 m126 reagent trough v shape for multi channel pipette 127 m127 viral transport media with swab 12.8 m128 rt pcr kit swine flu ( 111n1 ) 129 m129 reagent trough v shape for multi channel 100 130 m130 moeller decor boxy lase hiveg broth base 131 m131 mueller hinton ilivegtm agar no. 2 500gm 132 m132 nafcillin 30mcg 133 m133 nutrient agar 500gm 134 m134 nutrient broth 500 gm 135 m135 nutrient ilivegtm agar no.02 500gm 136 m136 of basal media 137 m137 onpg 150 mcg 138 m138 optochin ( 5mcg ) 139 m139 ornithine 140 m140 oxacillin lmcg 141 m241 oxacillin sodium salt monohydrate 5gm 142 m142 parafilm m250 143 m143 penicillin 0 10 units disc 144 m144 phenylanine agar 100gm phenol red base 145 m145 146 m146 piperacillin / tazobactam30 / 6mcg 147 m147 pipette tips, yellow 250 ml 148 m148 plain vials 100 pc 149 m149 polymyxin 13100 unit 150 m150 potassium hydroxide pallets 151 m151 potassium dichromate 15x500 gm 500gm 152 m152 potassium tillurite 1% ( 1mi / v ) 25 vials 5 / 25 ml 153 m1.53 potassium dihydropen phosphate anhydrous 154 m154 potato dextrose agar 500 gm 155 1 m155 polyester wipes lx50 156 m156 rhelax a51.0 lx1 00 157 m157 rhelax crp lx100 158 m158 rhelax rf lx100 159 m159 roberston cooked meat media 500gm 160 m160 sabouraud dextrose agar 500 gm 161 m161 sabouraud dextrose agar with chloramphenico! 500gm 162 m162 sabouraud dextrose agar with chloramphenicoi 84. cyclohexamide 100gm 163 m163 sabouraud dextrose broth 500 gm 164 m164 screw cap tubes with 0 ring 165 m165 scrub typhus 1gm ( elisa ) 1x96 166 m166 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 167 m167 selenite f broth ( t ) 168 m168 sheep blood agar plate lx50 169 m169 spirit lamp 170 m170 simmons critrate agar 100gm 171 m171 sodium hypochlorite 4% slts. 172 m177 sodium hypochlorite 5% 5lts. 173 m173 sterile disposable petri plates 120 mm 174 m174 sterile disposable petri plates 90 mm 175 m175 sterile micro tube 2 ml with looped screw 176 m176 sterile screw cap 10 ml 177 m177 straight wire 178 m178 syringe driven filter mse 179 m179 stool 0 / 13 180 m180 sulphuric acid conc 500 ml 181 m181 swab applicator in tube. plastic ( sterilized ) 5 or 6 individual pack 182 m182 swab applicator plastic ( sterilized ) 6 individual pack 183 m183 tcbs hiveg tm agar ( selective ) 500 gm 184 m184 teicoplan in 30mcg thernto roll pack 185 m185 186 m186 tigecycline 15ml g 187 m187 tissue paper rolls 188 _ m188 tobramycine 10 ml g , 189 m189 triple sugar iron hivegtm agar 100gm 190 m190 upt ( device / card ) test lx100 191 m191 urea hiveg tm agar 100 gm 192 m192 urine / stool sample collection container made with nontoxic polypropylene. cap. 35m1. with screw cap. air tight 193 194 m193 va neomycin 30mcg m194 vitamino growth supplements 5 vials 195 m195 voriconazole vrc 25 ugm mig 1x100 widal slide / tube lx100 196 m196 197 1 m197 96 well microplate 1x50 198 m198 m199 96 well microplate certified to contain 0.005 eu / ml 1x100 199 xld hiveg tm agar 500 gm 200 m200 xylene sulphur free 250 ml 201 m201 zn stain solution 100 ml / 500 ml 202 m202 platelia aspergillus ag ( bio kad ) 203 n1203 fungite111, 3 beta u glucan ( fungitell kit ) 204 m204 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

Department Of Medical Education - Rajasthan

33432025 supply of general items for tb / vrdl / rt pcr lab 1 absorbent paper roll 2 absorbent paper sheet 3 aluminum foil 4 autoclavable pp plastic racks for 96 places 5 bags, biohazard, ( transparent autoclavable ) 6 cetylpyridinium chloride ( cpc ) for biochemistry mw 358.0 1>98% 7 cold chain box ( 12 lit. ) , 8 cotton roll 9 diamond pencil 1o di sodium hydrogen phosphate 11 disposable head caps disposable lab gownspp ( large and 12 medium ) 13 disposable shoe cover disposable syringes 5 ml ( 22 & 24 14 gauge ) 15 dnase / rnase surface decontaminant 16 dropper bottle droppers, sterile, plastic 1 .5 ml, 17 graduated droppers, sterile, plastic 3.0 ml, 18 graduated, disposable 19 edta 20 ethunol 95% 21 filter paper 22 fluorescent staining kit for afb 23 formaldehyde 24 glass funnel 25 gloves nitrile, size s m l 2s gloves. latex size s m’ l 27 glycerol, 28 hydrochloric acid, fuming ( 37% ) 29 hydrogenperoxyde 30% 30 immersion oil laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for 31 pcr lab 32 laboratory thermometer 33 l asparagine 34 lint free soft tissue liquid dispensing wash bottle 35 plastic ( 500ml ) 36 u medium base powder ready mix 37 loop, disposable 10 i1 38 loopholder 39 loopholder rack 4o magnesium sulphate 41 malachite green 42 mask ( disposable surgical ) 43 mccartney bottle 15 ml 44 mccartney bottle 7 ml 45 mc farland standard set micro pipette stand pipette stands 46 for5pipettes , micropipette tips nuclease & pyrogen free & aerosol barrier ( 0.1 20iil ) maximum recovery / minimum retention 47 filtered, racked, sterile micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery / minimum retention filtered, raqked, sterile 48 ( i00 l000jil ) , micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery / minimum retention filtered, racked, sterle ( 49 2 200 ji l ) molecular grade ethanol 50 molecular grade isopropanol 51 52 n95 respirators ( niosh approved ) 53 na acetate n acetyl l cysteine ( nalc ) 54 powder 55 naphthyl ethylendiamine 56 needle destroyer 57 niacin strips 58 nichrome wire 59 nicotinamide 60 paraflim 61 pcr tubes flat snap cap 0.2 ml 62 pcr tubes strip wiih flat cap optical for rt pcr 0.2 ml 63 phenol, 64 plastic racks ( 15 ml tubes ) plastic racks for 15 ml conical 65 falcon tubes plastic racks for 2 ml mct, 66 autoclavable. plastic racks for 50 ml conical 67 falcon tubes plastic storage box for 0.2 ml pcr 68 tubes with lid plastic storage box with lid for 2 ml 69 cryovials i ox 10 7o potassium dihydrogen phosphate 71 potussium permanganate 72 sample collection container sterile 73 cryovials screw cap ( hinged ) mct tapered 74 ( 1.5ml ) 75 slide drying racks snap cap ( hinged ) mct tapered 76 ( 1.5 ml ) snap cap ( hinged ) mct round 77 bottom ( 2 ml ) 78 sodium chloride, naci 79 sodium hydroxide, naoh, 80 sodium hypochlorite solution 81 sodium nitrate 82 spnay botties spnaylde 500 ml 83 spray bottles plastic pp 250 ml 84 sputum container 85 staining bottle 86 staining rack 87 sterile blue tips bulk ( l000iil ) 88 sterile tips bulk ( l0ll ) , 89 sterile yellow tips bulk ( 10011l ) 90 sulfuric acid, concentrated 91 sulphanilamide 92 test tube rack pp for vtm tubes 93 tissue roll 94 torn iguet 95 tr maynesium di eitrgteu 96 tube, centrifuge, 15 ml with screw cap 97 tube, centrifuge, 50 ml with screw cap 98 tubes cryovial, sterile with screwcap. 2 ml 99 tubes reaction. 2 ml 100 universal bottle for cultures. 28 ml 101 water molecular biology grade 102 xylene 103 zinc powder 104 zn acid fast staining kit 105 autoclavable pp cryoboxes suitable for storage at 80 c 10 xi0 samples for2rnlcryovials, autoclavablepp racks for 1.5 ml 106 mct 48 samples ( 24 pieces ) ....

Jhalawar Medical College and SRG Hospital - Rajasthan

33421913 rate contract supply of general items for tb / vrdl / rt pcr labs at medical college and hospital jhalawar , microbiology dept. , absorbent paper roll , absorbent paper sheet , aluminum foil , autoclavable pp plastic racks for 96 places , bags, biohazard, ( transparent autoclavable ) , cetylpyridinium chloride ( cpc ) for biochemis mw 358.01>987% , cold chain box ( 12 lir ) , cofton roll , diamond pencil , di sodium hydrogen phosphate , disposable head caps , disposable iab gownspp ( large and medium ) , disposable shoe cover , disposable syringes 5 ml ( 22 & 24 gauge , dnase / rnase surface decontaminant , dropper bottle , droppers, sterile, plastic 1.5 ml, graduated , droppers, sterile, plastic 3.0 ml, graduated, disposable , edta , ethanol 95% , filter paper , fluorescent staining kit for afb , formaldehyde , glass funnel , gloves nitrile, size s m l , gloves, iatex size s m l , glycerol , hydrochloric acid, fuming ( 37% ) , hydrogenperoxyde 30% , immersion oil , laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for pcr lab , laboratory thermometer , l asparagine , lint free soft tissue , liquid dispensing wash bottle plastic ( 500m1 ) , lj medium base powder ready mix , loop, disposabte 10 pl , loopholder , loopholder rack , magnesium sulphate , malachite green , mask ( disposable surgical ) , mccartney bottle 15 mt , mccartney bottle 7 ml , mc farland standard set , micro pipette stand pipette stands for 5 pipttes , micropipette tips nuclease & pyrogen free & aerosol barrier ( 0.1 20p1 ) maximum recovery / lvlinim u m retention filtered racked, sterile , micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery / minimurt retention filtered, racked sterile ( 100 100ul ) , micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery / ivlinimum retention filtered, racked sterile ( 2 200ul ) , molecular grade ethanol , molecular grade isopropanol , n95 respirators ( niosh approved ) , na acetate , n acetyl l cysteine ( nalc ) powder , naphthyl ethylendiimine , needle destroyer , niacin strips , nichrome wire , nicotinamide , parafilm , pcr tubes flat snap cap 0.2 ml , pcr tubes strip with flat cap optical for rt pcr0.2 ml , phenol i , plastic racks ( 15 ml tubes ) , plastic racks for 15 ml conical falcon tubes , plastic racks for 2 ml mct, autoclavab le, , plastic racks for 50 ml conical falcon tubes , plastic storage box for 0.2 ml pcr tubes with lid , plastic storage box with lid for 2 ml cryovials 10x10 , potassium dihydrogen phosphate , potassium permanganate , sample collection container sterile , cryovials , screw cap ( hinged ) mct tapered ( 1.5ml ) , slide drying racks , snap cap ( hinged ) mct tapered ( 1.5 ml ) , cap ( hinged ) mct tapered ( 2 ml ) , sodium chloride, nacl , sodium hydroxide, naoh , sodium hypochlorite solution , sodium nitrate , spray bottles sprayldpe 500 ml , spray bottles plastic pp 250 ml , sputum container , staining bottle , staining rack , sterile biue tips butk ( 1000u1 ) , sterile tips butk ( 10ul ) , sterile yellow tips bulk ( l00ul ) , sulfuric acid, concentrated , sulphanilamide , test tube rack pp for vtm tubes , tissue roll , torniquet , tri magnesium di citrate , tube, centrifuge, 13 ml with screw cap , tube, centrifuge, 50 ml with screw cap , tubes cryovial, sterile with screwcap, 2 ml , tubes reaction, 2 ml , universal bottle for culturcs, 28 ml , water molecular biology grade , xylene , zinc powder , zn acid fast stainidg kit , autoclavable pp cryoboxes suitable for storage at 80 c 10 x10 samples for 2 mlcryovials , autoclavable pp racks for 1.5 ml mct 48 samples ( 24 pieces ) ...

Medical Health And Family Welfare - Rajasthan

33421680 supply of lab regents and x ray films in district saadat hospital at tonk ( annual contract ) 1 anti “a” 10 ml serum 2 anti “a 1” serum 3 anti “ab”serum 4 anti “abd” 10 ml serum polypack 5 anti “b” 10 ml serum polypack 6 anti “d” 10 ml serum polypack 7 anti humar serum coombs anti serum 8 aslotestkit 9 auto pipette tips1 ml blue1*1000 pkt 10 auto pipette tips1 ml blue1*500 pkt 11 auto pipette tips0.1 ml yellow 1*1000 pkt 12 blood sugar kit ( auto / manual ) 13 blood urea kit ( auto / manual ) 14 bovine albunium 22% 15 cbc print roll 16 cover slip for counting chamber 17 cover slipsper 10 gm 18 cpda bags350 ml 19 csf diluting fluid 20 dengue elisa ns1 21 dengue testantibody 22 dengue testantibody +antizan 23 distril water 24 e.c.g. paper roll 6 channal 25 ecg gel 26 ecg paper roll singal channel bpl 6108t 27 ecg paper roll 12 channel schiller at 102 ( 144 sheet pack ) 28 eosinphol fluid 29 esr stand 30 esr tube glass 31 esr tube plastic 32 filter paper 33 glass slide 34 glucometer strip codefree sd biosensor 35 h.b.pipette 36 h.c.v rapid card with positive & negative control & sensitivety & specific in litrature 37 hb meter 38 hb tubes round 39 hbs ag elisa ( 1*96 ) test 40 hbs ag rapid card test with positive & negative control & sensitivety & specific in litrature 41 hcv elisa ( 1*96 ) test 42 hiv elisa ( 1*96 ) test 43 hiv rapid card test with positive & negative control & sensitivety & specific in litrature 44 hiv tridot 45 jsb 1st500 46 jsb 2nd 500 47 k 3 edita tube 48 lancet 49 leisman stain 50 liq. paraffin 51 malaria card 1*50 antibody with positive & negative control & sensitivety & specific in litrature 52 malaria card 1*50 antigion with positive & negative control & sensitivety & specific in litrature 53 malaria card 1*50 antibody / antigion with positive & negative control & sensitivety & specific in litrature 54 malaria card + vdrl card combo with positive & negative control & sensitivety & specific in litrature 55 multistrix 56 n / 10hcl 57 pasture pipette ( glass ) 58 plastic analyzinf tube for semi auto analyzer 59 plastic test tube for blood collection 13*110mm 60 platelate fluid 61 urin pregnancy card with positive & negative control & sensitivety & specific in litrature 62 rbc fluid 63 rbc pipette 64 rheumatoid factor ( rf ) 65 s. albumin test kit 66 s. alkilinephosphate testkit ( semi auto analyeser ) kinetic 67 s. alkilinephosphate testkit ( semi auto analyeser ) kinetic 68 s. amylase test kit 69 s. calcium test kit 70 s. ck mb test kit 71 s. ck nac tast kit 72 s. ldh test kit 73 s. uric acid test kit 74 s.billirubin kit ( auto / manual ) 75 s.creatinine kit ( auto / manual ) 500 76 s.uric acid kit ( semi auto analyser ) ( semi auto analyeser ) kinetic 77 serum cholesterol kit ( auto / manual ) 78 serum cholesterol kit ( auto / manual ) 79 sgot 80 sgot 81 sgpt 82 sgpt 83 sodium citrate 3.8% liquid500 84 sodium hypo chloride soln 5 % 85 sonography gel 86 test tube 10*1 cm borocil 87 test tube 5*1 cm borocil 88 tissue paper 89 total colestrol test kit 90 total protine albumin globulinea:gratio ( semi auto analyeser ) kinetic 91 tournicate 92 transporastation tube / plain tube 93 tuberculin diluted 94 urine analyzer strip 95 urine contener50 ml 96 uristix glucose protein 97 usg photo paper roll upp 110s 98 vacutainer without vacume 5 ml purplecap 99 vacutainer without vacume 5 ml redcap 100 vacutainer without vacume 5 ml yellow cap 101 vdrl rapid card with positive & negative control & sensitivety & specific in litrature 102 vtm vial 103 wbc diluting liquid500ml 104 wbc pipette 105 wbc pipette 106 widal kit ( auto / manual ) 107 auto pipete ( 10micro let 50micro let ) 108 auto pipete ( 10micro let 200micro let ) 109 auto pipete ( 500micro let 1000micro let ) 110 esr tubes 111 h.b. meter ( digital ) 112 h.b. meter strips ( hemocue ) 113 sahali h.b. meter 114 dispo needle 24g. 115 transfer blood bag 350ml. 116 s.crp test kit 117 banded autiseptic plaster 118 eppendrop tube 119 capillary tube 120 prothrombine time kit 121 digital pipettes 1 20 μl 122 digital pipette 10 100 μl 123 digital pipette 100 – 500 μl 124 digital pipette 500 1000 μl 125 pipette stand 126 aerosol barrier pipette tips 0.5 20 μl 127 aerosol barrier pipette tips 10 200 μl 128 aerosol barrier pipette tips 100 1000 μl 129 digital multichannel micropipettes 5 50 μl 130 digital multichannel micropipettes 100 500 μl 131 1.5 ml eppendorfs ( micro centrifuge tubes ) 132 2 ml eppendorfs 133 optical pcr 8 strip tube with cap ( os 1 ml × 0.2 ml dna / rnase / pcr inhibition free ) compatible with biorad rt pcr machine 134 autoclavable yellow, red, black, blue biosafety bags with biosafety symbol 135 ethanol molecular grade 136 isopropanol molecuolar grade 137 hand sanitizer 138 lint paper ( kim wipe ) 139 micro pipette tips 1 10 μl 140 micro pipette tips 10 100 μl 141 micro pipette tips 100 1000 μl 142 cryo storage box with stand ampoules 80° c1.5 ml 143 cryo storage box with stand ampoules 80° c2 ml 144 alluminium foil paper roll 18 inch × 90 meter 145 reversible racks for microtubes ( 96 holes ) 146 falcon tube 20 ml 147 falcon tube 50 ml 148 parafin tape 149 paper towel 150 head cover 151 shoe cover 152 brown paper 153 full cover disposable gown 154 apron different color medium size full sleeves ( approx 5 color ) 155 nuclease free water 156 vtm storage rack 157 thermocol box 158 discarding jar ( glass made ) 159 himedia cled agar ( cystine lactose electrolyte deficient agar ) 160 sterile disposable petridishes 90mm 161 nichrome wire straight wire rod 162 sterile disposable 10 ml test tube 163 field stand a & b 164 methanol 165 semen diluting fluid 166 neubauer chammber 167 prolyte electrolyte ( na, k, cl fluid pack ) 168 prolyte electrolyte ( daily cleaner ) 169 prolyte electrolyte electrod 170 3 part cbc machine ( axiom 19 plus ) 171 diluent 172 detergent 173 conc. detergent 174 lyse 175 for fully automatic randox machine 176 albumin ( liquid ) bcg 177 alt ( gpt ) ( liquid ) mod. dgkc ( rx series ) 178 alk. phos. ( liquid ) amp ( ifcc ) ( rx series ) 179 ast ( got ) ( liquid ) mod ( ifcc ) ( rx series ) 180 amylase ( liquid ) eps ( rx series ) 181 bilirubin ( direct ) ( liquid ) jendrassik ( rx series ) 182 bilirubin ( total ) jendrassik ( rx series ) 183 calcium ( liquid ) ( mona reagent ) arsenazo ( rx series ) 184 choloestrol ( liquid ) chod pap 185 hdl cholestrol ( liquid ) clearance ( rx series ) 186 ldl cholestrol ( liquid ) clearance ( rx series ) 187 ck nac dgkc ( rx series ) 188 ck mb dgkc ( rx series ) 189 crp ( liquid ) immunoturb ( rx series 190 crr full range ( 0.1 160 ) mg / l ) l.e.i ( rx series ) 191 crp full range ( 0.1 160mg / l ) rx series 192 crp full range ( 0.1 160mg / l ) rx series 193 crp high sensitivity ( liquid ) l.e.i ( rx series ) 194 creatinine ( liuqid ) jaffe ( rx series ) 195 glucose ( liquied ) god pap ( rx series ) 196 ldh ( liquid ) 197 lactate color 198 ld pyruvate > lactate ( liquid ) mod. dgkc ( rx series ) 199 ld lactate > pyruvate ( liquid ) nad ( rx series ) 200 total protein ( liquid ( mono reagent ) biuret ( rx series ) 201 triglycerides ( liquid ) cpo pap ( rx series ) 202 uric aicd ( liquid ) color ( rx series 203 urea ( liquid ) kinetic ( rx series ) 204 calibration sera level 2 205 calibration sera level 3 206 hdl / ldl chloestrol calib. 207 ck mb control 208 ck mb calib. 209 crp calib. ( multi point ) liquid ) 210 crp high sensitivity control level 1 ( lilquid ) 211 crp high sensitivity control level 2 ( liquid ) 212 crp high sensitivity calib. series ( multi point, liquid ) 213 crp calib. series ( multi point, liquid ) 214 crp control level 2 ( liquid ) 215 crp control level 3 ( liquid ) 216 crp full range ( 0.1 160mg / l ) calib. series 217 human assayed multi sera level 3 218 human assayed multi sera level 2 219 specific protein calib. ( lqiuid ) undiluted sample assays 220 specific protein calib. ( lqiuid ) diluted sample assays 221 lipid control level 1 222 lipid control level 2 223 lipid control level 3 224 specific protein assayed control levlel 1 ( liquid ) 225 specific protein assayed control levlel 2 ( liquid ) 226 specific protein assayed control levlel 3 ( liquid ) 227 serum diluent water 228 wash solution no.1 rx3963 229 wash soluiton no.2 rx3962 230 c1 wash solution rx3973 231 acid wash solution ws3853 232 allurate cup 233 appenddrop tube 234 5 part cbc machine ( sfri ) 235 diluentsfri 236 quench sfri 237 cleair sfri 238 lysesfri 239 x ray film & consumable items 240 x ray film1*50 ( green base ) fujifilm 241 x ray film1*50 ( green base ) fujifilm 242 x ray film1*50 ( green base ) fujifilm 243 x ray film1*50 ( green base ) fujifilm 244 x ray film1*50 ( green base ) fujifilm 245 dental x ray film kodak 246 x ray developer for auto film processor rd 37 247 x ray fixer for auto film processorrf 34 248 x ray developer for manual 249 x ray fixer for manual 250 dry view film for dryview 6850 laser imeger carestream 251 dry view film for dryview 6850 laser imeger carestream 252 dry view film for dryview 6850 laser imeger carestream 253 dry view film for dryview 6850 laser imeger carestream 254 dry view film for prima t.m. with drypix plus fujifilm 255 dry view film for prima t.m. with drypix plus fujifilm 256 dry view film for prima t.m. with drypix plus fujifilm 257 dry view film for prima t.m. with drypix plus fujifilm 258 cassette for cr system for dryview 6850 laser imeger carestream 259 cassette for cr system for dryview 6850 laser imeger carestream 260 cassette for cr system for dryview 6850 laser imeger carestream 261 cassette for cr system for dryview 6850 laser imeger carestream 262 cassette for cr system for prima t.m. with drypix plus fujifilm 263 cassette for cr system for prima t.m. with drypix plus fujifilm 264 cassette for cr system for prima t.m. with drypix plus fujifilm 265 cassette for cr system for prima t.m. with drypix plus fujifilm 266 x ray cassette with push button 267 x ray cassette with push button 268 x ray cassette with push button 269 x ray cassette with push button 270 x ray cassette with push button 271 x ray intesifing screen kg8 272 x ray intesifing screen kg8 273 x ray intesifing screen kg8 274 x ray intesifing screen kg8 275 dental hangers 276 x ray hangers 277 x ray hangers 278 x ray hangers 279 x ray hangers 280 x ray hangers...

Medical Health And Family Welfare - Rajasthan

33349004 rate contract tender for supply of consumables item , acetic acid , calcium chloride fused , boric acid , hydrogen per oxide , hydrochloric acid , phospho molybdic acid , sudan ii , nitric acid , sulphuric acid , acetone , ammonium molybdate , di ammonium hydrogen phosphate , iso amyl alcohol , ammonium hydroxide solution , antimony ( iii ) chloride , ammonium ferric sulphate , acetonitrile , bismuth subnitrate , bromocresol green indicator ar , chloroform , carbon tetra chloride , petroleum ether 60 80 , phloroglucinol , phenol , paraffin liquid , resorcinol , sodium hydroxide pelletes , diethyl ether , fehling solution a , furfural , glycerol , xylene , methyleneblue solution indicator , methylorange indicator , fehling solution b , silver nitrate , di phenyl carbazide , petroleum ether 40 60 , phenopthaline indicator , cobalt sulphate , fast red ( allura red ) colour , alkali blue 6 b indicator , rosaniline acetate , zinc acetate , potassiumhydroxide , benzene , hexane , n heptane , potassium iodide , sudan i , sudan iii , sudan iv , sodium hydoxide solution , silica gel , toluene , furfuraldehyde , aluminum oxide ( al2o3 ) , tartrazine color , sunset yellow color fcf , carmosine color , ponceau 4rcolor , brilliant blue color , fast green fcf color , metanil yellow color , iodine monochloride ampules , ninhydrine , potassium chromate , potassium dichromate , starch soluble , sulphur powder , tri sodium citrate , ampules 0.1n sodium hydroxide of 6 , ampules 0.1n sodium thiosulphate of 6 , ampules 0.1n hydrochloric acid of 6 , ampules 0.1n silver nitrate of 6 , iodine crystal , sodium potassium tartrate , di methyle amino banzaldehyde , copper sulphate , potassium sulphate , edta powder , sodium carbonate , copper acetate , bromine ampule , carbon di sulphide , phenol , methyl red indicator , phenol red indicator , phenolphthalien indicator , eriochrome black t indicator , di mehtyel yellow , bromothymol blue indicator , bromophenol indicator , di mehtyel yellow colour , caramel colour , rhodamin b , amaranth colour , erythrosine colour , acid yellow colour , sucrose pure , acid orange ( orange grade ) color , butter yellow color , methanol ms optima grade , acetonitrilms optima grade , ethyl acetate ms optima grade , acetic acid ms optima grade , aluminum ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , antimony ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , arsenic ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , barium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , bismuth ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , cadmium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , calcium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , chromium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , copper ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , germanium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , gold ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , iron ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , lead ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , magnesium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , manganese ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , mercury ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , nickel ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , potassium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , rhodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , scandium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , selenium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , silver ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , sodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tellurium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tin ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , vanadium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , zinc ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , customized gc pesticide mix nist certified crm ( compound list enclosed ) , customizedlc pesticide mix nist certified crm ( compound list enclosed ) , curcumin nist certified crm ( 1000 mg / l ) , 37 component fame mixcrmfor fatty acid , vitamin a ( 1000 mg / l ) , vitamin d ( 1000 mg / l ) , vitamin b12 ( 1000 mg / l ) , vitamin b3 ( 1000 mg / l ) , vitamin c ( 1000 mg / l ) , potassium hydrogen phthalate , sodium carbonate , mustard oil , ground nut oil , potassium di chromate , sodium chloride , sucrose , oryzonol , argemone oil reference standard , castor oil reference standard , mineral oilreference standard , cotton seed oilreference standard , turmeric with lead chrome reference standard , potassium di chromate reference standard , potassium hydrogen phtallatereference standard , sodium carbonatereference standard , sodium chloridereference standard , sand particle size pass through 500 micron is seive size and retained on 180 micron is seive , standard is seive set ofaperture size size 4 mm, 3.35 mm, 1.70 mm, 1.0 mm with solid bottom pan each , vitamin a reference standard , nutrient brothw / 1%peptone , nutrient agar , mac conkey broth w / nurtral red , mac conkeys agar , plate count agar ( pca ) , bairedparkes agar medium , yeast extract dextrose chloramphenicol agar medium , potato dextrose agar , m r vp medium , bismuth sulphide agar medium , thermometer 0 to 1000c , cedar wood oil / immersion , forcepsss , tray plastic , kovacsindole reagent , grams stain kit , steam indicator tape , dry heat chemical process strips , stereothermophilus ampoule , disposable shoe cover , ph paper strips , autoclavable disposable bags , brown paper , uv lamp for sterilization , autoclavable micropipette ( 1000 fixed volume, 500 5000 variable volume, 50 200 microlitre , micropipette tip box , scissors small , labels and taps , aluminum foil , butter paper , hand gloves ( small and large ) , slippers , liquid soup solution for glassware washing 5 ltr pack , lens paper , beaker , beaker , beaker , beaker , beaker , burret , burret , butyrometer tube for milk testing , dropping bottle plastic , dropping bottle plastic , dropping bottle plastic , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , cover slip , condenser for rmset , crusible quartz without lid , diamond pencil , flask conical , flask conical , flask conical , flask conical , flask iodine stopper , funnel glass , funnel plastic , separating funnel , glass rod all type , rubber bulb medium size , rubber bulb size big , pipettes graduated , pipettes graduated , pipettes graduated , pipettes volumetric , pipettes volumetric , pipettes volumetric , pipettes volumetric , test tube with stopper , petri dish pair ( glass ) , volumetric pipette , caplliry tube , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , density bottle , soxhlet flask , glass beads , glass slide for microscopy , heating mantal net for 250ml , heating mantal net for 500ml , automatic tilt with 250ml bottle , automatic tilt with 250ml bottle , soxhletcondensor medium , aluminium dishes , reagent bottle , reagent bottle , reagent bottle amber coloured , reagent bottle amber coloured , mojonnier fat extraction tube , pipette stand plastic verticle , air condenser with joint 100cm , dean & stark apparatus 10.0ml , auto pippete sucker , suction flask , colum chomrplaingl, stpk for colour estimation , thermometer zeel , lactometerzeel , centrifuge tube glass with stopper , butyrometer tube aluminium stand , volatile oil clanveger type , lighter thanwater , desicator with cap , toungue ss , soxhlet clamps , with boss head , asbestosed wire gauge , mortar & pestal , volumetric flask ( rm reciever ) , membrane filtration assemboly with pump & filters , beaker , beaker , iodine flask , butyrometer key , butyrometer tube cork , filter paper sheet 1 ( 46*57cm ) , filter paper no. 1 diameter 125mm , filter paper no. 2 diameter 125mm , filter paper no. 4 diameter 125mm , filter paper no. 42 dimeter 125mm , centrifuge tubes ( pp tubes ) 50mlpkt , centrifuge tubes ( pp tubes ) 15mlpkt , nylon syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , ptfe syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , nitril gloves ( medium size ) , nitril gloves ( small size ) , brush for butyrometr test tube brush , tong 12 ss , spatulla 8 ss , auto sampler vials with cap and septa 1x100 , 100 1000 micro litre tips universal graduated ( 1x1000 ) , 10 100 micro litre tips , 1 5 ml tips ( 1x100 ) , tissue rolls , lens paper , disposable lab coat , non absorbant cotton roll500gm , nitrogen gas cylinder 47 litre ( 99.999% purity ) , argon gas cylinder47 litre ( 99.999% purity ) , helium gas cylinder47 litre ( 99.999% purity ) , hydrogen gas cylinder47 litre ( 99.999% purity ) , zero air gas cylinder47 litre ( 99.999% purity ) , membrane filter ( 0.45 ) um ( millipore ) , aluminum foil food grade ( extra hygiene ) rolls , tlc plate aluminium ( 20x20 cm ) , coloumn for vitamin analysis c 18 1.8?m, 2.1x100mm , coloumn for vitamin analysis c 18 2.6?m, 2.1x100mm , gc coloum 105 mtr. capillary tg 5ms, 105mtr. lenth x0.25 pore size for fatty acid profile , alpha. amylase 100 gm , sodium acetate500 gm , ammonium formate 100 gm , di potassium hydrogen phosphate 500 gm...

Indian Army - Rajasthan

33126371 annual price agreement of 187 mh fy 2022 23 annual price agreement for procurement of medicines for 187 mh fy 2022 23 , list iii lab reagents and chemical , pencil, marking glass. , acetic acidglacial ( analar ) , alcohol dehydrated , anti nuclear antibody elisa detection kit with 96 wells. , benedict solution, qualitative. , blood agar base, pack of 0.5kg , chloroform ar ( analytical grade ) , drabkins solution ( diluting solution for haemoglobin estimation by cyanmet haemoglobin method ) , fructose , glycerine ar ( glycerol ) , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , hiv antibody 1 & 2 detection elisa kit for 96 tests. , stain leishmans powder. , stain methylene blue , stain neutral red , sudan iii , xylene ( xylol pure ) , rapid card screening for hbv , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , serum, agglutinating, bact abortus monospecific , salmonella typhi o , salmonella typhi v , salmonella typhi h , salmonella paratyphi a.h , serum anti d for saline tube test , lieshmen stain ( ready to use ) , gram stain ( ready to use ) ( hi media ) , zn stain ( ready to use ) ( hi media ) , urine strip, bott of 100 strip 2sg ( siemens ) , multistrip 10sg , bott of 100 strips ( siemens ) , kit widal, 4 x 5 ml ( tulip ) , typhoid igm / igg, pkt of 100 ( j mitra ) , malaria ag ( j mitra ) , pkt of 50 , hcv tridot , pkt of 100 ( j mitra ) , vdrl ( kit of 30 ) ( ctk ) , ra factor ( tuylip / coral ) , esr tube ( ready to use ) , swab stick ( hi media ) , sterile urine container , kit micro protein ( 1x50 ) ( erba ) , petri dish ( disposable ) ( hi media ) , blood culture bottle aerobic ( ready to use ) , ( bactech ) , ph strip , biored level 1 , biored level 2 , hiv 1&2 ( rapid tridot ) 1x100 test ( j mitra ) , hiv 1&2 ( rapid sd card ) 1x30 test ( j mitra ) , antibiotic disc ampicillin, pkt of 250 ( hi media ) , antibiotic disc gentamycin, pkt of 250 ( hi media ) , antibiotic disc amikacin, pkt of 250 ( hi media ) , antibiotic disc ciprofloxacin, pkt of 250 ( hi media ) , antibiotic disc norfloxacin, pkt of 250 ( hi media ) , antibiotic disc nalidixic acid, pkt of 250 ( hi media ) , antibiotic disc nitrofurontoin, pkt of 250 ( hi media ) , antibiotic disc imipenem, pkt of 250 ( hi media ) , antibiotic disc vancomycin, pkt of 250 ( hi media ) , antibiotic disc co trimaxazole, pkt of 250 ( hi media ) , antibiotic disc cefixime, pkt of 250 ( hi media ) , antibiotic disc ceftazidime, pkt of 250 ( hi media ) , antibiotic disc clindamycin, pkt of 250 ( hi media ) , antibiotic disc piperacillin, pkt of 250 ( hi media ) , antibiotic disc optichin, pkt of 250 ( hi media ) , antibiotic disc polymixin b, pkt of 250 ( hi media ) , cover glass 22x40 ( blue star ) , cover glass 22x50 ( blue star ) , macckonkey broth double strenght ( hi media ) , pack of 0.5kg , hbsag sd card ( 1x100 test ) sd , distilled water , hcv sd card , pkt of 100 ( sd ) , hbsag tridot ( 1x100 test ) ( j mitra ) , easylyte plus solution pack na / k / cl ( medica ) , easylyte cleaning solution bott of 90ml ( medica ) , easylyte plus wash solution bott of 50ml ( medica ) , easylyte plus urine diluent bott of 500ml ( medica ) , clead agar ( hi media ) , pack of 0.5kg , mha agar ( hi media ) , pack of 0.5kg , blood agar base ( hi media ) , pack of 0.5kg , nutrient agar ( hi media ) , pack of 0.5 kg , semen diluenting fluid, bott of 500ml , erba diluent h 360, pack of 20 ltr , erba lyse h 360, bott of 500ml , erba h clean h 360, bott of 50ml , erba printer roll 55mm, h 360 , erba control h 360 , microscopic slide pack of 50 ( blue star ) , watman filter paper 125mm x 100 circle , kit rapid pap biofix spray ( biolab ) , kit lipase , 1 x 20ml ( erba ) , ab &d antisera ( 3 x 10ml ) , ependorf tube , acidh2so4 ( sulphuric acid ) , kit t3 detection elisa kit 96 tests ( calbiotech ) , kit t4 detection elisa kit 96 tests ( calbiotech ) , microtips ( 1 200ul ) , microtips ( 500 1000ul ) , erba wash ( 5x 20 ml ) , ethanol , tmppd , kit abst tobramycin disc, pkt of 250 ( hi media ) , kit abst colistin disc, pkt of 250 ( hi media ) , kit abst meropenam disc, pkt of 250 ( hi media ) , kit abst ceftrixone disc, pkt of 250 ( hi media ) , kit abst piptaz disc, pkt of 250 ( hi media ) , kit abst cefazolin disc, pkt of 250 ( hi media ) , kit abst cefotoxime disc, pkt of 250 ( hi media ) , kit abst linezolid disc, pkt of 250 ( hi media ) , kit abst penicillian disc, pkt of 250 ( hi media ) , duram tube , india ink , sda media , lj media , lpcb , blood culture castaneda , tubing kit set ( medica easylite ) , glass, cover, microscopic, square shape, 0.127 mm thick, side 22 mm, pkt of 14 g , micropipettes, tips for 1 200 ul , micropipettes, tips for 500 1000 ul , semi auto analyser, wash solution for , semi auto analyser, printing paper roll for , slide, microscope, thickness 1.15 to 1.35 mm size 75mm x 25 mm , acetone commercial , acid, sulphuricum ( sp. gravity 1.820 1.825 ) . , alcohol amyl , aluminium foils. , alcohol methyl , ( aso ) antistreptolysin o test latex agglutination principle, complete with control serum , cled agar ( with thymol blue ) , pack of 0.5kg , liquior formaldehyde 40% w / v , kit for estimation of hdl cholesterol ( 100 ml ) , hiv antibody 1 & 2 detection rapid test kit , keto diastix bott of 50 strips , kits for estimation of albumin , kits for estimation of cholestrol , kits for estimation of glucose , kits for estimation ofprotein , kits for estimation of urea , kits for estimation of uric acid , kits for estimation of creatinine , kits for estimation of alkaline phosphatase , kits for estimation of sgot ( ast ) , kits for estimation of sgpt ( alt ) . , macconkey agar , pack of 0.5kg , methylene blue , mueller hinton agar, pack of 0.5kg , prothrombin time reagents to give control of 10 14 secs , pttk reagent , sodium hypochlorite solution 10% , strips albumin and glucose bottle of 100 strips , tsi media / triple sugar iron agar, pack of 0.5 kg , kit for triglyceride estimation ( 100 ml ) , kit for ldl cholesterol by direct estimation , kit for estimation of bilirubin , kit for estimation of ggt ( gamma gluteryl transaminase ) ( 12 x 5 ml ) , kit for estimation of cpk mb ( 2.5 ml ) , kit for estimation of calcium ( 50 ml ) , kit for estimation of amylase ( 12 x 5 ml ) , kit for estimation of ldh ( 12 x 5ml ) , kit crp ( c reactive protein kit for 50 tests ) , pt reagent ( kit of 25 tests ) , serum haemaglutnating group a ( anti b monoclonal ) , serum haemagglutnating group b ( anti a ) monoclonal , serum heamaglutinating gp. o ( anti ab ) ( monoclonal ) ...

State Forensic Science Laboratory - Rajasthan

33052785 supply of stationery and misc. item envelope, laminated envelope, pencil, glass marking pencil, sharpner, eraser, marker pen, cd marker, ball pen, whightner, all pin, pen holder, stamp pad, stapler, stapler pin, punching machine, fevikol, gum bottle, chart sheet, pockerl, file tag, file lase, note pad, file cover, calculator, cd cover, register, candle, soap, hand wash liquid, sui, washing powder, pencil cell, paper cutter, plastic bucket, plastic tub, aluminum foil, mosquito electric machine, ret killer, lpg gas, plastic pipe, room lock, broom, etc....

Medical College - Rajasthan

33047950 rate contract for consumable and reagents for various rtpcr labs rate contract for consumable and reagents for various rtpcr labs , n 95 mask ( niosh certified ) , isopropanol molecular grade , nuclease free water molecular grade , rna zap [ rna kill ] , cool racks for pcr tube ( 0.2ml ) with temperature indicator , aluminium foil , vortex mixer for tubes , micro tips for 100 1000?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 10 100?l, low retention rnase, dnase & pyrogen free sterile , micro tips for 2 10?l, low retentionrnase, dnase & pyrogen free sterile , micropipette tips lowretention filtered, rnase, dnase, pyrogen free, sterile 1 10?l , aluminium foil 72 meter , bottle top dispenser with bottle capacity 1 liter capcity 1 10ml , cryo storage card board box 100 wells with cover 2.0ml , discarding jar with swinging lid 5 liter with biosafety symbol , disposable sterile speciman collection swab dacron type , gown blue cloth back open full sleves , gown green cloth back open full sleves , gown red cloth back open full sleves , gown white cloth back open full sleves , hand sanitizer with dispensar to be attached to wall , lysol , micro titer pipette set variable volume 100 1000?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , micro titer pipette set variable volume 10 100?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , micro titer pipette set variable volume 5 50?l. single channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , micro titer pipette set variable volume 30 300?l. eight channel fully autoclavable ce ivd certified. super blow out piston with volumes of 50?l and below volumes ensures delivery of micro size drops. piston should be made up of rust free polyether imide / ultralight fortron , microcentrifuge 8 tube rotor , microcentrifuge tube 1.5ml molecular grade sterile , pcr master mix with dntps, taq, mgcl 12, buffer 2000rnx , pcr thermo conductive rack for 96 pcr tubes , safety goggles , trough reservoir capacity 75ml polypropylene , wash bottle 500ml new type , ziploc bag 12x8 , ziploc bag 4x3 , ziploc bag 8x6 , manual multichannel micropipette variable volume autoclavable 100 300?l , eppendorf tube 1.5ml with screw caped self standing , micropipette tips filtered, rnase free, dnase free, pyrogen free, sterile 100 300?l...