Sawai Man Singh Medical College - Rajasthan

34121915 tender for supply of surgical disposable and consumable , ready to use hypotonic irrigation solution npwt 500 ml , • neutral ph • safely preserved • solution with shelf life of 24 months after manufacturing and €60 days after opening• gel with shelf life of 18 months after manufacturing and 90€ days after opening • can be warmed to body temperature before usage • non cytotoxic and non irritating • ready to use • eases the loosening of crusted wound dressings • can be combined with granulox® • does not require neutralisation or rinsing off npwt 1000 ml , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) [ s120 ] , 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) [ s123 ] , a reliable wound irrigation solution. hocl prevents the proliferation of gram+ and gram bacteria including; mrsa, gel 100 g , abdominal belt , abdominal drain kitno 22 , abdominal drain kit ( with collection bag 2000 ml size 24 , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 , absorbent cotton wool 500 gm , active ingredients: naocl / hocl ( 1000ml ) shelf life: 2 years sterilization method: non sterile packing information: the solution is filled in a pet bottle. there is a hanging label ( material: pehd ) on the bottle. on top of the bottle there is a plastic lid with 2 holes and a blue ov ring ( material: pp [ blue ] , pe [ white ] , tpe, pp ) . the lid of the bottle has got a sealing closure ( material: pe foil ) on top. 6 bottles come into a corrugated cardboard box as a trader unit and a leaflet for every bottle is also in the trader unit. it is an irrigation solution for cleansing and moisturising acute, chronic and contaminated wounds as well , active ingredients: naocl / hocl ( 250ml ) shelf life: 2 years sterilization method: non sterile packing information: the solution is filled in a pet bottle. there is a hanging label ( material: pehd ) on the bottle. on top of the bottle there is a plastic lid with 2 holes and a blue ov ring ( material: pp [ blue ] , pe [ white ] , tpe, pp ) . the lid of the bottle has got a sealing closure ( material: pe foil ) on top. 6 bottles come into a corrugated cardboard box as a trader unit and a leaflet for every bottle is also in the trader unit. it is an irrigation solution for cleansing and moisturising acute, chronic and contaminated wounds as well , active ingredients: naocl / hocl ( 500ml ) shelf life: 2 years sterilization method: non sterile packing information: the solution is filled in a pet bottle. there is a hanging label ( material: pehd ) on the bottle. on top of the bottle there is a plastic lid with 2 holes and a blue ov ring ( material: pp [ blue ] , pe [ white ] , tpe, pp ) . the lid of the bottle has got a sealing closure ( material: pe foil ) on top. 6 bottles come into a corrugated cardboard box as a trader unit and a leaflet for every bottle is also in the trader unit. it is an irrigation solution for cleansing and moisturising acute, chronic and contaminated wounds as well , active ingredients: naocl / hocl ( 50ml ) shelf life: 2 years sterilization method: non sterile packing information: the solution is filled in a pet bottle. there is a hanging label ( material: pehd ) on the bottle. on top of the bottle there is a plastic lid with 2 holes and a blue ov ring ( material: pp [ blue ] , pe [ white ] , tpe, pp ) . the lid of the bottle has got a sealing closure ( material: pe foil ) on top. 6 bottles come into a corrugated cardboard box as a trader unit and a leaflet for every bottle is also in the trader unit. it is an irrigation solution for cleansing and moisturising acute, chronic and contaminated wounds as well , adhesive paper tape with cutter 1 , adhesive paper tape with cutter 2 , adhesive paper tape with cutter 3 , adhesive silk tape1 / 2 , adhesive silk tape 1 , amboo bag 2 ltr. , anti microbial gloves , antimicrobial five layered highly absorbent foam dressing with activated carbon and sliver content 1.2mg / cm2, active release for 168hrs ( 7 days ) with self adherent borders and with soft silicone wound contact layer, with wound pad absorption layer made up of polyacrylate fibres & polyethylene / polyester fibres, with acquisition and spreading layer made up of polyurethane silver foam, with polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified. usage upto 7 days. size 10x25 cm , antimicrobial five layered highly absorbent foam dressing with activated carbon and sliver content 1.2mg / cm2, active release for 168hrs ( 7 days ) with self adherent borders and with soft silicone wound contact layer, with wound pad absorption layer made up of polyacrylate fibres & polyethylene / polyester fibres, with acquisition and spreading layer made up of polyurethane silver foam, with polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified. usage upto 7 days. size 10x30 cm , apple hunt trocar : should be single use sterile trocars, have side port , two cannula & one trocar , 5 mm & 10 mm trocar with pyramidal tip, ergonomic design , fascia anchoring thread should be usfda / ce approved , aprin plastic , asepto syringe with bulb 60 ml , auto clave lable , b.p. instrument ( digital ) , b.p. instrument ( marcurial ) , babykit ( cloth set for new bourn babies in summer use ) , babykit ( cloth set for new bourn babies in winter use ) , bain circuit for adult , bain circuit for neonatal , bakri postparyurnballoon catheter 100 % silicone, fda 510 clearance , band aid ( water proof ) long , band add long 0.5 inch , band add long 2inch , band add round , bed paan plastic , bed protective plastic sheet disposables size 120x210cm , biological glue with thrombin & aprotinin 2ml , blood administration set blood transfusion set , blood lancet pack of 100 pcs ( fill 100 pcs rate in boq ) , bp bulb with mattle scruw , bp cuff ruber , breast pump , cannula fixer , care handloom guaze pad ( sanitary pad ) pkt. of 10 pcc , carter thomason port closure : should be carter thomson type port closure system, have pilot guide and suture passer separately, able to use for trocar defects of 5mm 15mm, suture guide holes should be 180 degree access across each other’s, single use , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , ceasarian drape sheet , central line quadra lumen 8.5 fr with 15cm / 20cm catheter , central line triple lumen 8.5 fr with 16cm / 20cm catheter , chlorhexidine impregnated paraffin roll 15 cm x 1 , close suction system adult fr 14 , close suction system size 2.5 , close suction system size 3.0 , close suction system size 3.5 , close wound drainage device under negative pressure ( closed wound suction unit ) no. 12 , close wound drainage device under negative pressure ( closed wound suction unit ) no. 14 , closed suction catheter for paediatrics 6fr , cmg line ( central venus canula ) 45 cm + 70 cm 14 / 16 g , combined spinal epidural set 16g , combined spinal epidural set 18g , connecting cable for ultrasonic harmonic scalpel for lap energy with ace plus shear hp054 , connecting cable for ultrasonic harmonic scalpel for open energy with focus plus shear hp blue , cotton crepe bandage bp 6 cm x 4 m , cotton crepe bandage bp 8cm x 4 m , cotton crepe bandage bp 10cm x 4m , cotton roll 300 gm , culture plate , culture swab , culture vial , dead body bag , delivery kit ( disposable ) , diapers ( size adult ) pkt of 5 pcs. , diapers ( size neonate onwards ) pkt. of 5 pcs. , disposable laparoscopic clip applier with 16 clips, 5mm diameter , disposable needle18g. , disposable needle 21 g. , disposable needle 23 g. , disposable spo2 sensor , disposable syringe with needle1 ml. , dry lithium heparin pre filled abg syringe with air removal filter cap 1ml , dry lithium heparin pre filled abg syringe with air removal filter cap 3ml , dura pore 1 ( 2 to 3cm ) , dura pore 1 / 2 ( 1 to 2 cm ) , e.c.g. electrodes ( neonate ) , ecg electrode ( detail in rc ) [ s104 ] , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ) , electric suction machine , endoservical brush ( pep smea kit ) , endotracheal tube, cuff size 4.5mm , endotracheal tube, cuff size 5mm , endotracheal tube, cuff size 6mm , endotracheal tube, cuff size 7mm , endotracheal tube, cuff size 7.5 mm , endotracheal tube, cuff size 8mm , endotracheal tube, cuff size 8.5mm , endotracheal tube, cuff size 6.5 mm , endotracheal tube, plain size 2.5 mm , endotracheal tube, plain size 3mm , endotracheal tube, plain size 3.5 mm , endotracheal tubes plain size4mm , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile , epimatic lor syringe with precallibarated pressure band , face mask, disposable , five layered absordentfoam dressing with soft silicon saftac technology as wound contact layer with salf adherent borders bacterial and viral barrier water proof poly urethane backing filmsize 10x25 cm , five layered self adhesive absorbent sacral dressing designed for exuding wounds, with soft silicone adhesive wound contact layer, with wound pad absorption layer made up of polyacrylate fibres & polyester fibres, wound pad acquisition layer made up of polyurethane foam & spreading layer made up of non woven viscose polyester, with polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified. usage upto 7 days. size 22x25 cm , flow regulator extension set flow rate 2ml to 350ml per hour , foleys catheter no. 6 , folleys catheter fixation divice 18 to 24 fr , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) isi mark , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) isi mark , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) isi mark , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) isi mark , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) isi mark , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) isi mark , gluco meter strips , hand activated curved taper tip coagulating shears compatible focus 17 , highly compressed silicone dressings for scars, with shower proof backing film made up of polyurethane film, with textile core made up of non woven polyester, with ultra violet protection factor 5. a protective release liner made up of polypropylene film. self adherent soft silicone adhesive technology. size 5x7.5 cm , highly compressed silicone dressings for scars, with shower proof backing film made up of polyurethane film, with textile core made up of non woven polyester, with ultra violet protection factor 5. a protective release liner made up of polypropylene film. self adherent soft silicone adhesive technology. size 10x18 cm , hiv kit , hypochlorous acid ( hocl ) ensures safe preservation and makes granudacyn®gel 50 g .for first and second degree burns. , infant feeding tube size 10fg , infant feeding tube size 5fg , infant feeding tube size 8fg , infusion set with microdrip set, ( i.v. ) sterile disposable [ s13 ] , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn , ionic silver dressings for low to high exuding wounds 10 cms x 10 cms , kellys pad rubber , l.r apron , labour drape set , laparoscopic shears 5mm diameter, 36cm long, 15mm curved coated blade , laparoscopic shears 5mm diameter, 36cm long, 18mm curved coated blade [ , laparoscopic shears 5mm diameter, 45cm long, 15mm curved coated blade , laproscopic port with trocar , long line intravenousno. 22 , long line intravenousno. 24 , long line intravenousno. 28 , long nipple feading bottle , mackantosh sheetplastic , mackantosh sheet rubber 1 x 2 mtr , manual vacuum aspiration ( mva kit ) , micro cuf et ( all size ) , milex silicon passeries: should be silicon pessary, latex free, pessaries to be available for pelvic organ prolapses and urinary incontinences, with ring, ring with support and ring with knob, etc., available in multiple sizes. should be usfda / ce approved , mucus extractor sterile , n 95 mask disposable , nasal prong seal , nebulization mask adult , nebulization mask paediatric , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent , nonabsorbable polypropylene light weight macroporous mesh , non fibre optic single use adult scope , o.t. dress large ( cotton cloth ) , optically guided bladeless trocar 12mm length 100mm , optically guided bladeless trocar 12mm length 150mm , opu kit , orsa, vrsa, vre, viruses, fungi and spores. gel 250 g , ot icd tray sterilised ot drain tray with trocar drain and dual suction hemlich valveand other component , oxygen mask ( adult ) , oxygen mask ( pediatric ) , oxygen nasal canula for neonates , papain urea & silk protein based wound debriding ointment and cream 50gm , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , patient pre operative skin prepration solution 26 ml , pe coilled extension line for fluid infusion, fda approved 1mm internal diameterlength 100 / 200 / 150cm , pebaby wrap double layer green house gas generating bad with adjustable hud, front velcro and spine support for preterm baby to avoid hypothermia ( size ..s, m, l ) , pe , prssure capacity 40bar, male to female, venous infusion andpressure monitringline, fda approvedlength with 1mm internal diameterus fda approve50 / 100 / 150 / 200 / 10cm , pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) , pediatric epidural set with 22 g soft polyurethane epidural catheter to prevent dura puncture, 19 g touhy needle, .22 micron filter and lor syringe , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposablem. v. set 110` ml ) [ s12 ] , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposablem. v. set 150` ml ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( iv set ) , pipet curette curettes for endometrial sampling should be single use sterile should have centimeter marking the od should be 3mm should have stylet with o ring for easy and safe sampling , plastic jar 1 ltr. , polythine gloves , powered circular stapler 29 mm , ppe kit for covid 19 95 gsm , resuscitation mask for new born : 1. should be anatomical shape ( not circular ) 2. should cover both mouth and nose , rubber examination gloves made of natural rubber latex, non sterile, size large [ , rubber examination gloves, non sterile, extra small , rubber examination gloves, size medium , rubber examination gloves, size small , ryle’s tube 6no , ryle’s tube 8no , ryles tube / nasogastric tube size: 16 , ryles tube / nasogastric tube size: 18 , ryles tube / nasogastric tube size:14 , sanitary napkin beltless , sanitary napkin beltless with wings [ , sanitary pads belt type , see clear: should be able to attach to the side port of trocar, single use latex free, able to remove 99.99% of 0.01 micron particles, dual filter have charcoal & ulpa, max. flow rate 8.0 ltr / min., tubing have 30’’ length should be usfda / ce approved , self adhesive multi layered absorbent surgical dressing white color for easy exudate monintoring , soft silicone adhesive wound contact layer for painless dressing change, wound pad absorption layer made up of polyacrylate fibres & polyester fibres& spreading layer made up of polyethylene / polypropylene fibres with high flexibilty of dressing to allow early mobilitywith polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film with safetec techology. product should be ce certified. usage upto 7 days. size 10x25 cm , self adhesive multi layered absorbent surgical dressing white color for easy exudate monintoring , soft silicone adhesive wound contact layer for painless dressing change, wound pad absorption layer made up of polyacrylate fibres & polyester fibres& spreading layer made up of polyethylene / polypropylene fibres with high flexibilty of dressing to allow early mobilitywith polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified with safetec techology.usage upto 7 days. size 10x30 cm , self adhesive multi layered absorbent surgical dressing white color for easy exudate monintoring , soft silicone adhesive wound contact layer for painless dressing change, wound pad absorption layer made up of polyacrylate fibres & polyester fibres& spreading layer made up of polyethylene / polypropylene fibres with high flexibilty of dressing to allow early mobilitywith polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified with safetec techology. usage upto 7 days. size 10x25 cm , sharp container , shoe cover ( plastic ) , shoe covers knee length , sigle rate elastomeric disposable infusion pump with air event end cap for air bubble removal with two micro iv filters in 100ml & 275ml with flow rate of 2, 5, 8, 10ml / hr. , silicon fioley balloon catheter ( bh model ) 16no. , silicone foleys catheter sizes 16fr , silicone foleys catheter sizes 18fr , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management 10*25cm , silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 50gm , silk reel 1 0 , skin shaving blade ( rezar blade ) , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g [ s15.c ] , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g [ s15.d ] , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g [ s15.b ] , sterile disposable hypodermic needle no. 18x1½ , sterile disposable hypodermic needle no. 21x1½ , sterile disposable hypodermic needle no. 23x1½ , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch , sterile hypodermic syringe with needle attached, 22g, single use 50 ml [ s106 ] , sterile oxidized regenerated cellulose hemostating agent , suction catheter, sterile. size: f g 10 , suction catheter, sterile. size: f g 14 , suction catheter, sterile. size: f g 6 , suction catheter, sterile. size: f g 8 , surgical blade sterile, size 11 , surgical blade sterile, size 22 , surgical cap disposable ( for surgeons ) , surgical cap, disposable ( for nurses ) , surgical gloves 6.5 puncture indicator technology , surgical gloves 7 puncture indicator technology , surgical gloves 7.5 puncture indicator technology , surgical retractors with self retaining retraction should be single use sterile should be available with variety of flexible, articulating shapes appropriate to surgical site should have adjustable hinges for customization should have elastic stay hooks stay hooks should be available with sharp hooks, blunt hooks and blade hooks should have usfda / ce certification , surgical scrub brush spog in 20%chlorhexidine in 15 ml sol of isopropylalcohol and water with nail cleaner , surgical sponge disposable 30 cm x 30 cm 8 layer ( x ray detected ) , surgical sponge disposable 45 cm x 45 cm 8 layer ( x ray detected ) , suthi , synthetic oxidised re generated cellulose double layered with peg and trilysine size 2*4cm , synthetic oxidised re generated cellulose double layered with peg and trilysine size 5*10cm , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable , tegaderm 1 ( 2 two 3 cm ) , thermometer digital , three way adaptor , tur set , umbilical canulano. 4 , umbilical canula no. 5 , umbilical canula no. 6 , umbilical catheter for new born, all sizes , umbilical cord clamp , under pad ( adult ) 60x90cm , urethral catheter 90 ( fg 14 ) made up of medical grade pvc , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml , urine collecting bag, disposable 2000 ml with uroflow meter , urine collecting bag, disposable 2000 ml , urine pot male / female , uterine balloon tamponade* technical specifications should have a balloon capacity of 1000 2000ml should have a reservoir bag of 1000ml capacity height making for pressures of 60, 80, 100 and 120 mmhg are indicated on the tubing by black rings stock valve should be present tubing should be 1.8 m in length , vaccum suction set, 2.5 meter length ( yaunkuar suction set ) [ s109 ] , vaginal swap stick , wet wipes adult pack of 10 pcs , wet wipes baby pack of 40 pcs...

Medical And Health Services - Rajasthan

34045938 rate contract for surgical & sutures for mndy sr. no. drug code drug name packing unit 1 r1 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 1x12 foils 2 r2 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 1x12 foils 3 r3 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 4 r4 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 1x12 foils 5 r5 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 1x12 foils 6 r6 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 7 r7 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 1x12 foils 8 r8 absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) 1x12 foils 9 r9 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm 1x12 foils 10 r10 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm 1x12 foils 11 r11 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm 1x12 foils 12 r12 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm 1x12 foils 13 r13 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm 1x12 foils 14 r14 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed 1x12 foils 15 r15 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) 1x12 foils 16 r16 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm 1x12 foils 17 r17 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) 1x12 foils 18 r18 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm rc not exists 19 r19 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm 1x12 foils 20 r76 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) 1x12 foils 21 r77 chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) rc not exists 22 r80 chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) 1x12 foils 23 r20 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) 1x12 foils 24 r21 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) 1x12 foils 25 r22 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) 1x12 foils 26 r23 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) 1x12 foils 27 r24 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) 1x12 foils 28 r25 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) 1x12 foils 29 r26 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) 1x12 foils 30 r27 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 31 r28 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 32 r29 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm 1x12 foils 33 r30 non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 rc not exists 34 r31 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) 1x12 foils 35 r32 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) 1x12 foils 36 r33 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) 1x12 foils 37 r34 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) 1x12 foils 38 r35 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) 1x12 foils 39 r36 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) 1x12 foils 40 r37 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm 1x12 foils 41 r38 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) 1x12 foils 42 r39 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm 1x12 foils 43 r40 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm 1x12 foils 44 r41 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) 1x12 foils 45 r42 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm 1x12 foils 46 r43 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) 1x12 foils 47 r44 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) 1x12 foils 48 r45 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) 1x12 foils 49 r46 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) 1x12 foils 50 r47 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) 1x12 foils 51 r48 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) 1x12 foils 52 r49 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm 1x12 foils 53 r50 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm 1x12 foils 54 r51 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm 1x12 foils 55 r52 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) rc not exists 56 r53 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 1x12 foils 57 r54 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) 1x12 foils 58 r55 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 59 r56 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 60 r57 non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm 1x12 foils 61 r75 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 1x12 foils 62 r78 b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) 1x12 foils 63 r79 b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) 1x12 foils 64 r82 absorbable surgical suture polyglyconate, monofilament sutures ( 1 / 2 circle oval rb contrast needle 20 26mm, suture length 70cm ) rc not exists 65 r81 absorbable surgical suture, sterilised surgical needled suture polyglyconate, monofilament sutures ( 1 / 2 circle oval rb needle 26 30mm needle, suture length of 70cm ) rc not exists 66 r61 absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) 1x12 foils 67 r62 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) 1x12 foils 68 r63 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) 1x12 foils 69 r64 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) 1x12 foils 70 r65 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) 1x12 foils 71 r66 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) 1x36 foils 72 r67 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) 1x12 foils 73 r68 absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 74 r69 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 75 r70 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm 1x12 foils 76 r71 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm 1x12 foils 77 r72 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm 1x12 foils 78 r73 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm 1x12 foils 79 r74 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm 1x12 foils 80 s140 eye pressure shield rc not exists 81 s141 eyelid occlusion dressing rc not exists 82 s138 core biopsy instrument with compatible co axial needle ( automatic disposal ) rc not exists 83 s139 disposable bone marrow biopsy needle rc not exists 84 s99.p2 sanitary napkin beltless with wings ( udan yojna ) 6 napkin / pack 85 s1 absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) piece 86 s3 asepto syringe with transparent bulb sterile, 60 ml rc not exists 87 s4 blood administration set blood transfusion set ( details in rc ) unit 88 s5.a gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 89 s5.b gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 90 s6.a gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 91 s6.b gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 92 s7.a gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 93 s7.b gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) pair 94 s8.a suction catheter, sterile.size: fg 5 ( details in rc ) each piece 95 s8.b suction catheter, sterile. size: f g 6 ( details in rc ) each piece 96 s8.c suction catheter, sterile. size: f g 8 ( details in rc ) each piece 97 s8.d suction catheter, sterile. size: f g 10 ( details in rc ) each piece 98 s8.e suction catheter, sterile. size: f g 12 ( details in rc ) each piece 99 s8.f suction catheter, sterile. size: f g 14 ( details in rc ) each piece 100 s8.g suction catheter, sterile. size: f g 16 ( details in rc ) each piece 101 s8.h suction catheter, sterile. size: f g 18 ( details in rc ) each piece 102 s8.i suction catheter, sterile. size: f g 20 ( details in rc ) each piece 103 s8.j suction catheter, sterile. size: f g 22 ( details in rc ) each piece 104 s9.a catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 105 s9.b catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 106 s9.c catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 107 s9.d catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 108 s9.e catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 109 s9.f catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 110 s9.g catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 111 s10.a infant feeding tube size 10fg ( details in rc ) each piece 112 s10.b infant feeding tube size 8fg ( details in rc ) each piece 113 s10.c infant feeding tube size 5fg ( details in rc ) each piece 114 s11 perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) unit 115 s12 perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) unit 116 s13 infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) unit 117 s14 insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 unit 118 s15.a sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) each piece 119 s15.b sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) each piece 120 s15.c sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) each piece 121 s15.d sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) each piece 122 s15.e sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) each piece 123 s16 mucus extractor sterile ( details in rc ) unit 124 s17.a nasal oxygen set, twin bore all sizes adult ( details in rc ) each piece 125 s17.b nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) each piece 126 s18 paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 127 s19 paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 128 s20 paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 129 s21 plaster of paris bandage 15cm x 2.7 mts / roll unit 130 s22 plaster of paris bandage 10cm x 2.7mts unit 131 s23.a ryles tube / nasogastric tube size: 10 ( details in rc ) each piece 132 s23.b ryles tube / nasogastric tube size: 12 ( details in rc ) each piece 133 s24.a ryles tube / nasogastric tube size:14 ( details in rc ) each piece 134 s24.b ryles tube / nasogastric tube size: 16 ( details in rc ) each piece 135 s24.c ryles tube / nasogastric tube size: 18 ( details in rc ) each piece 136 s25.a scalp vein set ( disposable ) size 18g ( details in rc ) each piece 137 s25.b scalp vein set ( disposable ) size 20g ( details in rc ) each piece 138 s25.c scalp vein set ( disposable ) size 22g ( details in rc ) each piece 139 s25.d scalp vein set ( disposable ) size 24 g ( details in rc ) each piece 140 s26 syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 141 s27 syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 142 s28 syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 143 s29 syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 144 s30.a surgical blade sterile, size 11 ( details in rc ) 100 blades / packet 145 s30.b surgical blade sterile, size 15 ( details in rc ) 100 blades / packet 146 s30.c surgical blade sterile, size 22 ( details in rc ) 100 blades / packet 147 s39.a sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) each piece 148 s39.b sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) each piece 149 s40 urine collecting bag, disposable 2000 ml ( details in rc ) unit 150 s41.a double j stent, sterile, both ends open size 4f, length 16 cm each piece 151 s41.b double j stent, sterile, both ends open, size 5f, length 20 cm each piece 152 s42.a double j stent, sterile, one end closed size 4f, length 16 cm each piece 153 s42.b double j stent, sterile, one end closed, size 5f, length 20 cm each piece 154 s43.a endotracheal tube, plain size 2.5 ( details in rc ) each piece 155 s43.b endotracheal tube, plain size 3 ( details in rc ) each piece 156 s43.c endotracheal tube, plain size 3.5 ( details in rc ) each piece 157 s43.d endotracheal tube, plain size 4 ( details in rc ) each piece 158 s43.e endotracheal tube, plain size 4.5 ( details in rc ) each piece 159 s43.f endotracheal tube, plain size 5 ( details in rc ) each piece 160 s43.g endotracheal tube, plain size 5.5 ( details in rc ) each piece 161 s43.h endotracheal tube, plain size 6 ( details in rc ) each piece 162 s43.i endotracheal tube, plain size 6.5 ( details in rc ) each piece 163 s43.j endotracheal tube, plain size 7 ( details in rc ) each piece 164 s43.k endotracheal tube, plain size 7.5 ( details in rc ) each piece 165 s43.l endotracheal tube, plain size 8 ( details in rc ) rc not exists 166 s43.m endotracheal tube, plain size 8.5 ( details in rc ) each piece 167 s44.a endotracheal tube, cuffed size 4 ( details in rc ) each piece 168 s44.b endotracheal tube, cuff size 4.5 ( details in rc ) each piece 169 s44.c endotracheal tube, cuff size 5 details in rc each piece 170 s44.d endotracheal tube, cuff size 6 ( details in rc ) each piece 171 s44.e endotracheal tube, cuff size 6.5 ( details in rc ) each piece 172 s44.f endotracheal tube, cuff size 7 ( details in rc ) each piece 173 s44.g endotracheal tube, cuff size 7.5 ( details in rc ) each piece 174 s44.h endotracheal tube, cuff size 8 ( details in rc ) each piece 175 s44.i endotracheal tube, cuff size 8.5 ( details in rc ) each piece 176 s44.j endotracheal tube, cuff size 9 ( details in rc ) each piece 177 s45 tracheostomy tube, plain all sizes ( details in rc ) each piece 178 s46 tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) each piece 179 s47.a abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) each piece 180 s47.b abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) each piece 181 s47.c abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) each piece 182 s73 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm piece 183 s74 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm piece 184 s79 sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) each piece 185 s80 bone wax sterilised 2.5 gram / packet 186 s82 skin graft knife blade ( sterile ) ( details in rc ) one pack each 187 s84.a k wire, length 375 mm; 1mm ( details in rc ) each piece 188 s84.b k wire, length 375 mm; 1.6mm ( details in rc ) each piece 189 s84.c k wire, length 375 mm; 1.8mm ( details in rc ) each piece 190 s85 face mask, disposable ( details in rc ) piece 191 s86.a surgical cap disposable ( for surgeons ) ( details in rc ) unit 192 s86.b surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) piece 193 s87.a foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 each piece 194 s87.b foldable intra ocular lense with injector ( details in rc ) 18 to 24 each piece 195 s87.c foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 each piece 196 s88.a standard pama intra ocular lenses ( details in rc ) 11 to 17.5 each piece 197 s88.b standard pama intra ocular lenses ( details in rc ) 18 to 24 each piece 198 s88.c standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 each piece 199 s89.a disposable sterile surgical rubber gloves size 8 inches, powdered pair 200 s89.b disposable sterile surgical rubber gloves size 8 inches, powder free pair 201 s90.a rubber examination gloves, non sterile, extra small ( details in rc ) dispenser box of100 gloves 202 s90.b rubber examination gloves, size small ( details in rc ) dispenser box of100 gloves 203 s90.c rubber examination gloves, size medium ( details in rc ) dispenser box of100 gloves 204 s90.d rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) dispenser box of100 gloves 205 s91 pressure monitoring line / high pressure extension line ( details in rc ) each piece in blister pack 206 s92 urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) each piece 207 s93 umbilical catheter for new born, all sizes ( details in rc ) each piece 208 s94 umbilical cord clamp ( details in rc ) each piece 209 s95 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) each piece 210 s96.a close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) each piece 211 s96.b close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) each piece 212 s98 bone cement rc not exists 213 s99.a sanitary napkin beltless ( details in rc ) 6 napkin / pack 214 s99.b sanitary pads belt type ( details in rc ) rc not exists 215 s99.p sanitary napkin beltless with wings ( details in rc ) rc not exists 216 s100 oxygen mask ( adult ) unit 217 s101 oxygen mask ( pediatric ) unit 218 s102 foleys catheter no. 14 ( detail in rc ) each piece 219 s103 nelaton catheter size 14 fg ( detail in rc ) each piece 220 s104 ecg electrode ( detail in rc ) each piece 221 s105 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) each piece 222 s106 sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) each piece 223 s107 urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) each piece 224 s108 urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) each piece 225 s109 vaccum suction set, 2.5 meter length ( detail in rc ) each piece 226 s110 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) each piece 227 s111 vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 228 s112 vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 229 s113 vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 230 s114 vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 231 s115 vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) each piece 232 s116 vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) each piece 233 s117 vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) rc not exists 234 s118 vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) rc not exists 235 s119 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) each piece 236 s120 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) each piece 237 s121 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) each piece 238 s122 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) each piece 239 s123 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) each piece 240 s124 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) each piece 241 s125 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) each piece 242 s126 nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) each piece 243 s127 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) each piece 244 s128 sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) rc not exists 245 s129 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) each piece 246 s130 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) each piece 247 s131 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) each piece 248 s132 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) each piece 249 s133 niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) each piece 250 s134 nebulization mask adult ( detail in rc ) each piece 251 s135 nebulization mask paediatric ( detail in rc ) each piece 252 s136 chemotherapy port and non coring needles ( adult ) ( detail in rc ) rc not exists 253 s137 chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) rc not exists 254 nrr 1 braided e caprolactone coated lactomer 1, 90cm gs 25, 37 40mm1 / 2 circle taper point each foil 255 nrr 2 braided e caprolactone coated lactomer 2 0 90cm gs 25, 3omm1 / 2 circle taper point each foil 256 nrr 3 braided e caprolactone coated lactomer 1 90cm gs 25, 37 40mm1 / 2 circle reverse cutting each foil 257 nrr 4 braided e caprolactone coated lactomer 1, 90cm gs 24 , violet 40mm 1 / 2 circle taper point each foil 258 nrr 5 braided e caprolactone coated lactomer 3 0 75cm c 14 , undyed 24mm 3 / 8 circle reverse cutting each foil 259 nrr 6 braided e caprolactone coated lactomer 2 0 90cm gs 21 , undyed 30mm 1 / 2 circle taper point each foil 260 nrr 7 braided e caprolactone coated lactomer 1 90cm gs 25 , undyed 37 40mm 1 / 2 circle reverse cutting each foil 261 nrr 8 braided e caprolactone coated lactomer 0 90cm gs 24 , violet 40mm 1 / 2 circle taper point each foil 262 nrr 9 braided e caprolactone coated lactomer 3 0 75cm cv 25 , violet 20 22mm 1 / 2 circle taper point each foil 263 nrr 10 braided e caprolactone coated lactomer 1 0 90cm gs 25 , undyed 37 40mm 1 / 2 circle reverse cutting each foil 264 nrr 11 polyglactin 910 violet braided, 1, 35 cm 1 / 2 circle reverse cutting ( heavy ) 23 mm each foil 265 nrr 12 polyglactin 5 0 rb oval ½ circle 16 mm 45 cm each foil 266 nrr 13 polyglactin 5 0 cc 3 / 8 circle 16 mm 45 cm each foil 267 nrr 14 polyglactin 6 0 micro point ¼ circle 8 mm 45 cm each foil 268 nrr 15 polyglactin 910, braided coated with antibacterial 2 / 0, 70 cm undyed with ½ circle 25 mm rb each foil 269 nrr 16 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cm size 3 0 each foil 270 nrr 17 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cm size 4 0 each foil 271 nrr 18 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cm size 5 0 each foil 272 nrr 19 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm each foil 273 nrr 20 absorbable surgical suture sterilized surgical needled suture loop monofilament polydiaxanone violet no 1 40mm1 / 2 circle reverse cutting length 90 cm each foil 274 nrr 21 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 2 0 rb 30 mm needle length 75 cm each foil 275 nrr 22 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 6 0 rb 17 mm needle length 90 cm each foil 276 nrr 23 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 6 0 rb 11 mm needle length 90 cm each foil 277 nrr 24 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 5 0 rb 11 mm needle length 90 cm each foil 278 nrr 25 absorbable surgical suture sterilized surgical single armed needled suture monofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm each foil 279 nrr 26 monofilament polyglyconate 1 150cm gs 25 loop, green 48mm 1 / 2 circle taper point each foil 280 nrr 27 monofilament polyglyconate 2 0, 75cm green 26 30mm 1 / 2 circle taper point each foil 281 nrr 28 monofilament polyglyconate 3 0, 75cm green 20 26mm 1 / 2 circle taper point each foil 282 nrr 29 monofilament polyglyconate 4 0, 75cm green 17 20mm 1 / 2 circle taper point each foil 283 nrr 30 polydioxanone voilet monofilament, 3 0, 70 cm, 1 / 2 circle taper point rb 1, 17mm, each foil 284 nrr 31 polydioxanone voilet monofilament, 4 0, 70 cm, 1 / 2 circle taper point rb 1, 17mm, each foil 285 nrr 32 polydioxanone monofilament ( voilet ) , 5 0, 70 cm 1 / 2 circle round body double needle 13 mm each foil 286 nrr 33 monofilament glycomer 1, 90cm gs 21 , volet 37mm 1 / 2 crcle taper pont each foil 287 nrr 34 monofilament glycomer 2 0 90cm gs 21 , volet 37mm 1 / 2 crcle taper pont each foil 288 nrr 35 non absorbable surgical suture, sterilized surical needled black braided silk with needle 1 / 2 circle round bodied 30 mm needle , length 70 cm size 2 0 each foil 289 nrr 36 silk reel 1 0 each foil 290 nrr 37 silk reel 2 0 each foil 291 nrr 38 silk reel 3 0 each foil 292 nrr 39 silk reel 4 0 each foil 293 nrr 40 braided polyester caoted with silicon 2 0 8x75cm 2xy 31 plgt , blue & white 16mm 1 / 2 circle tapercutting oval pledget each foil 294 nrr 41 braided polyester caoted with silicon 2 0 10x75 2xcv 305 pgt , blue & white 25mm 1 / 2 circle taper point oval pledget each foil 295 nrr 42 braided polyester caoted with polybutylate 2 0 8x75cm 2x plgt , blue & white 16mm 1 / 2 circle tapercutting oval pledget each foil 296 nrr 43 braided polyester caoted with polybutylate 2 0 10x75 2x plgt, blue & white 25mm 1 / 2 circle taper point oval pledget each foil 297 nrr 44 braided polyester caoted with silicon 2, 26mm 1 / 2 circle rc 75cm each foil 298 nrr 45 braided polyester caoted with silicon 5, 55mm 1 / 2 circle rc 75cm each foil 299 nrr 46 braided polyester caoted with polybutylate 2, 26mm 1 / 2 circle rc 75cm each foil 300 nrr 47 braided polyester caoted with polybutylate 5, 55mm 1 / 2 circle rc 75cm each foil 301 nrr 48 monofilament polypropylene with peg additive 3 0 90cm 2xvf 20 , blue 26mm 1 / 2 circle taper point each foil 302 nrr 49 monofilament polypropylene with peg additive 2 0 90cm 2xv 20 , blue 30mm 1 / 2 circle taper point each foil 303 nrr 50 monofilament polypropylene with peg additive 4 0 90cm 2xcv 23 , blue 17mm 1 / 2 crcle taper cut each foil 304 nrr 51 monofilament polypropylene with peg additive 5 0 90cm 2xcv 23 , blue 17mm 1 / 2 crcle taper pont each foil 305 nrr 52 monofilament polypropylene with peg additive 6 0 75cm 2xcv 22 , blue 13mm 1 / 2 crcle taper pont each foil 306 nrr 53 monofilament polypropylene with peg additive 7 0 60cm 2xkv 1 , blue 9mm 3 / 8 crcle tapercuttng each foil 307 nrr 54 polypropylene blue monofilament, 2 0, 90 cm 1 / 2 circle round body double needle 26 mm each foil 308 nrr 55 polypropylene blue monofilament, 3 0, 90 cm 1 / 2 circle round body double needle 26 mm each foil 309 nrr 56 polypropylene blue monofilament, 4 0, 75 cm 1 / 2 circle round body double needle 17 mm each foil 310 nrr 57 polypropylene blue monofilament, 5 0, 90 cm 1 / 2 circle round body double needle 17 mm each foil 311 nrr 58 polypropylene blue monofilament, 6 0, 75 cm 3 / 8 circle round body ( 380 microns ) double needle 13 mm each foil 312 nrr 59 polypropylene blue monofilament, no. 7 0, 60 cm 3 / 8 circle round body, taper point double needle 9 mm each foil 313 nrr 60 monofilament polybuetester coated with polytribiolate 6 0 75cm 2xcv 1x36 , blue 9mm 3 / 8 circle taper point each foil 314 nrr 61 monofilament polybuetester coated with polytribiolate 4 0 90cm 2xcv 23x36 , blue 17mm 1 / 2 circle taper point each foil 315 nrr 62 monofilament polybuetester coated with polytribiolate 7 0 60cm 2xmv 175 8 , blue 8mm 3 / 8 circle taper point each foil 316 nrr 63 monofilament polybuetester coated with polytribiolate 2 0 90cm 2xv 20x36 , blue 26mm 1 / 2 circle taper point each foil 317 nrr 64 monofilament polybuetester coated with polytribiolate 3 0 90cm 2xv 20x36 , blue 26mm 1 / 2 circle taper point each foil 318 nrr 65 non absorbable synthetic unidrectional dual cut angle barb with welded loop end made up with polybeutester size 1, 37mm, 30cm, 1 / 2 circle, tp each foil 319 nrr 66 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polybeutester blue size 2 0, 1 / 2 circle, 37mm, 30cm tp, each foil 320 nrr 67 absorbable synthetic unidirectional dual cut angle barbed with welded loop end made up with polyglyconate 2 0 26 30 mm 30 cm 1 / 2 circle taper point each foil 321 nrr 68 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 1 0, 1 / 2 circle, 37mm, 30cm tp each foil 322 nrr 69 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 2 0, 1 / 2 circle, 26mm, 30cm tp each foil 323 nrr 70 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 3 0, 1 / 2 circle, 26mm, 30cm tp each foil 324 nrr 71 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with glycomer blue size 2 0, 1 / 2 circle, 24mm, 30 45cm rc each foil 325 nrr 72 laproscopic knotless pga pcl surgical suture self fixation device with autolock mechanism made up of pga pcl unidirectional taper point 26 mm & 20 cm size 2 0 each foil 326 nrr 73 polyester ethylene terephthalate nonabsorbable surgical suture polyester suture is a nonabsorbable, braided, sterile, surgical suture composed of poly ( ethylene terephthalate. ) it is prepared from fibers of high molecular weight, long chain, linear polyesters 1 / 2 circle tapercut 2 x v 5 double needle 26 mm 90 cm green color size 2 0 each foil 327 nrr 74 laproscopic knotless pga pcl bidirectional taper point surgical suture self fixation device with autolock mechanism made up of pga pcl bidirectional taper point 17 mm & 32cm each foil 328 nrr 75 absorbable antibacterial polydiaxonone monofilament taper point surgical suture absorbable antibacterial suture made up of polydiaxonone coated with triclosan voilet monofilament 1 / 2 circle taper point ct 1 40 mm needle 90 cm suture size 1 each foil 329 nrr 76 absorbable antibacterial polydiaxonone monofilament taper point surgical suture absorbable antibacterial suture made up of polydiaxonone coated with triclosan voilet monofilament 1 / 2 circle taper point loop ct sgle armed 65 mm needle 122 cm suture size 1 each foil 330 nrr 77 laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab reverse cutting 36 mm & 45 cm suture size 1 each foil 331 nrr 78 laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab taper point 36 mm & 45 cm suture size 1 0 each foil 332 nrr 79 non absorbable surgical suture black braided silk 1 0 rb ½ circle 30 mm 90 cm each foil 333 nrr 80 non absorbable surgical suture black braided silk 1 0 rc 3 / 8 circle 45 mm 76 cm each foil 334 nrr 81 non absorbable surgical suture black braided silk 5 0 rc 3 / 8 circle 12 mm 76 cm each foil 335 nrr 82 non absorbable surgical suture black braided silk 5 0 rb 3 / 8 circle 16 mm 76 cm each foil 336 nrr 83 non absorbable surgical suture black braided silk 6 0 rc mp 3 / 8 circle 8 mm each foil 337 nrr 84 non absorbable monofilament 3 0 reverse cutting 24mm needle each foil 338 nrr 85 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 2 0 rb ½ circle 30 mm 70 cm each foil 339 nrr 86 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 6 0 rb micro point ¼ circle 8 mm 45 cm 2670 each foil 340 nrr 87 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 4 0 cc 3 / 8 circle 16 mm 45 cm 2442 each foil 341 nrr 88 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 3 0 cc 3 / 8 circle 16 mm 45 cm 2442 each foil 342 nrr 89 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 6 0 rc micro point ¼ circle 8 mm 45 cm 2670 each foil 343 nrr 90 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 5 0 cc 3 / 8 circle 16 mm 45 cm 2442 each foil 344 nrr 91 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 5 0 rb oval 1 / 2 circle 16 mm 45 cm each foil 345 nrr 92 endoloop ligature made with polyglactin suture length18 inch, narrow at one end and scored at other each foil 346 nrr 93 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) ( 3 / 8 cir micropoint royund body 6mm length 38 cm ) 9 0 each foil 347 nrr 94 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) ( 3 / 8 cir micropoint royund body 6mm length 38 cm ) 10 0 each foil 348 nrr 95 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm3 0 each foil 349 nrr 96 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm4 0 each foil 350 nrr 97 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm 5 0 each foil 351 nrr 98 non absorbale surgical suture sterlised surgical needle suture monofilament polypropylene blue 1 / 2 circle round body 13 mm needle length 75 cm 6 0 each foil 352 nrr 99 non absorbale surgical suture sterlised surgical needle suture monofilament polypropylene blue 1 / 2 circle round body 13 mm needle length 75 cm 7 0 each foil 353 nrr 100 non absorbale surgical suture sterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm3 0 each foil 354 nrr 101 non absorbale surgical suture sterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm4 0 each foil 355 nrr 102 non absorbale surgical suture sterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm 5 0 each foil 356 nrr 103 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 3 0 each foil 357 nrr 104 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 4 0 each foil 358 nrr 105 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 5 0 each foil 359 nrr 106 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 6 0 each foil 360 nrs 1 nonabsorbable polypropylene light weight macroporous mesh each unit 361 nrs 2 three dimensional monofilament polyester composite mesh with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial each unit 362 nrs 3 three dimensional monofilament polyester composite mesh with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial each unit 363 nrs 4 three dimensional monofilament polyester composite mesh with with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial each unit 364 nrs 5 absorbable 5 mm hernia mesh fixation device 30 screw shaped with proximal wings of pgla tacks of 4.1 mm length along with flexible shaft up to 3 cm. each unit 365 nrs 6 absorbable 5 mm hernia mesh fixation device 15 screw shaped with proximal wings of pgla tacks of 4.1 mm length along with flexible shaft up to 3 cm. each unit 366 nrs 7 non absorbable 5 mm hernia mesh fixation device with 30 helical shaped titanium tacks 3.96mm width and 0.61 mm diameter each unit 367 nrs 8 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatic polymer ( peek ) cap to avoid metal exposure with 15 fasteners each unit 368 nrs 9 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatic polymer ( peek ) cap to avoid metal exposure with 30 fasteners each unit 369 nrs 10 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 370 nrs 11 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 371 nrs 12 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 372 nrs 13 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 373 nrs 14 battery operated 60mm articulating endo cutter with a disposable battery pack, for enhanced distal tip stability while firing, having closed channel in the cartrdige jaw for better stability during firing, 360 degree rotation shaft and one handed natural articulation up to 45 degrees, precision machined anvil to deliver initial, system wide compression, wide proximal to distal jaw aperture ( proximal 8mm , distal 22mm ) , 3 point gap control for alignment and calibration throughout the 60 mm staple line, knife direction / reverse control to discontinue the firing and return the knife, interchangeable 6 row cartridge options of white, blue , gold, green and black, all fits down to 12mm trocar sleeve, 440 mm shaft length 60 mm stapler each unit 374 nrs 15 linear cutter 55mm with six rows, 3d staple formation, option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only each unit 375 nrs 16 linear cutter 75mm with six rows, 3d staple formation, option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only each unit 376 nrs 17 universal linear cutter cartridge 75mm open linear cutter compatible with selectable staple height linear cutter 75mm.option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only. 6 rows 3 d staple technology. each unit 377 nrs 18 universal linear cutter cartridge 55mm for open linear cutter compatible with selectable staple height linear cutter 55mm.option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only. 6 rows 3 d staple technology. each unit 378 nrs 19 curved cutter stapler 40 mm linear cutter simultaneous cutting and stapling each unit 379 nrs 20 curved green cartridge having close staple height of 2.0 mm, tactile feedback on completion of firing sequence, new anvil, knife with every catridge each unit 380 nrs 21 powered circular stapler 29 mm with 3d staple and not slip grip each unit 381 nrs 22 powered circular stapler 31mm with 3d staple and not slip grip each unit 382 nrs 23 circular stapler 33mm with controlled tissue compression with adjustable staple height ( 1.0 2.5 mm ) for controlled tissue compression, longer staple leg 5.5mm & non slip grip surface each unit 383 nrs 24 laparoscopic cartridge for stapler 60 mm blue, 1.5 mm closed staple height with gripping surface technology and six rows compatible with all range of endoscopic linear cutter 60mm each unit 384 nrs 25 laparoscopic cartridge for stapler 60 mm green, 2.0 mm closed staple height with gripping surface technology and six rows compatible with all range of endoscopic linear cutter 60mm each unit 385 nrs 26 pph stapler 33mm hemorrhoidal stapler kit consists of 33mm hemorrhoidal circular stapler ( with fixed anvil, adjustable closed staple height from 0.75 mm – 1.5 mm, staple open leg length of 5.5 mm ) , suture threader, circular anal dilator, purse string suture anoscope, suture for purse string. each unit 386 nrs 27 optically guided bladeless trocar 12mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer, 150mm length. each unit 387 nrs 28 optically guided bladeless trocar 12 mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer length 100mm. each unit 388 nrs 29 facial closure device contain optical bladeless trocar with facial closure device comaptible with clear cannula have two side opening meant for uniform port closure each unit 389 nrs 30 varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length each unit 390 nrs 31 varied staple height reloads / cartridges for 80 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length each unit 391 nrs 32 linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 60 mm tristaple gia stapler, compatible with tri staple gia 60 mm open linear cutter reloads / cartridges purpule and black each unit 392 nrs 33 eea circular stapler purple colour medium thick , triple row with tristaple technology ( three row of staple inner to outer row 3.0, 3.5 and 4.0 mm with sloped cartridges face in one stapler ) diameter 31mm each unit 393 nrs 34 linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 80 mm tristaple gia stapler, compatible with tri staple gia 80 mm open linear cutter reloads / cartridges purpule and black each unit 394 nrs 35 wound protector with double ring in small 2.5 6 cm usfda approved each unit 395 nrs 36 wound protector with double ring in medium 5 9 cm each unit 396 nrs 37 wound protector with double ring in large in size 9 14 cm usfda approved each unit 397 nrs 38 endo catch specimen removal kit:with continuous ring , polyurethane pouch with 34.5 cm shaft length , 10mm with leakproof and impervious material to cancer cells of 0.5 microns / pretied purse string on pouch usfda approved each unit 398 nrs 39 disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logic technology and digital display titanium clips u shaped each unit 399 nrs 40 laparoscopic liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 30mmcapable of loading all length cartridges on same gun only each unit 400 nrs 41 laparoscopic liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 45mm capable of loading all length cartridges on same gun only each unit 401 nrs 42 laparoscopic liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 60mm, capable of loading all length cartridges on same gun only each unit 402 nrs 43 hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, 9cm length, 16mm curved active blade with adaptive tissue technology capable of sealing blood vessels up to and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 9 each unit 403 nrs 44 hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, 17cm length, 16mm curved active blade with adaptive tissue technology capable of sealing blood vessels upto and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 17 each unit 404 nrs 45 advance bipolar hand activated probe with 5mm shaft diameter and 35 cm shaft length with 5 mm wide straight jaw design with seal length of 20mm and cut length of 16mm, sealing vessel upto and including 7mm through radio frequency energy and having a temperature controlled mechanism within the jaw and having articulation of 110 degree ( 55 degrees on both sides ) and capable of 360 degrees rotation each unit 405 nrs 46 advance bipolar hand activated probe with 5mm shaft diameter and 45 cm shaft length with 5 mm wide straight jaw design with seal length of 20mm and cut length of 16mm, sealing vessel upto and including 7mm through radio frequency energy and having a temperature controlled mechanism within the jaw and having articulation of 110 degree ( 55 degrees on both sides ) and capable of 360 degrees rotation each unit 406 nrs 47 advance bipolar hand activated probe for open surgery with 13mm shaft diameter and 20 cm shaft length, 6 mm wide straight jaw design with jaw length of 38 mm , sealing vessel upto and including 7mm through radio frequency energy , having separate seal and cut buttons, capable of 360 degrees rotation each unit 407 nrs 48 laparoscopic shears 5mm diameter, 36cm long, 15mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 5mm in diameter, 360 degrees rotation, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation each unit 408 nrs 49 advanced bipolar tissue sealer 25 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in open surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation each unit 409 nrs 50 advanced bipolar tissue sealer 37 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation each unit 410 nrs 51 advanced bipolar tissue sealer 45 cms with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation each unit 411 nrs 52 laparoscopic shears 5mm diameter, 36cm long, 18mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter , ergonomic handle compatible with ultrasonic energy source, capable of hand and foot activation with an integrated hand piece and transducer. each unit 412 nrs 53 connecting cable for ultrasonic harmonic scalpel for open energy probes compatible with focus plus shear hp blue each unit 413 nrs 54 connecting cable for ultrasonic harmonic scalpel for lap energy probes compatible with ace plus shear hp054 each unit 414 nrs 55 laparoscopic shears 5mm diameter, 45cm long, 15mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation each unit 415 nrs 56 nasal haemostatic sponge pack ( with airway ) 10 inch each unit 416 nrs 57 platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 2*2 ) hole drill bit machine with insertion tools each unit 417 nrs 58 platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 1*2 ) hole drill bit machine with insertion tools each unit 418 nrs 59 platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 1*1 ) hole drill bit machine with insertion tools each unit 419 nrs 60 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 2 mm ) diameter drill bit machine with insertion tools each unit 420 nrs 61 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 1.5 mm ) diameter drill bit machine with insertion tools each unit 421 nrs 62 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 2.5 mm ) diameter drill bit machine with insertion tools each unit 422 nrs 63 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 3 mm ) diameter drill bit machine with insertion tools each unit 423 nrs 64 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 4 mm ) each unit 424 nrs 65 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 6 mm ) each unit 425 nrs 66 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 8 mm ) each unit 426 nrs 67 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 10 mm ) each unit 427 nrs 68 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 12.5 mm ) each unit 428 nrs 69 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 4 mm ) each unit 429 nrs 70 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 6 mm ) each unit 430 nrs 71 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 8 mm ) each unit 431 nrs 72 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 10 mm ) each unit 432 nrs 73 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 12.5 mm ) each unit 433 nrs 74 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 6 mm ) each unit 434 nrs 75 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 8 mm ) each unit 435 nrs 76 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 10 mm ) each unit 436 nrs 77 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 12.5 mm ) each unit 437 nrs 78 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 4 mm ) each unit 438 nrs 79 block used in thyroplasty ( sialestic and gortex ) 70*50 mm with 20 mm thickness each unit 439 nrs 80 disposable needle 16g x 1 inch each unit 440 nrs 81 curved tip & stepped cartridges face from inner to outer side 2.0, 2.5 and 3.0 mm staple heights row for variable thickness tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 45 mm tan colour code for vascular applications each unit 441 nrs 82 curved tip & stepped cartridges face from inner to outer side 3.0, 3.5 and 4.0 mm staple heights row for variable thickness tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 45 mm purpule colour code for medium to thick tissue each unit 442 nrs 83 varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with black varied staple height of 4, 4.5 and 5mm leg length each unit 443 nrs 84 disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logic technology and digital display titanium clips u shaped each unit 444 nrs 85 synthetic oxidised re generated cellulose double layered with peg and trilysine size 2*4cm each unit 445 nrs 86 synthetic oxidised re generated cellulose double layered with peg and trilysine size 5*10cm each unit 446 nrs 87 disposable 10 mm endoscopic clip applier with facility of loading clips independent of the firing mechanism: medium / large size each unit 447 nrs 88 disposable 10 mm endoscopic clip applier with facility of loading clips independent of the firing mechanism large size each unit 448 nrs 89 endo liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 30mm, capable of loading all length cartridges on same gun only each unit 449 nrs 90 endo liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 45mm capable of loading all length cartridges on same gun only each unit 450 nrs 91 endo liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 60mm, capable of loading all length cartridges on same gun only each unit 451 nrs 92 disposable clip applier preloaded with 20 clips, superinterlock security with clip design technology medium each unit 452 nrs 93 disposable clip applier preloaded with 20 clips, superinterlock security with clip design technology small each unit 453 nrs 94 sterile hypodermic syringe with needle attached, 22g, single use 2 ml each unit 454 nrs 95 sterile hypodermic syringe with needle attached, 22g, single use 5 ml each unit 455 nrs 96 biological glue with thrombin & aprotinin 1ml each unit 456 nrs 97 biological glue with thrombin & aprotinin 2ml each unit 457 nrs 98 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 458 nrs 99 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 459 nrs 100 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 460 nrs 101 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 461 nrs 102 sterile oxidized regenerated cellulose hemostating agent in netform fibrillar and in thick sheath as per ip each unit 462 nrs 103 urine collecting bag, disposable 2000 ml with uroflow meter each unit 463 nrs 104 central neck line double lumen ( 3 nobel metal coated ( gold, silver, palladium ) central lumen catheter, double lumen ) each unit 464 nrs 105 microcatheter selective infusion microcatheters for intra cranial aneurysm treatment with 2 tip markers each unit 465 nrs 106 microcatheter selective infusion microcatheters for deploying intracranial device: stent deployment each unit 466 nrs 107 microcatheter selective infusion microcatheters for flow diverter delivery with single tip markers 0.027inch each unit 467 nrs 108 microcatheter flow dependent super selective high flow infusion microcatheters for cerebral / spinal avms ( compatible with dmso ) each unit 468 nrs 109 micro guide wire for microcatheter shapable distal end and with torque 0.014inch each unit 469 nrs 110 bare platinum coil complex shape, soft, electrolytic detachable framing and filling each unit 470 nrs 111 bare platinum coil complex shape, soft, mechanically detachable framing and filling each unit 471 nrs 112 bare platinum coil helical shape, soft, electrolytic detachable each unit 472 nrs 113 bare platinum coil helical shape, soft, mechanically detachable each unit 473 nrs 114 aortic punch 2.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 474 nrs 115 aortic punch 3 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 475 nrs 116 aortic punch 3.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 476 nrs 117 aortic punch 4 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 477 nrs 118 aortic punch 4.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 478 nrs 119 aortic punch 5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 479 nrs 120 aortic punch 5.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 480 nrs 121 aortic punch 3.6 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 481 nrs 122 folleys catheter fixation divice foley catheter holder universal size should have leg band and is disposable single patiemnt use device should have catheter grip of 18 to 24 fr catheter and made of crobelt or any other. each unit 482 nrs 123 tur set tur irrigation set disposable urology instrument urology equipment endosurgery, mfg from clinical grade non toxic medical transparent pvc sheet, y shaped connector with pointed spike to easy pierce facilities alternative change solution, thumb operated clamp smooth chnage of bottle, proximal end fitted with flexible latest tubing for easy connection to endoscope, eto steril individual pack. should have minium lenght of 260 cm or more. each unit 483 nrs 124 laproscopic port with trocar 5mm optically guided bladeless trocar 5mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer, 150mm length. each unit 484 nrs 125 each unit 485 nrs 126 each unit 486 nrs 127 each unit 487 nrs 128 each unit 488 nrs 129 each unit 489 nrs 130 each unit 490 nrs 131 each unit 491 nrs 132 each unit 492 nrs 133 each unit 493 nrs 134 each unit 494 nrs 135 each unit 495 nrs 136 each unit 496 nrs 137 each unit 497 nrs 138 each unit 498 nrs 139 each unit 499 nrs 140 patient pre operative skin prepration solution 26 ml in one step sterile applicator container for single use with 2% chlorohexdine gluconate ( chg ) and 70% ipa with orange tint colour or easy visulization, us fda approved each unit 500 nrs 141 rem and non rem single use, corded patient return electrodes conductive adhesive hydrogel with usfda. each unit 501 nrs 142 chlorhexidine impregnated paraffin gauze 30x10 cm each unit 502 nrs 143 chlorhexidine impregnated paraffin 15 cm x 1 roll each unit programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. 503 nrs 144 surgical gloves 6.5 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved each unit 504 nrs 145 surgical gloves 7 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved each unit 505 nrs 146 surgical gloves 7.5 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved each unit 506 nrs 147 ionic silver dressings with broad spectrum antimicrobial, bactericidal, biofilm destruction & reformation efficacies recommended for low to high exuding wounds 5 cms x 5 cms each unit 507 nrs 148 ionic silver dressings with broad spectrum antimicrobial, bactericidal, biofilm destruction & reformation efficacies recommended for low to high exuding wounds 10 cms x 10 cms each unit 508 nrs 149 self adherent moist wound dressing made up of triple hydrocolloid matrix, elastomeric polymer for pressure ulcers / bed sores 10 cms x 10 cms each unit 509 nrs 150 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand broad spectrum antimicrobial & bactricidal activity with high exudate management capability with a wear time of 21 days & locking in edudates in gel form 23 x 100 cms each unit 510 nrs 151 double wall resuscitator with peep valve in adult it should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve for adult bag volume: mark iv ( 1300 ml ) weight: adult ( 415 g ) it should be us fda, ce & iso certified each unit 511 nrs 152 double wall resuscitator with peep valve in paediatrics it should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve for peadiatric it should have provision to attach manometer for paediatrics ambu bag bag volume: mark iv baby ( 300 ml ) weight: baby ( 190 g ) it should be us fda, ce & iso certified each unit 512 nrs 153 single patient use sebs resuscitator ( spur ii with peep valve in adult ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: adult ( 1475 ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. each unit 513 nrs 154 single patient use sebs resuscitator ( spur ii with peep valve in paed ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip.it should have provision to attach manometer for paediatrics ambu bag. • resuscitator volume: pediatric ( 635 ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. each unit 514 nrs 155 single patient use sebs resuscitator ( spur ii with peep valve in neonatal ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: neonate ( 220ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. each unit 515 nrs 156 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 516 nrs 157 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 517 nrs 158 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 518 nrs 159 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 519 nrs 160 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 520 nrs 161 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 521 nrs 162 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 522 nrs 163 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 523 nrs 164 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 524 nrs 165 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 525 nrs 166 silicone pre formed sga total size 8 • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 526 nrs 167 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 527 nrs 168 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 528 nrs 169 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 529 nrs 170 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 530 nrs 171 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 531 nrs 172 cervical collar with 12 sizes settings • it should be latex free adjustable collar with 12 size setting in paediatric collar • it should have standard sizing line for easy and accurate sizing • it should be ce / iso, us fda certified each unit 532 nrs 173 cervical collar with 16 sizes settings • it should be latex free adjustable collar with 16 size setting in adult collar • it should have standard sizing line for easy and accurate sizing • it should be ce / iso, us fda certified each unit 533 nrs 174 offset connector cardio sensor electrodes • it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm each unit 534 nrs 175 offset connector cardio sensor electrodes • it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm each unit 535 nrs 176 offset connector cardio sensor electrodes • it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm each unit 536 nrs 177 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone each unit 537 nrs 178 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 538 nrs 179 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 539 nrs 180 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 540 nrs 181 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 541 nrs 182 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 542 nrs 183 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 543 nrs 184 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 544 nrs 185 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 545 nrs 186 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 546 nrs 187 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 547 nrs 188 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 548 nrs 189 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 549 nrs 190 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 550 nrs 191 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 551 nrs 192 rhinolaryngo single patient use slim scope insertion tube diameter : 3.0mm. working length: 300 mm bending range : 130 degree up & 130 degree down field of view : 85 degree or more direction of view : 0 degree ( forward view ) depth of field : 6 50 mm or better complete system should be us fda and european ce certified each unit 552 nrs 193 rhinolaryngo single patient use invtervention scope channel width : 2.2mm insertion tube diameter : 5.0 mm. working length : 350 mm bending range :130 degree up & 130 degree down field of view : 85 degree or more direction of view : 0 degree ( forward view ) depth of field : 6 50 mm or better complete system should be us fda and european ce certified each unit 553 nrs 194 ultrasorbs ap disposable drypads, dry pad for moisture management, 58.4x90cm, with breathable layer, super absorbent core, aqua shield film and air permeable back sheet, absorbency of 1800 2300gm, usfda / ce / bis compliant, iso13485 compliant each unit 554 nrs 195 elastic head strap cannulas pediatric elastic head strap cannulas pediatric must be soft siliconised, transparent vinyl; adjustable elastic band for comfortable, snug fit below the ears; complete kit with 7 ft oxygen supply tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 555 nrs 196 over the ear nasal cannula over the ear nasal cannula with star lumen, 50 tubing, must be flexible contoured lip tab provides a high level of stability and patient comfort. over the ear design for a comfortable and secure fit, crush and kink resistant tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 556 nrs 197 pediatric nasal cannula pediatric nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight, flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs help maximize patient comfort. individually packaged for convenience and sterility. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 557 nrs 198 infant nasal cannula infant nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight, flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs to help maximize patient comfort. individually packaged for convenience and sterility. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 558 nrs 199 volumetric incentive spirometer ( adult ) volumetric incentive spirometer ( adult ) 4000 ml with handle. volume measurement must be compact comfortable designed to accommodate large inspired volumes. must have goodbetter best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 559 nrs 200 volumetric incentive spirometer ( pediatric ) volumetric incentive spirometer ( pediatric ) 2500 ml with handle. volume measurement must be compact comfortable designed to accommodate large inspired volumes. must have good better best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 560 nrs 201 inspiratory exerciser with 3 color coded balls, 3 chambers inspiratory exerciser with 3 color coded balls, 3 chambers & wide flow rate range from 600 to 1200 cc / sec, with minimum flow imprinted on each chamber. must be compact design and made of break resistant plastic. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 561 nrs 202 adult mask for tracheostomy adult mask for tracheostomy and laryngectomy aerosol therapy tubing connector must swivels 360° for ease of positioning; 22 mm od connector accepts 22 mm, corrugated tubing and nebulizer tees. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 562 nrs 203 pardiatric mask for tracheostomy pediatric mask for tracheostomy and laryngectomy aerosol therapy tubing connector must swivels 360° for ease of positioning; 22 mm od connector accepts 22 mm, corrugated tubing and nebulizer tees. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 563 nrs 204 elongated aerosol mask adult elongated aerosol mask adult with under the chin design for excellent fit on wide range of face sizes must be clear, soft vinyl for patient comfort; adjustable nose clip assures comfortable fit; specifically designed for aerosol therapy; must be with supplied with 6 ft. corr a flex corrugated tubing, featuring cuttable sections every 6 in. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 564 nrs 205 elongated aerosol mask pediatric elongated aerosol mask pediatric with under the chin design for excellent fit on wide range of face sizes must be clear, soft vinyl for patient comfort; adjustable nose clip assures comfortable fit; specifically designed for aerosol therapy; must be with supplied with 6 ft. corr a flex corrugated tubing, featuring cuttable sections every 6 in. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 565 nrs 206 elongated three in one adult mask elongated three in one adult mask must be able to use as a medium concentration, highconcentration or nonrebreathing mask which includes mask with flapper valve, nonrebreathing bag assembly; adjustable nose clip assures comfortable fit; with 7 ft. star lumen oxygen supply tubing; 750 ml reservoir bag. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 566 nrs 207 adult conventional single water trap adult conventional single water trap ( non heated ) ventilator circuits are available in a variety of different configurations and styles.to incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector inspiratory limb water trap ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 567 nrs 208 adult ventilator circuit single limb portable adult ventilator circuit with universal single limb. must be complete kit with main circuit hose, exhalation valve manifold, aerosol hose, patient elbow connector, proximal airway pressure line, exhalation valve line, and humidifier limb. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 568 nrs 209 adult ventilator circuit single water trap adult conventional single water trap ( non heated ) ventilator circuits are available in a variety of different configurations and styles.to incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector inspiratory limb water trap ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 569 nrs 210 adult conventional dual limb water trap adult conventional dual limb water trap ( non heated ) ventilator circuits are available in a variety of different configurations and styles.to incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector dual limb inspiratory & expiratory water trap 22mm tubing, ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 570 nrs 211 infant prong cpap cannula infant prong cpap cannula nasal size 0 with designed to reduce trauma associated with delivery of infant nasal cpap. must be soft siliconised, anatomically curved prongs to enhance fit. luer fitting on expiratory connector to allow proximal airway pressure monitoring. each set to include, soft siliconised cannula; inspiratory & expiratory elbow connector; knit cap; two 6 in. hook and loop fastener sections; two 10 to 7.5 mm adaptors. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 571 nrs 212 fhme heat and moisture exchangers with bacteria viral filters bacterial filtration efficiency> 99.99 % and viral filtration efficiency > 99.9999% . filter membrane should be of a hydrophobic non woven polypropylene material. should be tailored to meet the specific needs of both anaesthesia and intensive care. each unit 572 nrs 213 tracheostomy hme: 1 heat and moisture exchangers for spontaneously breathing tracheotomy patients. 2 should have in built oxygen port. 3 should be compact & light wt. 4 should be suitable for ambulatory patients, sampling and suctioning can be done without removing it. 5 the system should have kink resisting oxygen tubing each unit 573 nrs 214 double lumen endobronchial tube left: size 28fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 574 nrs 215 double lumen endobronchial tube left: size 32fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 575 nrs 216 double lumen endobronchial tube left: size 35fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 576 nrs 217 double lumen endobronchial tube left: size 37fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 577 nrs 218 double lumen endobronchial tube left: size 39fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 578 nrs 219 double lumen endobronchial tube left: size 41fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 579 nrs 220 double lumen endobronchial tube right: size 35fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 580 nrs 221 double lumen endobronchial tube right: size 37fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 581 nrs 222 double lumen endobronchial tube right: size 39fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 582 nrs 223 sub glottic tube taper guard evac: sizes 6mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 583 nrs 224 sub glottic tube taper guard evac: sizes 6.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 584 nrs 225 sub glottic tube taper guard evac: sizes 7mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 585 nrs 226 sub glottic tube taper guard evac: sizes 7.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 586 nrs 227 sub glottic tube taper guard evac: sizes 8mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 587 nrs 228 sub glottic tube taper guard evac: sizes 8.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 588 nrs 229 sub glottic tube taper guard evac: sizes 9mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 589 nrs 230 inflation device inflation device in 30atm & 20ml with clear polycarbonate barrel for easy visualisation of bubbles, luminescent dial, airless rotator, lock release handle for easy one handed control and primelok for easy preparation.usfda approved each unit 590 nrs 231 manifold manifolds in 2, 3, 5 port with configuration of left right orientation, on off handle, full half body, 200 psi 500 psi rating and wide port spacing. should have clear polycarbonate body to provide durability and visibility, airless rotator and large bore inner lumen throughout including rotator.usfda approved each unit 591 nrs 232 high pressure tube high pressure tubing in 25cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 592 nrs 233 high pressure tube high pressure tubing in 51cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 593 nrs 234 high pressure tube high pressure tubing in 76, cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 594 nrs 235 high pressure tube high pressure tubing in 122, cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 595 nrs 236 high pressure tube high pressure tubing in 183cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 596 nrs 237 torque device torque device for .014 to .038 standard and hydrophilic guide wires with squeeze load release mechanism.usfda approved each unit 597 nrs 238 radial band radial hemostatis band in 24 cm . curved backer plat with large area & clear unobstructed site visibility, convinient tubing clip with two check valve options and device stickers. should be available with standard luer and specialized connection syringe. us fda approved each unit 598 nrs 239 radial band radial hemostatis band in 29 cm. curved backer plat with large area & clear unobstructed site visibility, convinient tubing clip with two check valve options and device stickers. should be available with standard luer and specialized connection syringe. us fda approved each unit 599 nrs 240 angiography needle angiography needle in 18g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 600 nrs 241 angiography needle angiography needle in 19g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 601 nrs 242 angiography needle angiography needle in 20g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 602 nrs 243 angiography needle angiography needle in 21g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 603 nrs 244 angiography wire ptfe guidewire in .035, .038, in regular length. should have 3mm j tip, straight tip, precoating for smooth surface with less friction, finger straight able with precise j tip memory and packed in flush hoop with j straightener. should have option of fixed core, movable core, heparin coating, 1.5mm j tip. usfda approved each unit 604 nrs 245 angiography wire long length ptfe guidewire in .035, .038, with exchange length. should have 3mm j tip, straight tip, pre coating for smooth surface with less friction, finger straight able with precise j tip memory and packed in flush hoop with j straightener. should have option of fixed core, movable core, heparin coating, 1.5mm j tip. usfda approved each unit 605 nrs 246 amplatz wire ptfe amplatz type wire in .035 and .038, length of 75cm, 145cm, 180cm. should be available in multiple flexible tip length of 1.0cm, 3.5cm, 4.0cm, 6cm, 7cm and j 3.0mm. usfda approved. usfda approved each unit 606 nrs 247 hydrophilic wire hydrophilic guidewire of .018, .025, .035, .038 in 80cm, 150cm with straight, angled tip. should come in stiff & standard configuration, nitinol core polyurethane jacket hydrophilic coated guide wires with radiopaque jacket for enhanced visibility, hydrated gel coating and true 1:1 torque. usfda approved each unit 607 nrs 248 hydrophilic wire long length hydrophilic guidewire of .018, .025, .035, .038 in 180cm, 220cm, 260cm length with straight, angled tip. should come in stiff & standard configuration, nitinol core polyurethane jacket hydrophilic coated guide wires with radiopaque jacket for enhanced visibility, hydrated gel coating and true 1:1 torque. usfda approved each unit 608 nrs 249 hydrophillic braided sheath hydrophilic braided sheath introducer in 4f to 7f, length of 7, 11, 16, 23cm with the option of .018, .021, .025 plastic jacketed and spring coil guidewire. should have ultra thin wall and flat wire braiding technology to provide support and low profile.usfda approved each unit 609 nrs 250 femoral sheath with needle femoral sheath in 5f to 8f, length of 11 23cm with puncher needle of 18g and guidewire of .035, .038. should have rotating suture ring, snap fit dilator to prevent slipping during insertion and holster pack. should be available in polypropylene. usfda approved each unit 610 nrs 251 angiography catheter diagnostic catheter in 4f 6f, length of 70 110cm & 125cm , should come in various shapes & curve length including jl & jr ( 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6 cm ) , al, ar, tig, mp, im, sones, pigtail ( straight, angle, radial ) . should have flat wire braiding, nylon material, thin wall design for higher flow rates, radio opaque tip, strain relief and winged polycarbonate hub. should be available in various configurations braided, non braided, short tip, bumper tip, sideholes as applicable. usfda approved each unit 611 nrs 252 angiography radial catheters diagnostic radial catheter with radial ultimate curve in 4 6f. lenght of 100cm, 110cm, 125cm. should have four type of radial ultimate curves. should have flat wire braiding, nylon material, thin wall design for higher flow rates, radio opaque tip, strain relief and winged polycarbonate hub. us fda approved each unit 612 nrs 253 one loop & triple loop snare snare kit ( 2 35mm diameter, 90 degree nitinol & gold plated tungsten loop ) and multiloop snare kit ( 2 45mm diameter, three interlaced nitinol loops ) for foreign body retrieval, should come with flexible, reinforced, strain relief hub to reduce buckling and unique peel away insertion tool. usfda approved each unit 613 nrs 254 ptca kit ( 1 ) three port manifold with knobs to turnright when open ( 2 ) one pressure line, ( 3 ) fluid connecting line, ( 4 ) contrast connecting line, ( 5 ) one three way stop cock, ( 6 ) one yconnector hemoststic valve with spring type push and release mechanism, ( 7 ) one inflation device with manometer upto 30 atm ( easy to operate with luminescent dial ) , ( 8 ) one luer lock controlled syringe of 10 ml with finger grip, ( 9 ) insertion needle, ( 10 ) torque device.usfda approved each unit 614 nrs 255 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes are 5fr. each unit 615 nrs 256 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes are 6fr each unit 616 nrs 257 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes are 7fr. each unit 617 nrs 258 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes 8fr. each unit 618 nrs 259 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes are 10fr. each unit 619 nrs 260 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes 12fr. each unit 620 nrs 261 paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3mm. each unit 621 nrs 262 paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3.5mm. each unit 622 nrs 263 paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 5.5mm each unit 623 nrs 264 adult endotracheal tube cuff is made up of polyurethane.thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 20 cmh2o.burst pressure of cuff is 800cmh2o.cuff with play mode function. sizes 5.5mm. each unit 624 nrs 265 adult endotracheal tube cuff is made up of polyurethane.thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 20 cmh2o.burst pressure of cuff is 800cmh2o.cuff with play mode function. sizes 10mm. each unit 625 nrs 266 kimvent bal cath non bronchoscopic bal for bronchial aspirate sampling. can be performed in minutes at bedside. directional tip allows right or left lung sampling.maintains peep when used with supplied ventilator adapter. soft, cushioned, radiopaque tip for safe sampling. protected with outer catheter covering. t size 13fr . each unit 626 nrs 267 kimvent bal cath non bronchoscopic bal for bronchial aspirate sampling. can be performed in minutes at bedside. directional tip allows right or left lung sampling.maintains peep when used with supplied ventilator adapter. soft, cushioned, radiopaque tip for safe sampling. protected with outer catheter covering. sizes 16fr. each unit 627 nrs 268 disposable spo2 sensor it should be base on original nellcor technology with original oximax technology each unit 628 nrs 269 catheter mount double swivel connector, it should have bronchoscopy port . it sholud be approved by us fda each unit 629 nrs 270 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilized size – 12, length ( 0.8 – 5.0 ) each unit 630 nrs 271 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 14 length ( 0.8 – 5.0 ) each unit 631 nrs 272 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 16 length ( 0.8 – 5.0 ) each unit 632 nrs 273 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 18, length ( 0.8 – 5.0 ) each unit 633 nrs 274 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 20 length ( 0.8 – 5.0 ) each unit 634 nrs 275 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilized size – 24fr length ( 0.8 – 5.0 ) each unit 635 nrs 276 percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 14fr each unit 636 nrs 277 percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 20fr each unit 637 nrs 278 percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 24fr each unit 638 nrs 279 silk protein based sterile surgical pu foam dressing non adhesive biomodified, silk protein based, sterile, soft, conformable, absorbent, double layered polyurethene foam dressing comprised of silk protein 8% and asiaticoside nlt 0.6%, with super fluid handling capacity, decreases the risk of maceration, sterlization gamma sterlized each unit 639 nrs 280 silk protein & antimicrobial nanosilver based sterile surgical pu foam dressing non adhesive biomodified, silk protein & silver impregnated, soft, conformable, absorbent, double layered polyurethene foam dressing comprised of silk protein 8%, asiaticoside nlt 0.6% and silver 1.2%, with super fluid handling capacity, decreases the risk of maceration, sterlization gamma sterlized each unit 640 nrs 281 silk protein & antimicrobial silver based sterile surgical mesh wound dressing biomodified, bilaminated silk protein and silver wound dressing with mesh pores to facilitate the easy drainage of exudates, comprised of activated silk matrix 46% and asiaticoside nlt 0.6% and, sterlization gamma sterlizedsilver :1.2%. non adhesive, square / rectangular in shape, sterlization gamma sterlized each unit 641 nrs 282 silk protein & antimicrobial nanosilver based sterile surgical wound dressing sheet biomodified, bilaminated silk protein & silver based surgical wound dressing comprised of activated silk matrix 46% and asiaticoside 0.6% and silver :1.2%. non adhesive, square / rectangular in shape, sterlization gamma sterlized each unit 642 nrs 283 silk protein derived sterile surgical meshed wound dressing biomodified, bilaminated silk protein wound dressing with mesh pores to facilitate the easy drainage of exudates, comprised of activated silk matrix 46% and asiaticoside nlt 0.6%. non adhesive dressing, square / rectangular in shape, sterlization gamma sterlized each unit 643 nrs 284 silk protein based sterile surgical wound dressing sheet biomodified, bilaminated silk protein wound dressing comprised of activated silk matrix 46% and asiaticoside nlt 0.6%. non adhesive dressing, square / rectangular shape, sterlization gamma sterlized each unit 644 nrs 285 silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver biomodified silk protein and silver based wound healing ointment comprised of silk powder 8% , asiaticoside nlt 0.6% and silver:1.2%, sterlization gamma sterlized each unit 645 nrs 286 silk protein and nanosilver based microbicidal sterile surgical wound dressing sprinkling powder bottle biomodified silk protein and silver based microbicidal sprinkling powder, comprised of silk powder 8%, asiaticoside nlt 0.6% and silver :1.2% . conforms to any wound shape and size, easy to apply, sterlization gamma sterlized each unit 646 nrs 287 silk protein based sterile surgical wound dressing sprinkling powder bottle biomodified silk protein based wound healing sprinkling powder, comprised of silk powder 8% and asiaticoside nlt 0.6% . conforms to any wound shape and size, easy to apply, sterlization gamma sterlized each unit 647 nrs 288 centella asiatica extract based skin moisturization and antiscar gel centella asiatica extract based skin moisturization and antiscar gel, comprised of centella asiatica extract, glycerol and vitamin e., sterlization gamma sterlized each unit 648 nrs 289 silk protein based sterile surgical particle wound dressingbiomodified, bioabsorbable silk protein and collagen containing particle wound dressing, comprised of silk powder 8% , asiaticoside 0.6% and collagen , having natural moisturizing factor ( nmf ) , suitable for cavity wound and any kind of slow and non healing wound, sterlization gamma sterlized each unit 649 nrs 290 silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 5ml biomodified, bioabsorbable silk protein, collagen and silver containing broadspectrum antimicrobial particle wound dressing , comprised of silk powder 8%, asiaticoside 0.6% , having natural moisturizing factor ( nmf ) , suitable for deep, tunneling cavity wound or any kind of slow and non healing wound, sterlization gamma sterlized each unit 650 nrs 291 silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 10ml biomodified, bioabsorbable silk protein, collagen and silver containing broadspectrum antimicrobial particle wound dressing , comprised of silk powder 8%, asiaticoside 0.6% , having natural moisturizing factor ( nmf ) , suitable for deep, tunneling cavity wound or any kind of slow and non healing wound, sterlization gamma sterlized each unit 651 nrs 292 silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*20cm, silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized each unit 652 nrs 293 silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*25cm, silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized each unit 653 nrs 294 silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 15*15cm silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized each unit 654 nrs 295 silk protein and pu foam pad with self adhesive border, water proof dressing for postoperative scar or any scar management 10*20cm , silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlization gamma sterlized each unit 655 nrs 296 silk protein and pu foam pad with self adhesive border, water proof dressing for postoperative scar or any scar management 10*25cm , silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlization gamma sterlized each unit 656 nrs 297 silk protein and pu foam pad with self adhesive border, water proof dressing for postoperative scar or any scar management 10*21.5cm s silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlizationgamma sterlized each unit 657 nrs 298 silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 9*21.5cm silk protein, nanocrystalline silver & asiaticoside based highly conformable sterile antimicrobial surgical and scar free wound healing dressing with adhesive backing and absorbent layer, sterlization gamma sterlized each unit 658 nrs 299 silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 10*25cm silk protein, nanocrystalline silver & asiaticoside based highly conformable sterile antimicrobial surgical and scar free wound healing dressing with adhesive backing and absorbent layer, sterlization gamma sterlized each unit 659 nrs 300 silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*10cm . silk protein & nanocrystalline silver based sterile, nonadherent, antimicrobial gauze dressing , sterlization gamma sterlized each unit 660 nrs 301 silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*25cm . silk protein & nanocrystalline silver based sterile, nonadherent, antimicrobial gauze dressing , sterlization gamma sterlized each unit 661 nrs 302 silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*10cm silk protein based sterile, non adherent, antimicrobial gauze dressing , sterlizationgamma sterlized each unit 662 nrs 303 silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*25cm . silk protein based sterile, non adherent, antimicrobial gauze dressing , sterlization gamma sterlized each unit 663 nrs 304 papain urea & silk protein based wound debriding ointment and cream 25gm papain urea based debriding ointment and cream for removal of necrotic tissue and slough in infected wounds, containing papain ip : >521700 units and urea ip : 100mg each unit 664 nrs 305 papain urea & silk protein based wound debriding ointment and cream 50gm papain urea based debriding ointment and cream for removal of necrotic tissue and slough in infected wounds, containing papain ip : >521700 units and urea ip : 100mg each unit 665 nrs 306 silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 25gm broad spectrum antiseptic and antimicrobial topical ointment containing povidone iodine usp: 5% w / w, silk protein, centella asiatica for prevention of skin and wound infections. each unit 666 nrs 307 silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 50gm broad spectrum antiseptic and antimicrobial topical ointment containing povidone iodine usp: 5% w / w, silk protein, centella asiatica for prevention of skin and wound infections. each unit 667 nrs 308 anti microbial gloves each unit 668 nrs 309 anterior chamber iol pmma material, single piecekelman multiflex design5 6 mm optic size with 12 13 mm overall size biconvex power range +12 to +24should be iso or ce certified. manufacturer should be asked to sample for approval. each unit 669 nrs 310 capsular tension ring standard capsular tension ringpmma material with one eyelet each at each end 10 mm to 12 mm overall diameter sterile should be iso / ce certified mfg. each unit 670 nrs 311 iris hooks / retractors set of five disposable sterile iris hooks with soft silicon stopper sterile peek should be made pmma iso / ce certified mfg. each unit 671 nrs 312 silicone rod for ptosis repair implantable flexible silicon rod attached to malleable sharp needles with a silicon sleeve. needlelength 60 70mm diameter 920 μ length of silicone rod 40cm, length of silicon sleeve 0.7 mm. each unit 672 nrs 313 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 673 nrs 314 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 674 nrs 315 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 675 nrs 316 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 676 nrs 317 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 677 nrs 318 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 678 nrs 319 flow regulator extension set flow rate 2ml to 350ml per hour each unit 679 nrs 320 sterile disposable hypodermic needle no. 18x1½ each unit 680 nrs 321 sterile disposable hypodermic needle no. 21x1½ each unit 681 nrs 322 sterile disposable hypodermic needle no. 23x1½ each unit 682 nrs 323 neonatal single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. each unit 683 nrs 324 paed. single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. each unit 684 nrs 325 adult single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. each unit 685 nrs 326 neonatal high flow nasal cannula having 8 litre flow. should have soft tip . each unit 686 nrs 327 pur xro catheter 20 cm, 28g / 1fr picc line with stylet, splitting needle with securing wings with 8 cm extension tubing ( flow rate 1ml / min ) each unit 687 nrs 328 pur xro catheter 30 cm, 24g / 2fr picc line with split cannula and 10cm extension tubing over catheter ( flow rate 0.2ml / min ) each unit 688 nrs 329 dead body bag 7x3 ft size leak proof material pp closed on all other sides and zipped on front or on 3 sides each unit 689 nrs 330 introducer sheath with puncture needle for adults us fda approved· 10 11 cm long· pack must include 18 g, 6 7.5 cm long puncture needle: 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 690 nrs 331 introducer sheath with puncture needle for adults us fda approved· 10 11 cm long· pack must include 18 g, 6 7.5 cm long puncture needle: 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 691 nrs 332 intoducer sheath for adults ( size 10 fr.. ) ( standard length ) us fda approved us fda + ce / dgci approved· 10 11 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertionus fda + ce / dgci approved each unit 692 nrs 333 intoducer sheath for adults ( size 11 fr. ) ( standard length ) us fda approved us fda + ce / dgci approved· · 10 11 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertionus fda + ce / dgci approved each unit 693 nrs 334 long introducer sheath ( 20 30 cm long ) ( size 5fr.. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 694 nrs 335 long introducer sheath ( 20 30 cm long ) ( size 6fr. ) us fda + ce / dgci approved· .· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 695 nrs 336 long introducer sheath ( 20 30 cm long ) ( size 7fr. ) us fda + ce / dgci approved· · sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 696 nrs 337 long introducer sheath ( 20 30 cm long ) ( size 8fr ) us fda + ce / dgci approved· · sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 697 nrs 338 long introducer sheath ( 20 30 cm long ) ( size 9fr. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 698 nrs 339 long introducer sheath ( 20 30 cm long ) ( size 10fr.. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 699 nrs 340 long introducer sheath ( 20 30 cm long ) ( size 11fr. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 700 nrs 341 trans radial introducer sheeths 4f us fda + ce / dgci approved· sizes 4 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 701 nrs 342 trans radial introducer sheeths 5f us fda + ce / dgci approved· sizes 5 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 702 nrs 343 trans radial introducer sheeths 6f us fda + ce / dgci approved· sizes 6 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 703 nrs 344 steerable introducer sheeths 5f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 704 nrs 345 steerable introducer sheeths 6fr us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 705 nrs 346 steerable introducer sheeths 7f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 706 nrs 347 steerable introducer sheeths 8fus fda + ce / dgci approved· size 55 to 90 cms·to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 707 nrs 348 steerable introducer sheeths 9f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 708 nrs 349 steerable introducer sheeths 10f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 709 nrs 350 steerable introducer sheeths 11f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 710 nrs 351 steerable introducer sheeths 12f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 711 nrs 352 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 712 nrs 353 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 713 nrs 354 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 714 nrs 355 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 715 nrs 356 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 716 nrs 357 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during ins ertion each unit 717 nrs 358 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 718 nrs 359 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 719 nrs 360 long introducer sheath ( 30 50 cm long ) ( size 5fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 720 nrs 361 long introducer sheath ( 30 50 cm long ) ( size 6 fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 721 nrs 362 long introducer sheath ( 30 50 cm long ) ( size 7fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 722 nrs 363 long introducer sheath ( 30 50 cm long ) ( size 8fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 723 nrs 364 long introducer sheath ( 30 50 cm long ) ( size 9fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 724 nrs 365 long introducer sheath ( 30 50 cm long ) ( size 10fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 725 nrs 366 long introducer sheath ( 30 50 cm long ) ( size 11fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 726 nrs 367 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 727 nrs 368 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 728 nrs 369 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 729 nrs 370 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 730 nrs 371 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 731 nrs 372 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 732 nrs 373 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 733 nrs 374 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 734 nrs 375 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 735 nrs 376 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 736 nrs 377 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.035 size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 737 nrs 378 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.038 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 738 nrs 379 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 739 nrs 380 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032, inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 740 nrs 381 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in , 0.035 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 741 nrs 382 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.038 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 742 nrs 383 ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.032 inches size· should be between 240 300 cm long· should be available as straight & jshaped tip each unit 743 nrs 384 ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.035 inches size· should be between 240 300 cm long· should be available as straight & jshaped tip each unit 744 nrs 385 ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.038 inches size· should be between 240 300 cm long· should be available as straight & jshaped tip each unit 745 nrs 386 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long each unit 746 nrs 387 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032 inches size·should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long each unit 747 nrs 388 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved·should be available in 0.035 inches size·should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 120 300 cm long each unit 748 nrs 389 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.038 inches size·should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long each unit 749 nrs 390 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.025 inchessize· should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 150 180 cm long each unit 750 nrs 391 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.032, inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 150 180 cm long each unit 751 nrs 392 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.035 inches size· should have superelastic alloy core· should have super flexible wire tip· should be available in straight and angled tip·should be between 150 180 cm long each unit 752 nrs 393 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.038 inches size·should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip·should be between 150 180 cm long each unit 753 nrs 394 radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.025, inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved each unit 754 nrs 395 radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.032 inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip·should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved each unit 755 nrs 396 radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.038 inches size·should have superelastic alloy core· should have super flexible wire tip· should be available in straight and angled tip·should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved each unit 756 nrs 397 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 757 nrs 398 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 758 nrs 399 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 759 nrs 400 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 760 nrs 401 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 761 nrs 402 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 762 nrs 403 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 763 nrs 404 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 764 nrs 405 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 765 nrs 406 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 766 nrs 407 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 767 nrs 408 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 768 nrs 409 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 769 nrs 410 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 770 nrs 411 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 771 nrs 412 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 772 nrs 413 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 773 nrs 414 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 774 nrs 415 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 775 nrs 416 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 776 nrs 417 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 777 nrs 418 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 778 nrs 419 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 779 nrs 420 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 780 nrs 421 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 781 nrs 422 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 782 nrs 423 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 783 nrs 424 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 784 nrs 425 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 785 nrs 426 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 786 nrs 427 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 787 nrs 428 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 788 nrs 429 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 789 nrs 430 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 790 nrs 431 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 791 nrs 432 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 792 nrs 433 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 793 nrs 434 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 794 nrs 435 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 795 nrs 436 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 796 nrs 437 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 797 nrs 438 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 798 nrs 439 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 799 nrs 440 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 800 nrs 441 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 801 nrs 442 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 802 nrs 443 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 803 nrs 444 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 804 nrs 445 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 805 nrs 446 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 806 nrs 447 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 807 nrs 448 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 808 nrs 449 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 809 nrs 450 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 810 nrs 451 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 811 nrs 452 introducer sheaths for pediatric use ( size 4 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion each unit 812 nrs 453 introducer sheaths for pediatric use ( size 5 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion each unit 813 nrs 454 introducer sheaths for pediatric use ( size 6 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion each unit 814 nrs 455 judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved each unit 815 nrs 456 judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved each unit 816 nrs 457 judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved each unit 817 nrs 458 special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved each unit 818 nrs 459 special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved each unit 819 nrs 460 special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved each unit 820 nrs 461 angiographic double leumen tracking catheter us fda + ce / dgci approved each unit 821 nrs 462 angiographic double leumen tracking catheter us fda + ce / dgci approved each unit 822 nrs 463 angiographic double leumen tracking catheter us fda + ce / dgci approved each unit 823 nrs 464 3 ‘french’ diagnostic catheters for neonatal use us fda + ce / dgci approved· pigtail, judkins, multipurpose, cobra and other diagnostic catheters of 3 fr. size·varying lengths and shapes each unit 824 nrs 465 swan ganz catheter us fda + ce / dgci approved each unit 825 nrs 466 swan ganz catheter us fda + ce / dgci approved each unit 826 nrs 467 balloon tipped angiography catheter us fda + ce / dgci approved each unit 827 nrs 468 balloon tipped angiography catheter us fda + ce / dgci approved each unit 828 nrs 469 balloon tipped angiography catheter us fda + ce / dgci approved each unit 829 nrs 470 berman catheter us fda + ce / dgci approved· sizes· should have 6 8 holes proximal to the balloon for dye injection· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· 10 cm marking along catheter body to confirm insertion depth each unit 830 nrs 471 berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection·catheter should be tapered at tip to ensure uniform diameter of the whole catheter·10 cm marking along catheter body to confirm insertion depth each unit 831 nrs 472 berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection·catheter should be tapered at tip to ensure uniform diameter of the whole catheter·10 cm marking along catheter body to confirm insertion depth each unit 832 nrs 473 berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· 10 cm marking along catheter body to confirm insertion depth each unit 833 nrs 474 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 834 nrs 475 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 835 nrs 476 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 836 nrs 477 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 837 nrs 478 arterial pressure monitor lines ( 100 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. each unit 838 nrs 479 arterial pressure monitor lines ( 150 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. each unit 839 nrs 480 arterial pressure monitor lines ( 200 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. each unit 840 nrs 481 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 841 nrs 482 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 842 nrs 483 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 843 nrs 484 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 844 nrs 485 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 845 nrs 486 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 846 nrs 487 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip each unit 847 nrs 488 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible with radio opaque tip each unit 848 nrs 489 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible· with radio opaque tip each unit 849 nrs 490 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip each unit 850 nrs 491 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port·with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip each unit 851 nrs 492 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port.with 0.035 or 0.038 inch guide wire compatible· with radio opaque tip each unit 852 nrs 493 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port·with 0.035 or 0.038 inch guide wire compatible with radio opaque tip each unit 853 nrs 494 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 4f size with the largest id· should have lengths ranging from 40 110 cm each unit 854 nrs 495 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 5f size with the largest id· should have lengths ranging from 40 110 cm each unit 855 nrs 496 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 6f size with the largest id· should have lengths ranging from 40 110 cm each unit 856 nrs 497 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 7 f size with the largest id· should have lengths ranging from 40 110 cm each unit 857 nrs 498 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 8 f size with the largest id· should have lengths ranging from 40 110 cm each unit 858 nrs 499 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 9 f size with the largest id· should have lengths ranging from 40 110 cm each unit 859 nrs 500 mullin’s sheath for special dilation us fda + ce / dgci approved should be in septal puncture needle should be in 6f septal puncture needle each unit 860 nrs 501 angio.kit / ptca kit ( 3 port many fold with attached tubing one pressure line + two iv set connecting tube and two leurlock syringe ) us fda / ce / approved each unit 861 nrs 502 micro catheter for super selective catherization usfda / ce approved each unit 862 nrs 503 micro catheter for super selective catherization usfda / ce approved each unit 863 nrs 504 micro catheter for super selective catherization usfda / ce approved each unit 864 nrs 505 micro catheter for super selective catherization usfda / ce approved each unit 865 nrs 506 multi side port catheter infusion for catheter directed thromobolysis usa / fda / ce approved each unit 866 nrs 507 clot retrieval sheath usa / fda / ce approved aspiration catheter 16 f including flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm each unit 867 nrs 508 clot retrieval sheath usa / fda / ce approved aspiration catheter 20 f including flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm each unit 868 nrs 509 clot retrieval sheath usa / fda / ce approved aspiration catheter 24 f including flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm each unit 869 nrs 510 loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved each unit 870 nrs 511 loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved each unit 871 nrs 512 loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved each unit 872 nrs 513 pcd set puncture needle 18g, 0.035, j stiff stiff wire 0.035 / 80 cm , dilator set , pig tail / malecot catheter 8 24f each unit 873 nrs 514 ring biliary catheter usa / fda / ce approved catheter 8.5 f / 10 / 3 compatible 0.038 length~40 cm , catheter side ports 32 , side port segment length 8 cm , catheter introducer, stiffening cannula , secured device each unit 874 nrs 515 venaseal closure system for varicose veins usa / fda approved n butyl based adhesive formation 50 / 90 / 105 / 120 cm 145 cm ( 3 / 4 / 6 / 8 f , 014 / 0.35 compatible each unit 875 nrs 516 liver access and biopsy needle set usa / fda approved usa / fda approved 18g / 60 cm biopsy needle , 14 g cannula / 53.5 cm length sheath 7f each unit 876 nrs 517 tran jugular intrahepatic porto sytemic shunt ( tips set ) intoducer 10f / 40 cm , toclar diameter 0.038 legth60 cm , cannula 14 g / 51.5 cm each unit 877 nrs 518 percutaneous gastrostomy balloon retention tube set catheter 12 20 f, length 10 cm , balloon 5 20 ml each unit 878 nrs 519 each unit 879 nrs 520 each unit 880 nrs 521 each unit 881 nrs 522 each unit 882 nrs 523 each unit 883 nrs 524 each unit 884 nrs 525 each unit 885 nrs 526 each unit 886 nrs 527 each unit 887 nrs 528 each unit 888 nrs 529 breast nodule localizationwire should have curved locking element that provide superior migration resistance. the localization wire can be repositioned or removed after placement if required. usfda / ce approved each unit 889 nrs 530 disposable semi automatic core biopsy instrument with compatible coaxial needle. should be available with dual penetration throw of 10 and 20mm in single instrument. should be available with fire ready indicator. should be available with compatible coaxial needle set with a blunt tip needle & trocar needle. should be usfda approved. each unit 890 nrs 531 ultra clip disposable breast tissue marker should be available in coil shape & ribbon shape. should have color coded dual triggers identify different marker shape. should be visible in ultrasound, mri, mammography imaging. should be available in needle size of 17 gauge. should be available in coil shape and ribbon shape. each unit 891 nrs 532 bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verification marking should be available in 8, 11, 13 gauze usfda / ce approved each unit 892 nrs 533 bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verfication marking should be available in 8, 11, 13 gauze usfda / ce approved each unit 893 nrs 534 bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verfication marking should be available in 8, 11, 13 gauze usfda / ce approved each unit 894 nrs 535 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 895 nrs 536 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 896 nrs 537 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 897 nrs 538 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 898 nrs 539 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 899 nrs 540 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 900 nrs 541 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm. should have sharp beveled trocar. should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. with compatible disposable coaxial needle: should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar 901 nrs 542 cutting & coagulations device with tissue fusion ligasure technology having maryland jaw sealer and divider with wide jaw aperture 13mm and cut length 18.5mm with shaft rotation of 350 degrees and with one step sealing mechanism. should have the manual cutting mechanism. and it should have including 7mm cutting and coag with usfda . each unit 902 nrs 543 cutting &coagulations device with tissue fusion ligature technology have small jaw tissue sealing system for open procedures vessel sealing instrument with cut length of 14.7 mm, seal length of 16.5mm, jaw angle 28 degrees. should have the manual cutting mechanism.and its should have including 7mm cutting and coag with usfda . each unit 903 nrs 544 cutting &coagulations device with tissue fusion ligature technology laparoscopic blunt tipped vessel sealer and divider 37 cm long 5mm instrument. wide jaw aperture 14.5 mm with shaft rotation of 180 degrees ; multifunctional laparoscopic device for tissue fusion.and its should have including 7mm cutting and coag with usfda . each unit 904 nrs 545 cutting &coagulations device with tissue fusion ligasure technology instrument for open surgeries with instrument length between 18 19cm and electrode length between 16 17cm, having 28 degree curved jaw with contoured tip for blunt dissection and having activation both through hand activation and foot activation with a manually controlled cutting mechanism. each unit 905 nrs 546 cutting &coagulations device with tissue fusion ligasuretechnology have36mm jaw length, 180 degree rotatable instrument with curved blade for large volume tissue. should have the manual cutting mechanism. each unit 906 nrs 547 cutting &coagulations device with tissue fusion ligasuretechnology have vessel sealing instrument for open surgeries with reusable clamp length between 16 18cm, with 12 14 degree jaw curve.and its should have including 7mm cutting and coag with usfda . each unit 907 nrs 548 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 908 nrs 549 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 909 nrs 550 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 910 nrs 551 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 911 nrs 552 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 912 nrs 553 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 913 nrs 554 each unit 914 nrs 555 each unit 915 nrs 556 each unit 916 nrs 557 each unit 917 nrs 558 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 918 nrs 559 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 919 nrs 560 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 920 nrs 561 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 921 nrs 562 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit long term double lumen dialysis catheter with kit accessories should be provided ( catheter, pull apart sheath, dialator, tunneling stylet, guide wire j / s, with disppencer and injection caps, symmetrical tip retrograde and antigrade 922 nrs 563 non fibre optic single use adult scope channel width :2.2 mm insertion tube diameter :5.0mm. working length :600 mm bending range :180 degree up & 180 degree down field of view :85 degree or more direction of view : 0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :6 mm illumination method :led complete system should be us fda and european ce certified each unit 923 nrs 564 multi vent mask pediatric, multi vent mask pediatric, air entrainment masks, must be safe, simple delivery of variable oxygen concentrations. each mask to includes color coded diluters: green for low concentration, white for medium concentration. locking ring to secure flow setting. must include adaptor for high humidity entrainment. complete kit with 7 ft oxygen tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 924 nrs 565 incentive spirometer incentive spirometer with wide flow range between 200 cc / sec and 1200 cc / sec. must have dual chamber design to help create constant resistance that lifts ball when patient maintains inspiration equal to selected adjustable flow setting & clearly marked flow settings for easy monitoring. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification each unit 925 nrs 566 closed suction catheter mdi port has isolated turbo cleaning chamber for cleaning catheter tip with mdi port.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version. can be used for 72hr. each unit 926 nrs 567 closed suction catheter mdi port has isolated turbo cleaning chamber for cleaning catheter tip with mdi port.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version. can be used for 72hr. each unit 927 nrs 568 closed suction catheter has isolated turbo cleaning chamber for cleaning catheter tip.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version.can be used for 72hr. each unit 928 nrs 569 closed suction catheter has isolated turbo cleaning chamber for cleaning catheter tip.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version.can be used for 72hr. each unit 929 nrs 570 fenestrated tracheostomy tube cuffed with 2 inner cannula, inner cannula should reduce the id by 1mm of tracheostomy tube one inner cannula is with five fenestration holes and one is without fenestration each unit 930 nrs 571 multifocal iol biconvex, single piece designoptic size 6 mm, overall 12 13 mm sizetwo haptics, modified cuv blocking capability360 degrees square edge, sterile packingfoldable lens with insertion via injector, should able to insert in sub 2.8 m.msterile disposable injector with cartridge along with each iolinjector should be of good quality with smooth injection without damaging ioldiopters required +16 to +25 ddiffractive multifocal design with +3 to +4 dioptre additionshould be iso or ce certifiedmanufacturer should be asked to supply samples for approval3 piece feldable 11 28 d each unit 931 nrs 572 glaucoma drainage implant ( valved ) with silicon tube adult each unit 932 nrs 573 glaucoma drainage implant ( valved ) with silicon tube paediatric each unit 933 nrs 574 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 934 nrs 575 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 935 nrs 576 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 936 nrs 577 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 937 nrs 578 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 938 nrs 579 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 939 nrs 580 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 940 nrs 581 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 941 nrs 582 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 942 nrs 583 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 943 nrs 584 monocanalicular self retaining silicone stent for canalicular repair medical graded silicone implant for reconstructing traumatic canalicular lacerations. silicone rod length40mm, silicone rod diameter 0.64 mm each unit 944 nrs 585 lacrimal intubation set for dcr surgery – bicanalicular lacrimal intubation set comprised of two flexible stainless steel probes attached through a hollow medical tube which is used in conventional dcr procedure. probe length probe diameter silicon tube length silicon tube id silicon tube od 11 cm 0.60 mm ( 23g ) 30 cm 0.30 mm 0.64 mm each unit 945 nrs 586 scleral fixiated intraoccular lense having multifoccal toric , three piece foldable intraoccular lense each unit 946 nrs 587 vibratory pep therapy device for pead . patients , deliver airflow vibrations to the patients from 5 30 hz expiratory resistance / frequency dial to allow therapy to be adjusted to patientss needs each unit 947 nrs 588 tracheostomy tube cuffed with sub glotic suction line and with 2 inner cannula kit, inner cannula should reduce the id by 1mm of tracheostomy tube each unit 948 nrs 589 dry lithium heparin pre filled abg syringe with air removal filter cap 1ml each unit 949 nrs 590 dry lithium heparin pre filled abg syringe with air removal filter cap 3ml each unit 950 nrs 591 epidural and spinal needle kit 16 / 18g should have needle to needle technique without backeye on epidural needle with lenght of 8cm . should have locking mechanism with graduation marking on hub of epidural needle and pencil point spinal needle , should have the marking on the epidural needle with 1 cm distance and marking should starts from 3 cm distance from the tip of the epidural needle . each unit 951 nrs 592 epidural kit with epidural needle marking starts from 3cm from the tip and catheter fixation device with locking mechanism 16 / 18g each unit 952 nrs 593 central line triple lumen with y needle and nitinol guide wire 8.5 fr with 16cm / 20cm catheter with tecoflex material each unit 953 nrs 594 central line quadra lumen with y needle and nitinol guide wire 8.5 fr with 15cm / 20cm catheter with tecoflex material each unit 954 nrs 595 central line quadra lumen with straight needle and nitinol guide wire 8.5 fr with 15cm / 20cm catheter with tecoflex material each unit 955 nrs 596 peripherally inserted central line for high flow / power injection sterile made of polyurethane single 55 cm long, 5 french single, double and triple lumen made of polyutherane with guide wire & microintroducer. should deliever infusion at 5 ml / sec rate and have reverse taper hub to provide kink resitance. introducer needle of 21 g. and used for power injection & monitoring cvp . each unit 956 nrs 597 latex folley balloon catheter each unit 957 nrs 598 latex folley balloon catheter each unit 958 nrs 599 ryle’s tube each unit 959 nrs 600 ryle’s tube each unit 960 nrs 601 post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved each unit 961 nrs 602 post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved each unit 962 nrs 603 post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved each unit 963 nrs 604 2 pcs flat base ostomy body fit 60 mm kit 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm, elastic tape in semi circular shape with hydrocolloid adhesive for extra security of base plate. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 964 nrs 605 2 pcs flat base ostomy body fit 70 mm kit 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. 70mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 965 nrs 606 2 pcs convex base ostomy body fit 60 mm kit two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 966 nrs 607 2 pcs convex base ostomy body fit 70 mm kit two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 70mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 967 nrs 608 1 pcs trasnparent colostomy body fit 60mm kit one piece colostomy bag body fit additional elastic adhesive technology ( elastic modulus0.34 n / mm ) , bag consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection 60mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) each unit 968 nrs 609 2 pcs flat base ostomy body fit bag 60 mm 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm each unit 969 nrs 610 2 pcs flat base ostomy body fit bag 70 mm 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. 70mm. each unit 970 nrs 611 2 pcs convex base ostomy body fit bag 60 mm two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm. each unit 971 nrs 612 2 pcs convex base ostomy body fit bag 70 mm two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 70mm. each unit 972 nrs 613 1 pcs trasnparent colostomy body fit bag 60mm one piece colostomy bag body fit additional elastic adhesive technology ( elastic modulus0.34 n / mm ) , bag consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection 60mm. each unit 973 nrs 614 non fibre optic single use large scope channel width :2.8mm insertion tube diameter :5.8 mm. working length :600 mm bending range :180 degree up & 160 degree down field of view :85 degree or more direction of view :0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :7 mm illumination method :led complete system should be us fda and european ce certified. each unit 974 nrs 615 antimicrobial silver dresssing sterile non occulusive wound contact layer consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid particles ( cmc ) , petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity upto 7 days, using patented lipido colloid technology ( tlc ) each unit 975 nrs 616 antimicrobial silver dresssing sterile non occulusive wound contact layer consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid particles ( cmc ) , petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity upto 7 days, using patented lipido colloid technology ( tlc ) each unit 976 nrs 617 non fibre optic single use cysto scope for djr & diagnostic cystoscope it should be capable of easy navigation and fast identification of anatomical landmarks the scopes should be sterile packed one cmos camera and two led light source should be integrated at the distal end minimum length of the scope should be 380 400mm working channel should be of 6.5 6.6 fr the control lever on handle for the movement of distal tip up & down in a single plane with 210 degree up and 120 degree down each unit 977 nrs 618 non fibre optic single use paediatrics scope channel width :1.2mm insertion tube diameter :3.8 mm. working length :600 mm bending range :180 degree up & 180 degree down field of view :85 degree or more direction of view :0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :5 mm illumination method :led complete system should be us fda and european ce certified. each unit 978 nrs 619 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 979 nrs 620 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 980 nrs 621 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 981 nrs 622 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 982 nrs 623 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 983 nrs 624 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 984 nrs 625 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 985 nrs 626 100% polysiloxane based scar management in gel form pure poly siloxane based silicone scar management product in sheet form ( we also should mention about the 100% poly siloxane and nylon polyamide mesh ) each unit 986 nrs 627 triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. each unit 987 nrs 628 triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. each unit 988 nrs 629 triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. each unit 989 nrs 630 drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure each unit 990 nrs 631 drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure each unit 991 nrs 632 drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure each unit 992 nrs 633 sulu stepped cartridges for variable tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 60 mm inner to outer side 3.0, 3.5 and 4.0 mm , purple colour code, usfda approved each unit 993 nrs 634 titanium total ossocular replacement prosthesis ( torp ) each unit 994 nrs 635 titanium partial ossocular replacement prosthesis ( porp ) each unit 995 nrs 636 piston titanium ( 0.4mm ) diameter each unit 996 nrs 637 piston titanium ( 0.4mm ) diameter each unit 997 nrs 638 piston titanium ( 0.4mm ) diameter each unit 998 nrs 639 piston titanium ( 0.4mm ) diameter each unit 999 nrs 640 piston titanium ( 0.6mm ) diameter each unit 1000 nrs 641 piston titanium ( 0.6mm ) diameter each unit 1001 nrs 642 piston titanium ( 0.6mm ) diameter each unit 1002 nrs 643 piston titanium ( 0.6mm ) diameter each unit 1003 nrs 644 piston titanium teflon mix ( 0.4mm ) diameter each unit 1004 nrs 645 piston titanium teflon mix ( 0.4mm ) diameter each unit 1005 nrs 646 piston titanium teflon mix ( 0.4mm ) diameter each unit 1006 nrs 647 piston titanium teflon mix ( 0.4mm ) diameter each unit 1007 nrs 648 piston titanium teflon mix ( 0.6mm ) diameter each unit 1008 nrs 649 piston titanium teflon mix ( 0.6mm ) diameter each unit 1009 nrs 650 piston titanium teflon mix ( 0.6mm ) diameter each unit 1010 nrs 651 piston titanium teflon mix ( 0.6mm ) diameter each unit 1011 nrs 652 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1012 nrs 653 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1013 nrs 654 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1014 nrs 655 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1015 nrs 656 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1016 nrs 657 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1017 nrs 658 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1018 nrs 659 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1019 nrs 660 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 0.5 mm each unit 1020 nrs 661 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 0.6 mm each unit 1021 nrs 662 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting / 0.8 mm each unit 1022 nrs 663 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 1.6 mm each unit 1023 nrs 664 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 2.3 mm each unit 1024 nrs 665 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 2.8 mm each unit 1025 nrs 666 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 3 mm each unit 1026 nrs 667 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 3.5 mm each unit 1027 nrs 668 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 4 mm each unit 1028 nrs 669 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 5 mm each unit 1029 nrs 670 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 0.5 mm each unit 1030 nrs 671 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 0.6 mm each unit 1031 nrs 672 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond / 0.8 mm each unit 1032 nrs 673 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 1.6 mm each unit 1033 nrs 674 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 2.3 mm each unit 1034 nrs 675 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 2.8 mm each unit 1035 nrs 676 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 3 mm each unit 1036 nrs 677 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 3.5 mm each unit 1037 nrs 678 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 4 mm each unit 1038 nrs 679 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 5 mm each unit 1039 nrs 680 burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 1 mm each unit 1040 nrs 681 burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 3, mm each unit 1041 nrs 682 burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 5 mm each unit 1042 nrs 683 sialestic sheet 55*75 mm and thickness 0.5 mm each unit 1043 nrs 684 ear pack / wick ( 12*24 mm length ) each unit 1044 nrs 685 t tube ( silicone ) 9 mm length each unit 1045 nrs 686 nasal haemostatic sponge pack with out airway 8 inch each unit 1046 nrs 687 nasal haemostatic sponge pack with out airway 10 inch each unit 1047 nrs 688 nasal haemostatic sponge pack ( with airway ) 8 inch each unit 1048 nrs 689 tracheostomy tube ( pvc material ) double lumen 3.5 8mm all size each unit 1049 nrs 690 tracheostomy tube ( pvc material ) fenestrated 3.5 8mm all size each unit 1050 nrs 691 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1051 nrs 692 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1052 nrs 693 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1053 nrs 694 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1054 nrs 695 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1055 nrs 696 diagnostic catheter ar 1 aka amplatz right each unit 1056 nrs 697 diagnostic catheter ar 1 aka amplatz right each unit 1057 nrs 698 diagnostic catheter vert angled tip 125cm each unit 1058 nrs 699 diagnostic catheter sim 1 aka simmon’s each unit 1059 nrs 700 diagnostic catheter sim 1 aka simmon’s each unit 1060 nrs 701 diagnostic catheter sim 2 aka simmon each unit 1061 nrs 702 diagnostic catheter sim 3 aka simmon each unit 1062 nrs 703 diagnostic catheter h 1 aka headhunter each unit 1063 nrs 704 diagnostic catheter pigtail each unit 1064 nrs 705 guide wire hydrophilic coated angled tip soft regular standard each unit 1065 nrs 706 guide wire hydrophilic coated angled tip extra stiff each unit 1066 nrs 707 guiding catheter braided guiding catheter in various shapes each unit 1067 nrs 708 guiding catheter braided guiding catheter in various shapes each unit 1068 nrs 709 guiding catheter braided guiding catheter in various shapes each unit 1069 nrs 710 guiding catheter braided guiding catheter in various shapes each unit 1070 nrs 711 guiding catheter braided guiding catheter in various shapes each unit 1071 nrs 712 guiding catheter braided guiding catheter in various shapes each unit 1072 nrs 713 guiding catheter balloon tipped guiding catheter size each unit 1073 nrs 714 distal access catheter each unit 1074 nrs 715 distal access catheter each unit 1075 nrs 716 intracranial support catheter with flat soft distal segment each unit 1076 nrs 717 intracranial support catheter with flat soft distal segment each unit 1077 nrs 718 flexometlic tube 3 8.5 with stylet reinforce et tube with wiring from tip to end it should be approved by *us fda each unit 1078 nrs 719 act tubes us fda + ce / dgci approved· disposable act tubes compatible with existing medtronic machines at smsh· should meet highest medical industrial standards· quality certification should be provided from authorized agencies. each unit 1079 nrs 720 high – presure injector lines us fda + ce / dgci approved· should be available in various lengths· should have male and female luer locks· should be transparent and kink resistant· should be able to take high pressure of angiographic injections each unit 1080 nrs 721 disposable transducers for invasive pressure monitoring compatible with available system in cath lab in smsh us fda + ce / dgci approved· disposable transducers for invasive pressure monitoring· should be compatible with available system in cath lab ( iabp – data scope & cath lab transducer ) and iccu at smsh· should meet highest medical industrial standards· quality certification should be provided form authorized agencies each unit 1081 nrs 722 renal double curve catheter us fda + ce / dgci approved· each unit 1082 nrs 723 simmons / sidewinder catheter us fda + ce / dgci approved· each unit 1083 nrs 724 vertebral catheter each unit 1084 nrs 725 coeliac axis catheter us fda + ce / dgci approved· each unit 1085 nrs 726 shepherd’s hook catheter us fda + ce / dgci approved· each unit 1086 nrs 727 vtk diagnostic catheter us fda + ce / dgci approved· each unit 1087 nrs 728 angiographic sizing pigtail catheter 5fr us fda + ce / dgci approved each unit 1088 nrs 729 angiographic sizing pigtail catheter 6fr us fda + ce / dgci approved each unit 1089 nrs 730 angiographic sizing pigtail catheter 7fr us fda + ce / dgci approved each unit 1090 nrs 731 balloon inflation catheter for brto usa / fda / ce approved 9 / 10 f 0.035 compatible , length100 / 120 cm , max volume 30 / 40 cc each unit 1091 nrs 732 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1092 nrs 733 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1093 nrs 734 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1094 nrs 735 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1095 nrs 736 pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1096 nrs 737 pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1097 nrs 738 multirate elastomeric disposable infusion pump with air vent blue end cap for air bubble removal and with two micro iv filters in 100 ml & 275 ml with flow rate from 1 7 / hr and 2 14ml / hr each unit 1098 nrs 739 single rate elastomeric disposable infusion pump with air vent blue end cap for air bubble removal and with two micro iv filters in 100 ml & 275 ml with flow rate of 2, 5, 8, 10ml / hr each unit 1099 nrs 740 pct kit with griggs forceps and with subglotic suction line tracheostomy tube with usfda / european ce each unit 1100 nrs 741 pct kit without griggs forceps and with subglotic suction line tracheostomy tube with usfda / european ce each unit 1101 nrs 742 double lumen closed suction set for et and tt , with mdi adopter , trach wedge , swiel connector and with reservoir each unit 1102 nrs 743 et tube with yellow subglotic suction line with inverted and soft seal cuff. with usfda / european ce each unit 1103 nrs 744 tt tube with yellow sub glotic suction line with inverted and soft seal cuff. with usfda / european ce each unit 1104 nrs 745 catheter stabilization device sterile latex free sutureless with sliding post each unit 1105 nrs 746 titanium maxillofacial fracture fixation miniplate 2.5 mm each unit 1106 nrs 747 titanium maxillofacial fracture fixation miniplate 2.0 mm each unit 1107 nrs 748 titanium maxillofacial fracture fixation miniplate 1.5 mm each unit 1108 nrs 749 titanium maxillofacial fracture fixation miniplate 1.5 mm c plate each unit 1109 nrs 750 titanium maxillofacial fracture fixation miniplate 2.5 mm l plate right and left side each unit 1110 nrs 751 titanium maxillofacial fracture fixation miniplate 2.0 mm l plate right and left side each unit 1111 nrs 752 titanium maxillofacial fracture fixation screws 1.5 mm each unit 1112 nrs 753 titanium maxillofacial fracture fixation screws 2.0 mm each unit 1113 nrs 754 titanium maxillofacial fracture fixation screws 2.5 mm each unit 1114 abdominal suction set each unit 1115 arterial line each unit 1116 av blood line each unit camscanner...

National Institution for Transforming India Aayog - Rajasthan

33990982 bids are invited for package no. 4 atal tinkering lab of niti aayog power supply and accessories and safety equipment ( q3 ) total quantity : 1 glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb holders , electric wires, usb to bc jack cable etc...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical College - Rajasthan

33894869 tender invited for supply of surgical and disposable items tender invited for supply of surgical and disposable items , bandage , bakri ballon , bandaid round , brain circuit adult , d ventilator tube , closed suction set , cotton 500 gm , delivery kit , sonography jelly pack size , dura por 1 inch , c s drape , dura pore ½ inch , huggies , gluco meterwith strip , hiv kit , id band baby , iv dressing kit , naso.gastric tube no 6 ( n g tube 6 ) , naso.gastric tube no 8 ( n g tube 8 ) , naso.gastric tube no 10 ( n g tube 10 ) , lr apron green , mackintosh plastic , mackintosh sheet regular rubber , long line no 22 , three way adapter , signal lock , shoe cover , tega drumhp pad , hysterioscopic ( hys ) grasper , hysterioscopic ( hys ) scissor , chital forceps , artery forceps , c pap nasalseal , nasal seal , silicone adhesive ( silgrip ) , hutnson pronge , hfnc pronge , gauz than , nebulization mask , octopus double lumen , plastic apron , neocain no 26 , bubble c pap tubing , ambu bag child 500 ml , ambu bag infant 250 ml , ambu bag adult , laryngoscope , laryngoscope blade ( 0 00 ) , laryngoscope blade ( 3 ) , laryngoscope blade ( 4 ) , laryngoscope with blade ( 0 00 ) , laryngoscope withblade ( 3 ) , laryngoscope with blade ( 4 ) , pap’s smeare kits , bain circuit , vtm kit , dressing drum , instrument tray , dressing kit , dissecting tooth forceps , plain forceps , foetal scope , hsg set , i v stand , kidney tray , kallys pad , liggasuremariland , liggasure blunt , needle cutter drestroyer , rebreathing bag , pluse oxymeter , oxyzen regulatorl , sharpcontainer , thermometer digital , room thermometer , sims speculum , valsullum , baby weight machine , weight machine 200 kg capacity . , gyne drape , mersilk 1 0 , monocrylvio 2 0 70cm , monocryly plus 2 0 ( 20cm ) , prolane no 1 , pds plus 1 , ultra promesh , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 30mm length 76 cm ) r 3 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 40mm length 76 cm ) r 5 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) r 7 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ½ cir rb needle40mm length 90 cm r 13 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir rb needle 40mm length 90 cm ) r 17 , non absorbable surgical suture, sterilised surgical needled suture black braided silk ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) r 22 , non absorbable surgical suture, sterilised surgical needled suture polyamide monofilament black ( nylon ) ( 3 / 8 cir r cutting needle 40 45mm length 60 70 cm. ) r 27 , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm / r 68 , absorbable surgical suture, sterilised surgical needled suture polyglecaprone / polyglyconate, monofilament sutures ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) r 61 , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm r 69 , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) 1 / 2 circle round bodied 30mm, suture length 90 cm / r 70 , absorbable oxidized regenerated cellulose net size 2”x 3” with surgical sponge topical absorbable haemostatic bactericidal property s 95 , braided e caprolactone coated lactomer 1, 90cm gs 25, 37 40mm ½ circle taper point , vicryl rapid 1 0 , vicryl rapid 2 0 , vicryl rapid 3 0 , vicryl rapid 5 0 , sealing wax for 1000 capillary tubes , restabil standard value , 2 high and 2 low , sealing wax for 100 capillary tubes , sealing wax tray for 100 capillary tubes , soda lime specification: • it should be medical grade sodalime • its granules should be of “d” shape • its dust content should be less than 0.25 % • it should contain sodium hydroxide 0 4% by weight and calcium hydroxide over 85% by weight • it should consistently absorb 150 litres of co2 per kg of sodalimebefore experiencing 0.5% co2 breakthrough • its hardness should be of optimum level ( 99% uspxxii ) • it should change color from white to violet • it should be iso and ce. , braided e caprolactone coated lactomer 1, 90cm gs 24 violet 40mm ½ circle reverse cutting , hmef: specification: • heat and moisture exchanger with bacteria and viral filter for adult with sampling port. • it should have filtration efficiency bacterial – 99.9999% & viral – 99.998% • it should be suitable for tidal volume of 120 – 750 ml • it should have a dead space of 30 50 ml • it should weight 15 20 gm • it should be iso and european ce. , limb o circuit specification: it should also have hmef with below • heat and moisture exchanger with bacteria and viral filter for adult with sampling port. • it should have filtration efficiency bacterial – 99.9999% & viral – 99.998% • it should be suitable for tidal volume of 120 – 750 ml • it should be iso and european ce , braided e caprolactone coated lactomer 3 0, 75cm c 14 undyed 24mm 3 / 8 circle reverse cutting , adult dual heated circuit with chamber it should with dual heated circuit with disposable auto feed chamber length of the circuit should be 5 feet it should support minimum tidal volume of 120ml it should be dehp, bhp or latex free it should have spiral wire design for reduction of condensate and to promote ideal humidity output it should be compatible with fisher & paykel mr850 heater base it can be used for upto 30 days on a single patient it should have european ce ( by notified body ) / usfda , infant dual heated circuit with chamber it should with dual heated circuit with disposable auto feed chamber length of the circuit should be 4 feet it should support maximum tidal volume of 120ml it should be dehp, bhp or latex free it should have spiral wire design for reduction of condensate and to promote ideal humidity output it should have dual swivel patient port for ease in positioning of the circuit it should be compatible with fisher & paykel mr850 heater base it can be used for upto 30 days on a single patient it should have european ce ( by notified body ) / usfda , prone position head cushion with mirror color natural dimensions height: 5.84 in ( 14.83 cm ) width: 9.50 in ( 24.13 cm ) length: 12.05 in ( 30.61 cm ) materials cushion material: polyurethane foam made without dehp product does not contain natural rubber latex. it should have european ce ( by notified body , braided e caprolactone coated lactomer 2 0, 90cm gs 21 undyed 30mm 1 / 2 circle tapper point , braided e caprolactone coated lactomer 1 90cm gs 25 undyed 37 40mm 1 / 2 circle reverse cutting , braided e caprolactone coated lactomer 0 90cm gs 24, violet40mm ½ circle taper point , braided e caprolactone coated lactomer 3 0 75cm cv 25, violet20 22mm ½ circle taper point , braided e caprolactone coated lactomer 1 090cm gs 25, undyed 40mm ½ circle reverse cutting , polyglactin 910 braided coated with antibacterial 2 / 0, 70 cm undyed with ½ circle 25 mm rb , monofilament polyglyconate1 150cm gs 25 loop, green 48mm ½ circle taper point , monofilament polyglyconate2 0, 75cm , green 26 30mm ½ circle taper point , monofilament polyglyconate3 0, 75cmgreen 20 26mm ½ circle taper point , monofilament polyglyconate4 0, 75cm green 17 20mm ½ circle taper point , monofilament glycomer 2 0, 90cm gs 21, volet 37mm ½ circcle taper point , non absorbable surgical suture, sterilized surgical needle black silk with needle ½ circle round bodided 30 mm needle, length 70 cm size 2 0 , braided polyester coated with silicon 2 0 8x75 cm 2xy 31 plgt, blue & white 16mm ½ circlr taper cutting oval pledget , braided polyester coated with silicon 2 0 10x75 cm 2xcv 305 pgt, blue & white 25mm ½ circlr taper cutting oval pledget , monofilament polypropylenewith peg additive 3 0 90cm 2xvf 20, blue 26mm ½ circle taper point , monofilament polypropylenewith peg additive 2 0 90cm 2xvf 20, blue 30mm ½ circle taper point , monofilament polypropylenewith peg additive 4 0 90cm 2xvf 23, blue 17mm ½ circle taper point , monofilament polypropylenewith peg additive 5 0 90cm 2xvf 23, blue 17mm ½ circle taper point , monofilament polypropylenewith peg additive 6 0 75cm 2xvf 22, blue 13mm ½ circle taper point , monofilament polypropylenewith peg additive 7 0 60cm 2xkv 1, blue 9mm 3 / 8 circle taper cutting , monofilament polybuetester coated with polytribiolate 6 0 75 cm 2xcv 1x36, blue 9mm 3 / 8 circle taper point , monofilament polybuetester coated with polytribiolate4 0 75 cm 2xcv 23x36, blue 17mm½circle taper point , monofilament polybuetester coated with polytribiolate 7 0 60 cm 2xmv 175 8, blue 8mm 3 / 8 circle taper point , monofilament polybuetester coated with polytribiolate 2 0 90 cm 2xv 20x36, blue 26mm ½circle taper point , monofilament polybuetester coated with polytribiolate 3 0 90 cm 2xv 20x36, blue 26mm ½circle taper point , non absorbable synthetic unidirectional dual cut angle barb with welded loop end made up with polygbeutester size 1, 37 mm, 30cm ½ circle tp , synthetic absorbable wound clouser device with dual cut barb with velded loop on end madeup polybeutester , absorbable synthetic unidirectional dual cut angle barded with walded loop end madeup polyglyconate green size 1 0, 26 30mm, 30cm ½ circle taper point , synthetic absorbable wound cloure device with dual cut barb with velded loop on end madeup polyglyconate green size 1 0, ½ circle 37mm, 30cm taper point , synthetic absorbable wound cloure device with dual cut barb with velded loop on end madeup polyglyconate green size 2 0, ½ circle 26mm, 30cm taper point , synthetic absorbable wound cloure device with dual cut barb with velded loop on end madeup polyglyconate green size 3 0, ½ circle 26mm, 30cm taper point , synthetic absorbable wound cloure device with dual cut barb with velded loop on end madeup glycomer blue green size 2 0, ½ circle 24mm, 30 45cm rc , laproscopic knotless pg pcl surgical suture self fixation device with autolock mechinsm made up of pga pcl unidirectional tp 26mm & 20cm size 2 0 , polyester ethelene terephthalate nonabsorbable surgical suture polyester suture is a nonabsorbable braided sterial surgical suture composed of poly ( ethylene terephthlate ) it is prepared from fibers of high molecular weight long chain linear polyesters ½ circle tapercut 2xv 5 double needle 26 mm 90 cm green color size 2 0 , non absorbable surgical suture black braided silk 1 0 rb ½ circle 30 mm 90 cm , non absorbable surgical suture black braided silk 1 0 rc 3 / 8 circle 45 mm 76 cm , non absorbable surgical suture black braided silk 5 0 rc 3 / 8 circle 12 mm 76 cm , non absorbable surgical suture black braided silk 5 0 rb 3 / 8 circle 16 mm 76 cm , absorbable gelatin sponge 80 x 50x 10mm , absorbent cotton wool ip 500 gm , blood administration set blood transfusion set , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 6.5 inches, powderfree ( disposable sterile surgical rubber gloves ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7 inches , powder free ( disposable sterile surgical rubber gloves ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7.5inches, powder free ( disposable sterile surgical rubber gloves ) , suction catheter, sterile. size: fg 5 , suction catheter, sterile. size: f g 6 , suction catheter, sterile. size: f g 8 , suction catheter, sterile. size: f g 10 , suction catheter, sterile. size: f g 12 , suction catheter, sterile. size: f g 14 , suction catheter, sterile. size: f g 16 , suction catheter, sterile. size: f g 18 , catheter, size 8 ( foleys balloon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 10 ( foleys balloon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 16 ( foleys balloon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 20 ( foleys balloon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , infant feeding tubesize 10fg , infant feeding tube size 8fg , infant feeding tube size 5fg , perfusion set with airway and needle, ( adult use ) sterile disposable , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable , infusion set with microdrip, ( i.v. ) sterile disposable , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 [ s14 ] , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ] , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 26g , mucus extractor sterile , nasal oxygen set, twin bore all sizes adult , nasal oxygen set, twin bore all sizes paediatrics , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape [ s18 ] , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape [ s19 ] , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape [ s20 ] , plaster of paris bandage 15cm x 2.7 mts / roll [ s21 ] , plaster of paris bandage 10cm x 2.7mts [ s22 ] , ryles tube / nasogastric tube size: 10 , ryles tube / nasogastric tube size: 12 , ryles tube / nasogastric tube size:14 , ryles tube / nasogastric tube size: 16 , ryles tube / nasogastric tube size: 18 , scalp vein set ( disposable ) size 18g , scalp vein set ( disposable ) size 20g , scalp vein set ( disposable ) size 22g , scalp vein set ( disposable ) size 24 g , syringe 2 ml / 01 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable , surgical blade sterile, size 11 , surgical blade sterile, size 22 , surgical blade sterile, size 23 , skin shaving blade , p.p.e kit , blood lancets , suture needles curved 1 / 2 circle round body assorted size 11 15 , suture needles curved 1 / 2 circle round body assorted size 1 5 , suture needles curved 1 / 2 circle round body assorted size 16 20 , suture needles curved 1 / 2 circle round body assorted size 6 10 , suture needles curved and cutting 1 / 2 circle cutting size 6 10 , suture needles curved and cutting 1 / 2 circle size , suture needles curved and cutting 1 / 2 circle size 16 20 , suture needles curved and cutting size 1 5 , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch , urine collecting bag, disposable 2000 ml , double j stent, sterile, both ends open size 4f, length 16 cm [ s41.a ] , double j stent, sterile, both ends open, size 5f, length 20 cm [ s41.b ] , double j stent, sterile, one end closed size 4f, length 16 cm [ s42.a ] , double j stent, sterile, one end closed, size 5f, length 20 cm [ s42.b ] , endotracheal tube, plain size 2.5 , endotracheal tube, plain size 3 , endotracheal tube, plain size 3.5 , endotracheal tube, plain size 4 , endotracheal tube, plain size 4.5 , endotracheal tube, plain size 5 , endotracheal tube, plain size 5.5 , endotracheal tube, plain size 6 , endotracheal tube, plain size 6.5 , endotracheal tube, plain size 7 , endotracheal tube, plain size 7.5 , endotracheal tube, plain size 8 ] , endotracheal tube, plain size 8.5 , endotracheal tube, cuffed size 4 , endotracheal tube, cuff size 4.5 , endotracheal tube, cuff size 5 , endotracheal tube, cuff size 6 , endotracheal tube, cuff size 6.5 , endotracheal tube, cuff size 7 , endotracheal tube, cuff size 7.5 , endotracheal tube, cuff size 8 , endotracheal tube, cuff size 8.5 , endotracheal tube, cuff size 9 , tracheostomy tube, plain all sizes , tracheostomy tube ( pvc ) , cuffed all sizes , abdominal drain kit ( with collection bag 2000 ml size 24 , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 , corrugated drainage sheet all sizes , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm [ s73 ] , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm [ s74 ] , sterilized umbilical cotton tape width 3 mm, length 75 cm , bone wax sterilised [ s80 ] , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm [ s81 ] , skin graft knife blade ( sterile ) , k wire, length 375 mm; 1mm , k wire, length 375 mm; 1.6mm , k wire, length 375 mm; 1.8mm , face mask, disposable , surgical cap disposable ( for surgeons ) , surgical cap, disposable ( for nurses ) , rubber examination gloves, size small , rubber examination gloves, size medium , rubber examination gloves made of natural rubber latex, non sterile, size large , pressure monitoring line / high pressure extension line , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml , umbilical catheter fornew born , size 4 , umbilical catheter fornew born , size 5 , umbilical catheter fornew born , size 6 , umbilical cord clamp , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property , sanitary napkin beltless , sanitary pads belt type , sanitary napkin beltless with wings , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 , nelaton catheter size 14 fg , ecg electrode , ecg roll , surgical blade sterile, size 23 single peel package in metal foil as per is 3319 , sterile hypodermic syringe with needle attached, 22g, single use 50 ml , urethral catheter 90 ( fg 14 ) made up of medical grade pvc , urethral catheter 91 ( fg 10 ) , made up of medical grade pvc , vaccum suction set, 2.5 meter length , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) , 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) , double valve trosic drain which remove under water seal and generate negative suction , thoracic drain 8cm , thoracic drain 25cm , thoracic drainage kit , feeding pump , breast pump , ot dress , feeding pump consumables , disposal cpap tubes , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube , nasal pronge child , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g , nebulization mask adult , nebulization mask paediatric , liposomol amphotericine injection b 50mg , nonabsorbable polypropylene light weight macroporous mesh , three dimensional mono filament polyester composite mesh with collagen with glycerol anci adhesl t barrier visceral side and stay suture in parietal side along with medial medial , three dimensional mono filament polyester composite mesh with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along v.ith medial medial , three dimensional monofilament polyester composite mesh with with collagen with glycerol anti a.dl1esive barrier visceral side and stay suture in parietal side along with medial medial , absorbable 5 mm hernia mesh fixation device 30 screw shaped with proximal wings of pgla tacks of4.l mm length along nlth flexible shaft up to 3 cm. , absorbable 5 mm hernia mesh fixation device 15 screw shaped with proximal wings of pgla tacks of 4. j mm length along with flexible shaft up to 3 cm. , non absorbable 5 mm hernia mesh fixation device with 30 helical shaped tita11ium tacks 3.96mm v, 1dtl1 and 0.61 mm , 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatrc polymer ( peek ) cap io avoid metal exposure nlth 15 fasteners , 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered nlth atraumatic polymer ( peek ) cap to avoid metal exposure with 30 fasteners , light weight monofilament polypropylene mesh, design to confinn inguinal anatomy, 3d shape , light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape , light weight monofilament polypropylene mesh, design to confinn inguinal anatomy, 3d shape , light weight monofilament polypropylene mesh, design to confinn inguinal anatomy, 3d shape , stapler 33mm with controlled tissue compression with adjustable staple height ( i _0 2_::, mm ) for controlled tissue compression, longer staple leg 5.5mm & non slip grip surface , laparoscopic cartridge for stapler 60 mm blue, 1.5 mm closed staple height vith gripping surt3ce technology and six rows compatible with all range of endoscopic linear cutter 601mn , laparoscopic cartridge for stapler 60 mm green, 2 0 mm closed staple height with gripping surface technology and six rows compatible with all range of endoscopic linear cutter 60mm , pph stapler 33mm hemorrhoidal stapler kit consists of 33mm hcmorrhoidal circular stapler ( with cr cd anvil.. adjustable closed staple height from 0.75 mm 1.5 mm, staple open leg length of 5.5 mm ) , suture threader, cucular anal dilator, purse string suture anoscope, sulure for purse string. , optically guided bladeless trocar 12mm with bilateral tissue separators, optical tip to eliminate blind e11try, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill ;eeondary seal, integrated wliversal seal that eliminates the use of reducer, 150mm length. , optically guided bladeless trocar 12 mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer length 100mm. , facial closure device cont.a.in optical bladeless trocar with facial closure device comaptible with cle::ir , .:annula have two side opening meant for uniform port closure , varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length , varied staple height reloads / cartridges for 80 mm gia instruments with tri staple technology, with the cutting knife blade incorporaled in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg lengtl1 , linear cutler with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 60 mm tristaple gia stapler. compatible with tri staple gia 60 mm open linear cutte reloads / cartridges purpule and black , eea circular stapler purple colour medium thick, triple ro, v with tristaple technology ( three row ofslaple inner to outer row 3.0, 3.5 and 4.0 mm with sloped cartridges face in one stapler ) diameter 31mm , linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 80 mm tristaple gia stapler. compatible with tri staple gia 80 mm open linear cutter reloads / cartridges purpule and black , wound protector with double ring in small 2.5 6 cm usfda approved , wound protector with double ring in medium 5 9 cm , wound protector with double ring in large in size 9 14 cm usfda approved , endo catch specimen removal kit:with continuous ring , polyurethane pouch with 34.5 cm shaft lenglh, 10mm with leak.proof and impervious material to cancer cells of0.5 microns / pretied purse string on pouch usfda approved , disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logic technology and digital display titanium clips u shaped , laparoscopic i:iner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in hoth direction. for use with cartridges in sizes of30mmcapable of loading all length cartridges on same gun only , hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, l 7cm length, 16mm curved active blade with adaptive tissue technology capable of sealing blood vessels upto and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 17 , laparoscopic shears 5mm diameter, 36cm long, 15mm curved coated blade and a clamp arm with tis;, uc pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 5mm in diameter, 360 deg.rces rotation, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation , advanced bipolar tissue sealer 25 ems, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in open surgical procedures with curved and tapered iip and uses an advanced algorithm for intelligent and efficient energy delivery_ device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation , advanced bipolar tissue sealer 37 ems, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree conlinuous shaft rotation , laparoscopic shears 5mm diameter, 36cm long, 18mm curved coated blade and a clamp arm with tissue rad, capable of cutting, seajing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter , ergonomic handle compatible with ultrasonic energy source, capable ofhand and foot activation with an integrated hand piece and transducer_ , connecting cable for ultrasonic hannonic scalpel for open energy probes compatible with focus plus shear hp blue , connecting cable for ultrasonic hannonic scalpel for lap energy probes compatible with ace plus shear hp054 , biological glue with thrombin & aprotinin 1 ml , biological glue with thrombin & aprotinin 2ml , sterile oxidized regenerated cellulose hemostating agent in netform fibrillar and in thick sheath ab pc:1· jp , laproscopic port with trocar 5mm optically guided bladclcss trocar 5mm .vith bilateral tissue separators, optical tip to eliminate bl111d entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckb1!i econdaiy seal, integrated universal seal that eliminates the use of reducer, 150mm length. , surgical gloves 6.5non latex surgical gloves synthetic polyisoprene powder free overall length 2r3rnm with p1mcture indicator technology usfda approved , surgical gloves 7 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved , surgical gloves 7.5 non latex surgical gloves synthetic polyisoprene powder free overall l ngth 2!:nmm with puncture lndicator technology usfda approved , double wall resuscitator with peep valve in adult it should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve for adult bag volume: mark iv ( 1300 ml ) weight: adult ( 415 g ) it should be us fda, ce & iso certified , single patient use sebs resuscitator ( spur 11 with peep valve in paed ) • it should be single use resuscitator made to sebs material not pvc it should have unique single shutter valve system for reliable fimctionality & swivel bero.;een valve and mask pennits 360° positioning in relation to the patient • it should have thin walled compression bag v.rith hand strip.it should have provision io attach manometer for paediatrics ambubag. • resuscitator volume: pediatric ( 635 ml ) • ( including reservoir and mask ) it should be ce / iso, us fda certified. , single patient use sebs resuscitator ( spur 11 with peep valve in neonatal ) • it should be single use resuscitator made to sebs material not pvc • it should have unique single shutter valve system for reliable functionality & swivel between valve ant.1 mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: neonatc ( 220ml ) • ( including reservoir and mask ) it should be ce / iso, us fda certified , silicone pre formed sga • itshould be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atrau.matic insertion and removal. it should be ce / iso, us fda certified size 3 , over the ear nasal cannula with star lumen, 50 tubing, must be flexible contoured lip tab provide a high level of stability and patient comfort. over the ear design for a comfortable and secure fit, crush and kink reshtant tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 5 l ok & cf: certification , pediatric nasal cannula pediatric nasal cannula softech with universal oxygen connector. 7 star lumen tubing lightweight. flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs help mct: .nnize patient comfort. individually packaged for convenience and sterility_ manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification , infant nasal cannula infant nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight lkxible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs to help maximize patient comfort individually packaged for convenience and sterility manufacturer must be us fda registered & cert1f1ed with en / eu iso 13485 & applicable 510k & ce certification. , volumetric incentive spirometer ( adult ) volumetric incentive spirometer ( adult ) 4000 rnl with handle. volmne measurement must be compact comfortable designed to accommodate large inspired volumes. must have good better best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable siok & ce certification. , infant prong cpap cannula infant prong cpap cannula nasal size o 11th designed to reduce trauma associated with delivery of infant nasal cpap must be soft siliconised, anatomically curved prongs to enhance fit luer fitting on ex piratory conneclor to allow proximal airway pressure monitoring. each set to include, soft siliconised cannula; lnspiratory & expiratory dhow connector; knit cap; two 6 in. hook and loop fastener sections; two 10 to 7.5 mm adaptors. manufachrrer must be l.1s fua registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , fhme heat and moisture exchangers with bacteria viral filters bacterial filtration efficiency> 99.99 % and viral filtration efficiency > 99.9999%. ftlter membrane should be of a hydrophobic non woven polypropylene material. should be tailored to meet the specific needs of both anaesthesia and intensive care , closed suction catheter for paediatrics number and color coded graduations for conttolled depth suctioning.separate y connectors available for different tubes in the pack.catheter ls made up of medical grade silicon material_sizes are 5fr_ , closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning_separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon :tv1aterial. sizes are 6fr , paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane_l.hickncss of cuff is 10 microns.microcuffseals at an average cuff pressure of 11 cm.h2o.burst pressure of cuff is 805cmh2o anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3mm. , paediattic endotrncheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethanej h1dcness of cuff is 10 microns.microcuffseals at an average cuff pressure of 11 cmh2o.burst pressure ofcuffis 805cmh2tl anatomically ba, ;;ed intubation depth marking with precision bands.cuff with play mode function. sizes are 3.5mm. , paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyllrethane, tliickness of cuif is io microns.microcuff seals at an average cu!t ptessure of 11 cmh2o.burst pressure of cuff is 805cmh2o , natomically based intubation depth marking with precision bands.cuff with play mode function_ sizes are 5.5mm , disposable spo2 sensor it should be base on original nellcor technology with original oximax technolo , reusable anaesthetia face mask of silicone autocalvable & pure transparent us fda approved and size should be mentioned onmask. , reusable anacsthetia face mask of silicone autocalvable & pure transparent us fda approved and size should be mentioned on mask. , neonatal single heated wire breathing system with auto fill humidification chamber in sterile pad. cmd us fda approved. should be compatible every humidifier , paed. single heated wire breathing system with auto fill humidification chamber in sterile pack ai1d us fda approved. should be compatible every humidifier. , neonatal high flow nasal cannula having 8 litre flow. should have soft tip. , cutting & coagulations device with tissue fusion ligasure technology having maryland jaw sealer anj. divider with wide jaw aperture 13mm and cut length 18.5mm with shaft rotation of 350 degrees and with one step scclling mechanism. should have the manual cutting mechanism and it should have including 7mm cutting and coag with usfda , cutting &coagulations device with tissue fusion ligature technology have small jaw tissue sealing system for open procedures vessel sealing instrument with cut length of 14.7 mm, seal length of 16 5mm_, jaw angle 28 degrees. sbould have the manual cutting mechanism.and its should have including 7mm cutting and coag with usfdj , cutting &coagulations device with tissue fusion ligature technology laparnscopic blunt tipped vessel sealer and divider 37 cm long 5mm instrument. wide jaw aperture 14.5 mm with shaft rotation of 180 degrees; multifw1ctmnal laparoscopic device for tissue fusion.a.nd its should have including 7mm cutting and coag with usfda . , cutting &coagulations device with tissue fusion ligasure technology instrument for open surgeries , ith instrument length between 18 l9cm and electrode length between 16 1?cm, having 28 degree curved jaw with contoured tip for blunt dissection and having activation both through hand activation and foot activation with a manually controlled cutting mechanism. , cuuing &coagulations device with tissue fusion ligasuretechnology have36mm jaw length, l 80 degree rotatable instrument with curved blade for large volwne tissue_ should have the manual cutting mechanism. , cutting &coagulations device with tissue fusion ligasuretechnology have vessel sealing instrument for open surgeries with reusable clamp length bet .veen l 6 18cm, with 12 14 degree jaw curve.and its should have including 7mm cutting and coag withusfda_ , et tube with yellow subglotic suction line with inverted and soft seal cuff with usfda / ! :liropean ce , apple hunt trocar : should be single use sterile trocars, have side port , two cannula & one trocar , 5 mm & 10 mm trocar with pyramidal tip, ergonomic design , fascia anchoring thread should be usfda / ce approved , see clear: should be able to attach to the side port of trocar, single use latex free, able to remove 99.99% of 0.01 micron particles, dual filter have charcoal & ulpa, max. flow rate 8.0 ltr / min., tubing have 30’’ length should be usfda / ce approved , carter thomason port closure : should be carter thomson type port closure system, have pilot guide and suture passer separately, able to use for trocar defects of 5mm 15mm, suture guide holes should be 180 degree access across each other’s, single use should be usfda / ce approved , milex silicon passeries: should be silicon pessary, latex free, pessaries to be available for pelvic organ prolapses and urinary incontinences, with ring, ring with support and ring with knob, etc., available in multiple sizes. should be usfda / ce approved , flow cannula: to be used with low / high flow humidified oxygen soft and delicate interface individually packaged single use mode of high performance tpe suitable for medical use . connection: m15mm . dimensions:4 sizes xxs, xs, s, m . class according to 93 / 42iec directive: lla general information • cannula in tpe ( suitable to medical grade ) • tube in medical pvc • it is used in newborns for niv & hhfnc with an m 15 connector • latex free • dehp free • available in the following size: prongs length outer diameter 7.5 mm 2.3 mm 8.5 mm 2.6 mm 9.5 mm 3.0 mm 10.5 mm3.5 mm , kcm gown , nasal cannula assembly: characteristics . soft and delicate interface . individually packaged . single use . mode of high performance tpe suitable for medical use . connection: m15mm . dimensions:4 sizes xxs, xs, s, m . class according to 93 / 42iec directive: lla components nasal cannula bonnet made up of 100% cotton with elasticity bubble cpap cannula holder set includes: y connector with water condensation line out white cap two expandable tubes ( upto 7ocm ?10f ) available in the following size: prongs length outer diameter 8 mm 2 mm 10mm2 mm 12 mm 3 mm 14 mm 4 mm , nasal canula for new born made of tpe with & prong size ? 2mm l 8mm <750gm ? 2mm l 10mm <750 1250 gm ? 3mm l 12mm <1250 2000gm ? 4mm l 14mm <2100 4kg , resuscitation mask for new born : 1. should be anatomical shape ( not circular ) 2. should cover both mouth and nose , heparinized glass capillary tubes , hypothermia alert device , infant nasal fixator , neonatal heated wire circuit , infant nasal cpap , infant nasal mask , high folw nasal cannula , apnea monitor , technical specificaiton of one beam ( bilirubinometer ) ? bench top point of care bilirubin meter ? direct reading photometery determining total bilirubin in serum / plasma ? auto off ? automatic calibration setting between measurements ? dual wavelength measurement: 460 nm and 550 nm ? correcting for hb at 550 nm ? measuring range: reading 4 / 30 mg / dl or 68 / 510 micromol / l ? measure precision: + / 1% ( fs+ measurement ) ? read out in mg / dl and micromol / l at the same time ? display of interfering agent ? sample volume equal to 55 micro liter ? interfering haemoglobin automatic compensation interfering agent displayed ? fast analysis time <5 sec ? oled display ? power requirements: 220 v / 50 hz ( with adapter ) device is safety certified according ce european , cytology brush and wooden spatula , endometrial biopsy curette , hsg device , tubal recannulation set , ssg devise , cyst aspiration needle , sterile vaginal probe covers , endoscopic cleaning brush , ellavi ubt , 3.8cms lenth spinal needle with stylet 22 g and 25 g for pediatrics , pur single lumen umbilical 2.5 with 40cms length , 5cms length 25 g spinal needle , 0.22 micron endotoxic 96 hrs filter , umbilical canula no 5 , umbilical canula no 6 , pur single lumen umbilical 2.5, fr with 40cms length , pur single lumen umbilical 3.5, fr with 40cms length , pur single lumen umbilical 4 fr with 40cms length , pur single lumen umbilical 5fr with 40cms length , cmg central venous cannula 45cms + 70 cms 14 / 16g , extra large 120mm 25g spinal needle , extra large 145mm 25g spinal needle , extra large 145mm 27g spinal needle , quickie bevel 22g 120mm with extra large lenth spinal needle , single valve trosic drain which remove under water seal and generate negative suction , double valve trosic drain which remove under water seal and generate negative suction , thoracic drain 8cm , thoracic drain 25cm , thoracic drainage kit , pe baby wrap double layer green house gas bed with adjustable hud, front velco and spine support for pre term baby to avoid hypothermia size small , pe baby wrap double layer green house gas bed with adjustable hud, front velco and spine support for pre term baby to avoid hypothermia size medium, large , pe colled extension line for fluid infusion us fda approved 1mm internal diameter length 100cms , pe colled extension line for fluid infusion us fda approved 1mm internal diameter length 200cms , pe pressure capacity 40 bar male to female venous infusion and pressure monitoring line with 1mm internal diameter 100cm, 200cms us fda approved , pur transparent semi periable strechable.hypoallergic sterline incision drape or dressing for proctecting catheter introduction sites ( permiable to water vapour and oxygen 300% strechable. us fda approval 45* 60 , pur transparent semi periable strechable.hypoallergic sterline incision drape or dressing for proctecting catheter introduction sites ( permiable to water vapour and oxygen 300% strechable. us fda approval 45* 90cms , pur transparent semi periable strechable.hypoallergic sterline incision drape or dressing for proctecting catheter introduction sites ( permiable to water vapour and oxygen 300% strechable. us fda approval 15cm x 20cms , pur transparent semi periable strechable.hypoallergic sterline incision drape or dressing for proctecting catheter introduction sites ( permiable to water vapour and oxygen 300% strechable. us fda approval 8*6cms , surgical scrub brushes spong 20% chlorhexidine in 15ml sol of isopropyl alcohal and water with nail cleaner , epidurial kit paed , epidirial kit adult , feeding pump consumables , et tube with secondary lumen ( surfactant lumen ) , camscope , multifuctioning medical camera whole system , fiber optic laryngoscope paediatric set should be led white light should have mat finish with slim paed handle miler blades size 00, 0, 1 in pvc box , laryngoscope paediatric set should have led white light should have mat finish with slim paed handle miler blades size 000, 00, 0, 1 in pvc box , octopus 3 way , photosensitive pm line should be sterile, pyrogen free should be non toxic latex free ce mark length 150cm , tube exachanger and oxygenating bougie ped , bousinac bougie , picc line 24g double lumen , pur hd catheter kit double lumen 6.5fr 11cm with 7fr x 10cm dialator , pur hd catheter kit double lumen 8.5fr 11cm with 9fr x 10cm dialator , pur hd catheter kit double lumen 11.5fr 13cm with 9fr x 10cm dialator , silicon long term hemodialysis catheter , needleless 2 way connector with 10cm extension , burette ivset measured volume fluid administration set with bacteria retentive air inlet , triple pressure monitoring kit with option of closed loop blood sampling kit including needleless sampling site , pur central venous catheter triple lumen 7fr , 13cm & 16cm lengthand nitonel guidewire with anti blood flow connector on introducer needle. , pur central venous catheter four lumen 8.5fr , 13cm length and nitonel guidewire with anti blood flow connector on introducer needle. , central venous catheter setsingle lumen 24g with nitonel guidewire , adult under pad , baby care kit , bed protection sheet 100x150 cm , bed protection sheet 120x210 cm , baby clothing set for new born babies , b.p cuff complete set , adult diaper medium , adult diaper large , adult diaper xl , disposable full gown , heating pad , hot water bottle , plastic jar , polythene gloves , crepe bandage , knee cap , cannula fixator , n 95 mask , operation kit , rubber kellys pad , baby wipes 40 pcs pack , bed paan , urine pot , vaporizor , disposable bed sheet , hemostatic matrix with thrombin 5 ml ( floseal 5ml ) , hemostatic matrix with thrombin 10 ml ( floseal 10ml ) , neocain no 24 , kit actimpartus , kit actimprom , iui kits , iui catheter iui 11 cms. ( straight opening ) iui 11 cms. ( lateral opening ) iui 11 cms. ( lateral opening ) iui ( curve ) 17 cms. ( straight opening ) , makler counting chamber , sperm counting chamber hawksley , micro pipettes , syringe 1 ml hypodermic with needle attached 24g, sterile, single use disposable , uterine balloon tamponade...

Rajasthan Rajya Vidyut Utpadan Nigam Limited - Rajasthan

33891791 tn sc proc 132 requirement of various types of valves and spares for wagon tipplers, wheel chock, side arm charger, reclaimer and stacker cum reclaimer at chp, ssctpp suratgarh , valve & spares , accumulator ( 1 lit. ) , accumulator ( 2.5 lit. ) , accumulator adaptor , ball valve , ballvalve , ballvalve , ballvalve , ballvalve , ballvalve , ball valve , ball valve , ball valve , ball valve , breather , breather , butterfly valve , butterfly valve , checkvalve , check valve , check valve , check valve , counterbalance valve , counterbalancevalve , directactingrelief valve , expansionjoint , filler breather , flow control valve , flow control valve , flow control valve , hand pump ( 13cc, double stroke ) , inline throttle & check valve , magnetic candle , minimesscoupler , minimess coupler , minimess coupling , minimess hose , modular check valve , pilot operated check valve , pilot toclose checkvalve , poppet2 / 2 way valve , pr. switch ( 1no+1nc ) , pr. switch ( 1no+1nc ) , pr. switch ( 1no+1nc ) , pressurecompensatedflowcontrolvalve , relief valve , shutoff valve , shutoff valve , shut off valve , shut off valve , shut off valve , shuttle valve , slew / bucket wheel hydraulic motor end cap snap ring ( hy. motor h25 ) , slew / bucket wheel hydraulic motor end cap ( hy. motor h25 ) , throttlevalve , vane pump 46cc / rev...

Indian Oil Corporation Limited - Rajasthan

33881499 procurement of spares for major overhaul of greaves cotton make 6g11ta ff engine at wrpl sanganer procurement of spares for major overhaul of greaves cotton make 6g11ta ff engine at wrpl sanganer , cylinder liner neck rolled105 bore greaves cotton 6g11ta p / n 141101320074 ( as per details mentioned in the tender technical specification annexure ) , set of piston rings greaves cotton 6g11ta p / n 141100190098 ( as per details mentioned in the tender technical specification annexure ) , cylinder head gasket_victor greaves cotton 6g11ta p / n 141108540084 ( as per details mentioned in the tender technical specification annexure ) , piston 4g11tag3+pin+circlips greaves cotton 6g11ta p / n 141100196337 ( as per details mentioned in the tender technical specification annexure ) , conn. rod & cap assly. greaves cotton 6g11ta p / n p21101500017 ( as per details mentioned in the tender technical specification annexure ) , oilseal 78 100 12 greaves cotton 6g11ta p / n 104960650100 ( as per details mentioned in the tender technical specification annexure ) , set of gasket 6g11ta greaves cotton 6g11ta p / n 141100196048 ( as per details mentioned in the tender technical specification annexure ) , complete set of o rings 6g11ta genset greaves cotton 6g11ta p / n 141100196038 ( as per details mentioned in the tender technical specification annexure ) , con rod brg set leon std greaves cotton 6g11ta p / n 141104300017 ( as per details mentioned in the tender technical specification annexure ) , thrust washer ( c / s ) bottom greaves cotton 6g11ta p / n p21103400024 ( as per details mentioned in the tender technical specification annexure ) , thrust washer ( cr. shaft ) top greaves cotton 6g11ta p / n p21103400014 ( as per details mentioned in the tender technical specification annexure ) , primary element a / f greaves cotton 6g11ta p / n 105413100157 ( as per details mentioned in the tender technical specification annexure ) , secondary element a / f greaves cotton 6g11ta p / n 105413100158 ( as per details mentioned in the tender technical specification annexure ) , filt element with o ring part no 1200240911 ( as per details mentioned in the tender technical specification annexure ) , filt insert with o ring greaves cotton 6g11ta p / n 1200240912 ( as per details mentioned in the tender technical specification annexure ) , lube oil filter ( 232v12 ) greaves cotton 6g11ta p / n 605411880008 ( as per details mentioned in the tender technical specification annexure ) , cogged belt ax49 1285l greaves cotton 6g11ta p / n p03450211258 ( as per details mentioned in the tender technical specification annexure ) , swivel bolt 6g11 greaves cotton 6g11ta p / n 141103510124 ( as per details mentioned in the tender technical specification annexure ) , bush conn rod s end greaves cotton 6g11ta p / n p21104310012 ( as per details mentioned in the tender technical specification annexure ) , flex pipe greaves cotton 6g11ta p / n 100099390544 ( as per details mentioned in the tender technical specification annexure ) , flex pipe 1800 mm greaves cotton 6g11ta p / n 100099390754 ( as per details mentioned in the tender technical specification annexure ) , o ring ( liner ) greaves cotton 6g11ta p / n 104932111144 ( as per details mentioned in the tender technical specification annexure ) , fuel off solenoid ( isolated 24v ) greaves cotton 6g11ta p / n 107120130034 ( as per details mentioned in the tender technical specification annexure ) , stud m10 greaves cotton 6g11ta p / n 123203510264 ( as per details mentioned in the tender technical specification annexure ) , flex hose assembly 840 mm lg greaves cotton 6g11ta p / n 123209390124 ( as per details mentioned in the tender technical specification annexure ) , flang bellow greaves cotton 6g11ta p / n 123406520015 ( as per details mentioned in the tender technical specification annexure ) , complete set of hoses 6g11ta genset greaves cotton 6g11ta p / n 141100196018 ( as per details mentioned in the tender technical specification annexure ) , tension bolt 6g11 greaves cotton 6g11ta p / n 141103510135 ( as per details mentioned in the tender technical specification annexure ) , plain washer greaves cotton 6g11ta p / n 141103400044 ( as per details mentioned in the tender technical specification annexure ) , hard washer for cylinder head bolt greaves cotton 6g11ta p / n 141103400144 ( as per details mentioned in the tender technical specification annexure ) , flanged bolt m8x1.25x25 8.8 greaves cotton 6g11ta p / n 141103510825 ( as per details mentioned in the tender technical specification annexure ) , adaptor m16x1.5 m12x1.5 greaves cotton 6g11ta p / n 141104113024 ( as per details mentioned in the tender technical specification annexure ) , main bearing g11 std greaves cotton 6g11ta p / n 141104306019 ( as per details mentioned in the tender technical specification annexure ) , exh bellow iml greaves cotton 6g11ta p / n 141199936015 ( as per details mentioned in the tender technical specification annexure ) , hexbolt=m8x1.25x40 8.8 / cl greaves cotton 6g11ta p / n 602000100840 ( as per details mentioned in the tender technical specification annexure ) , hexscrew=m16x2.0x45 cl8.8 greaves cotton 6g11ta p / n 602000501645 ( as per details mentioned in the tender technical specification annexure ) , hexnut copper plated m8 10g greaves cotton 6g11ta p / n 602100540081 ( as per details mentioned in the tender technical specification annexure ) , hexnut m16x2.0 cl / 10 greaves cotton 6g11ta p / n 602100540160 ( as per details mentioned in the tender technical specification annexure ) , hexnut m10 cu. coated greaves cotton 6g11ta p / n 602100700100 ( as per details mentioned in the tender technical specification annexure ) , spring washer m 16 greaves cotton 6g11ta p / n 602160100160 ( as per details mentioned in the tender technical specification annexure ) , banjo bolt ( din 7623 ) greaves cotton 6g11ta p / n 604043200004 ( as per details mentioned in the tender technical specification annexure ) , banjo screw m14x1.5x31lg greaves cotton 6g11ta p / n 604043200008 ( as per details mentioned in the tender technical specification annexure ) , gasket exh silencer greaves cotton 6g11ta p / n 604910121000 ( as per details mentioned in the tender technical specification annexure ) , copper washer greaves cotton 6g11ta p / n 604920101014 ( as per details mentioned in the tender technical specification annexure ) , copper washer greaves cotton 6g11ta p / n 604920101218 ( as per details mentioned in the tender technical specification annexure ) , copper washer greaves cotton 6g11ta p / n 604920101420 ( as per details mentioned in the tender technical specification annexure ) , copper washer ( 1.5 mm ) 6g11tap / n 604920101824 ( as per details mentioned in the tender technical specification annexure ) , banjo screw m 10x22 6g11tap / n p04043301022 ( as per details mentioned in the tender technical specification annexure ) , thermostat element 6g11tap / n p05250100002 ( as per details mentioned in the tender technical specification annexure ) , washer for mb cap 6g11tap / n p21103400054 ( as per details mentioned in the tender technical specification annexure ) , boly, cyl. head m14x150 6g11tap / n p21103500014 ( as per details mentioned in the tender technical specification annexure ) , main bearing cap bolts g11 6g11tap / n p21103500024 ( as per details mentioned in the tender technical specification annexure ) , con rod bolt m12x1.25x67 6g11tap / n p21103530024 ( as per details mentioned in the tender technical specification annexure ) , pdc rocker cover 6g11tap / n p21107960024 ( as per details mentioned in the tender technical specification annexure ) , gasket t / c oil drain 6g11tap / n p21108530194 ( as per details mentioned in the tender technical specification annexure ) , gasket for pdc cover 6g11tap / n p21108530304 ( as per details mentioned in the tender technical specification annexure ) , integrated rocker assembly 14 hp 6g11tap / n p21106100027 ( as per details mentioned in the tender technical specification annexure ) , t / c repair kit 6g11tap / n 106907210002 ( as per details mentioned in the tender technical specification annexure ) ...

National Institution for Transforming India Aayog - Rajasthan

33827557 bids are invited for package no. 4 atal tinkering lab of niti aayog power supply and accessories and safety equipment ( q3 ) total quantity : 1 glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb holders , electric wires, usb to bc jack cable etc...

Rajasthan Rajya Vidhyut Utpadan Nigam Limited - Rajasthan

33804701 supply of various electrical items at csctpp, chhabra mcbs 1 mcb single pole 240/415v, 50 hz. channel mounted (in nos.) 1.01 2 a nos. 15 1.02 4 a nos. 15 1.03 6 a nos. 225 1.04 10 a nos. 215 1.05 16 a nos. 315 1.06 20 a nos. 5 1.07 25 a nos. 5 1.08 32 a nos. 205 1.09 63 a nos. 5 2 mcb double pole 240/415v, 50 hz, ac supply,channel mounted (in nos.) 2.01 2a nos. 50 2.02 4a nos. 20 2.03 6a nos. 25 2.04 10a nos. 20 2.05 16 a nos. 40 2.06 20 a nos. 4 2.07 25 a nos. 5 2.08 32 a nos. 9 2.09 40 a nos. 5 2.10 63 a nos. 9 3 mcb triplepole 240/415v, 50 hz, ac supply, channel mounted (in nos.) 3.01 32 a nos. 14 3.02 63 a nos. 2 3.03 6a nos. 17 3.04 10 a nos. 12 4 mcb four pole 240/415v, 50 hz, ac supply, channel mounted (in nos.) 4.01 2 a nos. 60 4.02 16 a nos. 25 4.03 20 a nos. 3 4.04 32 a nos. 30 4.05 63 a nos. 55 4.06 6a nos. 20 5 rccb four pole 240/415v, 50hz, ac supply, din rail mounted 5.01 63 a, 100ma nos. 15 5.02 40 a, 100ma nos. 2 18 6 mcb double pole dc, breaking capacity: ue=220 vdc, lcu=20ka, ue=440 vdc, lcu=10ka, ue=500 vdc, lcu=6ka, uimp=6kv 10ka, ics=75%lcu, din rail mounted 6.01 1a nos. 10 hrc fuses 7 hrc fuse links conforming to is:13703 ii, 80 ka, 415 v, 50 hz ,ns type with staggered tag in following ratings: 7.01 2a , ns 2 nos. 320 7.02 4a , ns 4 nos. 304 7.03 6a , ns 6 nos. 80 7.04 10a, ns 10 nos. 60 7.05 16a, ns 16 nos. 60 7.06 20a, ns 20 nos. 5 7.07 32a, ns 32 nos. 35 8 din fuse 415 v, 50 hz, breaking capacity: 100ka, type: hn, confirms to iec 60269 2, is 13703 part 2 8.01 125 a size 000 nos. 5 8.02 200 a size 0 nos. 3 8.03 125 a size 00 20 9 din fuse 500 v, 50 hz, breaking capacity: 120ka, type: nh, confirms to iec 60269 2, is 13703 part 2 9.01 63 a size 000 nos. 10 9.02 100 a size 000 nos. 6 10 bolted fuse 240 v, 50 hz, breaking capacity: 200ka, type: 160let (semiconductor fuse), confirms to iec 60269 2, is 13703 part 2 10.01 160 a nos. 15 11 bolted fuse 415 v, 50 hz, breaking capacity: 80ka, confirms to iec 60269 2, is 13703 part 2 11.01 200 a type: dd200 nos. 2 12 bolted fuse 690 v, 50 hz, breaking capacity: 200ka, (semiconductor fuse), confirms to iec 60269 2, is 13703 part 2 12.01 350 a type: 350fm nos. 3 12.02 63 a type: et nos. 6 12.03 80 a type: et nos. 3 19 13 din type ht hrc fuse: 100 a, 6.6 kv, model: fehvp, short circuit withstand current rating: 40ka, confirms to iec 60282 1 nos. 6 14 din type pt fuse: 3.15 a, 12 kv, model: abcna breaking capacity 45 ka nos. 3 15 din type pt fuse: 2 a, 6.6 kv, model: fevt nos. 3 16 690/700 v, 50 hz, 200 ka, type: square body din 43 653, stud mount 1100 a, size:3 nos. 3 17 ceramic fuse r055; rating: 250 v, 2 a nos. 5 18 hrc fuse link 80 ka hf type 18.01 2a nos. 270 18.02 4a nos. 170 18.03 6a nos. 270 18.04 10a nos. 170 18.05 16a nos. 320 18.06 20a nos. 150 18.07 25 a nos. 150 18.08 63a nos. 150 18.09 32a nos. 150 19 lt hrc fuse operating voltage 500v 50 hz breaking capacity 80ka performance requirement of is 9224 part ii 1979 and is:13703/1993 & mark isi nh type 19.01 6a,size 00 nos. 12 19.02 10a,size 00 nos. 12 19.03 16a, size 00 nos. 12 19.04 25a, size 00 nos. 12 19.05 32a size 00 nos. 299 19.06 63 a, size 00 nos. 122 19.07 100 a size 00 nos. 12 19.08 160 a size 01 grade ii nos. 12 19.09 200 a size 00 nos. 12 19.10 250a size 01 grade ii nos. 12 19.11 200 a size 01 grade ii nos. 12 19.12 315 a size 02 grade ii nos. 12 19.13 400 a size 02 grade ii nos. 12 20 type of rating tia type 20.01 32a nos. 5 20.02 63 a nos. 5 20.03 16 a nos. 5 20 21 lt hrc fuse operating voltage 500vac ,50 hz breaking capacity 80ka performance requirement of is 9224 part ii 1979 and is:13703/1993 & mark isi 21.01 nh type 250 amp size 02 nos. 5 21.02 nh type 80 amp size 00 nos. 5 21.03 nh type 6 amp size 00 nos. 5 22 tia type hrc fuse base & carrier of rating 32 amp nos. 200 pvc tape 23 pvc insulating tape rolls (type f pvc/90/0) with nominal thickness 0.125 mm exp. date must be 12 month from the date of supply in size : (0.125 mm x 1.8 cm x 8 m) 23.01 red colour nos. 430 23.02 yellow colour nos. 430 23.03 blue colour nos. 430 23.04 green colour nos. 330 23.05 black colour nos. 530 lugs 24 insulated copper lugs (pin type) in following sizes: 24.01 0.5 mm 2 nos. 1250 24.02 1.5 mm2 nos. 1450 24.03 2.5 mm sq. nos. 1250 24.04 4 mm sq nos. 700 24.05 6mm sq. nos. 175 24.06 10 mm sq. nos. 150 24.07 16 mm sq nos. 260 24.08 25 mm sq nos. 60 24.09 35 mm sq nos. 60 25 insulated copper lugs (fork type) in following sizes: 25.01 0.5 mm2 nos. 350 25.02 1.5 mm2 nos. 850 25.03 2.5 mm sq. nos. 1350 25.04 4mm sq nos. 750 25.05 6 mmsq nos. 100 25.06 10 mmsq nos. 100 25.07 16 mm sq nos. 50 26 insulated copper lugs (ring type) in following sizes: 26.01 0.5 mm2 nos. 750 26.02 1.5 mm sq. nos. 1500 26.03 2.5mm sq. nos. 1850 26.04 4mm sq. nos. 1350 26.05 6mm sq. nos. 500 21 26.06 10mm sq. nos. 100 26.07 16mm sq nos. 100 26.08 25 mm sq nos. 100 26.09 35 mm sq nos. 100 26.10 50 mm sq nos. 100 26.11 70 mm sq nos. 100 27 ring & tongue type heavy duty copper lugs, tin plated confirming to din 46235 / equit.; in following sizes: 27.01 35 sq mm nos. 50 27.02 50 sq mm nos. 50 27.03 70 sq mm nos. 30 28 aluminum lugs (pin type) in following sizes: 28.01 6mm sq. nos. 100 28.02 10mm sq. nos. 100 28.03 16mm sq. nos. 200 28.04 35mm sq. nos. 200 29 aluminum lugs (hole type) in following sizes: 29.01 6 sq. mm nos. 200 29.02 10 sq. mm nos. 200 29.03 16 sq. mm nos. 400 29.04 25 sq. mm nos. 200 29.05 35 sqmm. nos. 300 29.06 70 sqmm. nos. 200 29.07 120 sqmm. nos. 200 29.08 150 sqmm. nos. 200 29.09 185 mm sq. nos. 200 29.1 240 mm sq nos. 200 29.11 300 mm sq. nos. 80 29.12 400 mm sq. nos. 130 29.13 90 mm sq. nos. 50 30 copper lugs hole type (heavy duty) 30.01 6 sq.mm nos. 80 30.02 10 sq.mm nos. 80 30.03 16 sq.mm nos. 80 30.04 25 sq.mm nos. 80 30.05 35 sq.mm nos. 80 30.06 70 sq.mm nos. 80 30.07 120 sq.mm nos. 80 30.08 150 sq.mm nos. 80 30.09 185sq.mm nos. 80 31 aluminum lug in line connector 31.01 2.5 sq.mm nos. 25 31.02 6mm sq nos. 25 31.03 16 sq.mm nos. 25 31.04 25 sq.mm nos. 25 22 31.05 35 sq.mm nos. 65 31.06 70 sq.mm nos. 65 31.07 120 sq.mm nos. 25 31.08 185 sq.mm nos. 35 31.09 240 sq.mm nos. 25 31.10 300 sq.mm nos. 35 32 copper in line connector (long size) 32.01 6 sq.mm nos. 25 32.02 10 sq.mm nos. 25 32.03 16 sq.mm nos. 25 32.04 25 sq.mm nos. 25 32.05 35 sq.mm nos. 25 33 ring type aluminum lug (heavy duty) confirming to din46329/iec1238 part i/is 8309 33.01 10 sq mm nos. 100 33.02 16 sq mm nos. 100 33.03 35 sq mm nos. 75 33.04 50 sq mm nos. 75 33.05 70 sq mm nos. 50 33.06 120 sq mm nos. 50 33.07 150 sq mm nos. 50 33.08 240 sq mm nos. 50 33.09 300 sq mm nos. 30 33.1 630 sq mm chamfered mouth for 11 kv xlpe cable nos. 10 33.11 185 sq mm chamfered mouth for 11 kv xlpe cable nos. 10 33.12 150 sq mm chamfered mouth for 11 kv xlpe cable nos. 10 34 straight thru cu lugs 34.01 0.5 sq mm nos. 600 34.02 1.5 sq mm nos. 1000 34.03 2.5 sq mm nos. 1100 34.04 10 sq.mm nos. 300 34.05 16 sq.mm nos. 250 34.06 25 sq.mm nos. 250 35 insulated copper lugs (u type) in following sizes 35.01 0.5 sq. mm nos. 450 35.02 1.5 sq. mm nos. 250 cable gland 36 double compression heavy duty brass cable gland; ni plated, confirming to bs 6121/iec62444/iec 60529, ip 66/67 for armoured al xlpe cable 36.01 3cx240 sq mm nos. 10 36.02 3cx185 sq mm nos. 10 23 36.03 3cx150 sq mm nos. 10 36.04 3cx120 sq mm nos. 10 36.05 3cx35 sq mm nos. 10 36.06 3cx25 sq mm nos. 10 36.07 3cx6 sq mm nos. 10 36.08 5cx2.5 sq mm nos. 10 37 cable gland ss 1/2 nos. 100 38 cable gland ss 1 nos. 50 hand gloves 39 insulating hand gloves (pair) working voltage 1100v test voltage =11000 v ac size355mm pairs 35 40 cotton hand gloves (pair) for opening and closing steam valves and other heat areas; size medium; thickness 5 10mm; plain; leather (buff/split/chrome) pairs 45 indicating lamps 41 cluster led type 3plbrl 220v dc (red, green, amber, milky 100 nos. each) dia 22.5 mm with adaptor plate (2 nos.) for 30.5 mm dia hole . packet (100 each) 2 42 led type indicating lamp assembly ф 22.5mm, 110v ac ac/dc (red, green, amber, milky). nos. 190 43 rcb7 ivl 73 110, led pilot light, 110 ac, green color nos. 100 44 rcb7 ivl 73 110, led pilot light, 110 ac, red color nos. 100 45 gen x cluster led type (lvgp), 220 v dc 45.01 blue nos. 10 45.02 white nos. 20 45.03 clear nos. 10 45.04 amber nos. 20 45.05 green nos. 20 45.06 red nos. 20 46 gen x cluster led type (lvgp), 240 v ac 46.01 blue nos. 2 47 gen x cluster led type (lvgp), 64 v ac/dc 47.01 red nos. 2 47.02 yellow nos. 2 47.03 blue nos. 2 48 cluster led type, 110 v ac 48.01 green nos. 100 48.02 red nos. 100 48.03 amber nos. 50 24 49 indicating lamp assembly typerb2 bvl as per is 13947 5 1 iec 947 5 1 (red/green/amber/blue), 49.01 red (rb2 bvl74) nos. 120 49.02 green (rb2 bvl73) nos. 120 49.03 amber (rb2 bvl75) nos. 120 49.04 blue (rb2 bvl76) nos. 120 50 cluster led type 3plbrl 220v ac (red, green, amber, milky ) dia 22.5 mm with adaptor plate (2 nos.) for 30.5 mm dia hole . nos. 70 51 illuminated push button bch 30.5mm with 1 no +1 nc, 240 v, red/green colour lense nos. 10 terminal blocks 52 stud type terminal block (melamine housing) khaki color 52.01 4 sq mm (current rating 36a) nos. 100 52.02 10 sq mm (current rating 45a) nos. 100 52.03 16 sq mm (current rating 87a) nos. 100 52.04 35 sq mm (current rating 145a) nos. 100 53 25 mmsq screw type tb 100 54 bus bar type terminal block (melamine housing) khaki color 54.01 16 50 sq mm (current rating 145a) nos. 50 54.02 50 95 sq mm (current rating 250a) nos. 50 54.03 70 120 sq mm (current rating 300a) nos. 50 54.04 120 185 sq mm (current rating 450a) nos. 50 55 clip on type terminal block (melamine housing) khaki color 55.01 35 mmsq nos. 100 55.02 25 mmsq nos. 100 55.03 16 mmsq nos. 100 55.04 10 mmsq nos. 100 55.05 6 mmsq nos. 100 55.06 4 mmsq nos. 100 55.07 2.5 mmsq nos. 100 cork sheet 56 rubberized cork sheets confirming to is 4253 pt ii of 1980 rc 70c grade size of sheet : 915x610 mm of following thickness 56.01 2.00 mm nos. 50 56.02 4.00 mm nos. 10 56.03 6.00 mm nos. 5 56.04 8.00 mm nos. 5 25 56.05 10.00 mm nos. 10 56.06 12.00 mm nos. 5 switch fuse units 57 switch fuse unit with hrc 100a tpn nos. 5 58 switch fuse unit with hrc 63a tpn nos. 14 59 switch fuse unit in steel box 63 amp 4 pole(3p+1n) nos. 5 60 switch fuse unit with steel box 100 amp 4 pole(3p+1n) nos. 7 61 rewireable porcelain main switch fuse unit tpn 200a, with steel enclosures and side operating handle nos. 2 62 change over switvh 200a, 3ph, 4pole nos. 1 63 control transformer 415v/110v ac 150 va nos. 5 64 stop (red) pb push button with 1nc contact 22.5 mm nos. 20 65 start (green) pb push button with 1no contact 22.5 mm nos. 20 66 6 amp sp auto/off/manual selector switch nos. 15 67 water proof, puncture resistant, good mechanical strength, non corrosive electrical grade adhesive, fire retardant,: size 1.9 cm (w) x 0.3 mm (t) x 20 mtr.(l) specification: thickness0.3mm+/ 10%,adhesion to steel 100 gms/cm, tensile strength 8 kg/cm,bdv 2kv with 50% overlap nos. 5 68 polimeride film tape,0.05mm thick polymide film coated uniformly on one side with with silicon adhesive : size 2.5cm (w) x .05mm (t) x 25 mtr. (l), specification: total thickness (mm) 0.08mm minimum, adhesive to steel (gm/2.54cm) 800 minimum, tensile strength (kg/2.54cm) 30.0 minimum, elongation (%) 70.0 minimum. bdv (kv) (50% overlap) 11.0 minimum, flammability self extinguishing, nos. 5 69 ht insulation sleeves equivalent to permagrip 69.01 size 25 mm dia mtr. 2 26 69.02 size 16 mm dia mtr. 2 69.03 size 8 mm dia mtr. 2 70 control transformer resin cast 415/240v ac, 15kva ,1 ph, freq:50hz, type:an, hsv/il: 0.66/3kv, ins class: b, std. is: 12021/1987 nos. 1 71 control transformer : voltage 415/240v, capacity:250va, 1 phase,freq 50hz,line volts: i.l.0.66/3.0kv ins class: b,std. is:15/07/115803/9 nos. 4 72 lighting transformer: voltage 415/240v, capacity:1000va, 1 phase,freq 50hz, ins class: b nos. 1 73 lighting transformer: voltage 415/240v, capacity:2500va, 1 phase,freq 50hz, ins class: b nos. 1 74 welding transformer: voltage 415/415v, capacity:50kva, 1 phase,freq 50hz,dyn 11 ins class:b nos. 7 75 switch fuse unit with 32 a, tpn hrc fuse nos. 15 76 switch fuse unit with 125 a tpn hrc fuse nos. 2 77 11/6.6 kv pt fuse, 3.15 amp, 12 abcna3 15,12kvac, interrupt rating 45 ka, cartridge ,length : 195.3mm,diameter : 25.4mm ...

Rajasthan Rajya Vidyut Utpadan Nigam Limited - Rajasthan

33797101 supply of various electrical items at csctpp, chhabra supply of various electrical items at csctpp, chhabra , mcb single pole 240 / 415v, 50 hz. channel mounted , 2a , 4a , 6a , 10a , 16a , 20a , 25a , 32a , 63a , mcb double pole 240 / 415v, 50 hz, ac supply, channel mounted , 2a , 4a , 6a , 10a , 16a , 20a , 25a , 32a , 40a , 63a , mcb triplepole 240 / 415v, 50 hz, ac supply, channel mounted , 32a , 63a , 6a , 10a , mcb four pole 240 / 415v, 50 hz, ac supply, channel mounted , 2a , 16a , 20a , 32a , 63a , 6a , rccb four pole 240 / 415v, 50hz, ac supply, din rail mounted , 63a, 100ma , 40a, 100ma , mcb double pole dc, breaking capacity: ue=220 vdc, lcu=20ka, ue=440 vdc, lcu=10ka, ue=500 vdc, lcu=6ka, uimp=6kv 10ka, ics=75%lcu, din rail mounted , 1a , hrc fuse links conforming to is:13703 ii, 80 ka, 415 v, 50 hz , ns type with staggered tag in following ratings: , 2a, ns 2 , 4a, ns 4 , 6a, ns 6 , 10a, ns 10 , 16a, ns 16 , 20a, ns 20 , 32a, ns 32 , din fuse 415 v, 50 hz, breaking capacity: 100ka, type: hn, confirms to iec 60269 2, is 13703 part 2 , 125a size 000 , 200a size 0 , 125a size 00 , din fuse 500 v, 50 hz, breaking capacity: 120ka, type: nh, confirms to iec 60269 2, is 13703 part 2 , 63a size 000 , 100a size 000 , bolted fuse 240 v, 50 hz, breaking capacity: 200ka, type: 160let ( semiconductor fuse ) , confirms to iec 60269 2, is 13703 part 2 , 160a , bolted fuse 415 v, 50 hz, breaking capacity: 80ka, confirms to iec 60269 2, is 13703 part 2 , 200a type: dd200 , bolted fuse 690 v, 50 hz, breaking capacity: 200ka, ( semiconductor fuse ) , confirms to iec 60269 2, is 13703 part 2 , 350a type: 350fm , 63a type: et , 80a type: et , din type ht hrc fuse: 100 a, 6.6 kv, model: fehvp, short circuit withstand current rating: 40ka, confirms to iec 60282 1 , din type pt fuse: 3.15 a, 12 kv model: abcna breaking capacity 45 ka , din type pt fuse: 2 a, 6.6 kv model: fevt , 690 / 700 v, 50 hz, 200 ka, type: square body din 43 653, stud mount 1100 a size:3 , ceramic fuse r055: rating: 250v, 2a , hrc fuse link 80 ka hf type , 2a , 4a , 6a , 10a , 16a , 20a , 25a , 63a , 32a , lt hrc fuse operating voltage 500v 50 hz breaking capacity 80ka performance requirement of is 9224 part ii 1979 and is:13703 / 1993 & mark isi nh type , 6a size 00 , 10a size 00 , 16a size 00 , 25a size 00 , 32a size 00 , 63a size 00 , 100a size 00 , 160a size 01 grade ii , 200a size 00 , 250a size 01 grade ii , 200a size 01 grade ii , 315a size 02 grade ii , 400a size 02 grade ii , type of rating tia type , 32a , 63a , 16a , lt hrc fuse operating voltage 500vac , 50 hz breaking capacity 80ka performance requirement of is 9224 part ii 1979 and is:13703 / 1993 & mark isi , nh type 250 amp size 02 , nh type 80 amp size 00 , nh type 6 amp size 00 , tia type hrc fuse base & carrier of rating 32 amp , pvc insulating tape rolls ( type f pvc / 90 / 0 ) with nominal thickness 0.125 mm exp. date must be 12 month from the date of supply in size : ( 0.125 mm x 1.8 cm x 8 m ) , red colour , yellow colour , blue colour , green colour , black colour , insulated copper lugs ( pin type ) in following sizes: , 0.5mm sq. , 1.5mm sq. , 2.5mm sq. , 4mm sq. , 6mm sq. , 10mm sq. , 16mm sq. , 25mm sq. , 35mm sq. , insulated copper lugs ( fork type ) in following sizes: , 0.5mm sq. , 1.5mm sq. , 2.5mm sq. , 4mm sq. , 6mm sq. , 10mm sq. , 16mm sq. , insulated copper lugs ( ring type ) in following sizes: , 0.5mm sq. , 1.5mm sq. , 2.5mm sq. , 4mm sq. , 6mm sq. , 10mm sq. , 16mm sq. , 25mm sq. , 35mm sq. , 50mm sq. , 70mm sq. , ring & tongue type heavy dutycopper lugs, tin plated confirming to din 46235 / equit.; in following sizes: , 35mm sq. , 50mm sq. , 70mm sq. , aluminium lugs ( pin type ) in following sizes: , 6mm sq. , 10mm sq. , 16mm sq. , 35mm sq. , aluminium lugs ( hole type ) in following sizes: , 6mm sq. , 10mm sq. , 16mm sq. , 25mm sq. , 35mm sq. , 70mm sq. , 120mm sq. , 150mm sq. , 185mm sq. , 240mm sq. , 300mm sq. , 400mm sq. , 90mm sq. , copper lugs hole type ( heavy duty ) , 6mm sq. , 10mm sq. , 16mm sq. , 25mm sq. , 35mm sq. , 70mm sq. , 120mm sq. , 150mm sq. , 185mm sq. , aluminium lug in line connector , 2.5mm sq. , 6mm sq. , 16mm sq. , 25mm sq. , 35mm sq. , 70mm sq. , 120mm sq. , 185mm sq. , 240mm sq. , 300mm sq. , copper in line connector ( long size ) , 6mm sq. , 10mm sq. , 16mm sq. , 25mm sq. , 35mm sq. , ring type aluminium lug ( heavy duty ) confirming to din46329 / iec1238 part i / is 8309 , 10mm sq. , 16mm sq. , 35mm sq. , 50mm sq. , 70mm sq. , 120mm sq. , 150mm sq. , 240mm sq. , 300mm sq. , 630 sq mm chamfered mouth for 11 kv xlpe cable , 185 sq mm chamfered mouth for 11 kv xlpe cable , 150 sq mm chamfered mouth for 11 kv xlpe cable , straight thru cu lugs , 0.5mm sq. , 1.5mm sq. , 2.5mm sq. , 10mm sq. , 16mm sq. , 25mm sq. , insulated copper lugs ( u type ) in following sizes , 0.5mm sq. , 1.5mm sq. , cable gland: double compression heavy duty brass cable gland; ni plated, confirming to bs 6121 / iec62444 / iec 60529, ip 66 / 67 for armoured al xlpe cable , 3c x 240sq. mm , 3c x 185sq. mm , 3c x 150sq. mm , 3c x 120sq. mm , 3c x 35sq. mm , 3c x 25sq. mm , 3c x 6sq. mm , 5c x 2.5sq. mm , cable gland ss 1 / 2 , cable gland ss 1 , insulating hand gloves ( pair ) workingvoltage 1100vtest voltage =11000 v acsize 355mm , cotton hand gloves ( pair ) for opening and closing steam valves and other heat areas; size medium; thickness 5 10mm; plain; leather ( buff / split / chrome ) , indicating lamps: cluster led type 3plbrl 220v dc ( red, green, amber, milky 100 nos.each ) dia 22.5 mm with adaptor plate ( 2 nos. ) for 30.5 mm dia hole , indicating lamps: led type indicating lamp assembly ? 22.5mm, 110v ac ac / dc ( red, green, amber, milky ) . , indicating lamps: rcb7 ivl 73 110, led pilot light, 110 ac, green color , indicating lamps: rcb7 ivl 73 110, led pilot light, 110 ac, red color , gen x cluster led type ( lvgp ) , 220 v dc , blue , white , clear , amber , green , red , gen x cluster led type ( lvgp ) , 240 v ac , blue , gen x cluster led type ( lvgp ) , 64 v ac / dc , red , yellow , blue , cluster led type, 110 v ac , green , red , amber , indicating lamp assembly type rb2 bvl as per is 13947 5 1 iec 947 5 1 ( red / green / amber / blue ) , , red ( rb2 bvl74 ) , green ( rb2 bvl73 ) , amber ( rb2 bvl75 ) , blue ( rb2 bvl76 ) , cluster led type 3plbrl 220v ac ( red, green, amber, milky ) dia 22.5 mm with adaptor plate ( 2 nos. ) for 30.5 mm dia hole , illuminated push button bch 30.5mm with 1 no +1 nc, 240 v, red / green colour lense , terminal blocks: stud type terminal block ( melamine housing ) khaki color , 4 sq mm ( current rating 36a ) , 10 sq mm ( current rating 45a ) , 16 sq mm ( current rating 87a ) , 35 sq mm ( current rating 145a ) , 25 mmsq screw type tb , bus bar type terminal block ( melamine housing ) khaki color , 16 50 sq mm ( current rating 145a ) , 50 95 sq mm ( current rating 250a ) , 70 120 sq mm ( current rating 300a ) , 120 185 sq mm ( current rating 450a ) , clip on type terminal block ( melamine housing ) khaki color , 35 mmsq , 25 mmsq , 16 mmsq , 10 mmsq , 6 mmsq , 4 mmsq , 2.5 mmsq , rubberized cork sheets confirming to is 4253 pt ii of 1980 rc 70c grade size of sheet : 915x610 mm of following thickness , 2.00 mm , 4.00 mm , 6.00 mm , 8.00 mm , 10.00 mm , 12.00 mm , switch fuse unit with hrc 100a tpn , switch fuse unit with hrc 63a tpn , switch fuse unit in steel box 63 amp 4 pole ( 3p+1n ) , switch fuse unit with steel box 100 amp 4 pole ( 3p+1n ) , rewireable porcelain main switch fuse unit tpn 200a, withsteel enclosures and side operating handle , change over switvh 200a, 3ph, 4pole , control transformer 415v / 110v ac 150 va , stop ( red ) pb push button with 1nc contact 22.5 mm , start ( green ) pb push button with 1no contact 22.5 mm , 6 amp sp auto / off / manual selector switch , water proof, puncture resistant, good mechanical strength, non corrosive electrical grade adhesive, fire retardent, : size 1.9 cm ( w ) x 0.3 mm ( t ) x 20 mtr. ( l ) specification: thickness 0.3mm+ / 10%, adhesion to steel 100 gms / cm, tensile strength 8 kg / cm, bdv 2kv with 50% overlap , polimeride film tape, 0.05mm thick polymide film coated uniformly on one side with with silicon adhesive :size 2.5cm ( w ) x .05mm ( t ) x 25 mtr. ( l ) , specification: total thickness ( mm ) 0.08mm minimum, adhesive to steel ( gm / 2.54cm ) 800 minimum, tensile strength ( kg / 2.54cm ) 30.0 minimum, elogation ( % ) 70.0 minimum. bdv ( kv ) ( 50% overlap ) 11.0 minimum, flammability self extingiuishing, , ht insulation sleeves equivalent to permagrip , size 25 mm dia , size 16 mm dia , size 8 mm dia , controltransformer resin cast 415 / 240v ac, 15kva , 1 ph, freq:50hz, type:an, hsv / il: 0.66 / 3kv, ins class: b, std. is: 12021 / 1987 , control transformer : voltage 415 / 240v, capacity:250va, 1 phase, freq 50hz, line volts: i.l.0.66 / 3.0kv ins class:b, std. is:15 / 07 / 115803 / 9 , lighting transformer: voltage 415 / 240v, capacity:1000va, 1 phase, freq 50hz, ins class:b , lighting transformer: voltage 415 / 240v, capacity:2500va, 1 phase, freq 50hz, ins class:b , welding transformer: voltage 415 / 415v, capacity:50kva, 1 phase, freq 50hz, dyn 11 ins class:b , switch fuse unit with 32 a, tpn hrc fuse , switch fuse unit with 125 a tpn hrc fuse , 11 / 6.6 kv pt fuse, 3.15 amp, 12 abcna3 15, 12kvac, interrupt rating 45 ka, carridge , length : 195.3mm, diameter : 25.4mm...

National Institute Of Ayurveda - Rajasthan

33785908 rate contract for hospital consumables , injection : , inj.n.s. 100ml , inj.n.s. 500ml , inj. dns 500 ml , inj.d5% 500ml , inj. d 10% 500 ml , inj. d 25% 100 ml , inj.rl 500ml , inj dexa , inj genta , inj piloearpine , inj adrenaline (1 ml) (1x50 ampuls) , inj.xylocaine2%withadrenaline , inj.xylocaine2%(lox) , inj. anawin heavy(bupivacaine) , inj. lox heavy(lignocaine) , inj atropine (1x50 ampuls) , inj. dexona(dexamethasone) , inj.avil(pheniraminemaleate) , inj.thiopentone(thiopentalsodium) 0.5gm , inj.succinylcholine(sueol) , inj.perinorn2m(metoclopramide) , inj.emeset2ml(ondansetron) , inj.rantac2ml(ranitidine) , inj.ketamine5ml , inj.t.t.5ml (inj. tetanus toxide 0.5ml) , inj.neostigmine 1ml , inj.atracuriumbesylate 10ml , inj.midazolam 10ml.10mg , inj.dynapar 1ml/(diclofenec) , inj.gentamycin 2ml 80 mg , inj.maczone plus 1.5gms/(ceftrixone + salbectam) , inj.tramadol2ml , inj. vit. k , inj. deriphyllin , inj. hydrocort/(hydrocortisone) , inj. lasix 2ml (furosemide) , inj. paracetamol (150 mg) , inj. buscopan (hyoscine) , inj. tranexa 5ml (tranexamic) , inj. magnesium sulphate 50% 2ml , inj. hydrocortison , inj. metrogyl 100ml , inj. ketamin/ aneket vial , inj. haemaccel 500 ml , inj. labetatol , inj. carbetocin , inj. perinorm/metoclopramide 2ml , inj. epidosin , inj. drotin , inj. phenargan , inj. carboprost , inj. fevastin/neomol , inj. betnesol , inj. amikacin 2ml 500 mg , inj. dexomethosne , inj. kaplin 10mg , inj. botropase , inj. iron sucrose , sterile water 10ml , sterile water 5ml , sepguard 100ml , halothane liquid 250ml , mannitol 100ml , povidine iodine 7.5% (500ml) , povidine iodine 10% (100ml) , povidine iodine 5% (100ml) , solution asthalin 15ml , omnipaque dye 50ml , abgel foam , betadine ointment 250gm , inj. methergin , xylocaine jelly 2% 50gm , pc enema 100ml , justin suppository 25mg , betadine 5% 1 ltr , xylocaine jelly 2% 50gm , tablet : , tab. paracetamol (500 mg) , tab. ranitidine (150 mg) , tab. meftal spas (1x10) , tab. sorbitrat , cap. nicardia 5mg , tab. formaline (100 pcs) , items(suture) : , barbours thread surgical linen no. 20 , barbours thread surgical linen no. 40 , chromic catgut 1.1 (110cm45mm needle) 2crb , chromic catgut 1.1 (40mm needle) 2crb , chromic catgut 0.0 (zero) 2crb , chromic catgut 1.0 (110cm45mm needle) 1/2crb , chromic catgut 2.0 1/2crb , chromic catgut 3.01/2crb , vicryl no. 0.0 (zero) , vicryl no. 1.0 (110cm45mmneedle) , vicryl no. 1.1 (110cm45mmneedle) , vicryl no. 1 0/2crb , vicryl no. 1 1/2crb , vicryl 2.0 round body 1/2 crb , vicryl 3.0 1/2 crb , monocryl suture 3 0 with needle , prolene no. 1 , prolene no. 1 , prolene no. 1.0 , prolene 2.0 , monoglyde 3.0 , ethilono 1 3/8 cce , ethilono 1.0 3/8 cce , ethilono 2.0 3/8 cce , ethilono 3.0 3/8 cce , surgical sature 4.0 , surgical sature 5.0 , surgical sature 8.0 , surgical sature 10.0 , surgical items : , n 95 , surgical masks 3 layers , clinical surgical spirit 5 ltr , hand sanitizer 5 ltr , surgical gloves (sterile+ packed) 6 no. , surgical gloves (sterile+ packed) 6.5 no. , surgical gloves (sterile+ packed) 7 no. , surgical gloves (sterile+ packed) 7.5 no. , examination gloves (latex) small size , examination gloves (latex) medium size , examination gloves (latex) large size , surgical gowns ( green cloth) , patient ot gown (disposable) (size standard) , surgical caps , surgical absorbant cotton (500gm) , cotton roll 500gms , cotton roll bandages 15cmx3mtr. (deluxe) , cotton roll bandages 10cmx3mtr. (deluxe) , cotton roll bandages 5cmx3mtr. (deluxe) , soft roll 15cmx3mtr , soft rolll 10cm x 3 mtr , surgical gauze cloth (than) 90cmx180mtr. (deluxe) , surgical gauze piece 10cmx10cmx8ply , surgical gauze piece 2inchx2inch , pop bandages 15cmx2.7 mtr , pop bandages 10cmx2.7 mtr , disposable syringes with hypodermic needles 1ml , disposable syringes with hypodermic needles 2ml , disposable syringes with hypodermic needles 5ml , disposable syringes with hypodermic needles 10ml , disposable syringes with hypodermic needles 50ml , disposable hypodermic needles 18no. , disposable hypodermic needles 20no. , disposable hypodermic needles 22no. , disposable hypodermic needles 24no. , disposable hypodermic needles 25 no. , disposable hypodermic needles 26no. , iv cannula 20 no. , iv cannula 22 no. , iv cannula 18 no. , iv cannula three way 20 no. , iv sets , uro bags standard , folleys catheter 18 , folleys catheter 16 , folleys adaptors (standard size) , ultrasound jelly , paper tape 2.5 cm x 9 mtr , paper tape 5 cm x 9 mtr , paper tape 7.5 cm x 9 mtr , paper tape 10 cm x 9 mtr , ampule cutter , disposable needle cutter (electric) , elastic band tourniques adjustable free size , k 90 size f.c. 14 (urethral catheter) , surgical blade no. 24 , surgical blade no.15 , surgical blade no.11 , surgical needles cutting edge 1/2 circle no. 10 , surgical needles cutting edge 1/2 circle no. 08 , surgical needles cutting edge 1/2 circle no. 06 , surgical needles round body 1/2 circle no. 08 , plastic box 8x10 , plastic containers 500gm , disposable suction tube with tip , abdominal drainage kit no. 12 , ryles tube 16 no. , infant feeding tubes 6 no. , infant feeding tubes 8 no. , endotracheal tube (disposable) 3mm , endotracheal tube (disposable) 3.5mm , endotracheal tube (disposable) 6mm , endotracheal tube (disposable) 6.5mm , endotracheal tube (disposable) 7mm , spinal needle 25 no. , mops sponge cotton 25x25x12 ply (with x ray) , mops sponge cotton 30x30x12 ply (with x ray) , macintosh sheet(1 roll=20mtr.) , plastic aprons standard , hernia kit with polypropylene mesh suze 4x6 with polypropylene sutures 1 0, polypropylene sutures 2 0, polygalectin 1 0, sounds closure suture material preferred monoglide or nylon. , surgical cautery pencil unipolar , blood transfusion set (bt set) adult , blood transfusion set (bt set) paediatric , iv cannula 20g triway pink , eye drap sheet 100 cm x 120 cm , trolley sheet 100 cm x 200 cm (preferably green & blue) , pocket mask adult , pocket mask child , ecg jelly 5ltr , ecg paper (cardiart 9108 d) , miscellaneous items : , lyzol solution for pharmacy grade , formaline liquid 5ltr , hydrogen peroxide 400 ml , anticeptic liquid 1 ltr , hypochlorite solution 5% 5 ltr , anticeptic handwash 5 ltr , anticeptic soaps 125 gm , anticeptic liquid 1 ltr , slipper (ot m/f)...

Rajasthan Rajya Vidhyut Utpadan Nigam Limited - Rajasthan

33774903 purchase of spares for san make locomotives installed at chp, stps, suratgarh 11 electro pneumatic governor part no. 94714250 ( 94713020 ) 12 air pressure switch rt 116 or psm 550 part no. 91509420 13 blocking diodes part no. 91521690 ( 91514550 ) 14 rep. kit c 2 relay valve part no. 9471221047 15 switch high water temp. 24 v dc, 2 wire system part no. 91507700 16 diode part no. 91515720 17 diode part no. 91520790 18 engine safety relay part no. 91503920 19 lube oil pressure switch part no. 91507710 20 gauge part no. 97503370 21 pressure gauge ( air ) part no. 97501080 22 pressure gauge ( oil ) part no. 97501050 23 relay part no. 91503910 24 transducer oil pressure part no. 97504090 25 exchange filter part no. 42423080 / 52423060 26 gasket part no.52094060 27 hose assy part no.91014540 28 breather part no.52423090 29 breather filter part no.94802040 30 cap screw w38 part no.56093030 31 cap screw w18 part no. 56093010 / 66093011 32 ball joint part no. 55832050 33 circlip part no.98304190 34 indicator oil / fuel level part no. 97504140, 11 electro pneumatic governor part no. 94714250 ( 94713020 ) 12 air pressure switch rt 116 or psm 550 part no. 91509420 13 blocking diodes part no. 91521690 ( 91514550 ) 14 rep. kit c 2 relay valve part no. 9471221047 15 switch high water temp. 24 v dc, 2 wire system part no. 91507700 16 diode part no. 91515720 17 diode part no. 91520790 18 engine safety relay part no. 91503920 19 lube oil pressure switch part no. 91507710 20 gauge part no. 97503370 21 pressure gauge ( air ) part no. 97501080 22 pressure gauge ( oil ) part no. 97501050 23 relay part no. 91503910 24 transducer oil pressure part no. 97504090 25 exchange filter part no. 42423080 / 52423060 26 gasket part no.52094060 27 hose assy part no.91014540 28 breather part no.52423090 29 breather filter part no.94802040 30 cap screw w38 part no.56093030 31 cap screw w18 part no. 56093010 / 66093011 32 ball joint part no. 55832050 33 circlip part no.98304190 34 indicator oil / fuel level part no. 97504140 35 i hex head screw part no. 98732250 36 i ferrule part no. 94655010 37 ferrule part no. 94655020 38 ferrule part no. 94655030 39 ferrule part no. 94655040 40 i ferrule part no. 94655060 41 i ferrule part no. 94655070 42 grease nipple part no. 98410120 43 i hex head nut part no. 98517030 44 hex socket hd cap screw part no. 98614360 45 i main circuit breaker part no. 91507870 46 i nut part no. 94656010 47 i nut part no. 94656020 48 i nut part no. 94656030 49 i nut part no. 94656040 50 i nut part no. 94656060 51 i nut part no. 94656080 , 52 nylock nut part no. 98520060 cy ld pin part no. 56533030 54 tc oil pressure gauge part no. 97501320 55 pressure sensor part no. 97503540 56 push button part no.91521680 57 rep kit primary control pump part no. 4240502001 58 rep. kit for sal brake valve part no. 9470144029 59 repair kit for auto drain valve part no. 9471120040 60 safety valve repair kit part no. 9470140019 61 slack adjuster lock brkt part no. 41861040 62 stud part no. 51093040 63 stud part no. 51093030 64 switch part no. 91514400 65 union assembly part no. 94625070 66 union assembly part no. 94625020 67 spring washer b20 part no.98903070 68 circuit breaker part no.91535460 , 69 circuit breaker part no. 91535490 70 circuit breaker part no. 91536480 71 circuit breaker part no. 91535470 72 gauge part no. 97504080 73 starting key switch part no. 91502330 74 ammeter part no. 97501590 75 hex head screw part no. 98625120 76 rotary selector switch ( tcs ) part no. 91529100 77 seamless pipe 12 od x 16 swg part no. 94650010 78 circuit breaker part no.91517490 79 b16 spring washer part no. 98903060 80 grooved ring part no.94102700 81 pin part no. 51820420 82 sealing ring part no.94101110 83 sealing ring part no.98910060 84 split pin part no. 98405210 85 volt meter part no. 91528430 86 csk screw part no. 98605310 , 87 hex hd screw ( 98608020 / 98601370 ) part no. 98608020 88 89 hex head screw part no. 98607470 check valve soft seated 3 / 8 part no. 94701090 90 circuit breaker part no. 91514090 91 circuit breaker part no. 91514410 92 seamless pipe 10 od x 16 swg part no. 94650040 93 seamless pipe 18 od x 16 swg part no. 94650030 94 relay valve ( indegenous ) part no. 94715450 95 control switch part no. 91516430 96 service kit for secondary ctrl sca pump part no. 4245402001 97 indication lamp green part no. 91531010 98 engine hour meter part no. 97503270 99 air pressure switch part no. 91502020 100 temp. sensor part no. 97503380 101 pressure reducing valve part no. 94715850 102 head light bulb screw type part no. 91501920 103 wire wound resistor 75 watts part no. 91501910 104 water level sensor part no. 91522860 105 bulb head light part no. 91532480 106 hose pipe part no. 91014430 107 nipple grease straight part no. 98140070 108 filter element part no. 52423010 109 valve seat part no. 52467020 110 spring part no. 52464090, 111 release spring part no. 61626110 112 bulb part no. 91501630 113 tubular check valve 1 in part no. 94711950 114 indication lamp ( yellow ) part no. 91531030 115 push button switch part no. 91509320 116 proximity switch part no. 91541340 117 piston head disc part no. 9470203011 118 brake cross beam part no. 41810430 119 hex hd screw part no. 98608180 120 sealing ring part no. 94657060 121 sealing ring part no. 98910030 122 retaining ring part no. 98304150 123 mushroom push button detent ( emergency brake ) part no. 94709840 124 silencer part no. 94709960 125 brake shoe key part no. 51820130 126 socket part no. 94610030 127 stud union assembly part no. 9462080 128 stud union assembly part no. 94626140 129 isolating cock 3 / 8 part no. 94701020 130 air filter part no. 94802130, 131 hand no. circuit control valve ( brake valve ) part 94720830 132 breaker part no. 91515670 133 dipstick assly part no. 42684060 / 42684020 134 isolating cock 1 / 2 part no. 94701030 135 switch part no. 91507960 136 push button 91502060 137 stud union assembly part no. 94626080 138 4 / 2 way valve ( drivers valve trans ) part no. 9471308029 139 a 9 brake valve part no. 94712220 140 drivers valve part no. 94713080 141 reversible / lub oil pump part no.12351300 142 sa 9 brake valve part no. 94716430 143 1 unloader valve part no. 94709540 144 cross & bearing assy. w 38 part no 46002023 new part no. 46002020 145 adaptor part no. 51013090 / 51013091 146 cardian shaft w38 part no. 36031710 147 brake limiting valve l2r2 part no. 42408040 148 solenoid & magnet valve part no. 94712950 149 cross & bearing assembly w18 part no. 46002012 / 46002010 150 rep kit for main control valve part no. 4241102001 151 transmission control circuit ( pneumatic ) part no. 94718280 152 1 / 2 double check valve without spring 94701140 153 3 / 8 double check valve 24•a part no. 94701120, 154 n 1 keducing valve 523022 part no. 94713870 155 c 3 w distributor valve part no. 94709920 156 s k9 independent brake valve part no. 94713230 157 c 2 w relay valve 94713260 158 a 9 auto brake valve with handle and pipe bracket part no.94713390 159 single air pressure gauge part no. 97503440 160 duplax check valve part no. 94713320 161 isolating cock 3 / 4 part no. 94716670 162 1 1 / 4 x 37 hose coupling ( bp ) part no. 91015050 163 1 1 / 4 coupling cock ( bp ) part no. 94713500 164 dummy coupling part no. 91015080 165 cross rbearing assy. w12 part no. 46002033 / 46002030 166 cardian shaft w18 with flange part no. 36022250 167 cardian shaft w12 part no. 36012160 i nfi erm• engine rpm meter part no. 97503410...

Department Of Atomic Energy - Rajasthan

33722350 bids are invited for high efficiency absolute rated 5 micron, 36 inch filter element for sfsb purification filter , ss adaptor to connect filter element and filter housing joint for sfsb purificationsystem5 micron absolute rated filter element for sfsb purification total quantity : 63...

Rajasthan University Of Health Science - Rajasthan

33718300 suppy medicine and surgical items supply medicine and surgical items , oral and topical , 2% glutarldehyde lotion , abiphyline sr 200mg , acebrofline 100 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , aceclover+ thiocolside , acetazolamide tab ip 250mg , acetylcestine600mg tab , activated charcol , acyclovir 200mg , acyclovir cream 5.5% , acyclovir eye ointment , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole suspension 10 ml , albendazole tablets ip 400 mg , alkaliser syp , allopurinol tablets ip 100 mg , alovera+vit.e cream , alpha methyl dopa250mg , alprazolam 0.25mg , alprazolam 0.50mg , aluminium chlorohydrate solution , ambroxol 75 / 90 mg , amiodarane 100mg , amiodarane 200mg , amisulphiride 50mg , amitriptyline tab ip 25mg film coated , amitryptyline 10mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , amlodipine tab ip 2.5 mg , amlodipine tab ip 5 mg , amoxy+clave 375 tab , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg + 28.5 ml / 5 ml ( 30ml bottle ) , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mgg , amphotericin b tab , ampicillin cap ip 500mg , anastrozole 1mg , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint , anticolddrop , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , antioxidant , apixapan tab 2.5 mg , aripiprazole 10mg , artemether+lumefantrine 20mgdt, 40mgdt 60mgdt , artesal seath 6f, 5f , aspirin delayed release tablet / aspirin gastroresistant tab ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , atenolol tab ip 25 mg , atenolol tab ip 50 mg , atorvastatin tablets ip 40 mg , azathioprine tab ip 50 mg , azithromycin syp , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tab ip 500 mg , beclomethasone inhalation ip 200mg / dose , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , benzocaine20%+chlorhexidine gel ( for oral ulcer ) , benzyl peroxide 2.5%gel , betahistine tab ip 16 mg , betahistine tab ip 8 mg , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , betamethasone tab ip 0.5mg , betaxolol eye drops 0.5 o / o , biotin+minerals , biotin+pantothenic acid , bisacodyl tab ip 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , blu dye , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , bromofenac .09%eye drop , buprenorphine patch 10, 20 , bupropion 250mg tab , cabergolin 50 mg , calamine lotion ip ( 50 ml ) , calcitriol capsules ip 0.25 mcg , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , calcium calictrol + zinc , calcium carbonate and vitamin d3 tablets elemental calcium 500 mg, vitamin d3 250 iu calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp , capecitabin 500mg , capecitabine 500 mg tab , carbamazapine 200mg , carboxymethylcellulose sodium lubricant eye drops 0.5.5% , carvidilol 3.125mg , cefadroxil 125mg dt , cefadroxil 250mg dt , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefpodoxime dispersible tab 50 mg , cefpodoxime+clav acid 250 tab , cefpodoxime+clav acid 500 tab , cefuroxime 500 mg tab , cefuroxime axetil tab ip 250 mg , cefuroxime+clav acid tab , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , cephalexin tablets 125 mg ( dispersible tablets ) , cepodoxime +clavunic acid , cepodoxime 100mg , cepodoxime 200mg , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , cetirizine syrup ip 5mg / 5 ml , cetirizine tab ip 10mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cevverix ( cervical canccs ) , chiken pox ( varilix / biovac v ) , chloramphenicol+dexamethasoinbe eye ointment , chlordiazepoxide tablets ip 10mg , chlorhexidine gluconate solution 5% , chlorhexidine mouthwash ip / bp 0.2 o / o , chloroquine phosphate suspension ip 50 mg / 5ml , chloroquine phosphate tab. ip 250mg ( eq to 155 mg of chloroquine base ) ( film coated ) , chlorpheniramine maleate tab ip 4mg , chlorprocaine 50mg , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , cholecalciferol granules 60, 000 iu / gm , cinnarizine tablet ip 75 mg , cinnarizine tablets ip 25 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , ciprofloxacin eye drops 0.3 o / o w / v , ciprofloxacin opthalimic ointment 0.3% , ciprofloxacin tablet ip 500 mg film coated , ciprofloxacin tablets ip 250 mg film coated , clindamycin capsule ip 300 mg , clindamycin phosphate gel usp 1 o / o , clindamycin+adaplane cream , clinidine 10 mg , clobazam 5mg , clobetasol propionate cream 0.05 o / o , clomifene citrate 50 mg , clonazepam 0.5mg , clonazepam tab ip 1 mg , clonazepam tab ip 1 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , clopidogrel tab ip 75 mg , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab 500mg , coaltar 45+ketaconazole 2% shampoo , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , coug syp dextrometharphen , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cream eberconazole , cream itraconazole 1% , cream vit e+sea butter oil , critanitone+hydrocortisone 1% cream , crotamitone lotion , cyclopentolate eye drop , danzol 50mg , deflazacort 6mg , dental gel choline salicylate+benzalkonium+lignocaine , desmide gel , desvenlafaxin 50mg , dexamethasone tab ip 0.5 mg , dha drops , diclo+para+serra , diclo+serra , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5.5% , diclofenac sod + paracetamol tablets diclofenac sod 50 mg + paracetamol 325 mg , diclofenac sodium tab ip 50 mg ( enteric coated ) , diclofenc supposter , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , dicyclomine hydrochloride and activatd dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activatd dimethicone 40mg , dicyclomine oral solution , dicyclomine tab ip 10 mg , diethylcarbamazapine tab , digoxin tab ip 0.25 mg. , diltiazem gel , diltiazem tabs ip 30 mg film coated , dinoprostone vaginal pessasary 10mg , domperidone oral drops 10mg / ml ( 10ml ) , domperidone suspension 5mg / 5ml , domperidone tab ip 10 mg , dorazolamide eye drop , doxycycline cap ip 100 mg , doxylamine plus tab , drop anticold , drop iron folic 2mg / ml , drop mefenemic acid , drop vit d , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , drotaverine tab 40 mg , dulcolex suppository , dulexitine 20 mg , duolin respules , ear drop oflox+clotrimazole+beclomethasone , enalapril maleate tab 10 mg , enalapril maleate tab ip 2.5mg , enalapril maleate tab ip 5mg , erlotinib 150mg , escitalopram tab ip 10 mg , esmoprazole tab , etizolam 0.5mg , etoricoxib 90 mg tab , etoricoxib tab ip 120mg , etoricoxib tab ip 60mg , etoricoxib+thiocolchicoside 4mg , famotidine tab ip 20 mg , famotidine tab ip 40 mg , febustate 80mg , femitral plus budesonide 200 / 400 rotacap / inhaler , femitral plus fluticasone250 / 500 rotacap / inhaler , fenofibrate capsules ip 200 mg , fentanyl patch 25, 50mg , fenticonazole cream , ferrous sulphate with folic acid tab ( paediatric ) each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , ferrous sulphate with folic acid tab.each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , flavoxate tablets 200 mg , fluconazole 200mg , fluconazole 50mg dt , fluconazole eye drops 0.3% , fluconazole tablets / capsules ip 150mg , fluoxetine cap ip 20 mg , flupenthixol 1 mg , flurbiprofen sodium ophthalmic solution usp 0.03 o / o w / v , fluromethasone+neomycin eye drop , fluticalone furoate nasal spray , fluvoxamine 50mg , folic acid tab ip 5 mg , foracort 12 mg fort respules , foracort 400 respules , formaldehyde solution ( 34.5 per. 38 per. ) , formalin tab , framycetin 1%cream , frusemide 40 +ameloride 10mg , frusemide tab ip 40 mg. , fusidic acid cream ip 2% , gabapantin 100mg , gabapantin 300mg , gabapantin 300mg+mecobalamin , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , geftinib250mg , gemcitabine for injection 200 mg , gingikobiloba , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg , glibenclamide tab ip 5 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , gliclazide tab ip 40 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) , glipizide tab ip 5mg , glucosamine+diacerin , glycerin ip , glycerin supplostery , glycopyronium 50mg rotacops , griseofulvin 250mg , gum paint ( tannic acid+cetrimide+zinc chloride ) , hmf sachet ( human milk fortifier ) , homatropine eye drop , hpmc eye ointment , hydrochlorthiazide tab ip 12.5 mg , hydrocortisone 1% cream , hydroquinone 2% cream , hydroquinone2%+tretinoin+fluticasonre oint. , hydroxychloroquine sulphate tablets 200mg , hydroxyurea 500mg cap , hydroxyzine tab ip 25 mg , hyoscine butylbromide tab 10mg , ibu+para suspension , ibuprofen and paracetamol tablets ibuprofen 400 mg+paracetamol 325 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , imatinib 400mg , imipramine 75 mg tab , indomethacine cap 25mg , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , ismn 30, 60mg , isoflurane usp , isosorbide mononitrate tabs ip 20 mg , isotretinoin 10mg , isotretinoin 20 mg , isoxsuprine tab ip 20 mg , itraconazole 200mg cap , itraconazole 400mg , itraconazole cap 100 mg , itraconazole+terbinafine , iver mectin 12 mg , ivermectin 4% cream , ivermectin 6 mg , ivermectin shampoo , ivermectin soap , ketaconazole 200mg , ketoconazole cream 2% , ketoconazole soap , kojic acid+vit.c cream , l arginine sachet , labetalol tab ip 100mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , lancets , laxative supppository , leflunomide tablets 10mg ( film coated ) , leflunomide tablets 20mg ( film coated ) , letrozole 2.5 mg , levetiracetam 500 , levodopa and carbidopa tab 100 mg and 10 mg , levofloxacin 500mg tab , levofloxacin tablets ip 250 mg , levosalbutamol+ipratropium bromide respirator solution , lignocaine gel ip 2% , lignocaine+zinc oxide+steroid gel , linezolid tablets ip 600 mg , liquid parrafin ip , lisinopril tab 2.5 mg , lisinopril tab ip 5 mg , livamisole 150mg , loperamide tab ip 2 mg , lorazepam tab , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , loteprednolol eye drop , lotion permethrin , loxicard spray , lsolyte p 10% , lulicaonazole cream 10 gm , luliconazole cream , luliconazole lotion , lycopene plus cap , medroxyprogesterone acetate tablets ip 10 mg , mefloquine tablets ip 250 mg , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin tab ip 500 mg ( film coated ) , methotrexate tab ip 2.5 mg , methyl prednisolone 8 mg , methylcobalamine 1500mg tab , methylcobalamine 500mg tab , methyldopa tab ip 250mg film coated , methylergometrine tab ip 0.125 mg , metoclopramide tab ip 10 mg , metoprolol succinate extended release tablets usp 50 mg , metoprolol tablets ip 25 mg , metronidazole and norfloxacin suspension 100 mg + 100 mg per 5ml , metronidazole tablets ip 400 mg , miconazole nitrate cream 2% , micronized progestrone orall / veginal / rectul 200mg , minoxidil 10% , misoprost 600mg , misoprostol tab 200 mcg , moisturising soap , momentasone cream , momentasone nasal spray , montelukast +fexofenadine , montelukast+levocetrizine tab , moxifloxacin eye drop , multivitamin cap , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , mupirocaine 2% cream , nabivilol , naproxen 500mg , nasal drop botroclot , neomycine ointment , neomycine powder , neomycine+bacitracin ointment , neosporin powder , neosporin+sulphacetamide oint. , nephazoline+hpmc+cpm eye drop , netamycine eye drop , nicotex patch 7 / 14 / 21 mg , nifedipine gel , nikorandil 5mg , nitrofurantoin tab ip 100mg , norethisterone tab ip 5 mg , norfloxacin tab ip 400mg film coated , ntg 2.6 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin suspension , ofloxacin tab ip 200 mg , ofloxacin+betamethasone eye drop , oint. soframycine , oint.clobetasol+salicylic acid , oint.traimciclolone , olanzapine tab ip 5 mg , olanzipine 5mg , olapatadine +ketorolac eye drop , olmesartan 25mg , olmesartan 50mg , omega 3 fatty acid , omeprazole cap ip 20 mg , omocroptine 1mg , ondansetron orally disintegrating tablets ip 4mg , opipramol 50mg , ormeloxifene 60mg , ors powder ip , pantoprazole 40mg and domperidone 30mg sr cap pantoprazole as enteric coated pellets and domperidone as sr pellets , paracetamol 625 tab , paracetamol drops ( paracetamol syrup ip ) ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracine eye drop , pazopanib 400mg , pcm suppostery , penicilin g , perindoprine , permethrin cream 1% , permethrin cream 5% , permethrin lotion 1% , permethrin soap , phenytoin 100mg , pilocarpine eye drop , pioglitazone tab ip 15 mg , podophylin 20% resin solution , povidine iodine 5% 100 ml , povidone iodine 10% / 100ml sol , povidone iodine gargle , povidone iodine ointment 5% , powder clotrimazole , powder fluconazole , powder ketaconazole , powder terbinafine , ppd 5 tu , prednisolone 20 / 40 / 60mg , prednisolone acetate eye drop , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , pregabalin cap ip 75 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , progestron 100 mg , progestron 300 mg , promethazine tab ip 25 mg , propracaine eye drop , propranolol 10mg , propranolol tab ip 40 mg , protion powder 200gm , pyridoxime , ramipril 5+metoprolol 50 mg xl , ramipril tablets ip 2.5 mg , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , ranolazine 500mg , resperidone 2mg , revaroxabain 10 mg , roflimulast 500mg , rosuvastatin 10mg , rosuvastatin 20mg , rosuvastatin 40mg , salbutamol inhaler , salbutamol nebulizer sol. 5mg / .ml , salbutamol syrup ip 2mg / 5ml , salbutamol tablet ip 4 mg , salicylic acid 12% cream , salicylic acid 17.3%+lactic acid 17.3% cream , salicylic acid 3% cream , salicylic acid 6% cream , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , seerrratiopeptidase 20mg tab , serratiopeptidase 10mg tab , sertaconazole cream 1% , sertraline tab 50 mg , shampoo ketaconazole+zpto , sildinafil 20 mg tab , silversulphadiazine cream , sitagliptin , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , sodium valporate 500mg , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet 200 mg ( enteric coated ) , solution minoxidil 2% , solution minoxidil 5% , sorafenib200mg , spironolactone 50 mg tab , sunscreen lotion , surgical spirit 100ml , syp ambroxol+terbutaline+levosalbutamol , syp artemether+lumefantrine , syp azithromycin 100mg , syp cefixime 50mg , syp cepodoxime 100mg , syp cepodoxime 50mg / ml , syp cpm+dextro+phenylephrine , syp diclomine + pcm , syp digoxin , syp erythromycin 125mg / 5ml , syp levosalbutamol 1mg / sml , syp mct oil ( mediw chain triglycenide ) , syp mefenamic acid 100mg / 5ml , syp mefenamic acid+pcm , syp mom plus , syp nevirapin , syp ofloxacin , syp ofloxacin oz , syp phenobarbitone 20mg / 500ml , syp promethazine+pcm , syp sucralfate , tacrolimus 0.03%cream , tacrolimus 0.1% cream , tacrolimus lotion 0.1% , tamoxifen 10mg , tamsulosin hcl tablets 0.4 mg , telmisartan tablets ip 40 mg , temozolovide 100mg , teneligliptin 20mg , tenozolomide 200mg , terbinafine 250mg , terbinafine 500mg , terbinafine cream 1 % , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline ip 77 mg ) , thiamine 100mg , thiocolchicodide 4mg , thiocolciside 8 mg , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , timolol eye drop 0.5% , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , tiotropium 9 / 18 mg rotacaps , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycine eye ointment 0.3% , tofisopam 50mg , tooth gel sodium monoflurophosphate+pottasium nitrate , torsemide tab 10 mg , tramadol cap 50 mg , tramadol+pcm , tranexamic acid tablets 500 mg , travoprost eye drop , tretinoin .025%% cream , triamcinololone acetomide oral paste , triamcinololone acetonide 10mg tab , triamcinololone acetonide 40mg tab , trichloroacetic acid 30% , trihexiphenidyl 2mg , tropica plus eye drop ( tropicamide+phenerimine ) , trypan blue soluation .06% , trypsin + cymo trypsin tab , trypsin + rutotoside , urea lactic acid cream , ursodeoxycholic acid tablets 300 mg , vallsartan 100mg , valsartan 50mg , velcyclorver 1 gm , vericonazol , vilazodone 40mg , vit c , vit e 400 mg , vit.a 25000 iu , vit.d+e , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , white soft parrafin liquid parrafin , xylometazoline nasal drops ip 0.1% , zinc sulphate 50mg , zoledronic acid 4 mg inj. , syp caffeine citrate , glycerine suppositiry , fluconazole 200mg tab , syp sildenafil , savlon 100ml , paracain eye drop , cyclopentolate eye drop , prazoxamide eye drop , syp hydroxyzine , syp prednisolone , syp montas l , syp phenobarbitone 20mg / 500ml , syp azee 200ml , diazepam rectal , diazepam oral syp , pretermmilk formula , erythromycine drop , dha syp , fexofenadine syp , fexofenadine tablet , griseofulvin 125mg tab , syp sodium picosulphate , tab telma +amlo , tab telma h , tab atorva+fenofibrate , tab apixaben2.5mg , tab apixaben5mg , tab rivaroxaben10mg , tab febusrate 40mg , tab voglibose 0.3mg , tab voglibose 0.2mg , tab carbimazole 10mg , tab sitagliptin 50mg , tab sitagliptin+metformn , tab vidagliptin+metformin , tab escitalopram+propranolol , tab propranolol+alprazolam , tab nilazoxamide200mg , pulvis isapgol husk , tab triflurazine 1mg , tab rifaximine 400mg , tab n acetylcestine 600mg , tab acebrophyline + nac600 , tab methylprednisolone 8mg , tab methylprednisolone 16mg , tab clinidium+chlordiazepoxide , tab triflurazine+chlordiazepoxide , syp pcm , syp diclo , diclo suppository , valcyclovir tab 1gm , tab aripiprazole 5mg , tab vilazodone 20mg , tab propranolol+etizolam0.5mg , tab posaconazole 100mg , fluticasone +azilastin nasal spray , cap lycopene+mv , syp sodium picosulphate+liq.parrafin+mom , glycerine nitrate ointment , alkaline nasal wash solution , inj sodium valporate 500mg , tab thiocolchicoside 8mg , tab calcium+l carnitine , drop dicyclomine , drop mv , surgical item and others , adhesive tapee 1 / 2 ( durapore ) , 26 g cannula , abdominal belt alll sizes , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdomonal belt , absorable hemostates ( surgicel ) , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size3 / 0 1 / 2 rb 20mm, suture lenth 70mm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid / glycolid co lactide ) size2 / 0 1 / 2rb 20mm, suture lenth 70mm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbent cotton wool ip 500 gm , accepto syringe , adhesive tape 1 ( durapore ) , adhesive tape 2 ( durapore ) , adult diaper , ankle binder , arm pouch sling , b p cuff , baby diaper s, m, l , bain circuuit , bandage 10cm , bandage 15cm , bandaid , barbur thred , bed pan , biopsy container 1 kg , biopsy container 1 / 2 kg, 1 kg , bipap mask , bipap tubing / hose pipe , black google , blood administration set blood transfusion set ( details in rc ) , blood sugar glucometer withstrip ( sd code free ) , blood sugar strip ( 64765 ) free style optium h , blue dye , bone wax sterilised , bongic , bougie singal use , breast pump , buprenophine patch 10mg , buprenophine patch 5mg , c arm cover , cannula fixer , catheter for urinary drainage size 8 to 16 , cautry plate , cental line double lumen , central linetriple lumen , central line single lumen , chest tube with trachor , ciling drape , clavical brace s, m, l , clear sole inj ( rl glass bottle ) , clostomy bag / ileostomy bag , combined spinal epidural kit , comet spinal needle no. 18 / 16 , condom catheter , corrugated drainage sheet all sizes ( details in rc ) , corrugated rubber drain ( crd ) , cp geel , crepe bandage 2 , crepe bandage 4 , crepe bandage 6 , cresant eye blade , cutting burr , cvp manometer , delivery safety aprin , derma film , diagnostic sticks for urine sugar , diamond burr 0 , diamond burr 2 , diamond burr 4 , diamond burr 6 , diamond burr 8 , digital thermameter , dispo needle 16 , dispo needle 18 , dispo needle 22 , dispo needle no. 24 , dispo needle no. 26 1 / 2 , dispo razor blade , disposable o drape , disposable u drape , disposable aprin , disposable cautry plates , disposable cpap circuits , disposable drepping , disposable gown , disposable sheet , disposable sterile surgical rubber gloves size 6.5 inches ( details in rc ) , disposable sterile surgical rubber gloves size 7 inches ( details in rc ) , disposable sterile surgical rubber gloves size 7.5 inches ( details in rc ) , disposable sterile surgical rubber gloves size 8 inches ( details in rc ) , disposable syringes 1 ml , disposable syringes 10 ml , disposable syringes 2 ml , disposable syringes 20 ml , disposable syringes 5 ml , dispovan 50ml romsons , dj stent with guide wire , double lumen octopus with 2 binectons&clamps , durapore 1 , dyanoplast 4 ( inch ) , ecg electrode new born baby , ecg electrods , eliostomy beg , endo gi stappler with cartridge , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, plain size 2.5 ( details in rc ) , endotracheal tube, plain size 3 ( details in rc ) , endotracheal tube, plain size 3.5 ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 7 ( details in rc ) , endotracheal tube, plain size 7.5 ( details in rc ) , endotracheal tube, plain size 8 ( details in rc ) , endotracheal tube, plain size 8.5 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , enlarger blade 5.1 mm eye blade , epicath picc line 28fr , epidural kit , eusol solution , eye drape sheet , eye hand blade , eye incison blade , face mask, disposable ( details in rc ) , face shild , feeding tube no.6 , fibrin ( ear ) glue ( torseal ) , finger cot split , flatus tube , flexometalic et tube , flow regulator , fogarty catheter , foldable intra ocular lense with injector , foley catheter 12, 14, 16 , follops ring , g dress20 , g dress 10 , g dress 15 , g dress 20 , g dress 25 , g dress 30 , g dress 5 , gauze than 400gm , gel foam , gigli saw , glucometer optium h , green theraband , grommets of all sizes , guedel airways , halothane bp , hand sanitizer 500ml , hfnc catheters , hi flow mask , high concentration mask , high flow nasal canula all colours , hip u drape , hiv / hbsag safe delivery kit , hme filter , hot water bottle , i gel all sizes , i v canula 26 no. , i v set. , identification tag of neonatal size , incise drape iodine impregated different size , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infant feeding tube size: 1ofg, 8fg, 5fg ( details in rc ) , infrared thermometer , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , ioben 6640 , ioben betadine , iv cannula 26 g , j r circuit pedia , jelonet , johnson buds 30s , k 90 cathetor , ketone strip , knee brace , knee brase , knee cap , knee cap xl , koratome 2.1 mm eye blade , koratome 2.8 mm eye blade , lab pad , laproscopic hernia tracker , leader flex ( lorg dive ) 22g 2fr 4cm , liga clip 200 , liga clip 300 , liga clip 400 , lma all sizes , long taper diamond barr , longline axillony 45cm , longline femoral 75cm , loprescope mesh 15 x15 , makintosh rubber sheet , malecote catheter 28, 30, 32 , maro cel , mayo vein strippe , medicath 18 / 20 / 22 , metallic tracheostomy tube 30, 32, 34 , micropore , miph gun , moxi flozenie ( vigamox ) , mucus extractor sterile , nasal cannula adult , nasal dressing pack , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , nasal packing 4.5cms 400409 , nasal packing 8 cms 400402 , nasal packing 8cms airway 400405 , nasal prong , nebulization kit , nebulization mask , nebulizer machine , neck line , neonatal urine collectting bag , neonataldisposable ventilator circuits with dispos.humidifier chamber , neotamic enema , niv mask , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , ns 2 ltr glass bottle , orthoroll 50gm , oxygen hood , oxygen mask ( adult ) , oxygen mask ( pdeatric ) , oxygen recovery kit , oxygen regulator , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , pencil cautry , perfusion set ( infusion set ) with airway and needle ( paediatric use ) ( details in rc ) , perifencal catheter ( pediatrics ) l 20cm, 12fr , picc line 24, 26, 28 fr , plain sheet large , plain sheet small , plaster of paris bandage 10cm x 2.7mts , plaster of paris bandage 15cm x 2.7 mts / roll , plastic transparent sheet , plater of paris powder 50 kg , pmo line , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , pouch arm sling , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , ppe kit , premicath picc line 28fr , premicath picc line no.26 and 28 , pressure monitoring line / high pressure extension line ( details in rc ) , provox , puls oxymeter , red rubber catheter size 8.10, 12 , reservoir bag adult 1 lt. , reservoir bag adult 1.5 lt. , reservoir bag adult 2 lt. , respirpometer , romovac set 14 / 16 n0. , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves, size small ( details in rc ) , rubber shoes cover , ryles tube / nasogastric tube size: 10 ( details in rc ) , ryles tube / nasogastric tube size: 12 ( details in rc ) , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , ryles tube / nasogastric tube size:14 ( details in rc ) , s.s.g knife ( dawn blade ) , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , sanitizer 100 ml , savlon 100 ml , scalp vein set ( disposable ) size 18g ( details in rc ) , scalp vein set ( disposable ) size 20g ( details in rc ) , scalp vein set ( disposable ) size 22g ( details in rc ) , scalp vein set ( disposable ) size 24 g ( details in rc ) , shoulder immobilizer , side port eye blade , silk suture 40&30 with cutter , silling dress , skin graft knife blade ( sterile ) & handle ( details in rc ) , skin stapler , skin traction set , slow diclofenac tablets bp / diclofenac sodium extended release tablets usp 100 mg ( sustained release ) / diclofenac prolonged release tablet ip 100mg , sono jelly , spinal needle all sizes , stapes piston size 0.6mm ( teflon ) , stayfree pad , sterile catheter for urinary drainage ( foley balloon catheter ) , 2 way, size 10 ( details in rc ) , sterile catheter for urinary drainage ( foley balloon catheter ) , 2 way, size 18 ( details in rc ) , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size16 ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable infusion set with microdrip ( i.v. ) ( details in rc ) , sterile disposable perfusion set with airway and needle ( adult use ) ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , sterile gauze , sterile hypodermic syringe with needle attached, 22g, single use 10 ml ( details in rc ) , sterile hypodermic syringe with needle attached, 22g, single use 20 ml ( details in rc ) , sterile hypodermic syringe with needle attached, 24g, single use 2 ml ( details in rc ) , sterile hypodermic syringe with needle attached, 24g, single use 5 ml ( details in rc ) , sterile swab , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , sterllium 500 ml , stokinet 1.5m*8 , stokinet 1m*6cm , streptokinase injection 15 lac units , stylet , succinylcholine inj. ip 50 mg / ml ( iv use ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , suction catheter, sterile. size: f g 24 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , suction connector , suction tip , sugar strip caresons , surfactant for ( pre term babies ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , surgical mask , suti pan , suture 10 0 ( ethylene ) , suture 8 0 ( ethylene ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , swine flu mask n 95 , t piece , t tube 10 no. , t tube 12 no. , t tube 14 no. , tegaderm , three way adaptor , thumb spica , thumb support , torp porpseptoplast ( splints ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , tracheostomy tube ( portex with cuff 7, 7.5, 8 ) , tracheostomy tube, plain all sizes ( details in rc ) , trop t kit , tungeston burrr 0 to 8 , turp set , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , umblical catheter all size , underwater seal drain , universal sholder immulizer , upt kit , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , urine container sterile , urine ketone test strip , urine pot , uroflow meter , vaccume sucction tube , vaporizer machine , vein o line 10 cm , vein 0 line 150 cm , ventilator circuit , zommed grommet , octopus three way , octopus two way , dettol 200ml soap liquid handwash , leaderflex long line , bionectar , ventilator circuit pedia with heat wire , c pap bubble circuit , humedified high flow nasal cannula circuit , hhfnc optiflow red , hhfnc optiflow yellow , hhfnc optiflow blue , ecg electrode infant pedia , suction connection tube , iol foldable all powers 3000 , iol pmma , ac iol all powers , foley catheter 10 no. , cannula ptef 26no. , picc line 4fr , picc line5fr , cvc 4 fr , cvc 4.5 fr , cvc 5 fr , nasal prong pedia , nasal prong adult , nrbm pedia ( non rebreathing mask ) , oropharyngeal airway , hme filter bacterial , hme filter viral , kangaro care sling bag , soflene adhesive tape , intercostal drainage tube 24no. , intercostal drainage tube 28no. , intercostal drainage bag , cannula fixator , flexometalic et tube 6 to 7.5 cuffed , mls et tube 5, 5.5 cuffed , maggile forcap , neb t kit , close suction set , north pole et tube 6 to8.5 cuffed , south pole et tube 6 to 8.5 cuffed , proceal lma 3.0 , proceal lma4.0 , proceal lma5.0 , classic lma 1 to 5 no , pop bandage 6inch , pop bandage 4 inch , synthetic cast bandage 4 inch , synthetic cast bandage 5 inch , synthetic cast bandage 3 inch , softroll 4 inch , sofftroll 6 inch , compressed cotton rolll for plaster 4 inch , compressed cotton rolll for plaster 6 inch , iodine impregnated incise drape small around 15*10 , iodine impregnated incise drape medium around 20*20 , iodine imppregnatedincise drape large 20*30 , iodine impregnate incise drapearound 30*40 , skin traction set adults , skin traction kit kid , skin traction kit dunlop , skeletal traction kit , ssg knife blade , u drape , o drape , ls belt all size , silicon cusgioned heel , tennis elbow all size , long knee brace all size , cervical collar , linarand circular stapler with cartridge , glucometer dr morepen , glucometer dr morepen strip , glucometer caresens , glucometer caresens strip , glucometer accu sure , glucometer accu sure strip , bp instrument , laproscope warsher 10mm, 5mm ports , miph stapler , ipom mesh , nitrpous regulator , eto gas regulatorr , eto packing roll 10cm , eto packing roll 20cm , eto packing roll 30cm , amino acid bagfor parentral nutrition ( parentral nutrition ) , vein striper for varicose vein , urobag with flowmeter , forgaty catheter , enseal probe laproscopic compatable for eticon device , 24 hormonic probe ( compatable foreticon device 5mm laproscopic , debridder blades ( straight / rad 40 / rad 60 ) , coblator wands ( pro max ) , ear suction cannula , nasal suction , injectable , 5 fluorouracil inj 250mg / 5ml , acetylcystine solution usp ( injection ) 200 mg / ml , actrpid , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , adenosine 6mg / 2ml inj. , adrenaline injection ip 1mg / ml im / iv use , alamine inj , albumi 20% , albumin 10% , alpha beta artether inj , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , aminophylline inj ip 25 mg / ml , aminovain 100ml , aminovein 250 ml , amiodarone hydrochloride inj 50 mg / ml , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amphoteriricin b 50mg , ampicillin injection ip 500 mg , aq.diclofenac sodium inj ( dynapar aq ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , artracil 2.5 ml inj , arv , atropine sulphate injection ip 0.6 mg / ml ( sc / im / iv use ) , betamethasone sod phos inj ip 4mg / ml , bhcg 10000 iu inj. , bhcg 2000 iu inj. , b hcg 5000 iu inj. , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bleomycin 15 unit inj. , botroclot inj , botrophase inj. , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , butadol 1 ml inj. , caffeine citrate inj , calcium gluconate inj ip 10% ( iv use ) , carbolic acid 500ml bottle , carboplatin 150mg , carboplatin 450mg , carboplatin injection 150 mg , carboplatin injection 450 mg , carboprost tromethamine injection each ml contains carboprost 0.25 mg / ml , carpinol inj , cefipime 250mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , ceftrixone + sulbactam 1.5 gm inj. , chiken px ( varilix / biovac v ) , chlor procaine , chloroquine phosphate inj ip 40 mg / ml , ciprofloxacin injection ip 200mg / 100ml , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clonidine inj. , colistin , collin sulphate 10 miuinj vit d 3l / 6l , compound sodium lactate inj. ip , corbolic acid 500 ml bottle , crystalline penicilline , cyclophosphomide 200mg , cyclophosphomide 500mg , cytarabine inj ip 100mg / ml , dd 50 inj ( nandrololone ) ) , decarbazine 500mg , depomedrol 1ml , dexamethasone inj ip 8mg / 2ml , dexmedetomidine 100 mcg inj , dexmedetomidine 200 mcg inj , dextomid 1 ml inj , dextrose 5% 500ml ( d 5 ) , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% isotonic , diclofenac aq. , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , dicyclomine inj ip 10 mg / ml , digoxin inj ip 0.25 mg / ml , diltiazem , dobutamine inj 50mg / ml , dopamine hydrochloride inj 40 mg / ml , doxorubicin 50 mg inj. , drotaverine hydrochloride inj 40 mg / 2 ml , elderviit , enoxaparin sodium inj ip 60 mg ( lmwh ) , epirubicin 10mg , esmolol , et co2 samle lime , ethamsylate inj 250 mg / 2ml ( im / iv ) , etomidate 10 ml inj , etomidate inj 10mg , etoposide 100mg inj , fentanyl , fentanyl patch , fluconazole 100ml bottle , furosemide injection ip 10mg / ml ( im and iv use ) , gcsf 300 ug , gemcitabine 1gm , gemcitabine 200mg , gemcitabine for injection 1gm , gentamycin injection ip 80mg / 2ml ( im / iv use ) , glargin , gluteraldehyde solution 2% , glycopyrrolate + neostrogemin inj usp 0.2 mg / ml , glycopyrrolate inj usp 0.2 mg / ml , haloperidol , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis a ( havarix / biovac a ) , hepatitis b 1ml , hepatitis b immunoglotonlis 100 iu , hepatitis b ( hbig ) , heplock , human albumin inj 100ml , human anti d immunoglobulin injection 300mcg ( im use ) , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyprogesterone inj ip 250mg / ml , hyoscine inj ( buscopan ) , ifosfamide injection usp / bp 1gm , imunoglobulin 10gm , imunoglobulin 5gm , indomethacin , inj bevacizumab 100mg , insulin inj ip 40 iu / ml , ipv ( imovax / polio vac / polproket ) , iron ferric carboxymaltose 100mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , irrigation solution 500ml , iso p forte 10% , isolyte p 10% , isolyte p 500 glass bottle , isoprenaline injection ip 2mg / ml , kcl , ketamine inj ip 50 mg / ml , labetalol hcl inj ip 20mg / 4ml , lantus insulin , l asparaginase inj 10000 iu , leucovarin 15mg , levitiracetams , levo bupivacaine , levofloxacin 100ml , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% inj. , linazolid 300ml , linezolid inj 200mg / 100ml , lorazepalm , lorazepam inj 2mg , lox +adr inj , lox 4 % topical , lox spray , loxicard 2 % inj , loxicard 2% 50 ml , lsolyte p 10% , magnesium sulphate inj 50mg / ml ( 50% w / v ) , mannitol inj ip 20% w / v 100 ml , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml , mecobalamin inj 1000 mcg / ml , meropenem inj ip 500 mg , meropenem inj. ip 1gm , methotrexate 50mg , methotrexate inj ip 50 mg / 2 ml , methyl prednisolone sodium succinate for injection usp 500 mg , methyl prednisolone sodium succinate inj 80 mg , methylergometrine inj ip 0.2 mg / ml , metoclopramide inj ip 10mg / 2ml , metronidazole inj ip 500 mg / 100ml , milrinol , mitomycin 10mg , mixtard , mizolam 10 ml inj. , mmr ( tersivac ) , morphine , mucus extractor sterile ( details in rc ) , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , mvi inj , myoril ( thiocolchicoside ) , n.s 0.45% 500ml , naloxone , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , ns 100ml , ns 3 ltr , code free gluco strips , ns 3% 100ml , octreotide injection 50 mcg / ml , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin suspension 50mg / 5ml , omnidase inj , omnipaque , omniscan , ondansetron inj ip 2mg / ml , oxaliplatin 50 mg inj. , oxytocin inj ip 5 iu / ml , paclitaxel 260mg , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , palanosetron inj , pantazocin inj 30mg / ml , paracetamil inj 100ml , pemetrexed 100mg , pemetrexed 500mg , penidura la , pentoprazole inj 40 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone , phenytoin injection 50mg / ml , pilocarpine inj. , piperacillin + tazobactum for injection usp 4gm+500mg , pneumococcal ( synflorix / prevnav ) , polidoconol , potassium chloride inj. 0.15 gm / ml , pralidoxime chloride injection ip 25 mg / ml , prochlorperazone 5mg , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , propofol inj ip 10 mg / ml , quinine dihydrochloride inj 300 mg / ml , r l 500 ml glass , rabies vaccine human ip 2.5 iu , ranitidine hcl injection ip 50mg / 2ml , ringer acetate inj. 500 ml ( glass bottle ) , ringer lactate 500ml ( rl ) , rituximab 100mg inj , rituximab 500mg , ropivacaine 0.75 % 20 ml , rotavirus ( rotarix / rotateg ) , sensocaine inj , sevflurane / isoflurane , sevoflurane , sildinafil inj , soda lime medical grade , sodium bicarbonate inj ip 7.5% w / v , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium valproate inj 100 mg / ml , streptokinase 15 lac unit inj , succinylcholine 50mg / ml inj , taxim 500 inj , termin 10 ml inj. , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetrahes / voluven ( starch ) , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , thiocolchicoside 4mg , torsemide , trace elements ( celecil ) , tramadol inj 50 mg / ml , trastuzumab 440mg , trenaximic acid inj. , triamcinololone acetonide 10mg inj , triamcinololone acetonide 40mg inj , typhoid ( pcv typh bar / typhim vi ) , vancomycin 250mg , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , varicella zoster ( vzig ) , vassopressin , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil2.5 mg inj , vinblastine 10mg / 10ml inj , vincristine inj1mg / ml , vitamin a 40000 / ml , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) 1mg / 0.5ml injection ( detail in rc ) , vitcofol , vitcofol c , water for inj ip , zoledronic acid 4mg inj , distill water 5 ltr , inj terlipressin , mannitol 350ml , anti snake venom , anti scorpion venom , inj penidura la 6lac u , inj hbig 200iu , aminovain inj 10% , indamethasone inj , inj nac 600 , inj lorthinine +l asparginase , inj benzathine penicilin g 2.4lac , inj rocuronium , inj ropin 0.2% , inj nalbuphine10mg , pcm inj 150mg , pcm inj30mg , inj.polidoconal , inj d 125 , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , suction catheter, sterile. size: f g 24 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , suction connector , suction tip , sugar strip caresons , surfactant for ( pre term babies ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , surgical mask , suti pan , suture 10 0 ( ethylene ) , suture 8 0 ( ethylene ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , swine flu mask n 95 , t piece , t tube 10 no. , t tube 12 no. , t tube 14 no. , tegaderm , three way adaptor , thumb spica , thumb support , torp porpseptoplast ( splints ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , tracheostomy tube ( portex with cuff 7, 7.5, 8 ) , tracheostomy tube, plain all sizes ( details in rc ) , trop t kit , tungeston burrr 0 to 8 , turp set , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , umblical catheter all size , underwater seal drain , universal sholder immulizer , upt kit , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , urine container sterile , urine ketone test strip , urine pot , uroflow meter , vaccume sucction tube , vaporizer machine , vein o line 10 cm , vein 0 line 150 cm , ventilator circuit , zommed grommet , octopus three way , octopus two way , dettol 200ml soap liquid handwash , leaderflex long line , bionectar , ventilator circuit pedia with heat wire , c pap bubble circuit , humedified high flow nasal cannula circuit , hhfnc optiflow red , hhfnc optiflow yellow , hhfnc optiflow blue , ecg electrode infant pedia , suction connection tube , iol foldable all powers 3000 , iol pmma , ac iol all powers , foley catheter 10 no. , cannula ptef 26no. , picc line 4fr , picc line5fr , cvc 4 fr , cvc 4.5 fr , cvc 5 fr , nasal prong pedia , nasal prong adult , nrbm pedia ( non rebreathing mask ) , oropharyngeal airway , hme filter bacterial , hme filter viral , kangaro care sling bag , soflene adhesive tape , intercostal drainage tube 24no. , intercostal drainage tube 28no. , intercostal drainage bag , cannula fixator , flexometalic et tube 6 to 7.5 cuffed , mls et tube 5, 5.5 cuffed , maggile forcap , neb t kit , close suction set , north pole et tube 6 to8.5 cuffed , south pole et tube 6 to 8.5 cuffed , proceal lma 3.0 , proceal lma4.0 , proceal lma5.0 , classic lma 1 to 5 no , pop bandage 6inch , pop bandage 4 inch , synthetic cast bandage 4 inch , synthetic cast bandage 5 inch , synthetic cast bandage 3 inch , softroll 4 inch , sofftroll 6 inch , compressed cotton rolll for plaster 4 inch , compressed cotton rolll for plaster 6 inch , iodine impregnated incise drape small around 15*10 , iodine impregnated incise drape medium around 20*20 , iodine imppregnatedincise drape large 20*30 , iodine impregnate incise drapearound 30*40 , skin traction set adults , skin traction kit kid , skin traction kit dunlop , skeletal traction kit , ssg knife blade , u drape , o drape , ls belt all size , silicon cusgioned heel , tennis elbow all size , long knee brace all size , cervical collar , linarand circular stapler with cartridge , glucometer dr morepen , glucometer dr morepen strip , glucometer caresens , glucometer caresens strip , glucometer accu sure , glucometer accu sure strip , bp instrument , laproscope warsher 10mm, 5mm ports , miph stapler , ipom mesh , nitrpous regulator , eto gas regulatorr , eto packing roll 10cm , eto packing roll 20cm , eto packing roll 30cm , amino acid bagfor parentral nutrition ( parentral nutrition ) , vein striper for varicose vein , urobag with flowmeter , forgaty catheter , enseal probe laproscopic compatable for eticon device , 24 hormonic probe ( compatable foreticon device 5mm laproscopic , debridder blades ( straight / rad 40 / rad 60 ) , coblator wands ( pro max ) , ear suction cannula , nasal suction , injectable , 5 fluorouracil inj 250mg / 5ml , acetylcystine solution usp ( injection ) 200 mg / ml , actrpid , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , adenosine 6mg / 2ml inj. , adrenaline injection ip 1mg / ml im / iv use , alamine inj , albumi 20% , albumin 10% , alpha beta artether inj , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , aminophylline inj ip 25 mg / ml , aminovain 100ml , aminovein 250 ml , amiodarone hydrochloride inj 50 mg / ml , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amphoteriricin b 50mg , ampicillin injection ip 500 mg , aq.diclofenac sodium inj ( dynapar aq ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , artracil 2.5 ml inj , arv , atropine sulphate injection ip 0.6 mg / ml ( sc / im / iv use ) , betamethasone sod phos inj ip 4mg / ml , bhcg 10000 iu inj. , bhcg 2000 iu inj. , b hcg 5000 iu inj. , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bleomycin 15 unit inj. , botroclot inj , botrophase inj. , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , butadol 1 ml inj. , caffeine citrate inj , calcium gluconate inj ip 10% ( iv use ) , carbolic acid 500ml bottle , carboplatin 150mg , carboplatin 450mg , carboplatin injection 150 mg , carboplatin injection 450 mg , carboprost tromethamine injection each ml contains carboprost 0.25 mg / ml , carpinol inj , cefipime 250mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , ceftrixone + sulbactam 1.5 gm inj. , chiken px ( varilix / biovac v ) , chlor procaine , chloroquine phosphate inj ip 40 mg / ml , ciprofloxacin injection ip 200mg / 100ml , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clonidine inj. , colistin , collin sulphate 10 miuinj vit d 3l / 6l , compound sodium lactate inj. ip , corbolic acid 500 ml bottle , crystalline penicilline , cyclophosphomide 200mg , cyclophosphomide 500mg , cytarabine inj ip 100mg / ml , dd 50 inj ( nandrololone ) ) , decarbazine 500mg , depomedrol 1ml , dexamethasone inj ip 8mg / 2ml , dexmedetomidine 100 mcg inj , dexmedetomidine 200 mcg inj , dextomid 1 ml inj , dextrose 5% 500ml ( d 5 ) , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% isotonic , diclofenac aq. , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , dicyclomine inj ip 10 mg / ml , digoxin inj ip 0.25 mg / ml , diltiazem , dobutamine inj 50mg / ml , dopamine hydrochloride inj 40 mg / ml , doxorubicin 50 mg inj. , drotaverine hydrochloride inj 40 mg / 2 ml , elderviit , enoxaparin sodium inj ip 60 mg ( lmwh ) , epirubicin 10mg , esmolol , et co2 samle lime , ethamsylate inj 250 mg / 2ml ( im / iv ) , etomidate 10 ml inj , etomidate inj 10mg , etoposide 100mg inj , fentanyl , fentanyl patch , fluconazole 100ml bottle , furosemide injection ip 10mg / ml ( im and iv use ) , gcsf 300 ug , gemcitabine 1gm , gemcitabine 200mg , gemcitabine for injection 1gm , gentamycin injection ip 80mg / 2ml ( im / iv use ) , glargin , gluteraldehyde solution 2% , glycopyrrolate + neostrogemin inj usp 0.2 mg / ml , glycopyrrolate inj usp 0.2 mg / ml , haloperidol , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis a ( havarix / biovac a ) , hepatitis b 1ml , hepatitis b immunoglotonlis 100 iu , hepatitis b ( hbig ) , heplock , human albumin inj 100ml , human anti d immunoglobulin injection 300mcg ( im use ) , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyprogesterone inj ip 250mg / ml , hyoscine inj ( buscopan ) , ifosfamide injection usp / bp 1gm , imunoglobulin 10gm , imunoglobulin 5gm , indomethacin , inj bevacizumab 100mg , insulin inj ip 40 iu / ml , ipv ( imovax / polio vac / polproket ) , iron ferric carboxymaltose 100mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , irrigation solution 500ml , iso p forte 10% , isolyte p 10% , isolyte p 500 glass bottle , isoprenaline injection ip 2mg / ml , kcl , ketamine inj ip 50 mg / ml , labetalol hcl inj ip 20mg / 4ml , lantus insulin , l asparaginase inj 10000 iu , leucovarin 15mg , levitiracetams , levo bupivacaine , levofloxacin 100ml , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% inj. , linazolid 300ml , linezolid inj 200mg / 100ml , lorazepalm , lorazepam inj 2mg , lox +adr inj , lox 4 % topical , lox spray , loxicard 2 % inj , loxicard 2% 50 ml , lsolyte p 10% , magnesium sulphate inj 50mg / ml ( 50% w / v ) , mannitol inj ip 20% w / v 100 ml , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml , mecobalamin inj 1000 mcg / ml , meropenem inj ip 500 mg , meropenem inj. ip 1gm , methotrexate 50mg , methotrexate inj ip 50 mg / 2 ml , methyl prednisolone sodium succinate for injection usp 500 mg , methyl prednisolone sodium succinate inj 80 mg , methylergometrine inj ip 0.2 mg / ml , metoclopramide inj ip 10mg / 2ml , metronidazole inj ip 500 mg / 100ml , milrinol , mitomycin 10mg , mixtard , mizolam 10 ml inj. , mmr ( tersivac ) , morphine , mucus extractor sterile ( details in rc ) , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , mvi inj , myoril ( thiocolchicoside ) , n.s 0.45% 500ml , naloxone , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , ns 100ml , ns 3 ltr , ns 3% 100ml , octreotide injection 50 mcg / ml , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin suspension 50mg / 5ml , omnidase inj , omnipaque , omniscan , ondansetron inj ip 2mg / ml , oxaliplatin 50 mg inj. , oxytocin inj ip 5 iu / ml , paclitaxel 260mg , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , palanosetron inj , pantazocin inj 30mg / ml , paracetamil inj 100ml , pemetrexed 100mg , pemetrexed 500mg , penidura la , pentoprazole inj 40 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone , phenytoin injection 50mg / ml , pilocarpine inj. , piperacillin + tazobactum for injection usp 4gm+500mg , pneumococcal ( synflorix / prevnav ) , polidoconol , potassium chloride inj. 0.15 gm / ml , pralidoxime chloride injection ip 25 mg / ml , prochlorperazone 5mg , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , propofol inj ip 10 mg / ml , quinine dihydrochloride inj 300 mg / ml , r l 500 ml glass , rabies vaccine human ip 2.5 iu , ranitidine hcl injection ip 50mg / 2ml , ringer acetate inj. 500 ml ( glass bottle ) , ringer lactate 500ml ( rl ) , rituximab 100mg inj , rituximab 500mg , ropivacaine 0.75 % 20 ml , rotavirus ( rotarix / rotateg ) , sensocaine inj , sevflurane / isoflurane , sevoflurane , sildinafil inj , soda lime medical grade , sodium bicarbonate inj ip 7.5% w / v , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium valproate inj 100 mg / ml , streptokinase 15 lac unit inj , succinylcholine 50mg / ml inj , taxim 500 inj , termin 10 ml inj. , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetrahes / voluven ( starch ) , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , thiocolchicoside 4mg , torsemide , trace elements ( celecil ) , tramadol inj 50 mg / ml , trastuzumab 440mg , trenaximic acid inj. , triamcinololone acetonide 10mg inj , triamcinololone acetonide 40mg inj , typhoid ( pcv typh bar / typhim vi ) , vancomycin 250mg , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , varicella zoster ( vzig ) , vassopressin , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil2.5 mg inj , vinblastine 10mg / 10ml inj , vincristine inj1mg / ml , vitamin a 40000 / ml , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) 1mg / 0.5ml injection ( detail in rc ) , vitcofol , vitcofol c , water for inj ip , zoledronic acid 4mg inj , distill water 5 ltr , inj terlipressin , mannitol 350ml , anti snake venom , anti scorpion venom , inj penidura la 6lac u , inj hbig 200iu , aminovain inj 10% , indamethasone inj , inj nac 600 , inj lorthinine +l asparginase , inj benzathine penicilin g 2.4lac , inj rocuronium , inj ropin 0.2% , inj nalbuphine10mg , pcm inj 150mg , pcm inj30mg , inj.polidoconal , inj d 125 , diltiazen ointment , kehr t tube no.14 , amino acid ( for parentiral nutrition ) 10% , lipid ( for parentral nutrition ) 20% , albumin 20% , colostomy bag , gigli saw urire , liga clip lt 200 , lt 300 , lt 400 , suprapubic catheter with tocar kit , hemoclip , c arm cover , crape bandage 4” , stainless steel burr 1 mm , 2 mm , 3 mm , 4 mm , 5 mm , 6 mm , tungston carbide burr1 mm , 2 mm , 3 mm , 4 mm , 5 mm , 6 mm , debrider blade40, 60 , merocele nasal blade , lignocaine 10% spray , h2o2 solution , lignocaine aderniline vial , surgical shaw , surgical fibrillar , crescent knife ( eye ) , keratone knife ( eye ) , side port knife ( eye ) , ethibond no.5 , elastic adhesive bandage 6 inches , crepe bandage 2, 4, 6 inches , skin traction adhesive , skin traction dunlop’s , shoulder immobilizer , knee cap splint , thumb spice splint , stockinette 3, 6, 9 cm*15m roll , skin stapler , 1938cotton roll 4 inch. pressed cotton for plaster 50 gm , cotton roll 6 inch. pressed cotton for plaster 50 gm , sterile adhesive dressing size. pad size 5x5cm , ( primapore / g dress type ) , sterile adhesive dressing size. pad size 5x10cm , ( primapore / g dress type ) , sterile adhesive dressing size. pad size 5x15cm , ( primapore / g dress type ) , sterile adhesive dressing size. pad size 5x25cm , ( primapore / g dress type ) , iodine impregnated incised drape ( ioban type ) approx. size 15x15cm , iodine impregnated incised drape ( ioban type ) approx. size 25x25cm , iodine impregnated incised drape ( ioban type ) approx. size 30x40cm , arm pouch sling , clavicle brace , long knee brace , finger cot different sizes , tennis elbow belt , silicon heel pad , ankle brace , lumbosacral belt , hip u drape , knee o drape , circular stapler for endto end amastomois , ( various sizes ) – 28 6 , 31 6 , polypropylene mask 6*11cm , 7.5*15cm , hernia tacper ( 5mm ) with 30 tacps ( nonabsorbable ) , hernia tacper ( 5mm ) with 30 tacps ( absorbable ) , composit mask12cm circular , 15cm circular , 20cm circular , 15*10cm , 20*15cm , thoracis trocarcatheter 12f, 20f, 28f , underwater seal beg , multifire luiner cutter without blade dual firing knob, push realize button , 60cm, , 80cm , luiner cutter reload 75mm cartridage , catridage for luiner cutter knif 60mm , inj. etomidate 2mg / ml 10ml , inj. rocurinium 10mg / ml 5ml , inj dexamedetomidine 1% 1ml , inj. xylocard 2% vial 50ml ( inj ligocaine iv ) , inj ropivicane 0.75% 20ml , inj ropivicaine 0.2% 20 ml , inj ropivicaine heavy 0.75% 4ml , inj. chlorprocaine 1% spinal use 5ml , inj. nalbuphine 10mg / ml 1ml , lignocaine spray 10% 50ml , paracetamol suppositories 100mg , diclofenac suppositories50mg , inj. lignocaine heavy 5% spinal use 2ml , i.v. cannula fixator , flexometallic et tube no.6 , flexometallic et tube no.6.5 , flexometallic et tube no 7 , flexometallic et tube no 7.5 , microlaryngel surgery ( mls ) et tube no. 5 , microlaryngel surgery ( mls ) et tube no. 5.5 , flexible bougie , magill forcep , ventilator –t nebulisation kit ( neb t kit ) , north pole et tube no.6 , north pole et tube no.6.5 , north pole et tube no.7 , north pole et tube no.7.5 , south pole et tube no. 6 , south pole et tube no. 6.5 , south pole et tube no. 7 , south pole et tube no. 7.5 , laryngoscope mac intosh ( adult ) , laryngoscope magill ( pediatri ) , laryngoscope mac coy ( adult ) , arterial bp cannula ( jelco ) , etco2 sampli line , inj. palanossetron 0.25mg 5ml , spinocaine 27g ( lumber puncture needle ) , glucometer caresens , glucometer caresensstripes , inj. levobupivicaine heavy .5% , inj. phenylephrine 50mcg / ml 10ml , inj metoprolol 1mg / ml 5ml , inj mephentermine 10ml vial , plasticcountenar , code free strips , disinfectant for surface & environment chemical , requirements active ingredients : , n alkyl ( 60% c14%, 30% c16, 5% c12, 5% c18 ) , dimethyl benzyl ammonium chloride 2.37% , n alkyl ( 68% c12, 32% c14 ) , dimethyl ethylbenzyl ammonium chloride 2.37% , inert ingredients 95.26% , it should be effective against hiv, hcv, h1n1, h5n1 and certificate should be enclosed supporting the claim with contact time not more than 10min. and with proven claim efficacy either from epa or niv or nicd. , macro porus partiall absorbable mesh made up of approximately equal part ofpolypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with poresize 2.7mm &weight of 39g / m2 and containing blue orientation strips of polypropylene. 10*15cm / european ce approved , 2point fixation deviced for open hernia repairs with a curved cannula &strap positioning tip having a forward – tited handle & metric ruler. inserted length of straps should be 6 7 mm total no of straps 20 usfda / europen ce approved , triple layer ( polydioxanone / polypropylene / polydioxanone ) tissued separation mesh with orc layer ofr ventral hernia repair. 15*15cm, squar usfda / europen ce approved , 5mm absorbable mesh fixarion device for hernia repair, with 2 point secure fixation, withmultiangle firing inserted length of straps should be 6.7 mmno of straps 12 usfda / europen ce approved , softpolypropylene mesh construced of knitted filaments of extrudedpolypropylene identical in composition to that ised in polypropylene suture, the mesh should affords excellent strength, durability and surgical adaptability, with sufficient porosssity for necessaty tissued ingrowth, blue polypropylene monofilaments incorporated to produce contrast striping in the mesh. size 15*15cmusfda / europen ce approved...

Rajasthan State Road Transport Corporation - Rajasthan

33562145 supply of rubber parts essential 1. f1933450 hose leyland 300 2. f1941150/f1925150 hose radiator leyland 100 3. f1941450 hose radiator leyland 100 4. f0530150 rubber bush radiator leyland 100 5. f1944250 hose vent leyland 50 6. f0130350 rubber element leyland 100 7. f0130150 rubber element leyland 40 8. 2786 5010 5819 hose rubber (radiator to w.p.) tata bs iii 50 9. 2786 5010 5840 hose radiator (from engine outlet) tata bs iii 50 10. 2786 5010 5835 hose radiator (from engine inlet) tata bs iii 100 11. id302086 radiator hose pipe lower eicher 10.75 50 12 id204377 radiator hose pipe upper eicher 10.75 50 13 me011934 hose engn. breather eicher 10.75 50 14 id208618 hose air cleaner eicher 10.75 50 15 2785 5010 5803 hose (20idx110l) tata bs iv 100 16 2525 5010 5865 hose water fill pipe tata bs iv (20idx90x105) 100 17 2525 5011 5811 hose radiator to w.p. 100 18 2525 5011 5857 rubber hose (th. to radiator) 100 19 2525 5011 5858 vent hose (radiator to th.) 100 20 2786 0599 9906 hose plain tata bs iii 400 21 2786 1899 5803 hose elbow tata bs iii 100 22 2525 0117 5809 hose oil separator tata bs iv 100 23 252514605822 hose t.c. adaptor to pipe tata bsiv 50 24 252514605814 hose i.c.pipe to intake elbow tata bsiv 50 25 252520125841 rubber hose tata bs iv 50 26 252509145804 reducer hose (127aid x102 id)tata bsiv 50 27 252509145867 hose (air filter to air intakepipe) tata bsiv 50 bid documents for rubber parts (essential ) tata /leyland 19 signature and seal of bidder 28 252509145869 hose (hfm sensor to air intake pipe) tata bsiv 50 29 252509145856 hose (air intake to t.c.) tata bsiv 50 30 252523145810 rubber hose(a.c.to egr outline)tata bsiv 50 31 252523145807 hose oil return tata bsiv 100 32 216549105801 rubber hose silencer to dps tata bsiv 50 33 278650105845 hose(6idx55 long) tata bsiii 2017 100 34 278650115806 hose (translucent tank to fill pipe) tata bsiii 2017 100 35 278650105851 hose( radiator to w.p.) tata bsiii 2017 100 36 278650105838 rubber hose(6idx80 long)tata bsiii 2017 ...

Rajasthan State Road Transport Corporation - Rajasthan

33554654 rsrtc invites the tender for rubber parts essential rsrtc invites the tender for rubber parts essential , rubber parts (essential items) tata/leyland/eicher as , f1933450hose leyland , f1941150/f1925150hose radiator leyland , f1941450hose radiator leyland , f0530150rubber bush radiator leyland , f1944250hose vent leyland , f0130350rubber element leyland , f0130150rubber element leyland , 2786 5010 5819hose rubber (radiator to w.p.) tata bs iii , 2786 5010 5840hose radiator (from engine outlet) tata bs iii , 2786 5010 5835hose radiator (from engine inlet) tata bs iii , id302086radiator hose pipe lower eicher 10.75 , id204377radiator hose pipe upper eicher 10.75 , me011934hose engn. breather eicher 10.75 , id208618hose air cleaner eicher 10.75 , 2785 5010 5803hose (20idx110l)tata bs iv , 2525 5010 5865hose water fill pipetata bs iv (20idx90x105) , 2525 5011 5811hose radiatorto w.p. , 2525 5011 5857rubber hose (th. to radiator) , 2525 5011 5858vent hose (radiator to th.) , 2786 0599 9906hose plaintata bs iii , 2786 1899 5803hose elbow tata bs iii , 2525 0117 5809hose oil separatortata bs iv , 252514605822hose t.c. adaptor to pipe tata bsiv , 252514605814hose i.c.pipe to intake elbow tata bsiv , 252520125841rubber hose tata bs iv , 252509145804reducer hose (127aid x102 id)tata bsiv , 252509145867hose (air filter to air intakepipe) tata bsiv , 252509145869hose (hfm sensor to air intake pipe) tata bsiv , 252509145856hose (air intake to t.c.) tata bsiv , 252523145810rubber hose(a.c.to egr outline)tata bsiv , 252523145807hose oil return tata bsiv , 216549105801rubber hose silencer to dps tata bsiv , 278650105845hose(6idx55 long) tata bsiii 2017 , 278650115806hose (translucent tank to fill pipe) tata bsiii 2017 , 278650105851hose( radiator to w.p.) tata bsiii 2017 , 278650105838rubber hose(6idx80 long)tata bsiii 2017...

Department Of Defence - Rajasthan

33535024 bids are invited for demister switch , flasher solid state , hose non metalic , pump hydraulic ram hand driven , spring brake actuator adaptor , spring brake actuator , pin retention , major kitmaster cyl , relay assy , horn low total quantity : 11...

National Institution for Transforming India Aayog - Rajasthan

33524068 bids are invited for package no. 4 atal tinkering lab of niti aayog power supply and accessories and safety equipment ( q3 ) total quantity : 1 glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb holders , electric wires, usb to bc jack cable etc...

National Institution for Transforming India Aayog - Rajasthan

33488981 bids are invited for package no. 4 atal tinkering lab of niti aayog power supply and accessories and safety equipment ( q3 ) total quantity : 1 glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb holders , electric wires, usb to bc jack cable etc...

Department Of Atomic Energy - Rajasthan

33427404 bids are invited for fm head antenna assembly , spare magnet retainer for fm head antenna , spare switch retainer , spare housing for fm head antenna , spare spring adjuster for fm head antenna , spare spring holder for fm head antenna , spare compression spring for fm head antenna , spare insulatingcover for fm head antenna , spare switch adaptor for fmhead antenna , spare face ring for fm head antenna ,magnet material alnico 5 total quantity : 103...

Sms Medical College - Rajasthan

33427109 supply of ent and blood bank instrument injection 1. opd insmruments 1 nasal speculum 2 tongue depressor 3 aural speculum 4 ear speculum 5 nasal suction ( no 1, 2, 3, 4, 5 ) each two 6 suction apparatus 7 tuning fork r 8 jo8sons horne probe 9 nasal packing forceps 10 ear suction tip ( no 12, 14, 16, 18, 20 ) each two 11 ear packing forceps 2. tympanoplasty set 1 ear speculum 2 mastoid retractor ( left & right ) each two 3 hartmans dressing forceps 4 ear micro sucmnon cannula ( no. 12, 14, 16, 18, 20, 22 ) 5 adaptor for cannula 6 me elevator 7 circular knife 8 flag knife 9 10 sickel knife pick straight & curved ( 30°, 45°, 900 ) 11 me scissors 12 malu.eus head nibbler 13 ear micro scissor 14 mexbnaum scissor 15 graft cumming scissor 16 side circular knife 17 duck bills graft repositor chockey stick 18 ear micro forceps right & left cup straight 19 ear micro forceps right & ueft crocodile straight 20 ear micro crocodile forceps serated straight 21 tilley dressing forceps 22 antrumseaker 23 ball probe 24 tympano meatal flap elevator 25 mympano meatal fuap elevator 26 micro instruments case with double silicon mat large mastoidectomy set s.no. item name o1 fisch rerractor, 13 cm qty ( right, souid ) . 02 fisch rerractor, 13 cm qty ( left, solud ) __ 03 fisch retractor, 13cm qty ( 3x3 toothed ) 04 — scissors, curved, 15cm qty ( straight. ) 05 sciessors, curved, 15 cm qty ( left curved ) — 06 3cissors, curved, 15 cm qty ( right curved ) o7 artery rorceps, micro —: o8 scissors, delicate; sharp sharp, 10.5 cm 09 suction and irrigation tube, conical 10 suction and irrigation tube, cylindrical 11 surgical handle, fig. 3, 12.5 cm 12 elevator with scalpel handle no.7 13? — double curette, meoium, 15 cm 14 forceps, 11cm soft spring option 15 tissue forceps, soft spring action, 13 cm 16 wulistein forceps, spring action, 15 cm 17 farabeuf elevator, 10 mm, 16 cm 18 freer raspatory, curved, 4mm / 18cm 19 fisch suction tube, outer dia. 1.2mm 20 fisch suction tube, outer dia. 1.5 mm 21 fisch suction tube, outer dia. 2mm 21 fisch suction tube, outer dia. 2mm 22 fisch suctin tube, outer dia. 2.2 mm 23 suction tube, angular. 0.7 mm 24 suction tube, angular, 1 mm 25 fisch suction suction handle 26 fisch micro raspatory, 16 cm 27 round knife 45m 1mm. 16 cm 28 fisch tenotome, sickle shaped, 16 cm 29 pick 45, 0.5 mm 16 cm 30 pick45, 1mmm16cm? 31 pick 45, 15 mm 16 cm 32 pick 90, 1 mm 16 cm 33 pick 90, 1.5 mm 16 cm 34 pick90, 2mm16cm 35 ear forceps 0.9 mm, 8 cm 36 ear forceps 0.6 mm, 8 cm 37 earforceps2mm, 8cm 38 ear forceps 1 x 4.5 mm, 8cm 39 ear forceps 1 x 4.5 mm, 8cm 40 micro scissors, extra delicate, 3mm. scm 41 scissors, curved right, 7.5cm 42 scissors, curved left, 7.5 cm 43 malleus nipper. 0.8 mmqty 2 each ( head and handle nipper ) — 44 pick 45, 16 cm, 2.5 mm qty 2mm micro instruments case with double silicon mat large septoplasty set ma%in ( t surii ( al hani ) li, 14 ( m nasal kniii, ( ljrvi 1 ) n14 cm nasal knii i , strakmt 14 cm co11on applicator, diami ti ft 1.i, 15cm scissors, ixira dilicati, curvw, 10cm scissors, curvi 1 ) , 10.5 cm scissors, curvi 1 ) , 14 cm walu r scissors, anglid, 10 cm fomon dorsal chisel 4 mm 18.5 cm _ _ chisel 18.5cm 9 mm forceps 20 cm. cottie crossbar osteotome crossbar chisel 18.5 cm, 6 mm chisel. straight, 18 cm? reiractor, _narow.!14 cm . w knife guide and retractor, 19 cm 18 retractor, l hook. one 414.5 cm, 20 mm prong, 16.5 cm 20 nasal retractor. 40 mm 21 t suction raspatory, 19.5 cm / 4. 01 02 0. 04 o5 07 08 09 10 11 1i 13 14 15 16 17 — nasal retractor, 40 mm suction raspatory, 19.5 cm elevator, double ended 22.5 cm. elevator, 21cm raspatory, 5 mm 14.5 cm cottle double raspatory, 22.5 cm tissue forceps, atraumatic, 12 cm nasal rasp, double ended, fine 21.5 cm nasal rasp, double ended, coarse 21.5 cm septum straightening forceps 21 cm asch and walsham cottle metal mallet, 18 cm joseph nasal law, right, 18.5 cm joseph nasal saw, left, 18.5 cm cotti.e nasal speculum, ss mm nasal speculum, 75 mm, 13.5 cm nasal speculum, 90 mm 13.5 cm nasal forceps, size 1, 11 cm nasal forceps, size 3, 11 cm 38 nasal forceps, serrated, 11 cm 39 bone crusher, with clip, 5 x 1.5 cm 40 needue holder, 8cm 41 needle holder 13 cm 42 needle holder 17cm 43 suction tube, 7 fr. / 2 mm 10 mm 43 suction tube, 7 fr. / 2 mm 10 mm 44 suction tube 9 fr. / 3 mm, to mm 45 suction tube, curved, 65 mm coule columella clamp, 11 cm 46 47 septum forceps, angular, 10 cm 48 micro instruments case with double silicon mat large 5. dielectric tube sealer . 01 nos • heavy duty radio frequency sealer, usfda approved • automatic detection of the tube by pressing of a lever which activates sensor. • minimum sealing time should < 2 sec. • no warm up time for the equipment before sealing. • should have separable rupture line to seprate tube ends after sealing. • detection of wet tube leakage and sealing defect alarm in case of seal not safe and completed. • switch mode power supply for uniform sealing irrespective of power supply variation. • compatble with tube of various manufactures of blood bag should seals 3.0 to 5 mm tube with wall thickness of 0.75 mm. • indication for ready, seal and power. • protection against electric shock. • preferably power unit and sealing handle should be seprate with a cable length of 1.5 meters. • provision for extended portable hand unit will be added a cable length of 1.5 meters. • provision for extended portable hand unit will be added advantage to be operational on 220 to 240v at 50 hz, single phase. etc opo instrum ep4ts 1. nasal speculum tongue depressor aural speculum ear speculum nasal suction (no 1,2,3,4,5) each two suction apparatus tuning fork jobsons horne probe nasal packing forceps ear sucmion tip (no 12,14,16,18,2o) each two ear packing forceps z. tympanoplasty set 3 mastoidectomy set 3 mastoidectomy set 4 septoplasty set dielectric tube sealer ryv ...

National Institution for Transforming India Aayog - Rajasthan

33417049 bids are invited for package no. 4 atal tinkering lab of niti aayog power supply and accessories and safety equipment ( q3 ) ( pac only ) total quantity : 1 glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb holders , electric wires, usb to bc jack cable etc...

North Western Railway - Rajasthan

33400739 supply of optical fibre loss test setoptical fibre loss test set,optical fibre loss test set, (the set consists of model 560xl optical power meter with 1030 st pc fibre optics connector adaptor and 570xl st 850/1300nm led source with built in st pc connector interface). make greenlee. model 570 xl st led source or equivalent...

Department Of Atomic Energy - Rajasthan

33341468 bids are invited for supply of 1 / 2†nb class 600, moc: ss316l, integralflanged process sealant adaptor gate valves. total quantity : 100...

National Institution for Transforming India Aayog - Rajasthan

33337637 bids are invited for package no. 4 atal tinkering lab of niti aayog power supply and accessories and safety equipment ( q3 ) ( pac only ) total quantity : 1 glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb holders , electric wires, usb to bc jack cable etc...

National Institute Of Ayurveda - Rajasthan

33336345 rate contract for hospital consumables , injection : , inj.n.s. 100ml , inj.n.s. 500ml , inj. dns 500 ml , inj.d5% 500ml , inj. d 10% 500 ml , inj. d 25% 100 ml , inj.rl 500ml , inj dexa , inj genta , inj piloearpine , inj adrenaline (1 ml) (1x50 ampuls) , inj.xylocaine2%withadrenaline , inj.xylocaine2%(lox) , inj. anawin heavy(bupivacaine) , inj. lox heavy(lignocaine) , inj atropine (1x50 ampuls) , inj. dexona(dexamethasone) , inj.avil(pheniraminemaleate) , inj.thiopentone(thiopentalsodium) 0.5gm , inj.succinylcholine(sueol) , inj.perinorn2m(metoclopramide) , inj.emeset2ml(ondansetron) , inj.rantac2ml(ranitidine) , inj.ketamine5ml , inj.t.t.5ml (inj. tetanus toxide 0.5ml) , inj.neostigmine 1ml , inj.atracuriumbesylate 10ml , inj.midazolam 10ml.10mg , inj.dynapar 1ml/(diclofenec) , inj.gentamycin 2ml 80 mg , inj.maczone plus 1.5gms/(ceftrixone + salbectam) , inj.tramadol2ml , inj. vit. k , inj. deriphyllin , inj. hydrocort/(hydrocortisone) , inj. lasix 2ml (furosemide) , inj. paracetamol (150 mg) , inj. buscopan (hyoscine) , inj. tranexa 5ml (tranexamic) , inj. magnesium sulphate 50% 2ml , inj. hydrocortison , inj. metrogyl 100ml , inj. ketamin/ aneket vial , inj. haemaccel 500 ml , inj. labetatol , inj. carbetocin , inj. perinorm/metoclopramide 2ml , inj. epidosin , inj. drotin , inj. phenargan , inj. carboprost , inj. fevastin/neomol , inj. betnesol , inj. amikacin 2ml 500 mg , inj. dexomethosne , inj. kaplin 10mg , inj. botropase , inj. iron sucrose , sterile water 10ml , sterile water 5ml , sepguard 100ml , halothane liquid 250ml , mannitol 100ml , povidine iodine 7.5% (500ml) , povidine iodine 10% (100ml) , povidine iodine 5% (100ml) , solution asthalin 15ml , omnipaque dye 50ml , abgel foam , betadine ointment 250gm , inj. methergin , xylocaine jelly 2% 50gm , pc enema 100ml , justin suppository 25mg , betadine 5% 1 ltr , xylocaine jelly 2% 50gm , tablet : , tab. paracetamol (500 mg) , tab. ranitidine (150 mg) , tab. meftal spas (1x10) , tab. sorbitrat , cap. nicardia 5mg , tab. formaline (100 pcs) , items(suture) : , barbours thread surgical linen no. 20 , barbours thread surgical linen no. 40 , chromic catgut 1.1 (110cm45mm needle) 2crb , chromic catgut 1.1 (40mm needle) 2crb , chromic catgut 0.0 (zero) 2crb , chromic catgut 1.0 (110cm45mm needle) 1/2crb , chromic catgut 2.0 1/2crb , chromic catgut 3.01/2crb , vicryl no. 0.0 (zero) , vicryl no. 1.0 (110cm45mmneedle) , vicryl no. 1.1 (110cm45mmneedle) , vicryl no. 1 0/2crb , vicryl no. 1 1/2crb , vicryl 2.0 round body 1/2 crb , vicryl 3.0 1/2 crb , monocryl suture 3 0 with needle , prolene no. 1 , prolene no. 1 , prolene no. 1.0 , prolene 2.0 , monoglyde 3.0 , ethilono 1 3/8 cce , ethilono 1.0 3/8 cce , ethilono 2.0 3/8 cce , ethilono 3.0 3/8 cce , surgical sature 4.0 , surgical sature 5.0 , surgical sature 8.0 , surgical sature 10.0 , surgical items : , n 95 , surgical masks 3 layers , clinical surgical spirit 5 ltr , hand sanitizer 5 ltr , surgical gloves (sterile+ packed) 6 no. , surgical gloves (sterile+ packed) 6.5 no. , surgical gloves (sterile+ packed) 7 no. , surgical gloves (sterile+ packed) 7.5 no. , examination gloves (latex) small size , examination gloves (latex) medium size , examination gloves (latex) large size , surgical gowns ( green cloth) , patient ot gown (disposable) (size standard) , surgical caps , surgical absorbant cotton (500gm) , cotton roll 500gms , cotton roll bandages 15cmx3mtr. (deluxe) , cotton roll bandages 10cmx3mtr. (deluxe) , cotton roll bandages 5cmx3mtr. (deluxe) , soft roll 15cmx3mtr , soft rolll 10cm x 3 mtr , surgical gauze cloth (than) 90cmx180mtr. (deluxe) , surgical gauze piece 10cmx10cmx8ply , surgical gauze piece 2inchx2inch , pop bandages 15cmx2.7 mtr , pop bandages 10cmx2.7 mtr , disposable syringes with hypodermic needles 1ml , disposable syringes with hypodermic needles 2ml , disposable syringes with hypodermic needles 5ml , disposable syringes with hypodermic needles 10ml , disposable syringes with hypodermic needles 50ml , disposable hypodermic needles 18no. , disposable hypodermic needles 20no. , disposable hypodermic needles 22no. , disposable hypodermic needles 24no. , disposable hypodermic needles 25 no. , disposable hypodermic needles 26no. , iv cannula 20 no. , iv cannula 22 no. , iv cannula 18 no. , iv cannula three way 20 no. , iv sets , uro bags standard , folleys catheter 18 , folleys catheter 16 , folleys adaptors (standard size) , ultrasound jelly , paper tape 2.5 cm x 9 mtr , paper tape 5 cm x 9 mtr , paper tape 7.5 cm x 9 mtr , paper tape 10 cm x 9 mtr , ampule cutter , disposable needle cutter (electric) , elastic band tourniques adjustable free size , k 90 size f.c. 14 (urethral catheter) , surgical blade no. 24 , surgical blade no.15 , surgical blade no.11 , surgical needles cutting edge 1/2 circle no. 10 , surgical needles cutting edge 1/2 circle no. 08 , surgical needles cutting edge 1/2 circle no. 06 , surgical needles round body 1/2 circle no. 08 , plastic box 8x10 , plastic containers 500gm , disposable suction tube with tip , abdominal drainage kit no. 12 , ryles tube 16 no. , infant feeding tubes 6 no. , infant feeding tubes 8 no. , endotracheal tube (disposable) 3mm , endotracheal tube (disposable) 3.5mm , endotracheal tube (disposable) 6mm , endotracheal tube (disposable) 6.5mm , endotracheal tube (disposable) 7mm , spinal needle 25 no. , mops sponge cotton 25x25x12 ply (with x ray) , mops sponge cotton 30x30x12 ply (with x ray) , macintosh sheet(1 roll=20mtr.) , plastic aprons standard , hernia kit with polypropylene mesh suze 4x6 with polypropylene sutures 1 0, polypropylene sutures 2 0, polygalectin 1 0, sounds closure suture material preferred monoglide or nylon. , surgical cautery pencil unipolar , blood transfusion set (bt set) adult , blood transfusion set (bt set) paediatric , iv cannula 20g triway pink , eye drap sheet 100 cm x 120 cm , trolley sheet 100 cm x 200 cm (preferably green & blue) , pocket mask adult , pocket mask child , ecg jelly 5ltr , ecg paper (cardiart 9108 d) , miscellaneous items : , lyzol solution for pharmacy grade , formaline liquid 5ltr , hydrogen peroxide 400 ml , anticeptic liquid 1 ltr , hypochlorite solution 5% 5 ltr , anticeptic handwash 5 ltr , anticeptic soaps 125 gm , anticeptic liquid 1 ltr , slipper (ot m/f)...

Rajasthan Rajya Vidhyut Utpadan Nigam Limited - Rajasthan

33263446 purchase of critical type bearings category b against nit no. tn 09 / 2022 23 purchase of critical type bearing category b against nit no. tn 09 / 2022 23 , chhabra thermal power project, rvun, chhabra , 6004.2z.c3 , bearing 6006 , 6007 2rs , 6009 2rsr , bearing 6012 , 6012rsrc3c140 , bearing 6016 , bearing 6018 , bearing 6019 , bearing 6020 , bearing 6021 , bearing 6024 , bearing 6028 , bearing 6008 , bearing 6012 a , bearing 6201 , bearing 6202 , bearing 6202 2rs , bearing 6202 2z , bearing 6202.2z.c3 , bearing 6203 , bearing 6204 , bearing 6204 2z , bearing 6205 , bearing 6206 , bearing 6206 2rs , bearing 6206 zz , bearing 6207 , bearing 6208 zz , bearing 6208 , bearing 6208.2z.c3 , bearing 6208.2rs1 , bearing 6208.2rs.c3 , bearing 6209.2z.c3 , bearing 6209 , bearing 6209 zz , bearing 6210zz , bearing 6210 , bearing 6211 , bearing 6211.c3 , bearing 6212 , bearing 6212.c3 , bearing 6212 2z.c3 , bearing 6213 , bearing 6213.c3 , bearing 6215 zz , bearing 6216 , bearing 6216 2rs1 , bearing 6217 , bearing 6218 , bearing 6219 , bearing 6232 , km 17 , mb 26 , km 26 , mb 17 , uc209 , uc204 , csa212 , csa211 , bearing 6301 , bearing 6304 zz , bearing 6305 2z , bearing 6305 2z.c3 , bearing 6306 2z.c3 , bearing 6306 zz , bearing6306 2rs1 , bearing 6306 , bearing 6307 , bearing 6308 , bearing 6308 zz , bearing 6308.2z.c3 , bearing 6308.2rs.c3 , bearing 6309.2rs1 , bearing 6309 , bearing 6309 2z , bearing 6310 , bearing 6310 +h305 , bearing 6310 zz c3 , bearing 6311 c3 , bearing 6312 , bearing 6312.c3 , bearing 6313.c3 , bearing 6313 zr , bearing 6319 , bearing 6319.c3 , bearing 6321.c3 , bearing 6404 , bearing 6405 , bearing 6406 , bearing 22220cc / w33 , bearing 22222cc / w33 , bearing 22222 cck / w33 + h 322 , bearing 22222e1k , bearing 22224e1k , bearing 22226e1k , bearing 22226 e , bearing 22226 cck / w33 + h3126 , bearing 22228 cck / w33+h3128 , bearing 22230e1k , bearing 22230cc / w33 , bearing 22232e1k , bearing 22232 cck / w33 + h3132 , bearing 22244e1k , bearing 22244 cck / w33 with sleeve 3144 , bearing 22211 ek / ck + sleeve h 311 , bearing 22215 ek / ck + sleeve h 315 , bearing 22216ek / ck + sleeve h 316 , bearing 22216 cc / w33 , bearing 22216 , bearing 22217 , bearing 22217 cc / w33 , bearing 22217 ek / ck + sleeve h 317 , bearing 22218 ek / ck +sleeve h 318 , bearing 22219 cc / w33 , bearing 22220 ek / ck + sleeve h 320 , bearing 22222 e , bearing 22222 ek / ck + sleeve h 322 , bearing 22226e1amc3e1c3 , bearing 22309e , bearing 22308 , bearing 22311 , bearing 22311e1c3 , bearing 22313e1am , bearing 22314 , bearing 22314e1amc3 , bearing 22316 ek / ck + sleeve h 2316 , bearing 22319 , bearing 22320 , bearing 22322 , bearing 22312e1am , bearing 23136e1akm , bearing 23148 e1k + aoh3148 , bearing 2312 k + sleeve h 2312a , bearing23218 cck / w33 + sleeve h 2318 , bearing 23222 cck / w33 + sleeve h 2322 , bearing 23120 , bearing 23024 , bearing 23030 , bearing 23028 , bearing 23028 e1akm / w33+h3028 , bearing 23226cc / w33 , bearing 23064 e1a.mb1 ( brass cage ) , bearing 23236cc / w33 , bearing 23248cc / w33 , bearing 22330 e1 , bearing 23268cak / w33 + sleeve h3268 / 8151 + lock washer with locking clip , bearing 24030 smb , bearing 24064 e1a.mb1 ( brass cage ) , bearing 23128e1km , ahx3128 , bearing 30312a , bearing 30214a , ncf2926vc3 , ncf2928vc3 , ncf 2928 r / c3 , ncf2936 vc3 , ncf2938 vc3 , ncf3032 vc3 , ncf2948 vc3 , nj2306ecp / c3 , nj2318emiac4 , nj210e , nj2322emic3 , nj2308ecp / c3 , nj2310ecp , nj306 ecp / c3 , nj204 ecp , nj310 ejp / c3 , nu221.c3 , nu228em1 , nu236e.m1 , nu308 , nu313 , nu319 ecp , nu310e , bearing 2922 , sl182928bxl.c3 , sl 182932 bxl.c3 , ge 35 es 2rs , ge340 dw 2rs2 , ge 80es xxog , e 32226j , wu 150x270 m1.c4 ( fag / schaeffler make specifications ) , bearing 3310 a / c3 , bearing 3309 atn9 / c3 , bearing 3206 a / c3 , bearing 3205 a / c3 , bearing 3215 b / atup , bearing 32324 j , dyzv7307 , 1306 etn9 , 1213ektn9 +h305 , ta 1825 z , hk 1512 , sleeve no. h313 , sleeve no. h315 , sleeve no. h317 , sleeve no. h320 , sleeve no. h322 , sleeve no. h3124 , sleeve no. h3126 , sleeve no. h3130 , sleeve no. h3132 , sleeve no. h 3136 , sleeve h309 , bearing 29344 e , bearing 29322e , bearing 29332 e , bearing 211 ec , bearing 6220 , bearing 792 795 , bearing 48220 48290 , bearing 98350 98788 , mh813844 mh813810 , bearing 9285 9220 , bearing 749a 742d , bearing 32216 j2 / q , bearing 2312 , bearing 1211 ektn 9 , bearing 3203 atn 9 , t 210j , bearing 7309 , bearing ck 72212 / 2 &sk72487 / 3 , bearing 7214 bep , bearing 7314 , 310ec , bearing 30220 j2 / df , bearing 30210 j2 / q , bearing 30220 , bearing 30226 , bearing 30213 , bearing 30217 , bearing 30219 , bearing 31308 , bearing 30310 , bearing 31311 , bearing 31314 , bearing 31313 , bearing 31315 , bearing 31317 , bearing 31319 , bearing 3220 a / c3 , bearing 32006 , bearing 32014 , bearing 32213 , bearing 32216 , bearing 32218 , bearing 32219 , bearing 32232a , bearing 32302 , bearing 32305 , bearing 32306 , bearing 32307 , bearing 32308 , bearing 32310 , bearing 32309 , bearing 32311 , bearing 32311 j2 , bearing 32312 , bearing 32312a , bearing 32312 c3 , bearing 32314 , bearing 32313 , bearing 32315 , bearing 32315 / q , bearing 32316 , bearing 32318 , bearing 3306 , bearing 3307 , bearing 33205 , bearing 33207 , bearing 33207 c3 , bearing 33208 , bearing 33209 c3 , bearing 33209 , bearing 33213 , bearing uk216+sleeve h 2316 , bearing 23022 , ncf2948vc3 , bearing 23060 e1 ( brass cage ) , bearing 22248 e1 , bearing 22232 e1am ( brass cage ) , total , chhabra supercriticalthermal power project, rvun, chhabra , bearing 6204 zz , bearing 6205 zz , bearing 6205 2zc3 , bearing 6206 2zc3 , bearing 6206 zz , bearing 6207 zz , bearing 6208 zz , bearing 6209 zz , bearing 6210 zz , bearing 6309 zz , bearing 6310 zz , bearing 6313 zz , bearing 6313 c3 , bearing 6314 c3 , bearing 6316 c3 , bearing 6318 c3 , bearing 6319 c3 , bearing 6322 c3 , bearing nu 234 c3 , bearing nu 319 c3 , bearing nu 322 c3 , bearing nu 324 c3 , bearing 32313 , bearing 22318 , bearing 32030 , bearing 32315 , bearing 32219 , bearing 22326 , bearing 32034 , bearing 2211k+sleeve h311 , bearing 2216k+sleeve h316 , bearing 22218k+sleeve h318 , bearing 22220k+sleeve h320 , bearing 22222k+sleeve h322 , bearing 22240cckc3 / w33 +sleeve h3140 , bearing 23024 cck / w33 +sleeve h3024 , bearing 23026 cck / w33 +sleeve h3026 , bearing 23028 cck / w33 +sleeve h3028 , bearing 23030 cck / w33 +sleeve h3030 , bearing 23032 cck / w33 +sleeve h3032 , bearing 23034 cck / w33 +sleeve h3034 , bearing 23036 cck / w33 +sleeve h3036 , bearing 23040 cck / w33 +sleeve h3040 , bearing 23044 cck / w33 +sleeve h3044h , bearing 23048 cck / w33 +sleeve h3048h , bearing 24030 e#1 , bearing 23044 e#1 , bearing 230381 e1 a#m , bearing 2216 bearing+sleeve , bearing 22218 bearing+sleeve , bearing 6307 zz , bearing 6305 zz , bearing 32928 / q , bearing 24030 e1 k295 080804 0200 , bearing 6205 pt , j0913 , bearing 22211 k / c3 + sleeve h311 , plummer block ( snv 100 f l ) with double lip seal , bearing 6308 zz , bearing 6202 zzc3 , bearing 6208 z , bearing 3313 , bearing 6005 2rsr , bearing 6304 , bearing 6310 z , bearing 6312 , bearing uc 209 , bearing ucf 209 , bearing uc 204 , bearing ucf 204 , bearing 6212 zr , bearing 6211 , bearing 6311 2rs , bearing 7306 b , bearing 32310 a , bearing 32311 a , bearing 32024 x , bearing 22209e1ak.m + sleeve h034 , bearing ( de ) ball bearing skf 6220 , bearing ( nde ) ball bearing skf 7220 becbm , bearing 6205 zz c3 , bearing 6202 zz , bearing 6307 lb , bearing 6311 zz , bearing 6311 zz c3 , bearing 6312 z c3 , bearing 6315 zz , bearing 6317 c3 , bearing 6318 2rs , bearing nu 322 , bearing 6212 , bearing 6206 2rs c3 , bearing 6206 2hrs c3 , bearing 6208 z c3 , bearing 6212 c3 , bearing 6322m / c3vl0241 , bearing nu 224 c3 , bearing 7320 b , bearing 6224 c3 , bearing nu 226 c3 , bearing 6226 c3 , bearing nu 230 m , bearing nu 219 ec mc3 , bearing 6320 mc3 , bearing nu 236 m , bearing 7220 b , bearing nu 220 c3 , bearing 6220 c3 , bearing 6236 c3 , bearing 22315 sk mbc3 , bearing 22308 e1 x2 c3 , bearing 22310 exq w33 , bearing 29324 e1 , bearing 3309 a , bearing 6317 , bearing 7316 be , bearing 29322 e , bearing 6409 c3 , bearing 6313 z c3 , bearing 3314 c3 , bearing 6315 , bearing 6306 c3 , bearing 7319 becbm , bearing 16026 , bearing 6310 c3 , skf 938 / 932 , timken 932 m8 dp , bearing 32222 , bearing 22317 sk mb , sleeve h 2317 , bearing 6309 c3 , bearing 6313z , bearing 6210 , bearing 6309 , bearing 6408 z , bearing 6211 c3 , 7214 becbj , bearing 7313 , bearingfor 43.5 m dia x 3.5 mswd + 0.425fb , bearing 6312 c3 , bearing 6309 z c3 , bearing nu 305 ecp , bearing 3306 , bearing 6307 , bearing 7206 becbp , bearing 7214 becbm , bearing 29320 , bearing 29324 e , bearing 3310 , bearing 22211 , bearing 22309 c3 , nj314 , bearing 3610 zz , bearing 22328ccja / w33 , 4910v , suratgarh supercriticalthermal power project, rvun, suratgarh , nj412 cylindrical roller bearing , nj2319 ecp c3 cylindericalroller bearing , nu218 cylindical roller brearing. , nu 219m cylinderical roller brearing , nu220 cylindericalroller bearing. , nu 224 c3cylindericalroller bearing , nu 226 m cylindericalroller bearing , nu226m + 6226c cylinderical roller bearing , nu230 m cylindericalroller bearing , nu313 cylindericalroller bearing , nu316c3 cylindericalroller bearing , nu413 cylindericalroller bearing , nu1028mcylindrical roller bearing , nu1030m+6030c3 cylindrical roller bearing , nup 2213 cylindrical roller bearings , 1305 self aligning ball brg. , 1503 self aligning ball brg. , 1603 self aligning ball brg. , 3206 double row angular contactbrg. , 3206 bd c3 angular contract ball bearing , 3311double row angular contactbrg.. , 6016 deep groove ball bearings , 6036 deep groove ball bearings , 6202 zz c3 deep groove ball bearing , 6203 deepgroove ball bearing , 6204 deep groove ball bearing , 6204 zz c3 deep groove ball bearing , 6204 c3 deep groove ball bearing , 6205 deepgroove ball bearing , 6206 deep groove ball bearing , 6206 2rs1 single row deep groove ball bearing , 6208 2rs1 deep groove ball bearing , 6208 z deep groove ball bearings , 6208 zz deep groove ball bearing , 6208 zz c3 deep groove ball bearing , 6209 c3 deep groove ball bearing , 6209 zzc3 deep groove ball bearing , 6211deep groov ball brg. , 6212 c3 deep groove ball bearing , 6212 z deep groove ball bearing , 6212 zz deep groove ball bearing , 6213 c3 deep groove ball bearing , 6213 zz deep groove ball bearing , 6215 c3 deep groove ball bearing , 6215zz deep groove ball bearing , 6217deep groov ball brg. , 6218deep groovball bearing , 6218 c3 deep groovball bearing , 6220deep groovball bearing , 6220 c3deep groovball bearing , 6224 c3 deep groove ball bearing , 6228 c3 deep groove ball bearing , 6230c3deep groovball bearing , 6304 zzdeep groov ball brg. , 6305 deep groov ball brg. , 6308deep groov ball brg. , 6308 zzdeep groov ball brg. , 6309deep groov ball brg. , 6312 c3 deep groovball bearing , 6313 c3deep groovball bearing , 6313 zzdeep groovball bearing , 6314 c3 deep groove ball bearing , 6314 c4 deep groove ball bearing , 6314znr c3deep groov ball brg. , 6315 c3deep groovball bearing , 6315 2z c3deep groovball bearing , 6316 c3deep groovball bearing , 6317 c3deep groovball bearing , 6319 c3deep groovball bearing , 6319 2z c3deep groovball bearing , 6322 c3deep groovball bearing , 6406deep groov ball brg. , 6410 open deep groove ball bearing , 6412 deep groove ball bearing , 7213angular contact ball brg. , 7214 bgangular contact ball bearing , 7315single row angular contact ball brg. , 7316 angular contact ball brg. , 7319 angular contact ball bearing , 7320angular contact ball bearing , 16026 deep groov ball brg. , 22210k + h310 spherical roller bearing , 22213k+ h313 spherical roller bearing , 22218k+ h318 spherical roller bearing , 22219 ckspherical roller bearing , 22220k+ h320 spherical roller bearing , 22222 spherical roller bearing , 22222k+ h322 spherical roller bearing , 22224cspherical roller bearing , 22224k+ h3124 spherical roller bearing , 22226 spherical roller bearing , 22226k+ h3126 spherical roller bearing , 22228k+ h3128 spherical roller bearing , 22230 spherical roller bearing , 22230k+ h3130 spherical roller bearing , 22232 spherical roller bearing , 22232k+ h3132 spherical roller bearing , 22320 ck spherical roller bearing , 22326 spherical roller bearing , 23024k + h3024 spherical roller bearing , 23028k + h3028 spherical roller bearing , 23032k + h3032 spherical roller bearing , 23036k + h3036 spherical roller bearing , 23040k + h3040 spherical roller bearing , 23044 spherical roller bearing , 23064k + h3064hg spherical roller bearing , 23134k+ h3134 spherical roller bearing , 23136k+ h3136 spherical roller bearing , 23138k+ h3138 spherical roller bearing , 23140k+ h3140 spherical roller bearing , 23144k+ h3144a spherical roller bearing , 23148k+ h3148a spherical roller bearing , 23152k+ h3152a spherical roller bearing , 24168e1k30 + h3168a spherical roller bearing , 24030 e1 spherical roller bearing , 29240 spherical roller thrust bearings , 29320espherical roller thrust bearing , 29322e spherical rollar thrust bearing , 29422e spherical rollar thrust bearing , 30207 taper roller bearing , 30214 taper roller bearing , 30312 taper roller bearing , 31306 taper roller bearing , 32224 a tapered roller bearing , 51228 thrust ball bearings , ucf312 ball bearing block assembly , 6218 j20aa c3 insulated deep groove ball bearing , 6220 c3 insulated deep groove ball bearing , 6224 c3 insulated deep groove ball bearing , nu1028m insulated cylindrical roller bearing , 33019 / q tapper cylindrical bearing , 6306 2z l207 c3 single row deep groove ball bearing , total , suratgarh thermal power station, rvun, suratgarh , 6305deep groove ball bearing , 6214 c3 deep groove ball bearings , 6217 c3 deep groove ball bearings , 6306 c3 deep groove ball bearing , 6316 c3 deep groove ball bearing , 6317 c3deep groove ball bearings , 6318 c3deep groove ball bearings , 6014deep groove ball bearing , 6016 deep groove ball bearing , 6018deep groove ball bearing , 6021deep groove ball bearing , 6024 deep groove ball bearing , 6026 deep groove ball bearing , 6028 deep groove ball bearing , 6208 2z / 2zr deep groove ball bearing , 6210 c3 deep groove ball bearing , 6212 z deep groove ball bearing , 6224 deep groove ball bearing , 6305 2z deep groove ball bearing , 6306 zzdeep groove ball bearings , 6307 c3 deep groove ball bearing , 6309 c3 deep groove ball bearing , 6321 c3 deep groove ball bearing , 6020 z deep groove ball bearings , 6206deep groove ball bearings , 6213 2z c3deep groove ball bearing , 6220 c3deep groove ball bearing , 6234 m c3deep groove ball bearing , 6308 2z deep groove ball bearing , 6308 2z c3 deep groove ball bearings , 6309 zz c3 deep groove ball bearings , 6312 c3 deep groove ball bearings , 6312 2z c3deep groove ball bearing , 6314 deep groove ball bearing , 6315 c3 deep groove ball bearings , 6316 c3 deep groove ball bearing , 6319 c3 deep groove ball bearing , 6315 deep groove ball bearing , 6205 c3 deep groove ball bearing , 6210 zz deep groove ball bearing , 6309 deep groove ball brg , 6313 c3 deep groove ball bearing , 6313 2zrc3 deep groove ball bearing , 6218 deep groove ball bearings , 6311deep groove ball bearing , 6210 c4 deep groove ball bearing , 1213 k deep groove ball bearing , 1306 tvself aligning ball bearing , 7313 b jb angular contact ball bearing , 3307 a angular contact ball bearing , 7213 bjp angular contact ball bearing , 3207 btnh angular contact ball bearing , 3213 btvh angular contact ball bearing , nu 226 em1c3cylindrical roller bearing , nu 319 emi c3 cylindrical roller bearing , nu 321 emi c3 cylindrical roller bearing , nu 322 em1c3cylindrical roller bearing , nu324 emic3 cylindricalroller bearing , n 321 em1 c3cylindrical roller bearing , nu 220 em1c3 cylindrical roller bearing , nu 1020 ml cylindrical roller bearing , nu 2226 ecp / c3 cylindrical roller bearing , nu 318 ecj / c3cylindrical roller bearing , nu 307 cylindrical roller bearing , nu 218 etvp2cylindrical roller bearing , nu 2211 e m1 cylindrical roller bearing single row , nu 211 e m1 cylindrical roller bearing single row , nu 317 ecm c3 cylindrical roller bearing , 22217 ek spherical roller bearing , 22222 ek / c3 spherical roller bearing , 22226 cck / w33 spherical roller bearing , bearing 23236cc / w33 , 22217 cck / eiakm spherical roller bearing , 22220 e1 akm spherical roller bearing , 22224 cck / eiakm spherical roller bearing , 22317 ek spherical roller bearing , 22322 e1am spherical roller bearing , 22316 e1am spherical roller bearing , 23120e1 am c3 spherical roller bearing , 22226ek / c3 + h3126 spherical roller bearing , 23138 e1 akm spherical roller bearing , 48290 / 48220tapper roller bearing , 22234 cck / eiakm , 23144 cck / eiakm spherical roller bearing , 22211 e1akm+h311 or 22211kejw33+h311 spherical roller bearing , 22213 cck / e1 akm spherical roller bearing , 22228 cck / e1 akm spherical roller bearing , 22311 e1 c3 spherical roller bearing , 23136 e1 akm spherical roller bearing , 23228 e1 akm+h 2328 or 23228kemw33+h2328 spherical roller bearing , 23128 cck / w33 + ahx 3128 , 23064 cc / w33 spherical roller bearing , 24064 cc / w33 spherical roller bearing , h 311 sleevespherical roller bearing , h 313 spherical roller bearing sleeve , h 317 spherical roller bearing adopter sleeve , h 3124 spherical roller bearing sleeve , h 3126 spherical roller bearing sleeve , h 3128 spherical roller bearing sleeve , h 3132 spherical roller bearing sleeve , h 3134 spherical roller bearing sleeve , h 3136 spherical roller bearing sleeve , h 2317 spherical roller bearing sleeve , h 3144 spherical roller bearing sleeve , h 2328 spherical roller bearing sleeve , spherical rollerbearing 23248 ccw33 , 23268 cak / w33+sleeve oh 3268h+ lock nut hm 3168 , 22217 e1k spherical roller bearing , 22216 e1am spherical roller bearing , 22324 smb / skmb spherical roller bearing , 32318 a , 32208 tapper roller bearing , 22326tapper roller bearing , 30310 tapper roller bearing , 30312 atapered roller bearing , 31322 x tapper roller bearing , 32209 a taper roller bearing , 32312 a tapper roller bearing , 32313a taper roller bearing , 32314 a tapered roller bearing , 32317 a tapper roller bearing , 98350 / 98788tapper roller bearing , hm 813844 / 813810tapper roller bearing , 795 / 792tapper roller bearing , 9285 assy.902a5 tapper roller bearing , 32218 j2 / q taper roller bearing , taper roller bearing 749a assy.90070 , 30315 a tapered roller bearing , 32020tapper roller bearing , 32212 j2 / q tapered roller bearing , 32218a taper roller bearing , 30313 j2 / q tapper roller bearing , 30216 j2 / q taper roller bearing , 31313 j2 / q cl 7c tapper roller bearing , 29322 e1 spherical roller thrust bearing , hm926749 cup: hm926710d with spacer hm926749 xe , ucpx 12 bend pulleys of ilms of chp stg. i & ii. make: ntn , bearing qj320 n2mpac3 , ucpx 15 , h322bearing sleeve , h 3126 sleevespherical roller bearing , h3134bearing sleeve , 7309 btvpua angular contact ball bearing , 3310 bd angular contact ball bearing , nu 313 cylindrical roller bearing , 22209 e1 c3 spherical roller bearing , spherical roller bearing adaptor sleeve h 309 , spherical roller bearing22312 k , he 2312 spherical roller bearing sleeve , spherical roller bearing22308 e / c3 , 22224 e1 k or 2224kejw33 / kymw33spherical roller bearing with sleeve h3124 , 22232 e1 akm spherical roller bearing with sleeve h3132 , 22234 e1k spherical roller bearingwith sleeve h3134 , 22236 e1k spherical roller bearingwith sleeve h3136 , 22213 e1 akm spherical roller bearing with sleeve h313 , 22222 e1 akm spherical roller bearingwith sleeve h322 , 22228 e1 kor 22228kejw33 spherical roller bearing with sleeve h3128 , ge70es ( skf ) plain redial sperical brg. , 32221 j2 tapered roller bearing , ucf 213bearing block , ucf 212bearing block , sleeve 3140 , total , dholpur combined cycle power project, rvun, dholpur , bearing 71450 , bearing 6202 , 6315 c3 , 6316 c3 , total , kota super thermal power station, rvun, kota , brg. 29422 e , brg. 6030 , bearing 7313 , 29324e , bearing 6020 , brg. 22228 cck / w33 , bearing 29330 , brg. 6408 , bearing 6306 , bearing assembly ( non exp ) with brg. 1h22317 , thrust brg. 29338 e , thrust brg.29322 , spherical roller brg.22316 smbc3 , brg. 32209 a , brg. 32212 a , brg. 32218 a , brg. 3313 btvh , brg. 29426 e , brg. 22326 cc / c3w33 , brg. 29422 e1 , brg.22322 e1am , brg. nu 308 ecp , bearing 6205 , nu 2308 ec roller bearing , 22312eak , sleeve hkg h 2312 , 23220 cc / w33 / 23220 e1am , bearing no. 30311d , bearing no. 72212 / 72487q , bearing no. 32213 , bearing 22308 e / c3 , bearing no. 22317ekw33j , sleeve / adopter sleeve h 2317 , bearing no. 6307 c3 , bearing no. 6213 , bearing no. 3307 c3 , bearing no. nj 210 , bearing no. 6308 z , bearing 6217 , bearing no. 22315 smb , bearing no. 2224 e , bearing no. 22320 smb , bearing no. 29426 e1 ( nde ) , bearing no. 22326 cc / c3 w33 , 22220e / c3 , 31311 s2 / q , 6210 c3 , nu 319 em / c3 , 6208 zz , 6208 zz c3 , 6308 deep groove bearing , 6319 c3 , bearing no. 22216 e1 am , bearing no. 3313 s / 3313 b tvh ( fag ) , bearing no. 22313 smb , bearing no. nu 314 em1 , bearing no. nu 318 em1 , deep grove bearing6308 , bearing no. 3207 , bearing no. 7213 , bearing 31311a , bearing nu326 , bearing no. 3311 s , 6202 2z , 6203 zz , 6302 cm , double roller tapered worm shaft thrust bearing 29438ejw18w66 ( pair ) , cylindrical roller vertical shaft upper radial 280ru92ac1112 r3 imported , journal bearing upper tapper roller trb h 242649 / h242610 ( imported ) , journal bearing lower tapper roller trb hh437549 / hh437510 imported , vertical shaft thrust bearing trb t811 902a1 imported , vertical shaft lower radial bearing crb nu330 / ema imported , cylindrical roller worm shaft radial bearing crb 170rn03aa782r3 imported , cylindrical roller thrustbearing lower t ecrt 624 , tapper roller bearing for feeder gear box ( for worm gear ) trb 552a 2024 / 560 20024 , head pully bearing for volumetric feeder yel 209 , deep groove ball brg.6209 2rsr , deep groove ball brg.6212 2rsr , 23236 cc / w33 ( imported ) , 23248 cc / w33 ( imported ) , 23064e1am , 24064bmb , 23264kmb with sleeve , 23128 e1ak.m with withdrawal sleeve and lock nut& lock washer , uel209d1 / uel209d1 w33 , 22309e , 6212 2z , bearing 6204 , 6009 z , 6207 2z , 6306 2z , 6305zz , 30214a , 30312a , 23122 c , bearing 30220 , hr 303 mj , nu 309 w , hr 32217 j , bearing 6210 , hr 30309 j , bearing 23122 , hr 32213 j , hr 30308 j , 6306 2rs , bearing 21305 , bearing 22309 , qj313 , bearing 22313 , 6220 z , nu 220 , 63062z / c3 , bearing 22309 , qj313 , bearing 21313 , 6220 z , nu 220 , nu 210 ecj , 7214 becbm , bearing no.6020 , brg. no 29324 e , bearing no. 29322 e , bearing no.29317 e , brg no nu 313 , bearing no.7313 , bearing no.6024 , bearing no.29416 e , bearing 6310 , bearing no.31310 j2 , bearing no. nup 2310 ecp , brg. no., 32311 j2 , bearing 81216 tn , bearing nj 317 ecp / cylirdrical roller brg , bearing 6313 z nr , bearing 6313 z c3 , bearing no.6314z , bearing no.6314znr , 6004c3 , 6004zzc3 , 6205zz , 6205zzc3 , 6206c3 , 6206zzc3 , 6207zzc3 , 6208zz , bearing 6209 , 6209zz , 6209zzc3 , 6212 2rsrx2 , 6213c3 , 6216c3 , 6226c3 , 6240mc3 , 6305zz , 6306zz , 6308zz , bearing 6309 , 6309zz , 6309zzc3 , bearing 6310 , 6310zz , bearing 6312 , 6313c3 , 6313 2rs , 6314c3 , 6315c3 , 6316c3 , bearing 6317 , bearing 6318 , 6319c3 , bearing 6322 , 6322c3 , 7320becbm , 7322bg , 7324 bmpuo , nu226 em c3 , nu240em , nu316 , nu316c3 , nu318 , nu319c3 , nu320 , nu321 , nu322 , nu324 , nu326 , nu326ecmc3 , tapper roller bearing 29322e1 , 6310zzr , bearing ms11 , bearing 6406 , 23238e1c3 , bearing 6202 , bearing 6205 , bearing 51205 , bearing 6203 , bearing 6204 , bearing 30203 , bearing 30204 , bearing 30205 , radial ball bearing 30x68x15 , radial ball bearing 40x68x15 , radial ball bearing 30x62x16 , radial ball bearing 35x62x14 , radial ball bearing 30x55x13 , radial ball bearing 25x47x12 , radial ball bearing 35x62x14 , thrust ball bearing with sleeve 30 / 47x11 , thrust ball bearing with sleeve 25 / 47x15 , needle cage b30x35x17 , needle cage b20x24x13 , 22244 cck / c3 / w33 , bearing 32222 , 30228 j2 , 22240 cck / c3 / w33 , 22238 cck / c3 / w33 , 22236 cck / w33 , 22228 c3 / c33 , ncv 2936 / sl 182936 / ncf2936v , 23226 e1am / cc / w33 , 22218 ck , nj2318 em1c3 , 22236 cck / c3 / w33 , 22244 c3k , 22320 c or e1am , bearing 22324 , bearing 22334 , 32240 cc , bearing 30307 , bearing 30317 , 32311 a , bearing 32307 , bearing 32312 , bearing 32322 , bearing 31310 , sl 182926 , sl 182944 , sl 182972 , nj 318 , nj 2226 , qj 218 n2 , bearing 22316 , 23060 hlk with sleeve ah 3060 h , 23052 hlk with sleeve ah3052 h , 22215ek , 22218ek , 22220ek , 22222ek , 22224ek , 22230cc / w33 , 22211ek , 22217ek , 22212ek , 22228ek , 22232ek , 22226skmb , 23136e1akm , 23140ek ( cage steei ) , 32312j2 / q , ucf212 d1 , 22213ek , 22244k ( cage steei ) , 32310u , 32315u , 22230 ek , ucf 211 , ucf 210 d1 , ucf 213 d1 , 23144 ek , 23122 easkmc3 , nu 213 em1c3 , nu 316em1c3 , nu 315em1c3 , nu 318em1c3 , nu 321em1c3 , nu 320em1c3 , nu 322 em1c3 , nu 324 em1c3 , nu314 e / c3 , nj 2320 ecj / c3 , 6216 c3 , 3306 btvh , 3309btvhc3 , 6318 c3 , 6321 c3 , 6322 c3 , 6310 c3 , 6314 c3 , 6319c3 , 6324c3 , 6312 / c3 , total , kalisindh thermal power project, rvun, jhalawar , bearing 23238 , bearing 31330 , bearing 24048 , bearing nu238 , bearing 23138 , nu1080 , nu2368 , bearing 23168 , e60 xl krr , e 45 krr , ucf 209 , csa212 , cna209 , yar 210 2f , 6208 2rs , 6212 2rs , 6204 zz , 7319becb , nu316ecmp63 , 6316mc3 , nu234ecml / c3 , 6234m , nu2318 , h90381 / 90744 d , 22316 ck / w33 , nu316c3 , 6315c3 , 6319c3 , 6410 c3 , 6411 c3 , 6004 zz , 6203 2rs1 , 6204 zzc3 , 6205 zzc3 , 6206 zzc3 , 6208 zzc3 , 6209 2rs , 6210 zz / 2rs , 6213 2rs , 6221 em1c3 , 6305 zz , 6308 2z , 6310 zz / em1c3 , 6312 2rs / c3 , 6313 2rs / c3 , 6315 2rs / c3 , 6317 em1c3 , 6318 em1c3 , 6319 em1c3 , 6322 em1c3 , nu 221 em1c3 / epc / c3 , nu226 em1c3 / ecj / c3 , cylindrical roller bearing nj2317 ecml c4 , 22232 e1akm , 22216e1akm , 22256 bk.mb with adaptor sleeve oh3156 , bearing 6312 , 22210 e1kc3 , 22213 cck , bearing 7308 , bearing 7212 b , bearing 7305 , nu1020m1 , roller bearing nu218 , 3308 a / c3 , 32318 a , total , ramgarh gas thermal power project, rvun, ramgarh , 6203 zz , 6204 c3 , 6204 zz c3 , 6205 zz c3 , 6206 c3 , 6209 2rs , 6305 zz , 6308 zz c3 , 6304 zz , bearing 6305 , bearing 6308 , bearing 6310 , 6311 c3 , total => limited...

Medical And Health Services - Rajasthan

33263258 supply of electric and plumbing items switch socket regulator step , indicator , fuse , two way switch , bell switch , internal socket , two pin socket , tv socket , blank plate , put light 3 modulator put light 2 modulator holder plain holder fancy ceiling rose round set isolator 100amp isolator 63amp isolator 40amp mcb 32amp mcb 25amp mcb 16amp charging socket mcb box 4way mcb box 6way mcb box 8way mcb box 10way mcb box 12way 4 25 26 27 28 29 30 31 32 33 34 35 36 37 mcb box 4 tpn mcb box 4tpn 18 modular box 12 modular box 8 modular box 6 modular box 4 modular box 3 modular box 2 modular box 18 modular set 12 modular set 8 modular set 38 39 40 4 44 45 46 47 48 6 modular set 4 modular set 3 modular set 49 50 52 2 modular set 53 board 8*5 54 board 5*5 55 board 44 56 board 7*4 57 board 105 58 board 12*5 two pin top 6amp three pin top 6amp three pin top 16amp 59 60 61 62 wire 7smm 63 wire 1.00mm 4 wire .50mm 5 wire 2.50mm 66 wire 4.00mm wire6 .00mm cable 4mm cable omm 67 68 69 70 cable 8mm cable 1omm cable 16mm tubelight complete tubelight rod tubelight choke tubelight startor led light 7watt led light 12watt led light 18watt led light 27watt electric tape cooler motor copper cooler motor aluminium | cooler blade 73 74 75 76 77 78 79 80 8 82 83 84 85 cooler pump summercible celling fan 86 87 condensar 2.5mfd 88 condensar 3.15mfd 89 condensar 4mfd condensar 10mfd | celling fan set celling fan binding_ cooler motor binding water motor binding % hp water motor binding 1lhp water motor new h hp water motor new 1 hp red bulb for xray room connector knife switch tumbler switch ic main switch flush type switch cartise fuse cutout kitcat fuse cutout hrc fuse single adaptor electric pin plug multi plu8 socket adaptor parallel adaptor pipe 25mm hms pipe 25mm mms pipe 25mm lms pipe 20mm hms |pipe 20mm mms pipe 20mm lms keshing patti fan dandi | p.g 25mm p.g 20mm fan huke street light flused light panel led 8watt panel led 12watt panel led 16watt flexible pipe % inch flexible pipe 1 ench pipe linch sdr 11 pipe % inch sdri1 pipe linch sdr 13.5 pipe % inch sdr 13.5 elbow linch plain tee 1 inch plain brass elbow 1 inch brass tee l inch brass mta 1 inch brass mta 1*3 / 4 inch brass mta 1*1 / 2 inch brass fta 1*1 / 2 i10 111 112 113 114 l115 116 117 | 118 119 | 120 121 | 122 123 124 125 | 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 brass mta % inch brass mta y*1 / 2 plain mtai inch plain mta % inch brass fta %*1 / 2 elbow i inch 45degree union i inch tank nipple i inch wall 1 inch c.p.v.c reducer tee 1*3 / 4 inch reducer socket 1*3 / 4 inch reducer elbow 1*3 / 4 inch end cap 75mm end cap 63mm elbow 45 degeel 10mm elbow 45 degree 90mm elbow 45 degree 75mm elbow 45 degee 63mm reducer tee 110*90mm reducer tee 110*75mm 94 195 196 197 198 199 200 201 reducer tee 110*63mm reducer socket 110*90mm reducer socket 110*7smm 02 203 204 205 reducer socket 110*63mm 206 reducer socket 90*75mm reducer socket 90*63mm reducer socket 75*63mm 207 207 pee tnp 7smm nani trip 7s mm 08 09 1 pc olent 250ml pc sol ent 118ml pc olvent 59ml short body cock ( tunti ) i ong body tunti tonty swan neck tunti angle wall short body cock angle wall short long body tunti steel etc...

Indian Army - Rajasthan

33237959 bids are invited for dvr and nvr , ir camera , lcd 40 inch , cable , power supply adaptor , ups , hard disk , installtion and labour charges total quantity : 9028...

Indian Army - Rajasthan

33210790 bids are invited for electric power board modular , usb hub 4 port , plug top 15 a , socket 15 a , zero watt bulb red yellow and green , electric on off switch , drill light 6mm press and fit , adaptor for strip light , hdmi to micro hdmi cable , class c type cable , power strip with 5 mtr cable , channel to fit lights , gixxer machine blade set of 5 , carry handle for model box , lock hindge , switch 5 amp vinay , socket 5 a vinay , plug top 5 a vinay , co axial cable connector , plastic box for power board 3 switch and 3 socket , flexible cable , tubelight ww 2 ft , tube light ww 4 ft , wire stripper and cutter, hole saw set , spot light 5 watt warm wite , adaptor forled light , strip light led warm white , wall light 2 ft , ledtube light 15w , led bulb 9w ww , led bulb 10w , bulbholder , led bulb 5w osram , drill bulb 6mm , drill bulb8mm , wall light 1 ft , led bulb 3 w bajaj , bulb 100w , ledbulb surya 7w total quantity : 1156...

Department Of Local Bodies - Rajasthan

33192513 supply and installation of surveillance equipments for the municipal area pushkar supply and commising of 5 mp motorizedbullet camera image sensor,1 / 2.7 cmo,simage size( 2592×1944 ) ,electronic shutter,1 s ~ 1 / 100000 s, iris type,fixed iris,min. illumination,0.0236 lux @f2.0, agc on; 0 lux with ir,0.0085 lux @ f1.2, agc on; 0 lux with ir,lens 2.8 to 12 mm@f2.0, h wide dynamic range, blc, hlc, dfog, video compression h.265, h.265 compression,dynamicsharpness, standard main profile@leve4.1 high tierresolution,5mp, image settings,roi, saturation, brightness, hue, contrast, wide nr, etc. adjustable through client software or web browse,storage,built in micro sd card slot, up to 128gb,anr,network protocol,udp, dhcp, ntp, rtsp, pppoe, ddns, smtp, ftp, 802.1x, upnp, http, https, qos,interface protocol,onvif,smart alarm,motion detection,general function,watermark, ip address filtering, video mask, heartbeat, illegal login lock intelligent analytics,object removal detection (object left/missing), scene change detection, video blur detection, intrusion detection and line crossing detection,ir distance, 30 ~ 50 m ,ingress protection ip67,power supply.dc12v/poe,power consumption, 9w,operating environment, 30 °c ~ 60 certificate, bis,ce,ul,fcc, approve make pelco/axis/secura/infinova 2 supply and commising of 32 ch 4k anpr nvr with 4 sata,embedded linux,network input 32 ch ipc input,compressionstandard h.265 / h.264,2 way audiorca × 1.local outputrca × , resolution1, compression g.711(u/a), 8mp/6mp/5mp/4mp/3mp/1080p/1280×1024/960p/720p/960h/d1/cif,smart search highlighted color to display the camera record in a certain period of time, different colors refers to different record events, input4ch local alarm input; supports ipc alarm input,incoming bandwidth256mbps,outgoing bandwidth 256mbps, adopt standard h.265 / h.264 high profile compression,4k output, true high resolution display multi user online simultaneously,dhcp, ddns, pppoe network protocol and cms supported,• playback : 16 ch simultaneous playback,usb 3.0 × 1, usb 2.0 × 1 ( one in the front panel and the other in the rear panel ),hddsata × 4, max 6tb per hdd,consumption= 30w ( without hdd ),work environment10 ~ 50 ?,10% ~ 90% humidity,dimensions (mm)440 × 390 × 70 ( w × d × h ),power supplyatx ,certificate, bis, ce, ul, fcc, approve make pelco/axis/secura/infinova 3 supply installation and testing commissioning of 55 led monitor,17,55 diagonal 4k led display,2 x hdmi port,1 x vga port,2 x usb port, inbuilt media player should be as per oem for web browser & file sharing compatibility through ip, external control rs232c(in/out) thru stereo jack, rj45,contrast ratio 4000;1,response time 8 ms, brightness 350 cd/m2 20 watt built in speaker, viewing angle 178° x 178°,wall mount for display:, movable arm wall mount with 45° left / right movement, external media player compatible for above if required safety & emc certifications.make:sony/lg/ 4 supply installation and testing commissioning ofgigabit layer 2 poe switch 8 port 10/100/1000mbps+2sfpuplink gigabit all 8 10/100/1000 ports support ieee802.3af/at standards,2 gigabit sfp fiber port for sfp module,ai extend: 1 8 port rate down to 10mbps, but the transmission distance up to 250 meters,ai vlan: isolating ports 1 8 from each other, suppress network storms effectively and,ai poe detect pd, power failure and restart dead equipment make:dlink/cisco/hp/equivalent 5 supply installation and testing commissioning of24 port gigabit eathernet switch ,support ieee802.3, ieee802.3u, ieee802.3ab ethernet standard, support full/half duplex mode, support ieee802.3x standard flow control, support ieee 802.3x full duplex flow control and back pressure half duplex flow control,support ieee 802.1x channel control protocol, provides 24 adaptive rj45 port, supporting 10/100/1000mbps connection rate, provide up to 48gbps bandwidth and non blocking line speed forward, provide led indicators realize simple work statement reminder and trouble clearing, support port input/output bandwidth control, support up to 4kv port of lightning protection.make:dlink/cisco/hp/equivalent 6 supply , installation, testing and commissioning of ip 55 outdoor pole rack 9u x 550mm w x 500mm d construction of material 1.2/1.5mm thick crca sheet each enclosure includes: a very compact design, welded structure with front accessible the side panels are integrated type & welded with canopy & bottom cover rigid frame that can be fixed to the pole front door with filter, louver & lock 90cfm, 230v ac fan 2 nos, front door self adhesive thermal foam from inside door hinges 2 nos cable glands at bottom side for cable entry 19 angles 9u 2 nos for equipment mounting gasket ( as per ip55 standard ) pole mounting brackets at rear side 2 nos hood for air inlet at front side powder coated surface 3 socket pdu 5 amp 1 no. finish : light grey ral 7035 powder coated 7 supply and erection of5mtrstubular pole for fixing the cameras along with foundation structure make:fabricated 8 supply , installation, testing and commissioning of 27 u floor standing communication rack with width 600 mm, depth 600 mm, front glass door, rear ms door, side openable panels, min 10 socket vertical cable manager 01 no, two nos vertical cable managers, 05 nos horizontal cable managers, swing handles, lock on both doors, top and bottom cable entries with gland plates, coastor with brakes, 1 no fan tray with 2 x 230 volt fans, equipment mounting hardware.make:dlink/comrack/equivalent/dynamic 9 supply ,installation and testing of rack mounted 12 port liu loaded with pigtail, adaptor, patch cord etc. make:dlink/molex/digilink/amp 10 supply , installation, testing and commissioning of rack mounted 19 24 portcat 6 utp,1.5 1.6 mm crs chasis , powder coated modular patch panels with collapsible shutters on jacks to support latest amendments of tia / eia cat 6 specifications make:dlink/amp/molex/digilink 11 supply , drawing and testing of cat 6 cable ,made ofcombination of pvc and ldpe jacket,can be used for outdoor installation, 4pair, 24 awg utp cat 6 cable as per latest ammendments of tia /eia 568 b.2 1 specifications. 12 supply , drawing and testing of outdoor 6 fibersinglemode [ 9 micron ] glass fiber optic cable as per latest ammendments of tia /eia 568b.3 , gr 409 core / ul listed nec 770 standards make:aksh/dlink/molex/equivalent 13 supply ,installation and testing of indoor 1 pair singlemode [ 9 micron ] glass fiber optic patch cords of three mtr length as per latest ammendments of tia /eia 568b.3 and iec 794 standard specifications including st ii / sc/lc/mt rj/pc connectors at both ends as per requirements.make:syrotech/molex/dcb/dlink 14 supply , drawing and testing of 3cx2.5 sqmm armored power cable make:finolex/rr kable/havelles 15 supply and installation of surveillance hdd 6tb make:seagate/wd/toshiba 16 supply installation and testing commissioningofups 3 kva with battery for 60 minute battery backup make:apc/numeric/emerson/microtek 17 supply installation testing and commissioning of 600va ups it should high endmicro controller based, wide input voltage range, short circuit and overloadprotection, over temperature protection, output frequency fixed at 50hz or canbe synchronized with input frequency, static bypass enable or disable, protectionfrom dc fan failure, 14 ah battery capacity, power backup 45min. make:apc/numeric/emerson/microtek 18 supply installation and testing of media converter 10/100/1000mbps make:dlink/techroute/syrotech ...

North Western Railway - Rajasthan

33153840 supply of data retrieving unit and card readerdata retrieving unit and card reader,data retrieving unit with preloaded operating system ,processor,intel core i5(7th generation or above) operating system microsoft window 10 home or above , ram 04 gb or above ,hard disc:1 tb hdd or above ,dvd/cd writer yes, connectivity lan and wi fi(inbuilt),display screen ; 15.6 inch, with rs232 port manadatory,warranty 03 year on site ,battery with adaptor ; lithuim polymer/lithuim ion battery in built with 02 or 03 hrs back up or above, additional ; portable carrying bag, weight ; below 3.5 kg make ; dell/hp/acer or similar reputed company , lexvan card reader (compact card reader) to lexvan part no. 200 e 2 ma 1005,pac certified item...

National Institution for Transforming India Aayog - Rajasthan

33148373 bids are invited for package no. 4 atal tinkering lab of niti aayog power supply and accessories and safety equipment ( q3 ) ( pac only ) total quantity : 1 glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb holders , electric wires, usb to bc jack cable etc...

Western Railway - Rajasthan

33110811 supply of pen drive system for data transferpen drive system for data transfer,pen drive system for data transfer in ds 322 axle tester usb adaptor model ds3usbad => limited...

Indian Army - Rajasthan

33074266 bids are invited for electric power board modular , usb hub 4 port , plug top 15 a , socket 15 a , zero watt bulb red yellow and green , electric on off switch , drill light 6mm press and fit , adaptor for strip light , hdmi to micro hdmi cable , class c type cable , power strip with 5 mtr cable , channel to fit lights , gixxer machine blade set of 5 , carry handle for model box , lock hindge , switch 5 amp vinay , socket 5 a vinay , plug top 5 a vinay , co axial cable connector , plastic box for power board 3 switch and 3 socket , flexible cable , tubelight ww 2 ft , tube light ww 4 ft , wire stripper and cutter, hole saw set , spot light 5 watt warm wite , adaptor forled light , strip light led warm white , wall light 2 ft , ledtube light 15w , led bulb 9w ww , led bulb 10w , bulbholder , led bulb 5w osram , drill bulb 6mm , drill bulb8mm , wall light 1 ft , led bulb 3 w bajaj , bulb 100w , ledbulb surya 7w total quantity : 1156...

North Western Railway - Rajasthan

32947406 supply of sevoflurane liquid 250ml. bottle with quick fill adaptorsevoflurane liquid 250ml. bottle with quick fill adaptor,sevoflurane liquid 250ml. bottle with quick fill adaptor ajmer divisional rajasthan 15.00 numbers => limited...

Indian Army - Rajasthan

32947298 bids are invited for cd rom 700 mb, make original sony make accepted , d link switch 8 port base t ports make only d link branded ac dc power adaptor drywall anchors and screws 4 nos rubber feet , hp 77a black original laser jet toner cartridge make original hp make accepted only duplicate not acceptedasper sample , toner cartridge sharp ar 6026 ar 6023 nvmake original make sharp only accepted duplicate notaccepted as per sample , cd mailer as per sample paperquality good total quantity : 69...

Indian Army - Rajasthan

32925552 bids are invited for rope light , strips , adaptor , rope light blue , wire flexible , focus light , switch board , lari , services cable , switch board 16 amp , hdmi cable 20mtr , vga splitter , hdmi cable 5 mtr , jointer , hdmi cable 30 mtr , hdmi ultrau port cable 30 mtr , trolley , motor , remote , pully , rop ,wheel total quantity : 106...

Medical College - Rajasthan

32916910 supply of cardiothoresic hcitit prinvi? 1 lohexol for vascular procedures 350 x 50 ml in plastic polypropylene bottle. 2 lohexol for vascular procedures 350 x 100 ml in plastic polypropylene bottle. 3 lohexol for vascular procedures 350 x 200 ml in plastic polypropy’ene bottle. 4 lohexol for vascular procedures 350 x 5oo ml in plastic polypropylene bottle. 5 lodixanol vascular procedure 320 x 1oo ml in plastic polypropylene bottle. 6 syringe for pressure injector compatible with imaxon injector zy6322 7 syringe for pressure injector compatible with imaxon injector art 700 8 v adoptor for pressure injector compatible with imaxon injector 9 pnumbra catheter for thrombosuction compatible to pnumbra machine cat6 10 pnunbrn catneter fnr thronhosuctinn clntting canpatible tn pnunbra machine cat8 11 seprntor for thrnmhosuction clntting compatible nn cat 6 catheter and pnumbra macnine 12 seprntnr fnr thrombosuctinn clntting compatible to cat 8 catheter and pnunbrn machine 13 canister fnr tnronhosuctinn dnting exudate rompatible to pnumbrn nachine 10o0 ml 14 tubing for thrombosuction clotting compatible to pnumbra machine ____ ___ pur catheter 166 length 15 and 20cm with guide wire 0.9x40omm introducing needle 16 drug delivery system 2.45% activated glutaraldehyde with a powder activator, 51ok cleared and effective against human corona virus. it should be endorsed by minimum five mdms: karl storz pentax, 2.45% activated glutaraldehyde with a powder activator, 51ok cleared and effective against human corona virus. it should be endorsed by minimum five moms: xarl storz, pentax, 17 stryker, richard wolf, philips for their rigid & flexible telescopes, fiber optic cables, tee probes . should have disinfectant manufacturer compatible tray made of glass filled polypropylene which can be steam sterilized. should also have test strip which consists of _____ sodium sulfite and dyes impregnated and dried on filter paper. pack size= 5 litre jar solution containing benzotriazole, n (hydroxyethyl) ethylened iaminetriacetic acid (lhiedta),dipotassium hydrogen phosphate, potassium dihydrogen phosphate and 0.s5% 18 w/v opas. 510k cleared and effective against human corona virus and cytomegalo viruss. it should be endorsed by minimum five mdms: karl storz, pentax, stryker, richard wolf. olympus for their rigid & flexible telescopes, fiber optic cables, . also should be endorsed by aer manufacturers.should also have test strip which consists of sodium sulfite and dyes impregnated and dried on filter paper . pack size= 5 litre 19 effervescent 50% troclosene sodium tablet 5g each tablet. pack size so tab/bt. 20 trays trays made of glass filled polypropylene which can be steam sterilize and ce approved for disinfection. 21 dacron graft v 6x12 22 dacron graft v 7x14 23 dacron graft st 6x20/30 24 dacron graft st 6x40/60 25 dacrongraftst 6x70 26 dacron graft st 7x20/30 26 28 dacron graft st 7x20/30 dacron graft st 7x70 25 dacrongraftst 6x70 27 dacron graft st 7x40/60 29 dacron graft st 8x40/60 30 ptfe graft 6x20 31 ptfe graft 6x65/50 32 ptfe graft 6x75/80 33 ptfe graft 4x40 34 ptfe graft 5x20 35 ptfe graft 7x40/80 36 ptfe graft 8x40/50 iabp balloon compatible to maquet machine cardiac stablizer mics . platipus picco catheter continious cardiac output moniter catheter with injector housing 3 fr x 7 cm 37 38 39 40 41 picco catheter continious cardiac output moniter catheter with injector housing 4 fr x 8 cm 42 picco catheter continious cardiac output moniter catheter with injector housing s fr x 20 43 embolactomy catheter 44 ptfe felt 45 femoral arterial canula 46 venous arterial canula 47 ptfe bifergated graft lineaar cuttur stapler 60 mms. universal instrument 2 rows on both cut line side with b form staple technology —:—.—ii .. l— 49 linear cutter reload for medium tissue, no of staples 84, open staple height 3.8mm, formed closed stapple height 1.5mm blue, cut line 60mm, staple line 63 mm ,compatible with linear cutter reload for thick tissue, staples 84, open staple height 4.8mm, formed closed stapple height 2.0mm green, cut line 6omm, staple line 63 mm, compatible with linear cutter 6omm universal instrument 2 rows on both cut line side with b form staple technology 51 disposable curved cutter stapler open leg length 40mm, formed closed staple height 2.0 mm blue or green 52 single use circular stapler outer dianeter 25mm. inner i)iancter 17mm. no of staples 22. open height 4.8mm. formed heiwht 2.0 mm single uuse circular stapler outer diameter 29mm, inner diameter 21 mm, no of staples 26. open height 4.8 mm. formed height 2.0mm single use circular stapler outer i)iameter 3 1mm. inner i)iameter 23mm. no of staples 28. open height 5.0 mm. fommed height 2.2 mm single use circular stapler outer diameter 33mm. inner diameter 25mm. no of staples 32. open height 5.2 mm. formed height 2.2 mm 56 i’ransducer open surger> (multi uwe without counter limitation.) 57 transducer thorocoscopic (multi use sithout counter limitation.) probe 6 mm hand activated cuning & coagulating shears ith 360 degrees or shaft rotation. eapable or sealing blood esscls up to 5mm in dianeter srith 36cm shaft length. (‘ompatible ith existing rr generators .ultrasonic generator and transducer (multi use ithout counter limitation.) s ha.s.s.u,n. i probe 9 cm shaft. curked tapered tip for precise dissection. seals 5 mm uiiessels, as yell as 59 lymphatic .360 degpee or shaft rotation, triggprs support multiple hand poshons. compatible yith ultrasonie generator and transducer for (multi use without counter lirmnitationl)? probe 17cm shaft, curved, tapered tip fbr precise dissection, seals 5 mm vessels, as well as lymphatic. 360 degree of shaft rotation, triggers support multiple hand positions. compatible with ultrasonic generator and transducer (multi use without counter limitation.) 61 probe with bipolar 6mm hand activated (‘urved cutting &coagulating shears with 360 deyrees or shaft rotation, capable of sealing blood vessels up to 5mm in diameter with 23 cm shaft length . compatible ith existing rf generators & ultrasonie generator and transducer (multi use without counter limitation.) which can be used as both ultrasonic & bipolar laparoscopic shears. 62 virofil smoke.plume and pathogen filter with universal luer lock + 3 luer caps 63 nova 5 mm. 5 i0mm.5 12 mms. bladeless trocar w/ vifwfindf.r 100mm with virohl pathogen filter cartidge small titanium red trans erac grooves heart shawe wire usfda cartdige of 6 clip 65 cartidge small titanium trans erac grooves heart shape wire usfda cartdige or 6 clip 66 cartidge medium titanium trans verac grooves heart shape wire usfda cartdige of 6 clip 67 cartidge medium large titanium tmans vernc grooves heart shape wire usfda caridige of 6 clip 68 cartidge large titanium trans verac grooves heeart shape wire usfda cartdige or 6 clip u 74 undyed. braided coated short term poly (glycolide co l lactide) (polyglactin 91o) 1/2 circle taper cut, usp size 2 0 .suture length 90cm . needle length 36 mm 75 undyed. braided coated short term poly (glvcolide co l lactidc)(polyglactin 91o) 1/2 circle round bodied. 1/2 circle reverse cutting double armed. usp site 2 0 suture length 140cm . needle length 40 mm 76 pok ester 1 77 pok ester 2 78 79 80 pol ester 5 indoscopic linear cutter stapler 60 mm short shaft (open+thoracic) endoscopic linear cutter stapler 160mm standard shaft (regular i.aparoscop 69 polymer ligation clip with locking machanism. cover 3mm to 16mm vessels. medium large class 3 for ce 70 pokmer ligation clip with locking machanism. cover 3mm to 16mm vessels. larye class 3 for ce 71 polymer ligation clip with locking machanisn. cover 3mm to 16mm vessels. extra large class 3 for ce 72 poliglecaprone 25) usp site 3 0 .suture lenght 70cm , needle length 25 mm . 3/8 circle reverse cutting 73 monolilament poly (p dioeanone) (mni directional with end loop barbed suture. violet 1/2 circle taper point , usp site 2 0 ,suture length 30cm . needle length 37 mm 81 eadoscopic lmnear cotier stapler 260mn eatra long shaft? nn.ui imiici 1ywjmlfhlfnmin.jt i 80 endoscopie linear cutter stapler 160mn standard shaft (regular laparoscopy) 81 endoscopic linear cutter stapler 260mm lxtra long shaft 82 reload 45 mm white & blue endoscopic linear cutter articulating reload for vascular tissue. staple height 2.5mm. 3.5 mm 83 reload 60 mm white & blue endoscopic linear cutter articulating for vascular tissue. saple height 2.5mm. 3.5 mm reload 60 mm gold endoscopic linear cutter articulating for medium thick tissue. . _______ staple height 4.1mm 8s reload 60 mm green eadoscopie linear cutter articulutine for thick tissue. stapie _________ [leight 4.8mm 86 reload 60 em green endoscopie linear cutter articulating for extra thick tissue. _________ staple height 5.0mm pre fitted ith polyester sutures : visual mark printed on polyester for easy mesh centring. 87 honebcomb knitted structune for superior tissue integrntion and patient comfort. dual side mesh with composition of polyester with polyurethane. mesh came with circular sites also 12cm and 15cm circular. si,esc61 lcm.7.695cm.10 15cmj5 l5cm,l520cm? 88 central 4 lumen catheter 89 [ran sperent dressings tegaderm 90 talc powder for pleurodesiss ____._____ 91 multi hole multipurpouse catheter for throniholysis ________.__ 92 skin stapler 93 vascular stapler 94 bronceal stapler bovine pericardial bioprosthesis for the aortic position. fda and european ce. the leaflets (made from a single strip of pericardium) are externally mounted over a titanium stent and this allows complete opening of the leaflets and aids in proper coaptation. pericardial cover 9s on the stent helps in mitigating the tissue abrasion with tissue to tissue contact. a propriety fixation procedure aids in proper leaflet shaping for proper leaflet coaptation. presence of — — . : — — — .. — p.’’ p.’ j. i.. • ‘. ‘ r ‘.j limt i. t.j v t 9s on the stent helps in mitigating the tissue abrasion with tissue to tissue contact. a propriety fixation procedure aids in proper leaflet shaping for proper leaflet coaptation. presence of linx anticalcification treatment resists tissue calcification and degradation of the valve it is available in sizes 19mm, 2lmm,23mm,25mm27mm and 29mm. tissue heart valve . biological tissue heart valves for mitral and aortic heart position available in sizes 19 33mm. design: triple composite porcine valves. valves have patented anti calcification treatment ( linx ac technology). lowest profile 9mm (lowest in the market). sewing ring is made of polyester with markers for helping in suturing. suture friendly cuff minimizes suture drag & parachuting forces. fixation method: low pressure glutaridehyde fixation . flexfit stent to reduce leaflet stress.the flexfit system reduces the rinse time to 2x10 seconds. mitral ratcheting system facilitates insertion into the mitral annulus and avoids suture looping. scalloped inflow surface optimizes valve seating. usfda approved.________ ‘4 (re8ent flex cuff) aortic mechanical heart valve mechanical heart valve for aortic position. individually sterilized and ready for use in individual patients. expiration date: five years from the date of manufacturing. bileaflet and rotatable. supra annular placement. low profile.maximum protrusion of leaflets from the housing is 3.4mm. minimizes need for root enlargement. up to 84% orifice to annulus ratio. single digit pressure gradients. opening angle of 85 degrees. significantly larger eoas than other 97 mechanical heart valves. significant reduction in lv mass.disc: pyrolytic carbon/graphite substrate. housing: pyrolytic carbon/titanlum with pyrolytic carbon coating. sewing ring: made from polyester with markers for helping in suturing. the flex cuff is flanged and more pliable than the standard cuff. patented butterfly upstream pivot design that lowers thrombogenicity, results in larger opening angles for improved laminar flow and a reduction in turbulence .radio opaque for improved visualization during x ray and fluoroscopy. the valve is mri conditional. controlled torque rotation mechanism . available _____ in sizes 17 mm to 29mms. u.s fda approved and ce approved. bileaflet aortic with conduit double velour woven fabric offers excellent sealing handling and healing characteristics collagen impregnation provides uniform tissue in growth and biocompatibility. rotatable valve attached allows for upstream placement of leaflets 98 resulting in a wide opening anwle .enhanced cuff configuration offers excellent implantability ,conforms to the annulusdesigned to minimize potential for paravalvular leak. low porosity graft eliminates the need for pre clotting and reduces surgical tume.no pleats allows for easy posltioning and attachment of coronaries.available in sizes: 19mm to 33 mm .us. fda approved. — — ‘ rines rieid repair solutions available in rieid forms. the rigid ring is a fuul 3o ring which creates natural saddle shape.the ring hes a complete titanium alloy core.mimics healthy hitral anatomy and provides fuul remodeling which reduces stress. the ring helps in 9e redistributing leaflet stress and chordal tension and increases nepair durnbility. encourages tissue in growth through use of double velour polyester cuif. facilitates in suturing with the ez suture ruff supported by a unique triangular core. available in sizes 22mm to 34mm. usfda phricardiul patch: indicated for cardiac and great vessel reconstructioe and reeair ane pericardial caosure. 2. designed .hould be for ease of use, soft, pliabie tissue conforms to uneven surfaces and minimizes suture hole leaks for more reliable repairs. 3. should ha.el encaet%4 .echnology, reduces adhesions ennbling easier re access and structure 100 identification 4. should have encaptm anti cancification technology to minimize calcification and promote host endothelial izat ion resulting in a more biocompatible material. 5. should be rlutaraldegy and encaptm rechnology treated, bovine .ericardjuni rnsists shrinkage and aneurysm formaliofl._...potefltjaljy reducing the chance of re opera, iori.6 shoulo be rinse less preparation ready to use. thinner patch to accomm(jate pediatric 8. available si,rs should be: 2x5, sxio, 9x14, 4x5 pericardiul pntch: indicated for cardiac and great vessel reconstruetiun and repair and pericardjal closure. 2. designed .hould be for ease of use, soft, pliable tissue nonforms to une.en surfaces and minimizes suturs hole leaks for more reliuble repairs. 3. should ha.e encaetm technolos. reduces adhesions ennbling easier re access and .tructure identification. 4. should hacc encaetm anti caicifica, ion nechnology to minimiize calcification and pnomote host endotheliali,ation resulting in a more hiocompatible material 5. should be glutaraidehy and i nuaptm technology treated, bovine pericardium resists shrinkage and aneurysm formation:_potentjaii reducing the chance of re oper2jiofl should be rinse less preparation, ready to use. thinner pateh to rccommoja pediatric applications 8. a.nijnbie should be: 2x5, 5x10, 9x14, 4x5 ofltigra zj” ‘ascula, mimetic implant ( sspera). for distal sf4, poplitsl& acro jelfts •018 njtjnog iflten4o,en design 4—7mm diameter various lengthsupto 200rnm renal baeloon expandaele stern ( ilerculirik elite) rx .014 compatible cobalt chsomsium 3j multj. hink dgsign .5 f compatible across all size5 65 & 7 in length 12, 15 & 18 mmfllsfda iperipheral balloon expandable stent system ( omnilink elite).otw .035 guide wire compatible. 6f sheath compatible across all sizes ( 7mm to 10 mm dia). l 605 cobalt chromium multi link stent design. thin struts lonest cnmped profile. [)ual layer, five fold balloon. usfda 105 self expanding nitinol stent for carotid angioplasty assorted sizes (x.act). rx tapered closed cell design with flared ends. 6f sheath compatible across all sizes. freestyle technology. usfda 106 selr expanding nitinol stent for peripheral angioplasty assorted sizes. absolute pro & absolute pro ll). 035 otw 6f sheath compatible across all sizes. 135mm usable catheter length for all sizes. triaxial delivery system with i beam technology to ensure accurate stent placement. usfda 107 vascular closure device. ( perclose proglide). 5 22f polypropylene monofilament suture mediated vessel closure. with no re access restriction. immediate re access advantage. flexibility to pre close and close over the wire. for small hole and large hole closure both. usfda o35 peripheral angioplasty balloon ( armada 35). crossflex dual layer balloon technology. otw .035 guide wire compatible. 5f 7r sheath compatible to 12mm 14mm diameter faster deflation. usable catheter length 135cm for all sizesdia 4mm to 14mm up to 250mm length. usfda ii5lji. l.ar ijp? peripheral (‘to guide wire. . 014 with various tip load stiffness from 4.8 13.0 mg.. [)urastecl core material. transitionless core taper. exposcd shapable tip coils. wire lengths of 190cm and 300 cm. 109 014 peripheral angioplast balloon ( armada 14). crossfle l)ual layer balloon technology. otw 014 guide ire compatible. 4f sheath compatible for dia 1.5 to $ mm length upto 200mm. usable catheter length 150cm for all sizes:.. usfda 110 .018 peripheral angioplastv balloon ( armada 18). crossflex dual layer balloon technology. otw 018 guide wire compatible. sf sheath compatible to diameters from 2mm to 5.s mn. usable catheter length 135cm for all sizes .usfda carotid angioplasty balloon ( viatrac 14 plus). rx 014 carotid balloon. 014 guide ire compatible. 5f sheath compatible to 4 to 7 mm diameter with 20mm length avnilable in half sizes of diameter 4.5 & 5.5. tjsable catheter length 135em for all sizes .usfl)a 112 distal embolic protection device ( emboshield nav6). one size for all carotids. filter should be independent of yb ire . rx .014 6f sheath compatible. 190cm bare wbire %4orkhorsc ybire preloaded deiivcr catheteruniform micro pore size of 120 nicron pore site ith 1mm pore free tone. non thrombogenic nylon membrane ith hydrophilic coatiny. ljsfda 113 clip based closure device ( star close). 5 8 f nitinol clip based esscl closure device. with no re . access restriction. usfda 114 035 extrn support type guidewbire. supportive .035 wbire yb ith soft atraumatic tip. 1:1 torque response provides exceptional steering. hydrophobie coating to reduce friction. wire lengths of 190 cm. and 300cm 115 ._..e__ . _..... o.f. 116 018 stainless support guide wire. various tip length 3cm / 5cm with shapeable straight &j tip.supportive stainless steel shaft for excellent tactile feedback. 1:1 torque for navigation around vessel bends. 117 014 hybrid peripheral guide wire. distal nitinol tip and proximal stainless steel. tip load 2.8 & 3.5g. hydrophilic coating and radiopaque polymer cover. 1:1 torque for navigation around vessel bends. wire lengths of 190 cm and 300 cm. /r7 0)8 hybrid peripheral guide wires. distal nitinol tip and proximal stainless steel. tip load 118 4g. flydrophilic coating and radiopaque polymer cover. mailuble in short taper and long taper both types of fips. transition less weld between nitinol and steel part. 1:1 torque for navgation around vessel bends. wire lengths of 190 cm and 300 cm 119 peripheral vascular plug ( amplatier avp ii). multi layered, multiple lobed nitinol mesh design for rapid emboliiation within the vessel4. to emboli,e medium and high fkw vessels. guide catheter or sheath i)eli.erable: compatible with 4 7 f sheaths. or 5 9 f gudc catheters depending on device size 120 bioprosthetic heart valve. triple composite bovine pericardium with e igiloy/alloy frame stent. should have polymer support ring inside the polyester knit fabric for stent posts covering. should have anti calcification treatment done. should have tenting system for avoiding suture looping in mitral xosition. only latest version is acceptable. should have sizes for aortic position from 19 to 25mm and for mitral position from 25 to 3lmm.dgci/ce approved 121 disposable bladeless trocar with bird wing tip design, 5mm in diameter, 95mm standard sleeve length. self adjusting & detachable secondary seal which can accommodate instruments diameter upto 5mm 122 disposable bladeless trocar with bird wing tip design, 10mm in diameter, 95mm standard sleeve length, self adjusting & detachable secondary seal which can accommodate instruments diameter_ranging.from 5mm to 10mm 123 oisposable bladeless trocar with bird wing tip design & optdcal entry reature, 12mm in diameter, 95mm standard sleeve length, self adjusting & detachable secondary seal which can accommodate instruments diameter ranging from 5mm to 12mm 124 disposable bladeless trocar with bird wing tip design, 15mm in diameter, 110mm standard sleeve length, self adjusting & detachable secondary seal which can accommodate instruments diameter ranging from 5mm to 15mm 125 ultrasonic scalpel for cutting and coagulating, 36 cm shaft length, s mm diameter double layer non stick (teflon) coating pad on jaw. 14cm? 23cm/ 36cm/ 45cm 126 radial arterial cannula with built in sliding lock system sizes 2o 1 127 retrograde cannula catheter self inflating smooth ballon with pre shaped stylet and handle 14fr. overall length should approx 27cm & should have 18 2mm sized smooth balloon. should be fda approved 128 aortic perfusion cannulae: wire reinforced dispersion tip sizes: 2lfr and 24fr overall length approx. 35cm and vent should be us fda approved 129 p.a. catheter with 3, lumens & color coding for each lumen. should be able to means p.a. pressure flow directed insertion & should be supplied with all accessorises. like guid wire op sheath etc. bulb near end hole. should be us fda approved 130 flo trac sensor to measure contionuous cardiac output monitoring (to be compatible with vigileo/ev 10oo cardiac output monitoring machine) should be us fda approved 131 arterial transducer for measuring invasive blood pressure and cvp. should be us fda approved 132 disposable yellow bulldog clamp small size of 1 2 cm with metallic spring good occluding capacity. should be us fda approved 133 proximal aortic anastomosis device it should provide the surgeon with a stable, blood field. it allows for up to three anastomosis form one insertion site. it eliminates the need for partial occlusion clamping during coronary artery bypass grafting. size 3.smm/4.omm/4.smm 134 sternum and ribs lock plate should be available in different sizes and shapes to be supplied with applier (gun) sample based selection. should be us fda approved 135 sternum and ribs lock plate 2.4mm and 2.7mm dimaeter cancellous self drilling locking with applier. should be available in different sizes sample based selection. should be us fda approved 136 ultra high pressure non compilant pta dilation balloon catheter high performance balloon.non complaint,multilayer balloon with coaxial shaft and working pressure range of upto 12atm, highest rated burst pressure of 18 atm sizes: diameter (12mm to 26 mm) & lengths (2cm & 4cm ) with shaft lengths of 75and 12ocms. 137 retrieval ivc rilter (window period 3o0 day) clinically tested in largest longest ide filter demonstrated safely implanted to provide immediate protection againts pe,optional ivc filter, two levels of filtration with the legs aproviding the lower level of filtration and the arms providing and the arms providing the upper level of filtration, highly visible snare tip seamlessly welded to the body for easy filter retrieval even after long in dwell time. the upper level of filtration self expandable (electro polished ) with radiopic markers the stent fimnlant i shnu1d self expandable electro polished with radiopic markers , self expending and popliteal nitinol stent with unique triple helix design structure ultra high pressure non complaint ballon ballon expandable vascular covered stent , dru coated ballon , pta dilatation catheter semi comliant consisting of an over the wire pta dilatation catheter semi compliant hydrophyclic balloon cathater consisting of an our the wire (otw) it should for use in percutaneous transluminal angioplasty (pta) of the 144 renal, popliteal, tibial femoral and peroneal arteries. to facilitate catheter advancement througs the vasculature and the viessal stenosis, dual layer hydrophlic coating should present on the distal segment of the shaft and the balloon. dual sheath 9fr and, ideal for ivc filter rectrieval dual sheath 9fr and 1lfr ideal for denali retreval kink resistant nitinol construction with radiopaque loop for enhanced 145 visibility 90’ loon snare for proper diacement with precise 1:ltoegue facilitates filter easy percutaneous translumiflal nalvuloplasty of the pulmonary valve it should for percutaneous transluminal valvuloplasty of the pulmonary valve in the following patient with isolated pulmonary valve stenosis a patient with valvular pulmonary stenosis with other minor congenital heart disease that dose not require surgical intervention the proprietay non compliant low profile balloon is designed to provide consistent balloon diameters and length ecen at high pressure. ulna high pressure non complaint balloon it should for use in precutafleous transluninal angioplasty of the peripheral vasculature including the ilac arteries and ilac femoral veins 147 and for the treatment of obstructive lesions or synthetic arterioveflous dialysis fistulae a high performance balloon catheter consisting od an over thewire with a balloon fixed at the distul tip the proorietary noncompliant low profile balloon is designed to provide conwistent balloon dnameters and lengths even at high pressure 1 ultra high pressure large volume inflation device , flexible self expanding prosthesis comorising of dual layer eptef encaesulution with carbon impregnation flexible self expanding prosthesis compriwing of dual layer eptef encapsuuation with carbon nmpregnation on luninal surface to reduce intinal hyperplasia. the inner lunen of covered stent (blood contacting surfnce) is carbon impregnated. the 149 highly and fracture rasistant base stent architecture for tortous vessel like cephadie arch nnd sfa. the stent is availbie in straight and flured configurations avilable from variety sizes for avf and iliac /sfa indication diameter (6 10mm). safety lock system on delivery system prevents premature release and two wheel deployment to ensure accurate placement of stent at the lesion site. no stent migration high performance rossing catheter high performance catheter platfrom desigend to be first line aid to cross stenotic lesions and standard wires fail.radiopaque marking system, lcmradiopaque apartwityh doble markers dilenate 1o cm and 2o cm in 014” , 018 .035 chronic occlusions when markers positioned 1 cm self expanding nltinol stent it should self expanding nitlonal stent is fda approved for self expandable cover stent graft, dual layer eptfe it should vascular stent graft is used in residual stenoss with impaired perfusion following balloon dilation especially in stages lll & iv according to fontaine dissection; detached arteriosclerotic plaque material luminal obstruction following balloon dilatation occlusion after thrombolysis or after aspiration or dilatation restenosis or re occlusion proven dual layer eptfr encapsulation demonstrated a significant reduction at 90 day in the incidence of in stent restenosis compared to pta proprietary bioactive carbon impregnation designed to reduce early stage platelet adhesion flexible implant that demonstrated kink resistance placement in tortuos lesions presenting with in stent restenosis or non stented in patients 153 mutticonnecting tube with 150 cm tube for connecting to the patient end, 2 nos 100cm connecting tube with drip chamber to connect to the contrast and saline bottles/pack and 2 connectors for connecting the 2 syringes in the dual head injector system. 154 custom made pressure garment below knee stockings pair. 155 custom made pressure garment full knee stockings pair. 156 m m____n custom made pressure garment fore arm 157 custom made pressure garment full arm 158 custom made pressure garment fore arm with guantlet 159 custom made pressure garment full arm with guantlet 152 160 tepaderm chg clnrhetedine (thirnnst iv rtirdmisnt nfrscciria 1t7dc — — — — —.— — .o. ..... . — — . . — —s— —n. — .r, • • •e• v.t v vjmiii — i i i i nr... i i i 16o tegaderm chg clorhexedine gluconate iv securement dressing 16s7r 161 tegaderm chg clorhexedine gluconate iv sexurement dressing 1660r 162 sterile collagen sheets in wet & meshed form. pure type 1&3 triple helical membrane bovine origin preserved in a mixture of iso propyl alcohol and water gamma sterilized and ________ supplied in double sterile pouches. biocompatible as per iso 90o1/ iso13485 n lox 10 163 sterile collagen sheets in wet & meshed form. pure type 1&3 triple helical membrane bovine origin presenved in a mixture of so propyl alcohol and water gamma sterilized and ________ supplied in double sterile pouches. biocompatible as per iso 9001/1s013485 n loxlo sterile coliagen sheets in dmy form. pure type 1&3 triple helical membrane bovine origin 164 gamma sterilized and supplied in double sterile pouches. biocompatible as per iso 9o01/ _______ lso13485n 1oxlo sterile collagen sheets in dry form. pure type 1&3 triple helical membrane bovine origin 1ss gamma sterilized and supplied in double sterile pouches. biocompatible as per iso 9o01/ ________ 15o13485 n 10x2o 166 sterile porus collagen sheet in dry form (fish origin) lox 10 cm 167 sterile porus collagen sheet in dry form (fish origin) 8h x 12” silicone sheet pure poly siloxane based silicone scar management product in sheet form. _______ 1oxlo 169 biofil ab sterils medicated collegan particles s ml 170 biofil ab sterils medicated collegan particles 10 ml lipido colloid contact layer impregnated with silver salts urgotul ag silver sterile non 171 occulusive wound contact layer consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid particles| cmc) ,petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity _________ upto 7 days, using patented lapido colloid technology lox 12 lipido colloid contact layer impregnated with silver salts urgotul ag silver sterile non 172 occulusive wound contact layer consists of sulver healing matrix made of polyester mesh impregnated with hydrocolloid particles( cmc) ,petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity ______ upto 7 days, using patented lipido colloid technology 15x20 lipido colloid foam dressing with adhesive border urgotul sterile self adherent patented tlc matrix (lipido colloid technology) wound contact layer combined with absorbent 173 polyurethane foam pad , a superabsorbent layer ,a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and ______ repositioning of dressing. 13x13 lipidocolloid foam dressing with adhesive border urgotul sterile self adherent patented tic matrix (lipido colloid technology) wound contact layer combined with absorbent 174 polyurethane foam pad, a superabsorbent layer ,a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. 15x20 175 lipido colloid foam dressing with adhesive border urgotul sterile self adherent patented tlc matrix (lipido colloid technology) wound contact layer combined with absorbent polyurethane foam pad, a superabsorbent layer ,a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. 20x20 176 cabg kit off pump (annexure 1) 177 single valve surgery kit (annexure 2) 178 asd/vsd kit (annexure3) — e.e r— ‘.o... n.e. ——..—— i 179 dry suction wet seal with air flow capacity of i6lpm. should maintain suction level of ( 1o)( 43) c.m.should have single chamber with capacity of 2soml. 180 iabp ballon 30cc/3scc/4occ with 8fr sheath. 181 ptfagraftlog9ocm decrongratf88ocm .—r fibrillar oxdised regenerated cellulose 4r8 —_______________________ oxdised regenerated cellulose 2 14u 182 183 184 185 186 antibactirial coated polyglactine 910,2 0,70cm for port closure 187 ptfe patches 1o790mm, 0.2mm thickness 188 ptfe patches 10 90mm, 0.4mm thickness 189 needleless 2 way connector with 12cm extension burette iv set measured volume fluid administration set with bacteria retentive air inlet 191 triple pressure monitoring kit with option of closed loop blood sampling kit including needleless sampling site 192 pur central venous catheter triple lumen 7fr ,l3cm & 16cm length and nitonel guidewire with anti blood flow connector on introducer needle. 193 pur central venous catheter four lumen 8.sfr ,l3cm length and nitonel guidewire with anti blood flow connector on introducer needle. 194 central venous catheter set single lumen 24g with nitonel guidewire 195 cardioplegia fusion adapter—o— a.pi5r •uiiniei p &w•a wilpni ipplij(tei kuiuewire 195 cardioplegia fusion adapter 196 pur hd catheter kit double lumen 11.5fr 13cm with 9fr x 10cm dialator 197 rifampcin and miconazole impregnated triple lumen polyurethane catheter0 1 _______ 16cm, 7.5 fr, g 14 1818n . e line peeieer trieee lumen poiyereteane catheeer tb eoeble eeeee oee canflula aed one needle, ee5 fr, 6 cm, g2o 23’23 198 radial wter%al cathet with guiis wire • should have pe materiar to prevent dampflul8 • shou’d have anti inkiflg coller to prevent iflkiflg of catheter 199 • 20 g18 aed 18g/10 cm pe catheter wiih introducer needle and guidew polyurethane semorag arterial catheeer with guide were, without integral eeelft0flto 3veidt 200 ampinlg., 16g. 15cm 201 sileer ios pregflated eenteel vaeeee cathetee triple lumee 7.5 tr_l6crfl/a0ce pur xro cathiter 20cm with 22g 5singer teeeniwue with 5traigha guidewire with a hlexible tip and rne o so cm drape 202 _e__ _____ pur xso aatheter 20cm wits 22g 5eidngei techsliwue wits straight auide wire with a flexible?? tip? andn?? one 50r50 cm drape 203 _._r.____________________ ____m______ :disposabie curved circular stapleral sizes with thrie circular staggeied staple ies ( 3 204 ows) and optireied staple feematioi’ chnique, tissue compressbofl indicator, open 5taple leg length of 4.5mm which can accomm0at compressed tissue thlckres5 from 1.0 2.5mm bis /4 diwit european ce ceetified powered endoscopic lnear cutter blue reload 45mm ving six row of staple line, round 205 staple wir. with the open staple hright of 3.5mm and closed staple height of 1.5mm bis /4 digit eurowean ce certified ci, ro.v of staple line. 20s staple wire with the open staple height ot s.)rtefl • digit european ce certified rowered endoscopic linear cutter green reload 45mm having six row of stiple line, j 206 round staple wire with the open staple height of 4.1mm and closed staple height of l 2mm bis 1 4 digit european re certified powered endoscopic iinear cutmer white reload 4amm having six row of stapie linc, 207 round staple wire wath the open staple height of 2.5mm and closed staele heieht of 1mm bis 1 4 digit europenn ce certified ponered endoscopic linear cotter blre reload 60mm having six row of staple line, round 2a8 staple wire wath the open staele height of 3.5mm and closed staple heiwht of 1.5mm bis /4 digit european ce certified 209 powered endoscopic linear cutter gold reload 60mm having staple wire with the open staple height of 3.8mm and closed staple height of 1.8mm bis /4 digit european ce certified six of staple line, 210 powered endoscopic linear cutter green reload having row round staple wire witb the open staple height of 4.1mm and clostd staple height of 2mm six of line, 211 powered endoscopic linear cutter white reload 60mm having row round staple wire witb the open staple height of 2.5mm and closed staple height of 1 mm bis j 4 digit furopean ce certified 212 powered endoscopic linear cutter 45mm with 60 degree articulation on both side, having safety button to prevent accidental firing, with manual override spanner, stepped anvil for compression, 360 degree rotating shaft and having 280mm shaft length bis /4 digit european ce certified turopean ..ertrneg powered endoscopic linear cutter 60mm with 60 degree articulation on both side, having 213 safety button to pnevent accidental firing, with manual override spanner, stepped anvil for compression, 360 degree rotating shaft and having 280mm shaft length bis /4 digit european ce certified disp. circular stapler non detachable anvil varient row 3 external diameter 34/32 mm no of rows 3 214 staple quality 48 closed staple hight 0.75 1.6 mm shaft length 14 cm kinfe diameter 23mm bis / 4 digit european c certitied 20 vent canula _____ 1 21 powder free gloves 5 sno. 1 asd/vsd kit oxygenato’r heprin coated qty. 2 custom tubing pack 3 cardioplegia delivery system 4 arterial flter 1 5 chest tube 3 6 cdbottle 1 7 acttube 6 cautry pencil 1 cautry plate urtometer lobart 1 steridrape 1 8 9 10 11 12 13 m_________a buretta 1 14 venoline 2 15 v conector 3 16 avtubing 2 17 arch canula 1 18 venous canula 2 19 chest binder 1 22 nspouch 2 . ._ . __. i? 23 plegiogard 3 24 phempress 2 25 protamin 3 26 purge line 1 27 scratch pad 1 28 hemostat 1 29 pledget foil 1 30 balance salt solution 3 31 root canula 1 32 hifg pressure line 200 cm 3 33 level sensor 1 34 alkline activator 1 35 lap pad 7x7 25 36 under water seal drain 1 s.no single valve surgery kit qty. 1 oxygenator heprin coated 1 2 custom tubing pack 1 3 cardioplegia delivery system 1 4 arterial filter — chest tube 1 5 2 6 cdbottle acttube 1 7 6 8 cautry pencil cautry plate 1 9 1 10 unometer 1 11 loban 1 12 steridrape 1 13 buretta 1 14 bulb syringe 1 15 vein o line 2 16 —m s_____e v conector avtubing arch canula 3 17 2 18 1 19 venous canula 2 20 chest binder 1 21 sump 1 22 powder free gloves 5 l4 ruwuer iree gioves 23 ns pouch 2 24 plegiogard 3 25 phempress 2 26 high pressure tine 200 cm 3 27 purge line 1 28 multiple y adoptor 1 29 scrasatch pad 25x25 1 30 protamin 5 31 balance salt solution 3 32 pledget foil 1 33 level sensor 1 34 lap pad 7x7 25 35 root canula 1 _______ cabg off pump (anne*ure 1 1 chest tube ____ 2 act tube 3 cd bottle 4 cautry pencil s cautry plate _____._ 6 urometer 7 loban 8 respirometer 9 bureta set 10 vein o line 11 coronary shunt 12 yconector 13 avtubing 14 suction line 15 pledget foil 16 vessel canula 17 cardiac sump 18 powder free gloves 19 ns pouch 2o papavarin ____ 21 phempress 22 mister blower — — a . i i — 22 mister blower 1 23 o— buldog clamp yellow buldog 1 24 2 25 cardiotomy resorvior 1 26 chest binder 1 27 cardiotomy resorvior circuit 1 28 hemostat 1 29 aortic punch 2 30 scratch pad 25x25 1 31 protamin 5 32 lap pad 7x7 25 33 crusent knife 1 34 multiple y adaptor 3 35 balance salt solution (500ml) 2 36 pledget foil 2 37 lap pad 7x7cm 5 pkt 38 3 way adapter 2 etc ...

Medical Health And Family Welfare - Rajasthan

32913730 one year rate contract for supply of implants in ortho / dental unit in rbm hospital, bharatpur one year rate contract for supply of implants in ortho / dental unit in rbm hospital, bharatpur , arthoplasty , cruciate retainingtkr consisting of femoral component right / left with tibial component corresponding articulating surface with with one packet 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , cruciate retainingtkr consisting of femoral component size c / 3 right with tibial component corresponding articulating surface with with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cruciate retainingtkr consisting of femoral component size d / 4 left with tibial component corresponding articulating surface with with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cruciate retainingtkr consisting of femoral component size d / 4 right with tibial component corresponding articulating surface with with one packet 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cruciate retainingtkr consisting of femoral component size e / 5 left with tibial component corresponding articulating surface with with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cruciate retainingtkr consisting of femoral component size e / 5 right with tibial component corresponding articulating surface with with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cruciate retainingtkr consisting of femoral component size f / 6 left with tibial component corresponding articulating surface with with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cruciate retainingtkr consisting of femoral component size f / 6 right with tibial component corresponding articulating surface with with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cruciate retainingtkr consisting of femoral component size g / 7 left with tibial component corresponding articulating surface with with onepacket 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cruciate retainingtkr consisting of femoral component size g / 7 right with tibial component corresponding articulating surface with with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , postreior stablised tkr consisting of femoral component right / left with tibial component corresponding articulating surface & with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , postreior stablised tkr consisting of femoral component size c / 3 right with tibial component corresponding articulating surface & with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , postreior stablised tkr consisting of femoral component size d / 4 left with tibial component corresponding articulating surface & with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , postreior stablised tkr consisting of femoral component size d / 4 right with tibial component corresponding articulating surface & with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , postreior stablised tkr consisting of femoral component size e / 5 left with tibial component corresponding articulating surface & with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , postreior stablised tkr consisting of femoral component size e / 5 right with tibial component corresponding articulating surface & with one packet 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , postreior stablised tkr consisting of femoral component size f / 6 right with tibial component corresponding articulating surface & with one packet 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , postreior stablised tkr consisting of femoral component size f / 6 left with tibial component corresponding articulating surface & with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , postreior stablised tkr consisting of femoral component size g / 7 left with tibial component corresponding articulating surfacewith onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , postreior stablised tkr consisting of femoral component size g / 7 right with tibial component corresponding articulating surface & with one packet 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size c / 3 left with tibial component corresponding aarticulating surface with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size right / left with tibial component corresponding aarticulating surface with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , hi flex tkr consisting of femoral component size c / 3 right with tibial component corresponding aarticulating surface with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size d / 4 left with tibial component corresponding aarticulating surface with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size d / 4 right with tibial component corresponding aarticulating surface with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size e / 5 right with tibial component corresponding aarticulating surface with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size e / 5 left with tibial component corresponding aarticulating surface with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size f / 6 left with tibial component corresponding aarticulating surface with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size f / 6 right with tibial component corresponding aarticulating surface with onepacket 40 gm antibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size g / 7 left with tibial component corresponding aarticulating surface with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , hi flex tkr consisting of femoral component size g / 7 right with tibial component corresponding aarticulating surface with one packet 40 gmantibiotic bone cement, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist ofacetabulumshell with highly cross linked acetabulum liner, cocr head 32 mm with 3 screw and uncemented stem, implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , uncemented total hip replacement consist of 48mm acetabulumshell with highly cross linked acetabulum liner, cocr head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 50mm acetabulumshell with highly cross linked acetabulum liner, cocr head 32 mm with 3 screw and uncemented stem, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 52mm acetabulumshell with highly cross linked acetabulum liner, cocr head 32 mm with 3 screw and uncemented stem, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 54mm acetabulumshell with highly cross linked acetabulum liner, cocr head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 56mm acetabulumshell with highly cross linked acetabulum liner, cocr head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 58mm acetabulumshell with highly cross linked acetabulum liner, cocr head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 60mm acetabulumshell with highly cross linked acetabulum liner, cocr head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 62 mm acetabulumshell with highly cross linked acetabulum liner, cocr head 32 mm with 3 screws and uncemented stem, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , revision tkr system consisting of constraint condylar femoral component size c left with provison of stem extesion , constraint articulating surface, tibial tray with provision of stem extension one stem 11mmand two packet of high viscosity antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , revision tkr system consisting of constraint condylar femoral component size c right with provison of stem extesion , constraint articulating surface, tibial tray with provision of stem extension one stem 11mm and two packet of high viscosity antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , revision tkr system consisting of constraint condylar femoral component size d left with provison of stem extesion. constraint articulating surface, tibial tray with provision of stem extension 12 mm , one stemand two packet of high viscosity antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , revision tkr system consisting of constraint condylar femoral component size d right with provison of stem extesion , constraint articulating surface, tibial tray with provision of stem extension 12 mm , one stemand two packet of high viscosity bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cemented pe cup, highly polished cobalt chrome , triple taperd cemented femoral stem ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) with 2 pkt antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , cemented pe cup size 48mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 0 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) with 2 pkt antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cemented pe cup size 50mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 1 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) with 2 pkt antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cemented pe cup size 52mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 2 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) with 2 pkt antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , dual mobility uncemented hip replacement prosthesis ( complete set ) consisting of uncemented femoral stem ( 12 / 14 taper ) , uncemented acetabulum cup, crosslinked uhmwpe shell and metal head, implant should have registry follow up data / odep rating. usfda approved / eu ce certified, implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , dual mobility uncemented hip replacement prosthesis ( complete set ) consisting of uncemented femoral stem ( 12 / 14 taper ) , uncemented acetabulum cup, crosslinked uhmwpe shell and metal head with 3 ( 6.5mm screw ) for cup, implant should have registry follow up data / odep rating. usfda approved / eu ce certified, implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , cemented pe cup size 56mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 4 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) with 2 pkt antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cemented pe cup size 58mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 0 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) with 2 pkt antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cemented pe cup size 60mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 1 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) with 2 antibiotic bone cement 40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , cemented humeral component for shoulder hemiarthroplasty with dual offset bio polar humeral head component 18mmx46mm, dual taper stem with anterio, posterior and lateral / anterolateral fin 9mmx130mm along with one packet of anti biotic bone cement 40 gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , lps femoral comp sz g right , lps femoral comp sz g left , lps flex option fem sz g right , lps flex option fem sz g left , cruciate retaining femoral comp sz g / 7 right , cruciate retaining femoral comp sz g / 7left , mosaic plasty assorted size , mosaic plasty 4.5 mm , mosaic plasty 6.5 mm , mosaic plasty 8.5 mm , uni / bipolar radial head prosthesis assorted size , gender tkr consisting of femoral component size c / 3right with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , gender tkr consisting of femoral component size c / 3 left with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , gender tkr consisting of femoral component size d / 4right with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , gender tkr consisting of femoral component size d / 4 left with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , gender tkr consisting of femoral component size e / 5 right with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , gender tkr consisting of femoral component size e / 5 left with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , gender tkr consisting of femoral component size f / 6right with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , gender tkr consisting of femoral component size f / 6 left with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , gender tkr consisting of femoral component size g / 7 right with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , gender tkr consisting of femoral component size g / 7 left with tibial components corresponding articular surface with one pkt antibiotic bone cement40gm , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , constrained articular surface size cd 1 / 2 10mm , constrained articular surface size cd 1 / 2 12mm , constrained articular surface size cd 1 / 2 14mm , constrained articular surface size cd 1 / 2 17mm , constrained articular surface size cd 3 / 4 10mm , constrained articular surface size cd 3 / 4 12mm , constrained articular surface size cd 3 / 4 14mm , constrained articular surface size cd 3 / 4 17mm , constrained articular surface size cd 5 / 6 10mm , constrained articular surface size cd 5 / 6 12mm , constrained articular surface size cd 5 / 6 14mm , constrained articular surface size cd 5 / 6 17mm , constrained articular surface size ef 3 / 4 10mm , constrained articular surface size ef 3 / 4 12mm , constrained articular surface size ef 3 / 4 14mm , constrained articular surface size ef 3 / 4 17mm , constrained articular surface size ef 5 / 6 10mm , constrained articular surface size ef 5 / 6 12mm , constrained articular surface size ef 5 / 6 14mm , constrained articular surface assorted size , stem extension straight, assorted size , stem extension straight, size 10 x 145mm , stem extension straight, size 11 x 145mm , stem extension straight, size 12 x 145mm , stem extension straight, size 13 x 145mm , stem extension straight, size 14 x 145mm , stem extension offset, size 11 x 145mm , stem extension offset, size 12 x 145mm , stem extension offset, size 13 x 145mm , stem extension offset, size 14 x 145mm , tibial block, size 5mm , tibial block, size 10mm , taper stem plug , femoral knee cement mold size 60mm with 3 packs of 40gm antibiotic bone cement , femoral knee cement mold size 65mm with 3 packs of 40gm antibiotic bone cement , femoral knee cement mold size 70mm with 3 packs of 40gm antibiotic bone cement , femoral knee cement mold size 75mm with 3 packs of 40gm antibiotic bone cement , tibial knee cement mold size 65mm with 3 packs of 40gm antibiotic bone cement , tibial knee cement mold size 70mm with 3 packs of 40gm antibiotic bone cement , tibial knee cement mold size 75mm with 3 packs of 40gm antibiotic bone cement , tibial knee cement mold size 80mm with 3 packs of 40gm antibiotic bone cement , constrained liner 28mm for shell size 48 , constrained liner 28mm for shell size 50 , constrained liner 28mm for shell size 52 , constrained liner 28mm for shell size 54 , constrained liner 32mm for shell size 56 , constrained liner 32mm for shell assorted size , constrained liner 36mm for shell size 60 , constrained liner 36mm for shell size 62 , constrained liner 36mm for shell size 64 , biolox delta ceramic head 12 / 14 taper size 28 small , biolox delta ceramic head 12 / 14 taper size 28 medium , biolox delta ceramic head 12 / 14 taper size 28 large , biolox delta ceramic head 12 / 14 taper size 32 small , biolox delta ceramic head 12 / 14 taper size 32 medium , biolox delta ceramic head 12 / 14 taper size 32 large , biolox delta ceramic head 12 / 14 taper size 36 small , biolox delta ceramic head 12 / 14 taper size 36 medium , biolox delta ceramic head 12 / 14 taper size 32 assorted size , uncemented shell for ceramic on ceramic with cap for screws size ø46mm , uncemented shell for ceramic on ceramic with cap for screws size ø48mm , uncemented shell for ceramic on ceramic with cap for screws size ø50mm , uncemented shell for ceramic on ceramic with cap for screws size ø52mm , uncemented shell for ceramic on ceramic with cap for screws size ø54mm , uncemented shell for ceramic on ceramic with cap for screws size ø56mm , uncemented shell for ceramic on ceramic with cap for screws size ø58mm , uncemented shell for ceramic on ceramic with cap for screws size ø60mm , uncemented shell for ceramic on ceramic with cap for screws size ø62mm , biolox delta ceramic liner size 28 / 37g , biolox delta ceramic liner size 32 / 39g , biolox delta ceramic liner size 36 / 44g , biolox delta ceramic liner size 36 / 48g , biolox delta ceramic liner size 36 / 52g , vitamin e poly liner 10 deg / hw size 46 / 28mm , vitamin e poly liner 10 deg / hw size 50 / 32mm , vitamin e poly liner 10 deg / hw size 54 / 32mm , vitamin e poly liner 10 deg / hw size 58 / 32mm , vitamin e poly liner 10 deg / hw size 54 / 36mm , vitamin e poly liner 10 deg / hw size 58 / 36mm , vitamin e poly liner 10 deg / hw size 60 / 36mm , titanium porus acetabullam shell with multi holes size 48 , titanium porus acetabullam shell with multi holes size 50 , titanium porus acetabullam shell with multi holes size 52 , titanium porus acetabullam shell with multi holes size 54 , titanium porus acetabullam shell with multi holes size 56 , titanium porus acetabullam shell with multi holes size 58 , titanium porus acetabullam shell with multi holes size 60 , titanium porus acetabullam shell with multi holes size 62 , titanium porus acetabullam shell with multi holes size 64 , titanium porus acetabullam shell with multi holes size 66 , titanium porus acetabullam shell with multi holes size 68 , hip spacer mold size 9mm x 125 x 43mm with 3 packs of 40gm antibiotic bone cement , hip spacer mold size 9mm x 125 x 51mm with 3 packs of 40gm antibiotic bone cement , cemented thr revision long stem size 2 x 180 mm taper 12 / 14 , cemented thr revision long stem size 3 x 200 mm taper 12 / 14 , antibiotic hip spacer , articluated antibiotic knee spacer , high performace knee system consisting of anatomically designed femur ( narrow ) , polished tibial base plate with matching polyethylene insert with variable constrained in 1mm increment ( persona ) , implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted sizes ) , rotating hinge knee implant consisting of cobalt chromium femoral componenet with inbuilt rotating hinge machenism with compitable modular rotating insert and tibial base plate with two stem and four augment ( rotating hinge knee ) , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 46mm acetabulumshell with highly cross linked acetabulum liner, ceramic head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 48mm acetabulumshell with highly cross linked acetabulum liner, ceramic head 32 mm with 3 screw and uncemented stem, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 50mm acetabulumshell with highly cross linked acetabulum liner, ceramic head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 52mm acetabulumshell with highly cross linked acetabulum liner, ceramic head 32 mm with 3 screw and uncemented stem, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 54mm acetabulumshell with highly cross linked acetabulum liner, ceramic head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 56mm acetabulumshell with highly cross linked acetabulum liner, ceramic head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 58mm acetabulumshell with highly cross linked acetabulum liner, ceramic head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , uncemented total hip replacement consist of 60mm acetabulumshell with highly cross linked acetabulum liner, ceramic head 32 mm with 3 screw and uncemented stem , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , i assist knee navigation 2 pod system , total shoulder replacement set consisting of humerus stem with head and glanoids , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , shoulder hemiarthroplasty set complete , trabewlar metal reverse shoulderset complete , contineum shell and liner , constrained condyler knee consisting of femoral component with option of stem straight and opset withmatching tibial componenet andlcck insertwithtwo stem and four augment and 2 pkt antibiotics bone cement 40 gm , oxford mobile bearing unicondylar knee comlete set assorted size , total elbow replacement setwith consisting of humeral and ulnar componenet withantibiotic bone cement40 gm , meniscal cinch , tiger loop size 2 , flipcutter assorted size , modular bipolar, highly polished cobalt chrome , triple taperd cemented femoral stem size 0 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) with one pkt antibiotic bone cement40 gm assorted size , modular bipolar size 48mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 0 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) one pkt antibiotic bone cement40 gm , modular bipolar cup size 50mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 1 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) one pkt antibiotic bone cement40 gm , modular bipolar size 52mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 2 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) one pkt antibiotic bone cement40 gm , modular bipolar size 56mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 3 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) one pkt antibiotic bone cement40 gm , modular bipolar size 58mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 4 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) one pkt antibiotic bone cement40 gm , modular bipolar cup size 60mm, highly polished cobalt chrome , triple taperd cemented femoral stem size 0 ( with centraliser and imset plug ) cobalt chrome head ( 28mm ) one pkt antibiotic bone cement40 gm , bipolar prosthesis assorted size , anterior stabilized knee system consisting of : anatomically designed femur compatible tibial base plate with matching congruent highly crosslinked vitamin e polythylene insert size b / 2, c / 3, d / 4, e / 5, f / 6, g / 7, h / 8, 10, 12 ( right / left ) , hybrid thr consiting of uncemented shell ( size 48 / 50 / 52 / 54 / 56 / 58 / 60 / 62 or equivalent ) with highly cross linked acetabulum liner, polished cocr triple tapered cemented femoral stem with centraliser and insert plug, cobalt chrome head 28 / 32 / 36mm, one 40gms antibiotic bone cement , uncemented short stem with porous coating , cemented short stem , revision stem with proximal body & distal stems modular type porous on porous coating assorted size , hi flex tkr consisting of: femoral component, tibial component, corresponding articulating surfacewith one antiboitic bone cement 40 gm ( size c / 3 / d / 4 / e / 5 / f / 6 / g / 7 or equivalent ) , implant should have registry follow up data / odep rating. usfda approved / eu ce certified , revision uncemented total hip replacement consist ofacetabulum multi holeshell with highly cross linked acetabulum liner, head 32 / 36 mm with 4 screws and uncemented monoloc long stem with augment , implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , revision uncemented total hip replacement consist ofacetabulum multi holeshell with highly cross linked acetabulum liner, head 32 / 36 mm with 4 screws and uncementedmodular long stem with augment, implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , revision cemented total hip replacement consist ofcemented cup id 32 mm with headsize 32 mm , cemented long stem , one cement resectractor with centerliser and two antibiotics bone cement40 gm, implant should have registry follow up data / odep rating. usfda approved / eu ce certified ( assorted size ) , mobile bearing tkr complete consisting of femoral component tibial component highly cross linked articular surface. , anti protrusio cage 50 / 52 mm, left with compatible 6 x 6.5 mm cancellous screws , anti protrusio cage 56 / 58 mm, left with compatible 6 x 6.5 mm cancellous screws , anti protrusio cage 50 / 52 mm, right with compatible 6 x 6.5 mm cancellous screws , anti protrusio cage 56 / 58 mm, right with compatible 6 x 6.5 mm cancellous screws , disposable mould for knee articulating spacer , radial head prosthesis, uncemented with grit blasted / porous coated stem surface, multiple head diameter and stem length options required , reverse shoulder arthroplasty implant complete construct consisting of glenoid base plate with compatible screws, glenosphere, uncemented modular humeral stem, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , reverse shoulder arthroplasty implant complete construct consisting of glenoid base plate with compatible screws, glenosphere, cemented modular humeral stem, implant should have registry follow up data / odep rating. usfda approved / eu ce certified , modular distal femoral resection prosthesis complete set. , modular proximal tibial resection prosthesis complete set. , modular proximal humerus resection prosthesis complete set. , modular distal humerus resection prosthesis complete set. , articulated antibiotic cement spacer for hip complete construct various sizes , articulated antibiotic cement spacer for knee complete construct various sizes , cemented femoral stem for total hip replacement fully polished, collarless and tapered , uncemented short femoral stem for total hip replacement fully ha coated , uncemented femoral stem for total hip replacement proximal porous coated metaphyseal fit , uncemented femoral stem for total hip replacement long stem fluted with diaphyseal fit , uncemented femoral stem for total hip replacement long stem with distal locking bolt option with 02x distal locking bolts , fully porous coated acetabulum shell peripheral self locking, with screw options in ring assorted sizes , cemented acetabulum shell assorted sizes , highly cross linked polyethylene liner compatible with head size 28 mm with neutral and lipped options , highly cross linked polyethylene liner compatible with head size 32 mm with neutral and lipped options , vitamin e enriched highly cross linked polyethylene liner , cobalt chromium femoral head size 28 mm , cobalt chromium femoral head size 32 mm , fluted stem compatible with tibial tray total knee replacement , fluted stem compatible with femoral component total knee replacement , metal wedges assorted sizes for tibial defect , tantalum metal cone for bone defects in total knee replacement assorted sizes , highly crosslinked polyethylene articular insert total knee replacement assorted sizes compatible with existing implant system , cement restrictor , arthroscopy , tight rope rt assorted size , endo button with closed loop size 15 mm , endo button with closed loop size 20 mm , endo button with closed loop size 25 mm , radio frequency probe assorted size , nitinol wire ( box of 10 ) , suture laaso 45deg. left , suture laaso 45deg. right , tibial post , suture lasso 60deg straight , suture lasso 25deg left , suture lasso 25deg right , flexible needle for suture passer , tendenosis anchor assorted size , btb fixation device assorted size , bio absorbable lateral anchor assorted size , bio composite knotless anchor size assorted size , mpfl kit sterile , ac joint sterile kit , latarjet screw , lc –lcp variable angle ( va ) elbow plate – medial & lateral tt assorted sizewith 3 locking screw and 3 cortical screw , rotator cuff repair sterile kit , knotless biocomposite anchor with peek eyelet , 6.5mm x 16mm fully threaded anchor titanium , banana suture passer with thumb pad , dog bone button and coracoids button with uhmw fibertape , ligament staple 8mm & 11mm , meniscal repair needles with continous #2.0 uhmpw suture , micro suture lasso straight , micro suture lasso, minor bend , micro suture lasso, major bend , passport button cannula 6mm id x 2cm , passport button cannula 6mm id x 3cm , passport button cannula 6mm id x 4cm , passport button cannula 8mm id x 2cm , passport button cannula 8mm id x 3cm , passport button cannula 8mm id x 4cm , passport button cannula 10mm id x 2cm , passport button cannula 10mm id x 3cm , passport button cannula 10mm id x 4cm , oats kit 6mm , oats kit 8mm , oats kit 10mm , acl tight rope with 55mmcollapsable loop for acl reconstruction. , tiger loop , fiber wire no 2 with needle , fast fix straight , fast fix curved , mini tight rope , tenodesis anchor , suture lasso cresent , knot less pasta suture anchor repair kit , speed bridge suture anchor kit , meniscus root avulsion repair kit , swiwel lock anchor 4.75mm / 5.5mm, / 3.5mm , 2.4mm biocomposite knotless anchor with preloaded with fiber wire , knot pusher / cutter , suture anchor 2.8 / 3.0mm titanium with pre loaded suture , suture anchor 3.5 / 3.0 mm titanium with pre loaded suture , suture anchor 5.0 mm titanium with pre loaded suture , suture anchor assorted size titanium with pre loaded suture , clear track cannula 8.25 / 8.5 mm , graft passing pin 2.7 / 3 mm , drill bit 4.5 mm for endobutton , bio rc ha screw 8.0mm , bio rc ha screw 9.0mm , bio rc ha screw 10.0mm , bio rc ha screw assorted size , bio absorable ( plla ) screw 7mm assorted size , bio absorable ( plla ) screw 8mm assorted size , bio absorable ( plla ) screw 9mm assorted size , bio absorable ( plla ) screw 10mm assorted size , bio absorable ( plla ) screw 11mm assorted size , aclflexible loop size 15mm femoral tunnel , aclflexible loop size 20mm femoral tunnel , aclflexible loop size 25mm femoral tunnel , aclflexible loop size 30mm femoral tunnel , aclflexible loop size 35mm femoral tunnel , aclflexible loop size 40mm femoral tunnel , aclflexible loop femoral tunnel assorted size , ultra fast fix curved / straight , bio raptor suture anchor 2.3 / 2.4mm , bio raptor suture anchor 2.9 / 3.mm , suture passing needle for rotator cuff , suture passing device for rotator cuff repair with interchangeable suture capture device and needle , disposable suture passing device for acl avulsion and repair with interchangeable suture capture device and needle , conventry staplestt , tibial tapered screwassorted size ( tt ) , unsterile nitrile gloves assorted size , extendobutton ( for brust tunnel ) , shaver blade assorted size , orthochord / fiberwire no. 2 / 0 suture on needle ( sterile, disposable ) , knot less sutures with unidirectional pds barbs 1 0, 45 cm , half circle 37mm taper point, , knot less sutures with unidirectional pds barbs no 2 , 45 cm , half circle 37mm taper point, , arthroscpic ablator 90 degree lotus shape tip suction ( shft length 6 inches and dual tubing for both irrigation and couterzation ) , meniscal repair system , rotator cuff repair self punching suture anchor , suture disc ( tt ) , rotator cuff repair double row kit , rotator cuff repair self punching suture anchor , all suture anchor for bankart repair assortes size , tappered suture for tendon repair with n without needle , rotator cuff self retriveiving suture passing devise with needle , continous loop of suture for tendon stitching , adjustable loop with double button for ac joint reconstruction , clavicle fracture set with ac joint repair options , suture anchor for bicep tenodesis , wedge shaped plate for bony bankart with screws , proximal humerus titanium suture plate with variable angles , adjustable loop with on button for acl reconstruction , curved suture passing devise for pcl graft , osteochondral repair kit , medio patello femoral ligament repair kit , allinside meniscal repair kit assorted size , allinside meniscal repair device , inside out meniscal repair set , outside in meniscal repair devise , adjsutable loop with double button for syndesmosis repair. , planter lapidus plate for bunion correction , percutaneous plate for calcaneal fracture repair , bio absorbablek wire , endoscopic carpel tunnel release set , mini adjustable loop with double button for hand / foot , achillis tendon repair kit , drill tip guide wire 2.4mm , beath pin 2.7 / 3 mm , 3.5mm peek suture anchor with one force fibre for shouder arthroscopy , 3.5mm peek suture anchor with double force fibre for shouder arthroscopy , 3.5mm peek se suture anchor with double force fibre for shouder arthroscopy , drill guide for peek suture anchor , awl for peek suture anchor , drill bit for peek suture anchor , suture laaso 45deg. left / right assorted size , knotless peek suture anchor 4.5mm for shoulder arthroscopy , all suture anchor 1.4mm with single suture for bankart arthroscopy , all suture anchor 1.4mm with single suture for slab repair , all suture anchor 2.4mm with double suture for slab repair , all suture anchor 2.4mm with triple suture for slab repair , flexible drill bit for 2.4mm all suture anchor , flexible drill bit for 1.4mm all suture anchor , shaver blade 3.5mm , shaver blade 4.0mm / 4.5mm , shaver blade 5.0mm / 5.5mm , shaver burr assorted size , 3.5mm ablation probe with suction 90deg , 4.0mm ablation probewith with suction 90deg , 3.5mm ablation probe with suction 50deg , flower tip reamer for acl / pcl surgery assorted sizes , spiked stapler , true pass / scorpion needle , atfl kit , suture shuttle 45 degree lt and rt , trauma , interlocking nail for tibia ( universal ) with 5 locking bolt assorted size ss , interlocking nail for tibia ( universal ) with 5 locking bolt assorted size tt , 3.5mm lcp t platec 5 hole with 4 locking and 4 cortical screw, oblique angled tt ( mri safe & compatible ) , 3.5mm lcp t plate 5 hole with 4 locking and 4 cortical screw, oblique angled ss ( mri safe & compatible ) , 3.5mm lcp t plate 4 hole with 4 locking and 4 cortical screw, oblique angled tt ( mri safe & compatible ) , 3.5mm lcp t plate 4 hole with 4 locking and 4 cortical screw, oblique angled ss ( mri safe & compatible ) , 3.5mm cortex screw, self tapping ssassorted size ( mri safe & compatible ) , femoral fixion nail rt / lt assorted size , tibial fixion nailassorted size , antibiotic femoral nailrt / lt with 4 antibiotic locking bolt assorted size , antibiotic tibialnailwith 4 antibiotic locking bolt assorted size , distal medial femur , long proximal femoral nailrt / lt with 2 hip screw and 2 locking bolt assorted size tt , long proximal femoral nailrt / lt with 2 hip screw and 2 locking bolt assorted size ss , short proximal femoral nail rt / lt with 2 hip screw and 2 locking bolt assorted size tt , short proximal femoral nail rt / lt with 2 hip screw and 2 locking bolt assorted size ss , long proximal femoral nailrt / lt with 1 hip blade and 2 locking bolt assorted size tt , short proximal femoral nail rt / lt with 1 hip blade and 2 locking bolt assorted size tt , distalfemoral nail rt / lt with 4 locking bolt assorted size tt , distalfemoral nail rt / lt with 4 locking bolt assorted size ss , titanium elastic nailing system size 2mm , titanium elastic nailing system size 2.5mm , titanium elastic nailing system size 3.0 mm , titanium elastic nailing system size 3.5 mm , titanium elastic nailing system size 4.0 mm , herbert screw assorted size tt , jessassorted size , humerus interlocking nail with 4 locking bolt tt assorted size , calcanium plate with 4 locking and 4 cortical ttassorted size , mini plate 2.7 mm with 4 locking and 3 cortical screw tt assorted size , external fixator assorted size consisting rod 400mm 2, 200mm 2, universal clamp 6 tube to tube clamp 1, double pin clamp 1, shanz pin 4.5 x 150mm 6 , steel wire 1 / 2 circle centenial size 5 , steel wire 1 / 2 circle centenial size 4 , skin stapler 35 pin size 6.9mm x 3.6mm , rail fixator consisting of 1 no. rai / 300mm, 2 no. central clamps, 1 no. end clamp, 1 no. cd unit and 6 nos tapered schariz pins 6mm to 5mm. , rail fixator consisting of 1 no. rai / 400mm, 2 no. central clamps, 1 no. end clamp, 1 no. cd unit and 9 nos tapered schariz pins 6mm to 5mm. , rail fixator consisting of 1 no. rai / 400mm, 2 no. central clamps, 1 no. end clamp, 1 no. cd unit and 6 nos tapered schariz pins 4.5mm to 3.5mm. , rail fixator consisting of 1 no. rai / 250mm, 2 no. central clamps, 1 no. end clamp, 1 no. cd unit and 6 nos tapered schariz pins 4.5mm to 3.5mm. , ha coated tapered schanz pins 170mm. , ha coated tapered schanz pins 200mm. , ha coated tapered schanz pins 100mm. , ha coated tapered schariz pins 120mm. , self adjusting clamp with medium dyanamic external fixator. , elbow clamp , k wire assorted size , theraband , antirotation promixal femoral nail short assorted size with proximal screw and 2 locking bolt tt , antirotation promixal femoral nail long assorted size with proximal screw and 2 locking bolt tt , 2.7 mm lockig head screwss , 2.7 mm lockig head screwtt , 3.5 mm cortical screw with 2.7 head ss , 3.5 mm cortical screw with 2.7 head tt , 2.4 mm locking head screw assorted size tt , lcp plate for distal femur with 5 locking and 4 cortical screw rt / lt assorted size tt , lcp plate proximal tibiawith 5 locking and 4 cortical screwrt / lt assorted size tt , lcp plates proximal humeruswith 5 locking and 4 cortical screw phpl / phillos rt / lt assorted size tt , 5.0 mm cancellous screw assorted size tt , 5.0 mm cancellous screw assorted size ss , 5.0 mm cortical screws assorted size tt , 5.0 mm cortical screws assorted size ss , 3.5 cortical screws ttassorted size , 4.0 mm cortical screws tt assorted size , 4.0 cannualated cancellous screwstt assorted size , 4.5 mm cortical screwstt assorted size , 5.0 mm locking screw tt assorted size , polyaxial distal volar radius locking plate assorted sizes , 2.5 locking head screws tt , 3.5 locking head screws tt assorted size , lcp for proximal lateral tibia, 11 holes, right with 5 locking and 3 cortical screw tt , lcp for proximal lateral tibia, 11 holes, left with 5 locking and 3 cortical screwtt , lcp for proximal lateral tibia, 13 holes, rightwith 6 locking and 4 cortical screw tt , lcp for proximal lateral tibia, 13 holes, leftwith 5 locking and 3 cortical screw tt , lcp for proximal lateral tibia, 11 holes, rightwith 5 locking and 4 cortical screw ss , lcp for proximal lateral tibia, 11 holes, leftwith 5 locking and 4 cortical screw ss , lcp for proximal lateral tibia, 13 holes, rightwith 6 locking and 4 cortical screw ss , lcp for proximal lateral tibia, 13 holes, leftwith 5 locking and 4 cortical screw ss , lcp for distal femur, 5 holes, rightwith 5 locking and 4 cortical screw ss , lcp for distal femur, 5 holes, leftwith 5 locking and 4 cortical screw ss , lcp for distal femur, 13 holes, rightwith 8 locking and 5 cortical screw ss , lcp for distal femur, 13holes, leftwith 5 locking and 4 cortical screw ss , lcp for distal femur, 5 holes, rightwith 5 locking and 4 cortical screw tt , lcp for distal femur, 5 holes, leftwith 5 locking and 4 cortical screw tt , lcp for distal femur, 13 holes, rightwith 8 locking and 5 cortical screw tt , lcp for distal femur, 13holes, leftwith 5 locking and 4 cortical screw tt , pfna ii proximal femoral nail ø 9.0 mm, extra small, 130°, length 170 mm, ( tan ) , sterile, 1 prox blade, 1 end cap and 2 locking bolt. , pfna ii proximal femoral nail ø 9.0 mm, small, 130°, length 200 mm, ( tan ) , sterile, 1 prox blade, 1 end cap and 2 locking bolt. , pfna ii proximal femoral nail ø 9.0 mm, long, left, 130°, length 300 mm, titanium alloy ( tan ) , sterile, 1 prox blade, 1 end cap and 2 locking bolt. , pfna ii proximal femoral nail ø 9.0 mm, long, right, 130°, length 300 mm, titanium alloy ( tan ) , sterile, 1 prox blade, 1 end cap and 2 locking bolt. , dhs® trochanter stabilizing plate , locking attachment plate 3.5, for lcp 4.5 / 5.0, 8 holes, pure titanium , locking attachment plate 3.5, for lcp 4.5 / 5.0, 4 holes, pure titanium , va lcp condylar plate 4.5 / 5.0, right, 18 holes, length 375 mm, stainless steel , va lcp condylar plate 4.5 / 5.0, left, 18 holes, length 375 mm, stainless steel , va periprosthetic locking screw stardrive® ø 5.0 mm, self tapping, length 16 mm, stainless steel , va periprosthetic locking screw stardrive® ø 5.0 mm, self tapping, length 18 mm, stainless steel , va periprosthetic locking screw stardrive® ø 5.0 mm, self tapping, length 20 mm, stainless steel , va locking screw stardrive® ø 5.0 mm, self tapping, length 36 mm, stainless steel , va locking screw stardrive® ø 5.0 mm, self tapping, length 38 mm, stainless steel , va locking screw stardrive® ø 5.0 mm, self tapping, length 40 mm, stainless steel , va locking screw stardrive® ø 5.0 mm, self tapping, length 42 mm, stainless steel , va locking screw stardrive® ø 5.0 mm, self tapping, length 44 mm, stainless steel , va locking screw stardrive® ø 5.0 mm, self tapping, length 46 mm, stainless steel , va locking screw stardrive® ø 5.0 mm, self tapping, length 48 mm, stainless steel , va locking screw stardrive® ø 5.0 mm, self tapping, length 50 mm, stainless steel , va cannulated locking screw ø 5.0 mm, length 20 mm, stainless steel , va cannulated locking screw ø 5.0 mm, length 25 mm, stainless steel , va cannulated locking screw ø 5.0 mm, length 30 mm, stainless steel , va cannulated locking screw ø 5.0 mm, length 35 mm, stainless steel , va cannulated locking screw ø 5.0 mm, length 40 mm, stainless steel , va cannulated locking screw ø 5.0 mm, length 45 mm, stainless steel , va cannulated locking screw ø 5.0 mm, length 50 mm, stainless steel , va cannulated locking screw ø 5.0 mm, length 55 mm, stainless steel , va cannulated locking screw ø 5.0 mm, length 60 mm, stainless steel , lcp posterior medial proximal tibial plate 3.5, titanium alloy ( tan ) with 6 locking screw and 6 cortical screw assorted size , lcp posterior medial proximal tibial plate 3.5, 4 holes, length 105 mm, titanium alloy ( tan ) with 3 locking screw and 3 cortical screw , lcp posterior medial proximal tibial plate 3.5, 6 holes, length 131 mm, titanium alloy ( tan ) with 4 locking screw and 3 cortical screw , lcp posterior medial proximal tibial plate 3.5, 8 holes, length 157 mm, titanium alloy ( tan ) with 6 locking screw and 4 cortical screw , lcp posterior medial proximal tibial plate 3.5, 10 holes, length 183 mm, titanium alloy ( tan ) with 7 locking screw and 4 cortical screw , va lcp anterior clavicle plate 2.7 / 3.5, lateral, 7 holes, length 77 mm, titanium alloy ( tan ) with 5 locking screw and 3 cortical screw , va lcp anterior clavicle plate 2.7 / 3.5, lateral, 9 holes, length 89 mm, titanium alloy ( tan ) with 6 locking screw and 3 cortical screw , va lcp anterior clavicle plate 2.7 / 3.5, lateral, 11 holes, length 113 mm, titanium alloy ( tan ) with 7 locking screw and 4 cortical screw , va locking screw stardrive® ø 2.7 mm ( head 2.4 ) , self tapping, length 10 mm with 3 locking screw and 3 cortical screw , va locking screw stardrive® ø 2.7 mm ( head 2.4 ) , self tapping, length 12 mm with 3 locking screw and 3 cortical screw , va locking screw stardrive® ø 2.7 mm ( head 2.4 ) , self tapping, length 14 mm, titanium alloy ( tan ) with 3 locking screw and 3 cortical screw , va locking screw stardrive® ø 2.7 mm ( head 2.4 ) , self tapping, length 16 mm, titanium alloy ( tan ) with 3 locking screw and 3 cortical screw , lcp proximal humeral plate, periarticular, left, 4 holes, length 127mm, pure titanium with 5 locking screw and 3 cortical screw , lcp proximal humeral plate, periarticular, right, 4 holes, length 127mm, pure titanium with 5 locking screw and 3 cortical screw , lcp proximal humeral plate, periarticular, left, 5 holes, length 145mm, pure titanium with 5 locking screw and 3 cortical screw , lcp proximal humeral plate, periarticular, right, 5 holes, length 145mm, pure titanium with 5 locking screw and 3 cortical screw , lcp proximal radius plate 2.4, right, for radial head rim, shaft 2 holes, head 5 holes, length 37.5 mm, pure titanium, 3 locking and 3 certical screw tt with 3 locking screw and 3 cortical screw , lcp proximal radius plate 2.4, left, for radial head rim, shaft 2 holes, head 5 holes, length 37.5 mm, pure titanium with 3 locking screw and 3 cortical screw , locking screw stardrive® ø 4.0 mm, length 18 mm, for medullary nails, titanium alloy ( tan ) , dark blue with 3 locking screw and 3 cortical screw , locking screw stardrive® ø 4.0 mm, length 20 mm, for medullary nails, titanium alloy ( tan ) , dark blue with 3 locking screw and 3 cortical screw , locking screw stardrive® ø 4.0 mm, length 22 mm, for medullary nails, titanium alloy ( tan ) , dark blue with 3 locking screw and 3 cortical screw , locking screw stardrive® ø 4.0 mm, length 24 mm, for medullary nails, titanium alloy ( tan ) , dark blue with 3 locking screw and 3 cortical screw , locking screw stardrive® ø 4.0 mm, length 26 mm, for medullary nails, titanium alloy ( tan ) , dark blue with 3 locking screw and 3 cortical screw , locking screw stardrive® ø 4.0 mm, length 28 mm, for medullary nails, titanium alloy ( tan ) , dark blue with 3 locking screw and 3 cortical screw , locking screw stardrive® ø 4.0 mm, length 30 mm, for medullary nails, titanium alloy ( tan ) , dark blue with 3 locking screw and 3 cortical screw , locking screw stardrive® ø 4.0 mm, length 32 mm, for medullary nails, titanium alloy ( tan ) , dark blue with 3 locking screw and 3 cortical screw , reconstruction plate 3.5 with low profile, curved ( r108 ) , 6 holes, length 78 mm, stainless steel, 6 screw assorted size , reconstruction plate 3.5 with low profile, curved ( r108 ) , 8 holes, length 104 mm, stainless steel, 6 screw assorted size , reconstruction plate 3.5 with low profile, curved ( r108 ) , 10 holes, length 130 mm, stainless steel, 6 screw assorted size , symphyseal plate 3.5 with coaxial combi holes, 4 holes, length 57mm, stainless steel, 4 screw assorted size , symphyseal plate 3.5 with coaxial combi holes, 6 holes, length 78 mm, stainless steel, 6 screw assorted size , 3.5mm cortex screw, l 10mm tt , 3.5mm cortex screw, l 12mm tt , 3.5mm cortex screw, l 14mm tt , 3.5mm cortex screw, l 16mm tt , 3.5mm cortex screw, l 18mm tt , 3.5mm cortex screw, l 20mm tt , 3.5mm cortex screw, l 22mm tt , 3.5mm cortex screw, l 24mm tt , 3.5mm cortex screw, l 26mm tt , 3.5mm cortex screw, l 28mm tt , 3.5mm cortex screw, l 30mm tt , 3.5mm cortex screw, l 32mm tt , 3.5mm cortex screw, l 34mm tt , 3.5mm cortex screw, l 36mm tt , 3.5mm cortex screw, l 38mm tt , 3.5mm cortex screw, l 40mm tt , 3.5mm cortex screw, l 45mm tt , 3.5mm cortex screw, l 50mm tt , 3.5mm cortex screw, l 55mm tt , 3.5mm cortex screw, l 60mm tt , 3.5mm cortex screw, l 10mm ss , 3.5mm cortex screw, l 12mm ss , 3.5mm cortex screw, l 14mm ss , 3.5mm cortex screw, l 16mm ss , 3.5mm cortex screw, l 18mm ss , 3.5mm cortex screw, l 20mm ss , 3.5mm cortex screw, l 22mm ss , 3.5mm cortex screw, l 24mm ss , 3.5mm cortex screw, l 26mm ss , 3.5mm cortex screw, l 28mm ss , 3.5mm cortex screw, l 30mm ss , 3.5mm cortex screw, l 32mm ss , 3.5mm cortex screw, l 34mm ss , 3.5mm cortex screw, l 36mm ss , 3.5mm cortex screw, l 38mm ss , 3.5mm cortex screw, l 40mm ss , 3.5mm cortex screw, l 45mm ss , 3.5mm cortex screw, l 50mm ss , 3.5mm cortex screw, l 55mm ss , 3.5mm cortex screw, l 60mm ss , 1st mtp fusion plate 2.4 / 2.7, va locking, medium, length 52 mm, 5°, left, titanium alloy ( tan ) , 1st mtp fusion plate 2.4 / 2.7, va locking, medium, length 52 mm, 10°, right, titanium alloy ( tan ) , antegrade femoral nailing system ( titanium ) consisting of : antegrade femoral nail 1 nos, hip screw cannulated 2 nos, distal screw 2 nos, end cap 1 nos.left / right, assorted size , tibial nailing system ( expert type titanium ) consisting of : expert tibial nail 1 nos, locking bolt 5 nos, endcap 1 nos. assorted size , suv frame assorted size , lc lcp posterior medial proximal tibia tt assorted sizewith 3 locking screw and 3 cortical screw , lc lcp volor rim distal radius tt assorted sizewith 3 locking screw and 3 cortical screw , lc lcp extra articular distal humerus tt assorted sizewith 3 locking screw and 3 cortical screw , lc lcp tomofix tibal – lateral & medial plate tt assorted sizewith 3 locking screw and 3 cortical screw , lc lcp tomofix femur– lateral & medial plate tt assorted size with 3 locking screw and 3 cortical screw , lc lcp 3.5mm antibiotic plate 6 hole with 6 antibiotic screw , lc lcp 3.5mm antibiotic plate 7 hole with 7 antibiotic screw , lc lcp 4.5mm antibiotic plate broad 8 hole with 8 antibiotic screw , schanz pin 3.5 mm , carbon fibre rings for ilizarov ring fixator half ring 160 mm , carbon fibre rings for ilizarov ring fixator half ring 180 mm , carbon fibre rings for ilizarov ring fixator half ring 200 mm , carbon fibre ring for ilizarov fixator half ring diameter 180 mm , carbon fibre ring for ilizarov fixator half ring diameter 160 mm , guide wire 1.5mm diameter, length 300mm , guide wire 2.0mm diameter, length 300 mm , proximal femoral plate rt and ltassorted size with 8 nos compitable screw ( 05 each side ) , tube to tube clamp for universal external fixator , large combination clamp for external fixator , multi – pin clamp for external fixator , large open adjustable clamp , transverse clamp for external fixator , adjustable hinged fixator for distal radius fractures with four ha coated compatible pins , ss drill bit with ao pattern coupling 1.8 mm x 90 mm ( 10% variation in length acceptable ) , ss drill bit with ao pattern coupling 2.0 mm x 90 mm ( 10% variation in length acceptable ) , ss drill bit with ao pattern coupling 2.5 mm x 90 mm ( 10% variation in length acceptable ) , ss drill bit with ao pattern coupling 2.7 mm x 90 mm ( 10% variation in length acceptable ) , ss drill bit with ao pattern coupling 3.2 mm x 120mm ( 10% variation in length acceptable ) , ss drill bit with ao pattern coupling 3.5 mm x 120mm ( 10% variation in length acceptable ) , ss drill bit with ao pattern coupling 3.5 mm x 180mm ( 10% variation in length acceptable ) , ss drill bit with ao pattern coupling 4.2 mm x 180mm ( 10% variation in length acceptable ) , ss drill bit with ao pattern coupling 4.2 mm x 200mm ( 10% variation in length acceptable ) , ss drill bit with ao pattern coupling 4.5 mm x 120 mm ( 10% variation in length acceptable ) , trochanteric fixation hook plate ( 3 hole ) with 5 compitable screw tt , trochanteric fixation hook plate ( 5 hole ) with 7 compitable screw tt , precontoured pelvic reconstruction plates 10 hole ss , precontoured pelvic reconstruction plates 12 holess , precontoured pelvic reconstruction plates 14holess , precontoured pelvic reconstruction plates 16 holess , washer for 6.5 / 7 mmcancellous screws tt , washer for 6.5 / 7 mmcancellous screws ss , 2.7 mm cannulated drill bit , quick coupling ( ss ) 160 mm length , 4.0 mm cannulated screw ( ss ) partially threaded assorted size , 4.0 mm cannulated cancellous screw ( tt ) partially threaded assorted size , limited contact dynamic compression plate ( ss ) 3.5 mm 05 hole with 05 self tapping cortical screws , limited contact dynamic compression plate ( ss ) 3.5 mm 06 hole with 06self tapping cortical screws , limited contact dynamic compression plate ( ss ) 3.5 mm 07 hole with 07 self tapping corticalscrews , limited contact dynamic compression plate ( ss ) 3.5 mm 08 hole with 08 self tapping corticalscrews , limited contact dynamic compression plate ( ss ) 3.5 mm 09 hole with 09 self tapping corticalscrews , limited contact dynamic compression plate ( ss ) 3.5 mm 10 hole with 10 self tapping corticalscrews , limited contact dynamic compression plate 4.5 narrow ( ss ) 07 hole with 07 self tapping corticalscrews , limited contact dynamic compression plate 4.5 narrow ( ss ) 08 hole with 08self tapping corticalscrews , limited contact dynamic compression plate 4.5 narrow ( ss ) 09 hole with 09 self tapping corticalscrews , limited contact dynamic compression plate 4.5 narrow ( ss ) 10 hole with 10self tapping corticalscrews , limited contact dynamic compression plate 4.5 narrow ( ss ) 11 hole with 11 self tapping corticalscrews , limited contact dynamic compression plate 4.5 narrow ( ss ) 12 hole with 12 self tapping corticalscrews , limited contact dynamic compression plate 4.5 mm broad ( ss ) 05 hole with self tapping 05 corticalscrews , limited contact dynamic compression plate 4.5 mm broad ( ss ) 06 hole with self tapping 06 corticalscrews , limited contact dynamic compression plate 4.5 mm broad ( ss ) 07 hole with self tapping 07 corticalscrews , limited contact dynamic compression plate 4.5 mm broad ( ss ) 08 hole with self tapping 08 corticalscrews , limited contact dynamic compression plate 4.5 mm broad ( ss ) 09 hole with self tapping 09 corticalscrews , limited contact dynamic compression plate 4.5 mm broad ( ss ) 10 hole with self tapping 10 cortical screws , limited contact dynamic compression plate 4.5 mm broad ( ss ) 11 hole with self tapping 11corticalscrews , limited contact dynamic compression plate 4.5 mm broad ( ss ) 12 hole with 12self tapping corticalscrews , ao pattern dhs barrel plate 95 degree 8 to 14 oval holes with 65 to 75 mm lag screw , compression screw and 6 x cortical screws complete construct. material 316lvm stainless steel.implant should be mri safe. , ao pattern dhs fixed angle barrel plate 135 degrees 2 oval holes , standard barrel with 90 to 105 mm lag ( richards ) screw , compression screw and 2 x cortical screws complete construct. material 316lvm stainless steel. , ao pattern dhs fixed angle barrel plate 135 degrees 4 oval holes , standard barrel with 90 to 105 mm lag ( richards ) screw , compression screw and 4 x cortical screws complete construct. material 316lvm stainless steel. , ao pattern dhs fixed angle barrel plate 135 degrees 2 oval holes , short barrel with 75 to 90mm lag ( richards ) screw, compression screw and 2 x cortical screws complete construct.material 316lvm stainless steel. , ao pattern dhs fixed angle barrel plate 135 degrees 4 oval holes , short barrel with 75 to 90mm lag ( richards ) screw, compression screw and 4 x cortical screws complete construct.material 316lvm stainless steel. , ao pattern dhs variable angle barrel plate 3 to 6 oval holes , standard barrel with 90 to 105 mm lag ( richards ) screw, compression screw and 4 x cortical screws complete construct. material 316lvm stainless steel. , supra condylar distal femoral nail femur 9 mm dia, 150 to 420 mm length with 2 x 4.9 / 5.0 mm and 2 / 3 x 6.0 mm locking bolts / spiral blade and end cap, titanium complete construct. it should be mri compatible. , supra condylar distal femoral nail femur 10 mm dia, 150 to 420 mm length with 2 x 4.9 / 5.0 mm and 2 / 3 x 6.0 mm locking bolts / spiral blade and end cap, titanium complete construct. it should be mri compatible. , supra condylar distal femoral nail femur 11 mm dia, 150 to 420 mm length with 2 x 4.9 / 5.0 mm and 2 / 3 x 6.0 mm locking bolts / spiral blade and end cap, titanium complete construct. it should be mri compatible. , orthopaedic cable system consisting of 1.0mm orthopaedic cable with crimp , 4 circlage threaded positioning pins, 4 crimp positioning pins , 4 circlage buttons titanium complete construct , orthopaedic cable system consisting of 1.7mm orthopaedic cable with crimp , 4 circlage threaded positioning pins, 4 crimp positioning pins , 4 circlage buttons and trochantric reattachment device titanium complete construct , articulated hinged adjustible external fixator elbow with an option of insertion of 3x 3.5 / 4.5mm tapered shanz screws in humerus and 3 x3.5 / 4.5mm tapered shanz screws in ulna. , distal radius fixator system distal radius fixator, 2 x tapered half pin dia 4 mm amd 2 x 3mm dia shanz pins. , paedeatric rail lrs fixator system 150mm rail 150 mm long, clamp 3, 40 mm cd unit 1, threaded schanz screws 4.5 / 3.5 mm x 4 ( 1 set ) , 6.5 mm cancellous screws; fully threaded; compatible with uncemented acetabulum cup , 3.5mm lcp t plate , right angled tt with 3 cortical 3 locking screw ( mri safe & compatible ) , 3.5mm lcp t plate, oblique angled tt with 3 cortical 3 locking screw ( mri safe & compatible ) , 3.5mm lcp t plate , right angled ss with 3 cortical 3 locking screw ( mri safe & compatible ) , 3.5mm lcp t plate, oblique angled ss with 3 cortical 3 locking screw ( mri safe & compatible ) , lcp 3.5 mm distal medial tibial plate 06 hole ( rt ) tt with 4 cortical 5 locking screw , lcp 3.5 mm distal medial tibial plate 08 hole ( rt ) ttwith 4 cortical 6 locking screw , lcp 3.5 mm distal medial tibial plate ( rt / lt ) tt with 5 cortical 7 locking screw with each plate, assorted size , lcp 3.5 mm distal medial tibial plate 06 hole ( lt ) tt with 4 cortical 6 locking screw , lcp 3.5 mm distal medial tibial plate 08 hole ( lt ) ttwith 5 cortical 6 locking screw , lcp 3.5 mm distal medial tibial plate 06 hole ( rt ) sswith 4 cortical 6 locking screw , lcp 3.5 mm distal medial tibial plate 08 hole ( rt ) sswith 5 cortical 6 locking screw , lcp 3.5 mm distal medial tibial plate 10 hole ( rt ) sswith 6 cortical 6 locking screw , lcp 3.5 mm distal medial tibial plate 06 hole ( lt ) sswith 4 cortical 6 locking screw , lcp 3.5 mm distal medial tibial plate 08 hole ( lt ) ss with 5 cortical 6 locking screw , lcp 3.5 mm distal medial tibial plate 10 hole ( lt ) sswith 6 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate 06 hole ( rt ) ttwith 4 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate 08 hole ( rt ) ttwith 5 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate ( rt / lt ) ttwith 6 cortical 6 locking screw with each plate, assorted size , lcp 3.5 mm distal antero lateral tibial plate 06 hole ( lt ) ttwith 4 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate 08 hole ( lt ) ttwith 4 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate 06 hole ( rt ) sswith 4 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate 08 hole ( rt ) sswith 4 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate 10 hole ( rt ) sswith 6 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate 06 hole ( lt ) ss with 4 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate 08 hole ( lt ) sswith 4 cortical 6 locking screw , lcp 3.5 mm distal antero lateral tibial plate 10 hole ( lt ) sswith 4 cortical 6 locking screw , lcp 3.5 mm / 2.7 mm clavicular plate 4 hole rtttwith 4 cortical 3 locking screw , lcp 3.5 mm / 2.7 mm clavicular plate 4 hole lt ttwith 4 cortical 3 locking screw , lcp 3.5 mm / 2.7 mm clavicular plate 5 hole rt ttwith 4 cortical 3 locking screw , lcp 3.5 mm / 2.7 mm clavicular plate 5 hole lt ttwith 4 cortical 3 locking screw , lcp 3.5 mm / 2.7 mm clavicular plate 6 hole rt ttwith 4 cortical 4 locking screw , lcp 3.5 mm / 2.7 mm clavicular plate 6 hole lt ttwith 4 cortical 6 locking screw , lcp 3.5 mm / 2.7 mm clavicular plate rt / lt ttwith 4 cortical 6 locking screw each plate, assorted size , lcp distal humerus locking plate with lateral supportrt / lt ttwith 4 cortical 6 locking screw assorted size , lcp distal humerus locking plate with lateral support 5 hole rt ttwith 4 cortical 6 locking screw , lcp distal humerus locking plate with lateral support 5 hole lt ttwith 4 cortical 6 locking screw , lcp distal humerus locking plate with lateral support 6 hole rt ttwith 6 cortical 6 locking screw , lcp distal humerus locking plate with lateral support 6 hole lt ttwith 6 cortical 6 locking screw , lcp distal humerus locking plate with lateral support 4 hole rt sswith 4 cortical 6 locking screw , lcp distal humerus locking plate with lateral support 4 hole lt sswith 4 cortical 6 locking screw , lcp distal humerus locking plate with lateral support 5 hole rt sswith 4 cortical 6 locking screw , lcp distal humerus locking plate with lateral support 5 hole lt sswith 4 cortical 6 locking screw , lcp distal humerus locking plate with lateral support 6 hole rt sswith 6 cortical 6 locking screw , lcp distal humerus locking plate with lateral support 6 hole lt sswith 6 cortical 6 locking screw , lcp distal humerus locking plate with medial rt / lt ttwith 4 cortical 6 locking screw assorted size , lcp distal humerus locking plate with medial5 hole rt ttwith 4 cortical 6 locking screw , lcp distal humerus locking plate with medial 5 hole lt ttwith 4 cortical 6 locking screw , lcp distal humerus locking plate with medial6 hole rt ttwith 6 cortical 6 locking screw , lcp distal humerus locking plate with medial 6 hole lt ttwith 4 cortical 6 locking screw , lcp distal humerus locking plate withmedial 4 hole rt sswith 4 cortical 6 locking screw , lcp distal humerus locking plate with medial 4 hole lt sswith 4 cortical 6 locking screw , lcp distal humerus locking plate with medial5 hole rt sswith 4 cortical 6 locking screw , lcp distal humerus locking plate with medial 5 hole lt sswith 4 cortical 6 locking screw , lcp distal humerus locking plate with medial6 hole rt sswith 4 cortical 6 locking screw , lcp distal humerus locking plate with medial 6 hole lt sswith 4 cortical 6 locking screw , lcp distal radius plate ttrt / lt with 3 cortical 3 locking screw ( assorted size ) , lcp distal radius plate tt 4 hole rt with 4 cortical 4 locking screw , lcp distal radius plate tt 4 hole ltwith 4 cortical 4 locking screw , lcp distal radius plate tt 5 hole rt with 4 cortical 5 locking screw , lcp distal radius plate tt 5 hole lt with 4 cortical 5 locking screw , lcp distal radius plate ss 3 hole rt with 3 cortical 3 locking screw , lcp distal radius plate ss 3 hole ltwith 3 cortical 3 locking screw , lcp distal radius plate ss 4 hole rt with 4 cortical 4 locking screw , lcp distal radius plate ss 4 hole ltwith 4 cortical 4 locking screw , lcp distal radius plate ss 5 hole rt with 4 cortical 4 locking screw , lcp distal radius plate ss 5 hole ltwith 4 cortical 4 locking screw , lcp olecranon plate lt / rt ttwith 4 cortical 6 locking screw assorted size , lcp olecranon plate 4 hole lt ttwith 4 cortical 4 locking screw , lcp olecranon plate 5 hole rt ttwith 4 cortical 6 locking screw , lcp olecranon plate 5 hole lt ttwith 4 cortical 6 locking screw , lcp olecranon plate 6 hole rt ttwith 4 cortical 6 locking screw , lcp olecranon plate 6 hole lt ttwith 4 cortical 6 locking screw , lcp olecranon plate 4 hole rt sswith 4 cortical 4 locking screw , lcp olecranon plate 4 hole lt sswith 4 cortical 4 locking screw , lcp olecranon plate 5 hole rt sswith 4 cortical 5 locking screw , lcp olecranon plate 5 hole lt sswith 4 cortical 5 locking screw , lcp olecranon plate 6 hole rt sswith 4 cortical 6 locking screw , lcp olecranon plate 6 hole lt sswith 4 cortical 6 locking screw , clavicle hook plate assorted sizewith 4 cortical 4 locking screw , calcanium plateassorted sizewith 4 cortical 4 locking screw , mini plate assorted size assorted sizewith 4 cortical 3 locking screw , locking attachment plate 3.5, for lcp 4.5 / 5.0, 8 holes, pure titaniumwith 4 cortical 5 locking screw , locking attachment plate 3.5, for lcp 4.5 / 5.0, 4 holes, pure titaniumwith 4 cortical 2 locking screw , va lcp condylar plate 4.5 / 5.0, right, 18 holes, length 375 mm, stainless steelwith 6 cortical 8 locking screw , va lcp condylar plate 4.5 / 5.0, left, 18 holes, length 375 mm, stainless steelwith 6 cortical 8 locking screw , lcp proximal radius plate 2.4, left, for radial head rim, shaft 2 holes, head 5 holes, length 37.5 mm, pure titaniumwith 4 cortical 6 locking screw , lc lcp 3.5mm antibiotic plate 6 holewith 4 cortical 2 locking screw , lc lcp 3.5mm antibiotic plate 7 holewith 4 cortical 3 locking screw , lc lcp 4.5mm antibiotic plate broad 9 holewith 4 cortical 5 locking screw , courtry lead with long tip , tubular stockinett , 5.0mm cannnulated locking head screw ( ss ) , 5.7mm cannulated locking head screw ( ss ) , disposable suction canister system of 1500cc for fluid easte management with fluid solidifier designed to solidify liquid medical waste without compromising the integrity of the closed suction system for increased safety and infection control us fda approved , single use applicator 25ml ( chlorhexidine gluconate 2%w / v ethanol 80% w / w poly fatty acid estars ) , disposable pudde vac floor suction device , 6.5mm cancellous cannulated screw 16mm threaded ( tt ) assorted size , 6.5mm cancellous cannulated screw 32mm threaded ( tt ) assorted size , 6.5mm cancellous cannulated screw 16mm threaded ( ss ) assorted size , 6.5mm cancellous cannulated screw 32mm threaded ( ss ) assorted size , ss wire roll 16 , 18 and 20 gauge , 2.4mm cortical screw ( tt ) assorted size , 2.4mm cortical screw ( ss ) assorted size , 4.0mm cancellous cannulated screw ( tt ) assorted size , 4.0mm cancellous cannulated screw ( ss ) assorted size , washer for 4mm cancellous cannulated screw ( tt ) , washer for 4mm cancellous cannulated screw ( ss ) , 2.7mm cortical screw ( ss ) assorted size , 2.7mm cortical screw ( tt ) assorted size , lcp 3.5mm distal fibular plate assorted size with 3 locking and 3 cortical screw tt , 3.5 mm proximal tibial medial plate ( tt ) , lt / rt with 3.5mm locking screw 5, 3.5mm cortical screw 4 ( assorted ) , puddu plate complete set ( ss ) , puddu plate complete set ( tt ) , lcp distal radius extra articular volar column plate 2.4 / 2.7mm rt / ltwith 4 cortical 5 locking screw tt ( compatable with plate ) assorted size , lcp distal radius inrta articular volar columnplate rt / lt with 4 cortical 5 locking screw tt compatable with plate ) assorted size , lcp 3.5 mm locking compration plate tt assorted size , lcp 3.5 mm locking compration plate ss , tension band plate guided growth system ( 12mm, 16mm ) , cannulated screws of 16mm, 24mm and 32 mm lenghts for tension band plate guided growth system , solid screws of 24mm and 32mm lenghts for tension band plate guided growth system , paediatric dhs system dhs screw length 50 145 at 5mm increments, outer diameter 13mm , dhs plate with dcp holes, barrel angle 130 150degree, 2 to 6 holes, barrel length standard and short with cortex screws 4.5mm ( 10 24mm ) at 2mm increments , 3.5 mm proximal femur locking valgus osteotomy plate 140 degrees with 03 x locking screws from 16 60mm and 03 x cortical screws from 16 to 60mm in 5 mm increments , 5.0mm proximal femur locking valgus osteotomy plate 140 degrees woth 05 x locking screws from 16 60 mm and 05 x cortical screw from 16 60mm at 5 mm increments , 2.7mm proximal femur varus osteotomy plate 100 degrees, 110 degrees and 130 degrees with 03x locking screws from 16 to 60mm and 3x cortical screwsfrom 16 to 60mm at 5mm increments , 3.5mm proximal femur varus osteotomy plate 100 degrees, 110 degrees and 130 degrees with 03x locking screws from 16 to 60mm and 3x cortical screwsfrom 16 to 60mm at 5mm increments , 5mm proximal femur varus osteotomy plate 100 degrees, 110 degrees and 130 degrees with 03x locking screws from 16 to 60mm and 3x cortical screwsfrom 16 to 60mm at 5mm increments , paediatric rail fixator system, rail 150mm long, 02 clamps, 2x cd units, threaded schanz screws 2.5 and3.5mmx 4 ( 1 set ) , 3.5mm proximal tibial medial plate ( tt ) assorted size ( lt / rt ) with 5 locking and 3 cortical screw , schanz pin 4.5 x 150mm ( 16mm thread ) ss , schanz pin 3.5 x 75 100mm ( 16mm thread ) ss , schanz pin 5 x 150mm ( 16mm thread ) ss , guide wire 2mm threaded tip , proximal femoral locking plate assorted size with 8 nos compitable screw ( complete set ) , 4.5mm lcp narrow plate ( tt ) assorted size , 4.5mm lcp broad plate ( tt ) assorted size , trigen intertan 130 degee assorted size with 01 lag, 01 compression screw and 2 locking bolt , uncemented modular radial head ( with ha coated steam ) , high tibial opening wedge osteotomy peek plate , high tibial opening wedge osteotomy titanium plate , distal femur opening wedge osteotomy peek plate , flat foot correction plate set , ankle fusion plate , lisfranc fracture plate set , tensionable all suture system for fracture reduction , patella fracture repair system , patella suture plate set , expendable femoral nail with 2 locking screw assorted size , expendable tibial nail with 4 locking screw assorted size , expendable humerus nail with 2 locking screw assorted size , cable assembly circlage cable ( assorted size ) , foot & ankle anatomically precontoured calcaneal plates with 3.5mm screw system ( small / medium / large ) , foot & ankle anatomically precontoured mini link plates with 2.4mm / 2.7mm screw system ( 2, 3, 4, 5, 6 hole ) , foot & ankle anatomically precontoured stick plates with 3.5mm / 2.7mm screw system ( 2, 3, 4, 5, 6 hole ) , foot & ankle straight plate with 2.4 mm screw system , foot & ankle anatomically precontoured midfoot tmt plates with 3.5mm / 2.7mm screw system ( small, medium ) , foot & ankle anatomically precontoured midfoot tmt plates with 2.4mm / 2.7 mm screw system ( small, medium ) , foot & ankle anatomically precontoured midfoot c plates with 2.4mm / 2.7 / 3.5 / 5 mm screw system ( large, medium ) , foot & ankle anatomically precontoured universal x plates with 3.5mm screw system ( 2, 4, 6, 8, 10 left / right ) , foot & ankle anatomically precontoured mini universal x plates with 2.4 / 2.7mm screw system ( small, medium, large ) , foot & ankle anatomically precontoured first mtp fusion plates with 2.7 / 3.5mm screw system ( left / right ) , foot & ankle anatomically precontoured mini y plates with 2.4 / 2.7mm screw system ( small , large ) , foot & ankle anatomically precontoured lepidus plates with 2.4 / 2.7mm screw system ( small , large ) , foot & ankle anatomically precontoured mini x plates with 2.4 / 2.7mm screw system ( 4 hole ) , foot & ankle anatomically precontoured ankle y plates with 3.5 mm screw system ( left , right ) , foot & ankle anatomically precontoured ankle l plates with 2.7 mm screw system ( left , right ) , foot & ankle anatomically precontoured rhomboid plates with 3.5 mm screw system ( small, medium, large ) , foot & ankle arthrodesis nail with 6 bolt ( 3.9 / 4.9mm ) and optimise compression option , lcp distal femur antero medial plate rt / lt with 5 locking and 5 cortical screw assorted size tt , lcp distal ratius styloid plate rt / lt with 4 locking and 4 cortical screw assorted size tt , lcp small forearm 2.7 mm with 5 locking and 5 cortical screw assorted size tt , lm pelvic infrapectineal plate rt / lt , miscellaneous , latex free gloves size 7, 7.5, 8 ( each 200 ) , oscilating saw blade assorted size , synthetic prime cast 10 mm , synthetic prime cast 15 mm , oscilating saw blade small , oscilating saw blade medium , oscilating saw blade large , disposable bilateral tkr drape set with consisting of 01 bilateral drape set 04 reinforcement gown, 04 screen cover 02 trolley cover 02 leg cover with 08 ot towel & cling film , disposable tkr drape set consisting of 01 bilateral drape set 04 reinforcement gown, 04 screen cover 02 trolley cover 02 leg cover with 08 ot towel & cling film , disposable thr drape set consisting of 01 bilateral drape set 04 reinforcement gown, 04 screen cover 02 trolley cover 02 leg cover with 08 ot towel & cling film , cling film sterile pack , pop bandages 15 cm , pop bandages 10 cm , disposable sterile tourniquet assorted size ( usfdi ) , pulse lavage , disposable bvb gown , white mop large 30x20cm , encore orthopaedics gloves assorted size , encore orthopaedics gloves ( size 7 ) , encore orthopaedics gloves ( size 7.5 ) , encore orthopaedics gloves ( size 8 ) , xl prep resistant ink coloured marker , bone cement 40 gm with gentamycin , subcuticular stapler , absorbale subcuticular staples , chlorhexidine gluconate microbicidal , synthetic ha powder 1cc , vacuum mixing system , disposable arthroscopy drape set , disposable leg o drape , disposable leg u drape , disposable screen cover , disposable trolley cover , disposable reinforcement gown , disposable water proof wrap around gown , cling drape size 15x500cm , disposable ioban large , disposable ioban medium , knee cylinder splint large 60x18x3.5 , knee cylinder splint medium 58x17x3.5 , knee cylinder splint small 42x14x3.5 , dermimarker thick , water proof dressing 10cm , water proof dressing 15cm , water proof dressing 20cm , disposable c arm cover 2 pcs , disposable c arm cover 3 pcs , granules ( 1cc ) bone graft , granules ( 10cc ) bone graft , chips ( 10cc ) bone graft , blocks 30x15x6 bone graft , blocks 30x15x7 bone graft , blocks 30x15x8 bone graft , blocks 30x15x9 bone graft , gentamicin beads 10 , gentamicin beads 30 , gentamicin beads 60 , synthetic absorbable polygalactin 910 polyglycolic acid coated size 2, 90 cms, 1 / 2 circle reverse cuting needle 50 mm , poygalactin braided no. 1 / 0, 90 cms, 1 / 2 circle reverse cutting, 36mm needle , synthetic absorbable polygalactin 910 polyglycolic acid coated size 1, 90 cms, 1 / 2 circle reverse cutting needle 50 mm , synthetic absorbable polygalactin 910 polyglycolic acid coated with polycaprolate size 2 / 0, 70 90cm, 1 / 2 circle reverse cutting 40 mm , disposable cannula with obturator 6.5mmx70 75mm , disposable cannula with obturator 8mmx70 75mm , disposable cannula with obturator 8.5mmx70 75mm , knee arthroscopy drape set consistig of: knee arthroscopy drape with double gripper and fluid collection pouch 1 nos ( size:190x300cmc ) , camera cover 1 nos , drainage system with nozzle 1 nos, plain sheet ( size 120x210cms ) 1nos, back table cover 1 nos, breathable viral barrier wraparound gown 2 nos, foot guard 2 pairs, face mask with eye shield 2 pcs, hand towels 4 pcs and hood caps 2 pcs. , shoulder arthroscopy drape set consistig of : shoulder arthroscopy drape with fluid collection pouch 1 os ( size 190x300cms ) , camera cover 1 nos, drainage system with nozzle 1 nos, plain sheet ( size 120x210cms ) 1 osback table cover 1 nos breathable viral barrer wraparound gown 2 nos, foot guard 2 pairs, face mask with eye shield 2 pcs, hand towels 4 pcs and hood caps , upper limb drape set consisting of: o drape with gripper size 240x340cms 1 no, patient legging 1pc, cling film 1 pc, impervious u drape 1 pc, plain sheet size: 120x210cms 1 pc, cautery bag 1 pc, breathable viral barrier wraparound gown 2 nos, foot guard 2 pairs, face mask witheye shield 2 pcs , 4 pcs hand towels and hood caps 2 pcs , lower limb drape set consisting of: o drape with gripper 1 pc ( size 190x350cms ) , patient legging 1 pc, cling film 1 pc, ipervious u drape 1 pc, plain sheet 120x 210cms 1 pc, mayo stand cover with absorbent area 1 pc , back table cover 1 pc , cautery bag 1 pc, breathable viral barrier wraparound down 2 nos, foot guard 2 pairs, face mask with eye shield 2 pcs , 4 pcs hand towels and hood caps 2 pcs. , disposable drill , disposable saw , vac dressing assorted size consisting ( pad, tubing and canister ) , vac silverdressing assorted size ( pad, tubing and canister ) , cartilage regenerative medical kit for autologous chondrocyte implantation , bone regenerative medical kit for autologous bone implantation , fully resorbable antibioticcrystal for bone regeneration assorted size , pen type surgical blade , bone graft ha +tcp cubes , bone graft 10 microns, size 10cc, 2.0 3.0mm granules , polypropylene non woven with cellulose et polyacrylate de sodium size 78.7 x 23.6 in , cellulose and sodium polyacrylate polypropylene non woven size : 28.34 x 14.56 in , cellulose and sodium polyacrylate polypropylene non woven airlaid and blue polypropylene barrier size : , single use sponge with chamomilla recuitita ( matricaria ) , ci 42090, sodium chloride, sodium benzoate sice : 20 x 20cm , hygienic cover for urinal support with super absorbent pad in cover 100% recyclable material , vomit support made of durable and 100% recyclable polypropylene plastic , bedpan support made of durable and 100% recyclable polypropylene plastic , urinal support made of durable and 100% recyclable polypropylene plastic , hygienic cover for vomit sad in cover 100% support with super absorbent recyclable material , hygienic cover for bedpansad in cover 100% support with super absorbent recyclable material , rom knee brace ( iso / ce / who gmp ) , acl / pcl brace ( iso / ce / who gmp ) , below knee stocking ( iso / ce / who gmp ) , above knee stocking ( iso / ce / who gmp ) , walker child size ( iso / ce / who gmp ) , bunion splint ( iso / ce / who gmp ) , arm siling pouch ( adult ) ( iso / ce / who gmp ) , wrist and forearm splint ( iso / ce / who gmp ) , cervical pillow ( iso / ce / who gmp ) , knee immobilizer ( iso / ce / who gmp ) , ankle support ( iso / ce / who gmp ) , shoulder immobilizer ( iso / ce / who gmp ) , back rest ( iso / ce / who gmp ) , walking strick quadripod ( iso / ce / who gmp ) , walking strick tripot ( iso / ce / who gmp ) , ankle stirrup ( air gel cushion ) , ankle support with silicon pad for tendo achilles , heel relief shoe offloader , pawlik bandage stable , pawlik bandage with hook & loop fastener , ideal hip abduction brace , lumbosacral spinal orthosis ( semi rigid ) , shoulder abduction orthosis , elbow support with silicon pads , wrist orthosis with hand support , thumb, hand & forarm orthosis , hand & forarm orthosis , super oxidized solution with hypochlorous acid 0.003% and sodium hypochlorite 0.004% with neutral ph ( usfda approved ) in spray bottle of 100ml , super oxidized solution with hypochlorous acid 0.003% and sodium hypochlorite 0.004% with neutral ph ( usfda approved ) in spray bottle of 500ml , super oxidized solution with hypochlorous acid 0.003% and sodium hypochlorite 0.004% with neutral ph ( usfda approved ) in spray bottle of 1 ltr. , super oxidized gel with hypochlorous acid 0.008 % and sodium hypochlorite 0.002% with neutral ph ( usfda approved ) in spray pump bottle of 60 gm , super oxidized gel with hypochlorous acid 0.008 % and sodium hypochlorite 0.002% with neutral ph ( usfda approved ) in spray pump bottle of 120 gm. , synthetic absorbable coated vicryl plus antibacterial sutures size no 1 ( polyglactin 910 with triclosan ) with ½ circle reverse cutting os , synthetic absorbable coated vicryl plus antibacterial sutures size no 2 ( polyglactin 910 with triclosan ) with ½ circle reverse cutting os , synthetic absorbable coated vicryl plus antibacterial sutures size no 0 ( polyglactin 910 with triclosan ) with ½ circle reverse cutting os , synthetic absorbable coated vicryl plus antibacterial sutures size no 2 / 0 ( polyglactin 910 with triclosan ) with ½ circle reverse cutting os , five layer foam dressing with absorber spreading and retention layers of foam, super absorbent size 10 x 20cm , five layer foam dressing with absorber spreading and retention layers of foam, super absorbent size 10 x 25cm , five layer foam dressing with absorber spreading and retention layers of foam, super absorbent size 10 x 30cm , triple layered anti microbial foam dressing with silver sulfate, silver content 1.2 mg / cm2 with soft silicone wound contact layer 10 x 20cm , triple layered anti microbial foam dressing with silver sulfate, silver content 1.2 mg / cm2 with soft silicone wound contact layer 20 x 50cm , bone cement antibiotic 20gms , stick pencil , filter suction catheter with holes , flexible pen , decontaman wipes , cleanisept wipes maxi , water proof cast liner rolls 2 inch , water proof cast liner rolls 3 inch , water proof cast liner rolls 4 inch , protective under cast adhesive strip: width 1.25 inch and length 10 feet approx , water proof cast liners for hip spica for infants and pediatric population , absorbable skin ( subcuticular ) stapler with 30 pins , sterile disposable bone marrow aspiration needle , sterile disposable bone marrow biopsy needle , sterile pack for hooddisposable , surgical hood for surgery , cement syringe gun ( sterile packed ) , braided dyed polyglactin for orthopaedic surgery size no 1, 90 cm long thread with taper cut heavy needle. , braided dyed polyglactin for orthopaedic surgery size no 2, 90 cm long thread with taper cut heavy needle. , triclosan coated braided dyed polyglactin for orthopaedic surgery size no 1, 90 cm long thread with taper cut heavy needle. , triclosan coated braided dyed polyglactin for orthopaedic surgery size no 2, 90 cm long thread with taper cut heavy needle. , fiber tape ( sterile, disposable ) , alcohol based sterillium hand rub solution 500 ml bottles , gel based chlorhexidine antiseptic hand rub with moisturiser 500 ml bottles , cutacept ( isopropanol and benzalkonium chloride ) skin disinfectant , sterile disposable dressing set ( dissecting forceps, plastic bowl, kidney tray, gauze piece pkt of 4, two abdominal swabs, towel 50 x 50cm ) , post operative sterile adhesive porous dressing with absorbent pad and confirmative fixative layer 30 cm x10 cm , post operative sterile adhesive porous dressing with absorbent pad and confirmative fixative layer 20 cm x10 cm , post operative sterile adhesive porous dressing with absorbent pad and confirmative fixative layer 10 cm x10 cm , post operative sterile adhesive porous port dressing with absorbent pad and confirmative fixative layer 5 cm x 5 cm , synthetic resin casting bandage 12.5 cmx 3.6 mtr , synthetic resin casting bandage 7.5 cm x 3.6 mtr , ortho roll cast padding cotton size 10 cm x3 mtr , ortho roll cast padding cotton size 15 cm x3 mtr , water resistant synthetic orthopaedic cast padding 10 cm x 3 meter , water resistant synthetic orthopaedic cast padding 15 cm x 3 meter , surgical face mask with eye protecting film , semi rigid fiberglass cast tape for paediatric use ( eg dynacast® soft ) 5 cm x 3.6 m , non adhesive elastic compression crepe bandage 10 cm x 4.5 m ( 100% cotton and autoclavable ) , non adhesive elastic compression crepe bandage 15 cm x 4.5 m ( 100% cotton and autoclavable ) , self adherent elastic compression crepe bandage 10 cm. , self adherent elastic compression crepe bandage 15 cm . , triple antibiotic tulle gras dressing sterile packed , protective spray film dressing 100ml , sterile disposable arthroscopic camera and cables cover , bandage dvt stocking small , bandage dvt stocking medium , bandage dvt stocking large , dynamic wrist cock up with finger extension right / left ( sizes – s / m / l / xl / xxl as per requirement ) , paediatric clavicle brace , paediatric arm sling strap – universal , disposable floor suction , stabilized formulation of hydrogen peroxide 10% v / v with 0.01% w / v silver, i ltr , germicidal detergent and deodorant effective in hard water ( calculated as caco3 ) in the presence of a moderate amount of soil ( 5% orgainc serum ) according to the aoac use dilution test disinfects, cleans, and deodorizes in one laboursaving step. , antimicrobial cleansing crossbond fabric for kin & mucous membrane containing polyhexanide 0.3g, microwavble size 20x30cm, pack of 10 , disinfection alcohol wipes containing: 45.0 g ethanol, size 14x20cms, pack of 80 wipes , terminal point of use, 0.2 micron sterililizing grade ( fda ) water filter , hygenic cover for bedpan support and comfort with super absorbant pad in cover ( recycled material ) , size 62.2 x 45.7cm ( box of 20 ) , hygenic cover for urinal support and comfort with super absorbant pad in cover ( recycled material ) , size 35 x 15.5cm ( box of 20 ) , braded hot and cold pack with hole in centre for fitting in elbow and knee , compression cold therapy for shoulder with air pump size land xxl , compression cold therapy for ankle with air pump size land xxl , compression cold therapy for elbow with air pump size land xxl , polyurethane ester dressing 11 cm x 8cm x 1.8cm for npwt instillation therapywith holdercassette fortopical solution and1000 ml canister forexudate collection , it should bedcgi andfda & ce certified , the unique three layer design dressing 18x12.5cm x varying thicknesses ( 0.8–3.2cm ) ; dressing forautolyticdebridement ofwoundsfornpwt instillation therapysystem alsocontains wound ruler;advanced drape;cavilon no sting barrier film, enhancedpad and tubing, it shouldmade up of grey polyurethane ester and fda & ce certified with cassetteholderfortopicalsolutionandcanister for exudate collection.itshould bedcgi andfda & ce certified , sterile, freeze dried composite of 44% oxidized regenerated cellulose ( orc ) , 55% collagen and 1% silver orc. silver orc contains 25 % w / w ionically bound silver, a well known antimicrobial agent european ce and dcgi certified size 10x10cm , courtry lead expendable positon can be fixed at any length form 70 200mm , self adhesive absorbent surgical dressing with soft silicone adhesive wound contact layer with absorption layer made up of polycrylate fibres & polyester fibres with high exudate absorption & retention capacity also with flex cut technology. ( assorted size ) , activated charcoal dressing with silver, enclosed in a nonadherent nylone sleeve , size ( 6.5x9.5 cm ) , activated charcoal dressing with silver, enclosed in a nonadherent nylone sleeve , size ( 10.5x10.5 cm ) , activated charcoal dressing with silver, enclosed in a nonadherent nylone sleeve , size ( 10.5x19 cm ) , protease modulating matrix is comprised of 45% oxidized regenerated cellulose ( orc ) and 55% collagen in a sterile, freeze dried composite.size 28cm square. , protease modulating matrix is comprised of 45% oxidized regenerated cellulose ( orc ) and 55% collagen in a sterile, freeze dried composite.size 123cm square. , non adherentwound carboxymethyl cellulose ( cmc ) and silver coated nylon fibers, with a non adherent wound contact layer.size ( 5cm x 5cm ) , non adherentwound carboxymethyl cellulose ( cmc ) and silver coated nylon fibers, with a non adherent wound contact layer. size ( 11cmx11 cm ) , non adherentwound carboxymethyl cellulose ( cmc ) and silver coated nylon fibers, with a non adherent wound contact layer. size ( 10cmx20 cm ) , non adherentwound carboxymethyl cellulose ( cmc ) and silver coated nylon fibers, with a non adherent wound contact layer. size ( 2.5cmx30.5cm ) , non adhering knitted cellulose acetate mesh assorted size , adaptic touch non adhering silicone dressing assorted size , hydro alginate antimicrobial dressing with silver is a sterile, non woven pad composed of high g ( guluronic acid ) alginate, carboxy methyl cellulose ( cmc ) and silver coated fibers, size ( 5cm x 5cm ) , hydro alginate antimicrobial dressing with silver is a sterile, non woven pad composed of high g ( guluronic acid ) alginate, carboxy methyl cellulose ( cmc ) and silver coated fibers, size ( 11cmx11 cm ) , hydro alginate antimicrobial dressing with silver is a sterile, non woven pad composed of high g ( guluronic acid ) alginate, carboxy methyl cellulose ( cmc ) and silver coated fibers , size ( 10cmx20 cm ) , hydro alginate antimicrobial dressing with silver is a sterile, non woven pad composed of high g ( guluronic acid ) alginate, carboxy methyl cellulose ( cmc ) and silver coated fibers, size ( 2.5cmx30.5cm ) , aquacel ag scd ( surgical cover dressing ) , negative portble pressure wound therapy system canister free silicone adhesive large dressing size 10 x 30 , negative portble pressure wound therapy system canister free silicone adhesive large dressing size 10 x 22 , negative portble pressure wound therapy system canister free silicone adhesive large dressing size 15 x 15 , negative portble pressure wound therapy system canister free silicone adhesive large dressing size 15 x 20 , negative portble pressure wound therapy system canister free silicone adhesive large dressing size 15 x 30 , 100% ha ( hydroxyapetite ) based sbg with 80% porosity. synthetic bone graft ( 10cc ) usfda based ce approved , topical tissue adhesive ampouls 0.75ml ( cyanoacrylate with flow control ) , wound clot trauma gauze , suction & waste fluid management system , pico battery operated single use npwt portable device ( dressing size 15cm x 30cm each , paediatric fibre cast 2 , paediatric fibre cast 3 , paediatric fibre cast 4 , walker paediatric , paediatric tourniquet cuff , universal mini external stablization system set complete ( jess ) for ctev large , universal mini external stablization system set complete ( jess ) for ctev medium , universal mini external stablization system set complete ( jess ) for ctev small , absorbable calcium sulphate powder ( pharmaceutical grade ) with bead kit with option to add antibiotic of choice 5ml, 10ml , multi purpose tubular bandage adjusting to the contours of the body with different color coding for easy identification, washable with three dimensional stretch technology ( assorted size ) , antimicrobial five layered highly absorbent foam dressing, with absorbent, spreading & retention layers, with self adherent borders, bacterial and viral barrier. water proof polyurethane film with soft silicone wound contact layer ( assorted size ) , self adhesive porous non woven fixation dressings for swabs, catheters and tubes 5x10, 10x10cm, 15x10cm, 30x10cm , non absorable, coated polyester green, 1 / 2 circle tp heavy 55mm, 100cm no 5 , trusynth absorable, polyglactin 910 size 2, 1 / 2 circle reverse cutting orb haevy, 40mm 90cm , disposable sterile skin stapler pin removal , ls belt premium size s, m, l, xl, xxl , hinged knee cap open patella size m, l, xl, xxl , elastic knee cap size s, m, l, xl, xxl , ankle support size s, m, l, xl, xxl , ankle support with binder size s, m, l, xl , foot drop splint size s, m, l, xl , taytor brace size m, l, xl , clavicle brace size s, m, l, xl, xxl , shoulder immobiliser size s, m, l, xl, xxl , wrist brace , wrist support with thumb hold , thumb spica splint , arm pouch sling size s, m, l, xl, xxl , cervical collar s, m, l, xl , tennis elbow support universal , walker hd adjustable , walking stick tripod , walking stick monopod , walking stick tetrapod , elbow cructch , rib belt m / f , abdominal binder s, m, l, xl , tibial gurad size m, l, xl , weight cuff1 / 2, 1, 2, 3 kg , thigh suppoort size m, l, xl , philadelphia collar size s, l, m, xl , cock up splint static , back support executive; bis / us fda / eu ce ( full quality assurance ) ; back support made of pulling system which provides correct ergonomic compression , should have two way pulling cord with fastern fitting in front, can relieve lower back pain and improve spinal stability , back rest universal; bis / us fda / eu ce ( full quality assurance ) ; made of molded foam with removable / washable cover with zipper. should be light in weight & easy to carry. , clavicle strap ( assorted ) ; bis / us fda / eu ce ( full quality assurance ) ; should be made of 4mm thick pad for back panel, should have 35 40mm wide shoulder strap to foam figure of 8 design. , wrist and forearm brace l / r ( assorted ) ; bis / us fda / eu ce ( full quality assurance ) ; made from spandex +nylon +bamboo charcoal fiber, woven non stitched. size s, m, l, xl , thumb spica splint universal; bis / us fda / eu ce ( full quality assurance ) ; should be made 4mm thick padded fabric with terry lining for comfort, should have 1 / 2 mallable splint. should have 38mm wide velcro closure. , rom knee brace ( assorted ) ; bis / us fda / eu ce ( full quality assurance ) ; should be made of 3 layered soft foam material with patellar open design, should have strong durable aluminium hinge rom with flexion and extension stop setting. rom should have static pin lock option. should have 4 fastern for closure. size xl , knee cap ( multi directional stretch ) ; bis / us fda / eu ce ( full quality assurance ) ; knee cap made from spandex +nylon +bamboo charcoal, fiber, woven non stitched with anti slip silicone gripper on top. size s, m, l, xl , shoe cast large; bis / us fda / eu ce ( full quality assurance ) ; should be made in double layered waterprooff sole, should be made in canvas material. size large , cot finger splint; bis / us fda / eu ce ( full quality assurance ) ; should be made of eva foam padding on inside with aluminium construction on outer part. should have velcro for easy closure of splint , neoprene knee support with hinges ( assorted ) ; bis / us fda / eu ce ( full quality assurance ) ; neoprene functional knee support made of 3mm neoprene & lycra material with 4 way stretch. should have small pores for ventilation & easy wearing. should have three velcro closure with buckle for wrap around fitting. should have padded patella opening. should have two 1.25 metal hinges on medial & lateral sides. should have tubular design for easy application on knee. size s, m, l, xl , neoprene knee cap ( open patella ) ; bis / us fda / eu ce ( full quality assurance ) ; neoprene knee cap ( open patella ) made of 3mm neoprene & lycra material with 4 way stretch. should have small pores for ventilation & easy wearing. should have two velcro closure with buckle for wrap around fitting. should have padded patella opening with 4mm thick gel ring on patella for proper pressure dispersion. should have tubular design for easy application on knee. size s, m, l, xl , neoprene wrist and thumb support; bis / us fda / eu ce ( full quality assurance ) ; should be made of neoprene 3mm perforated layered with self stick fabric, should have 125mm wide wrap around strap , should have 25mm diameter hole for thumb opening , neoprene ankle wrap; bis / us fda / eu ce ( full quality assurance ) ; should be made of neoprene 3mm perforated layered with self stick fabric, should have 75mm wide wrap around strap that should form figure of 8design , should have 25mm diameter hole for thumb opening. size s, m, l , neoprene wrist & forearm brace ; bis / us fda / eu ce ( full quality assurance ) ; made up of fused & perforated neoprene material for better heat retention with aluminium stray fit left or right hand. size s, m, l, xl , leg traction kit; bis / us fda / eu ce ( full quality assurance ) ; traction pad should be made of 10mm thick laminated foam for leg traction brace. should have triple velcro closure. should have u shaped wrought iron frame to hold optimum weight & height adjustment. should have high quality weight bag with proper weight levels marking from 1kg to 10kg. should have non stretchable weight cords , walking stick monopod; bis / us fda / eu ce ( full quality assurance ) ; should be made up of alluminium with adjustable height with silicon shoe , walking stick quadripod; bis / us fda / eu ce ( full quality assurance ) ; aluminium four leg with handle grip and silicone shoe , walker adustable; bis / us fda / eu ce ( full quality assurance ) ; adjustable height ( 80cm 95cm ) , folding walker, lightweight 4 legged all aluminium pipe two soft pvc handgrips on the handrail with silicon rubberbottom pod size l, xl , walker static; bis / us fda / eu ce ( full quality assurance ) ; balanced & firm four leg steel frame with handle grip , elbow crutches adjustable; bis / us fda / eu ce ( full quality assurance ) ; elbow crutch aluminium light weight, adjutable height ( 100cm 115cm ) telescopic complete with silicon rubber bottom pod and forearm support with cuff. , back wrap; bis / us fda / eu ce ( full quality assurance ) ; should be made of neoprene blend wrap, reusable / micro wavable cold and hot gel pack insulating wrap with adjustable strap. size universal , knee sleeve; bis / us fda / eu ce ( full quality assurance ) ; should be made of high perfrormance fabric and padwith proven compression technology , dynamic cock up splint lt universal; bis / us fda / eu ce ( full quality assurance ) ; should be made of moulded aluminium frame with eva foam padding, should have 5 finger springs with canvas support & double velcro strap for easy closure. , dynamic cock up splint rt universal; bis / us fda / eu ce ( full quality assurance ) ; should be made of moulded aluminium frame with eva foam padding, should have 5 finger springs with canvas support & double velcro strap for easy closure. , arm sling pouch; bis / us fda / eu ce ( full quality assurance ) ; breathable fabric with heavy duty strap and two way buckle system. size s, m, l, xl , abdominal binder; bis / us fda / eu ce ( full quality assurance ) ; should be made in 10 wide breathable elastic with .5 wide durable & mouldable strips for extra support to the abdoment . should have 50mm wide velcro closure on each side for adjustable & comfortable fitting. , arm sling strap ( universal ) ; bis / us fda / eu ce ( full quality assurance ) ; should be made in 38mm durable strap with two way adjustable buckles. , ankle binder; bis / us fda / eu ce ( full quality assurance ) ; made up of fused neoprene material with two flexible strays and wrap around elastic support , cervical collar ( hard ) ; bis / us fda / eu ce ( full quality assurance ) ; should be made of soft polyurethane foam: 1.2 density. should have hypollergic skin friendly thick cotton stockinette for sweat absorbant and air circulation. , elbow support; bis / us fda / eu ce ( full quality assurance ) ; elbow support made from spandex +nylon +bamboo charcoal fiber, woven non stitched with lateral media silicon padding size s, m, l, xl , heel cushion ; bis / us fda / eu ce ( full quality assurance ) ; should be made of medical grade silicon, material should be hypo allergenic, non toxic & non flammable. should be easy washable. size s, m, l , insole ( full ) universal; bis / us fda / eu ce ( full quality assurance ) ; insole should have medial arch & heel cover, should be made of medical grade silicon, material should be hypo allergenic, non toxic & non flammable. should be easy washable. , knee immobilizer; bis / us fda / eu ce ( full quality assurance ) ; fine foam fused fabric with five aluminium moulded strays for medial, lateral and anterior support having atleast 19 length size s, m, l, xl , l s support –medium; bis / us fda / eu ce ( full quality assurance ) ; with four contoured and malleable aluminium strays, breathable & sweat absorbable towel inner lining with double pull elastic. , l s support –large; bis / us fda / eu ce ( full quality assurance ) ; with four contoured and malleable aluminium strays, breathable & sweat absorbable towel inner lining with double pull elastic. , l s support –x large; bis / us fda / eu ce ( full quality assurance ) ; with four contoured and malleable aluminium strays, breathable & sweat absorbable towel inner lining with double pull elastic. , l s belt –small; bis / us fda / eu ce ( full quality assurance ) ; with four contoured and malleable aluminium strays, breathable & sweat absorbable towel inner lining with double pull elastic. , l s belt –xx large; bis / us fda / eu ce ( full quality assurance ) ; with four contoured and malleable aluminium strays, breathable & sweat absorbable towel inner lining with double pull elastic. , tlso brace; bis / us fda / eu ce ( full quality assurance ) ; should be made of foam laminated on 4mm eva for back frame.should have .5 vertical & horizontal malleable aluminium stays, should have 38mm wide clavical strap. should have 4 for navel closure &3 for chest closure breathable elastic panels . should have velcro closure : 2 strips each for navel & chest closure. , toe separator; bis / us fda / eu ce ( full quality assurance ) ; should be made of medical siliconand anatomically shapred , shoe cast; bis / us fda / eu ce ( full quality assurance ) ; should be made in double layered waterprooff sole, should be made in canvas material. size s, m, l, x large , pcl brace; bis / us fda / eu ce ( full quality assurance ) ; ideal for acl / pcl & oa patient, consist of mouled plastic & foam with integrated steel struts which limits movement to the side.the brace should be rigid with hinge & strap system. , skin traction kit; bis / us fda / eu ce ( full quality assurance ) ; shoud have durable foot plate attached to a non woven fabric & padded with a breathable foam liner to cushion.should be latex free. should have 75mm x 2mtr wide crepe bandage for wrapping, should have u shaped wrought iron frame to hold optimum weight & height adjustment. should have high quality weight bag with proper weight levels marking from 1kg to 10kg. should have non stretchable weight cords. , acl / pcl ligmanet brace; bis / us fda / eu ce ( full quality assurance ) ; ideal for acl / pcl & oa patient, consist of mouled plastic & foam with integrated steel struts which limits movement to the side.the brace should be rigid with hinge & strap system. , ankle support adult; bis / us fda / eu ce ( full quality assurance ) ; ankle support made from spandex +nylon +bamboo charcoal fiber, woven non stitched with lateral media silicon padding size s, m, l, xl , compression stockings below knee; bis / us fda / eu ce ( full quality assurance ) ; class ii medical compression stocking b / k, should be made of cotton spandex with max pressure 20 30mmhg at ankle. gradually decreasing along height size s, m, l, xl , compression stockings above knee; bis / us fda / eu ce ( full quality assurance ) ; class ii medical compression stocking a / k, should be made of cotton spandex with max pressure 20 30mmhg at ankle. gradually decreasing towards the thigh having anti skid silicon grippers size s, m, l, xl , elbow cryo cuff; bis / us fda / eu ce ( full quality assurance ) ; should be made of an integrated approach to cold therapy to be used with cryo cooler. should be anatomically designed to fit and minimise the tissue damage. size universal , shoulder wrap; bis / us fda / eu ce ( full quality assurance ) ; should be made of neoprene blend wrap, reusable / micro wavable cold and hot gel pack insulating wrap with adjustable strap. size universal , hallux valgus splint; bis / us fda / eu ce ( full quality assurance ) ; should be made up of breathable 3 layered puf fused fabric. should be made available for left and right separately , coccyx cushion; bis / us fda / eu ce ( full quality assurance ) ; should be made up of medical grade p u foamwith easily removable and washable cover. size universal , cryo cuff cooler; bis / us fda / eu ce ( full quality assurance ) ; should be of combined with rapid inflation and gradual sequential asymmetrical compression. cuffs should be breathable and comfortable for foot, calf and thigh components , thigh support ( padded to prevent proximal femur fractures in elderly; bis / us fda / eu ce ( full quality assurance ) , arm sling pouch s; bis / us fda / eu ce ( full quality assurance ) ; breathable fabric with heavy duty strap and two way buckle system. size small , dvt stocking; bis / us fda / eu ce ( full quality assurance ) ; class i stocking above knee with foot inspection window & anti slip silicone gripper. size s, m, l, xl , cuff & collar sling; bis / us fda / eu ce ( full quality assurance ) ; should have uniquely designed to treat clavicle fractures, humerus fractures, shoulder or arm dislocations, wrist and hand fractures / sprains, post shoulder surgery , medial arch; bis / us fda / eu ce ( full quality assurance ) ; should have medial arch & heel cover, should be made of medical grade silicon, material should be hypo allergenic, non toxic & non flammable. should be easy washable. , knee support; bis / us fda / eu ce ( full quality assurance ) ; knee support made from spandex +nylon +bamboo charcoal fiber, woven non stitched with silicon patellar ring and lateral medial spiral strays with anti slip silicon gripper size s, m, l, xl , shoulder abduction splint; bis / us fda / eu ce ( full quality assurance ) ; shoulder abduction orthosis, made of adjustable shoulder strap, pillow with waist strap. should hav detachable soft gel ball, universal size for right and left hand. size s, m, l , hybride mess cast ( hm cast ) assorted size with stockinett , neodisher lm2 ( instrument cleaner ) in ltr , disposable shoe cover , disposable facesheiled mask , disposable goggles , disposable skin marking pen , stich bonded hydrofiber dressings with 1.2% impregnated lonic silver with sustained and on demand antimicrobial activity with high exudate management capability and self adherent waterproof moist wound ressing made up of triple hydrocolloid elastomeric polymer matirx sizes 9x10cm, 9x25cm, 9x30cm, 9x35cm , platelet rich plasma +collagen solution for tendinopathies , bone marror aspiration centrifuge system , bio absorbableheadless screws , injectable form monoporous calcium set , non absorable, coated polyester green, 1 / 2 circle tp heavy 45mm, 100cm no 2 , non absorable monofilament polypropylene 1 / 2 circle rc heavy45mm, 100cm size 1 , non absorable monofilament polypropylene 1 / 2 circle tc heavy30mm, 90cm size 0 , synthetic absorbable surgical suture monofilament poligecaprone 25 undyed size 2 0, 1 / 2 circle rb 30mm, 70 cm , synthetic absorbable surgical suture monofilament poligecaprone 25 undyed size 3 0, 3 / 8 circle rc 26mm, 70 cm , pulse lavage with intramedullary canal brush , montract neck traction , orthopedic suction set with extra filter + 23 cm curved tip *1, 23 cm straight tip 1 with 2.5cm suction connecting tube id.6mm , disposable dvt prophylaxis device , injectable bone substituted for filling bone gaps, containing with radio opacity enhancing agent, should we moldable and sterile packed 10ml , injectable bone substituted for filing bone gaps, containing with radio opacity enhancing agentshould be moldable and sterile packed 5ml , cement mixing bowl with spatula , high viscosity bone cement with green color pigment with gentamicin and vancomycin 40gm , high viscosity bone cement with green color pigment with gentamicin and clindamycin 40gm , tooth brush blade for unicondylar knee replacement ( assorted size ) , reciprocating blade for unicondylar knee replacement ( assorted size ) , drill, twist, s.s., dia 4 mm, length 7.62 cm , drill twist ss dia 4.4mm, length 7.62cm , drill, twist, s.s., dia 4.8 mm, length 7.62 cm , drill, twist, s.s., dia 6.4 mm, length 7.62 cm , drill, twist, s.s. dia 2.0 mm length 10.16 cm ( 4 ) , drill, twist, s.s. dia 2.4 mm length 10.16 cm , drill, twist, s.s. dia 2.8 mm length 10.16 cm , drill, twist stainless steel , dia 3.2 mm length 10.16 cm , drill, twist, s.s. dia 4.00 mm length 10.16 cm , drill, twist, s.s. dia 4.4 mm length 10.16 cm , drill, twist, s.s. dia 4.8 mm length 10.16 cm , drill, twist, s.s. dia 6.4 mm length 10.16 cm , drill, twist, s.s., dia 2 mm, length 12.70 cm , drill, twist, s.s., dia 2.3 mm, length 12.70 cm , drill, twist, s.s., dia 2.8 mm, length 12.70 cm , drill, twist, s.s., dia 3.1 mm, length 12.70 cm , drill, twist, s.s., dia 3.3 mm, length 12.70 cm , drill, twist, s.s., dia 3.9 mm, length 12.70 cm , drill, twist, s.s., dia 4.4 mm, length 12.70 cm , drill, twist, s.s., dia 4.8 mm, length 12.70 cm , drill, twist, s.s., dia 6.4 mm, length 12.70 cm , heel walking rubber large size , heel walking rubber medium size , hook, for strirrup , knife, meniscus, smillie, straight, chisel type blade, 17.78 cm stainless steel , knife, meniscus, smillie, curved, 17.15 cm stainless steel ( for dislocating central attachment of the posterior horn ) , knife, meniscus, smillie, curved, 17.15 cm stainless steel ( for dividingposterior third from the capsule , knife tenotomy blunt ended , knowles pin , stockinet 5.08 cm bleached , stockinette, 10.16 cm, bleached , stockinette, 35.56 cm, bleached , square intra medullary set for radius and ulna , screw driver for single slot screw , tape, broad, piece of 16.5 metre , tape, narrow, piece of 16.5 metre , wire ( kirschner ) with drill head ended 25 cm long x 1.5 mm dia, stainless steel , titanium anchor 2.8 / 2.4, 3.5, 5.0 mm ( for components see appx ) , bio anchor 2.8 / 2.4, 3.5, 5.0 mm , bio absorbable 3.7 mm tag rod style , clear trac cannula 5 mm to 10 mm various sizes , suture grasper straight , suture grasper 35 degree , rci tibial tapered screw 7, 8, 9, 10, 11 mm all sizes , bio absorbable interference screws 7, 8, 9, 10, 11 mm all sizes , endobutton cl 20, 25, 30, 35, 40, 45 , bio anchor 2.8 / 2.4, 3.5, 5.0 mm , bone cement antibiotic loaded 40 gm , bone cement antibiotic loaded 80 gm , cmw 1 , simplex / cmw 3 ( low viscosity ) / cement , pmma ( poly methyl methacrylate ) genta mycin beads of 10 , pmma genta mycin beads of 30 , pmma genta mycin beads of 60 , hemostat gel antibiotic loaded , granules , cancellous bone chips , tapered plug , stockinette 10cms , stockinette 15cms , stockinette 35cms , chlorhexidine hand scrub brush , intraoperative suction set , postoperative suction set , cannulated screw, 4.5mm, self tapping short thread 30 mm , cannulated screw, 4.5mm, self tapping short thread 34 mm , cannulated screw, 4.5mm, self tapping short thread 42 mm , cannulated screw, 4.5mm, self tapping short thread 46 mm , cannulated screw, 4.5mm, self tapping short thread 50 mm , cannulated screw, 4.5mm, self tapping short thread 54 mm , cannulated screw, 4.5mm, self tapping short thread 60 mm , cannulated screw, 4.5mm, self tapping short thread 68 mm , cannulated screw, 4.5mm, self tapping short thread 72 mm , cannulated screw, 4.5mm, self tapping / fully threaded 26mm , cannulated screw, 4.5mm, self tapping / fully threaded 30mm , cannulated screw, 4.5mm, self tapping / fully threaded 34mm , cannulated screw, 4.5mm, self tapping / fully threaded 40mm , cannulated screw, 4.5mm, self tapping / fully threaded 42mm , cannulated screw, 4.5mm, washer 10.0mm dia , guide wire dia 2mm , cannulated drill 5.5 mm , cannulated tap , cannulated screw with washer 65 mm , cannulated screw with washer 70 mm , cannulated screw with washer 75 mm , cannulated screw with washer 80 mm , cannulated screw with washer 85 mm , cannulated screw with washer 90 mm , cannulated screw with washer 95 mm , cannulated screw with washer 100 mm , c.h.s. lags screw a.o type 65 mm , c.h.s. lags screw a.o type 75 mm , c.h.s. lags screw a.o type 65 mm , c.h.s. lags screw a.o type 80 mm , c.h.s. lags screw a.o type 85 mm , c.h.s. lags screw a.o type 90 mm , c.h.s. lags screw a.o type 95 mm , c.h.s. barrel plate auto compression holes 38mm barrel, 130 x 4h , c.h.s. barrel plate auto compression holes 38mm barrel, 130 x 5 h , c.h.s. barrel plate auto compression holes 38mm barrel, 135 x 4 h , c.h.s. barrel plate auto compression holes 38mm barrel, 135 x 5 h , c.h.s. barrel plate auto compression holes 38mm barrel, 135 x 6 h , c.h.s. barrel plate auto compression holes 38mm barrel, 140 x 4 h , c.h.s. barrel plate auto compression holes 38mm barrel, 140 x 5 h , c.h.s. barrel plate auto compression holes 38mm barrel, 140 x 6 h , drill bits h.s.s. ( long length ) 2.5 mm , drill bits h.s.s. ( long length ) 3.2 mm , drill bits h.s.s. ( long length ) 4.5 mm , drill guide eccentric cortical screw xl 3.5 mm , dc plate small xl 10 mm x 49 mm x 4 h , dc plate small xl 10 mm x 61 mm x 5 h , dc plate small xl 10 mm x 73 mm x 6 h , dc plate small xl 10 mm x 85 mm x 7 h , dc plate narrow xl 12 mm x 71 mm x 4 h , dc plate narrow xl 12 mm x 87 mm x 5 h , dc plate narrow xl 12 mm x 103 mm x 5 h , dc plate narrow xl 12 mm x 119 mm x 7 h , dc plate broad xl 16 mm x 119 mm x 7 h , dc plate broad xl 16 mm x 151 mm x 9 h , dc plate broad xl 16 mm x 167 mm x 10 h , dc plate broad xl 16 mm x 183 mm x 11 h , dc plate broad xl 16 mm x 190 mm x 12 h , reconstruction plates for 2.7 mm screws 36 mm ( 4 holes ) , reconstruction plates for 2.7 mm screws 44 mm ( 5 holes ) , reconstruction plates for 2.7 mm screws 52 mm ( 6 holes ) , reconstruction plates for 2.7 mm screws 60 mm ( 7 holes ) , reconstruction plates for 2.7 mm screws 64 mm ( 8 holes ) , reconstruction plates for 2.7 mm screws 80 mm ( 10 holes ) , reconstruction plates for 2.7 mm screws 96 mm ( 12 holes ) , reconstruction plates for 3.5 mm screws 58 mm ( 5 holes ) , reconstruction plates for 3.5 mm screws 70 mm ( 6 holes ) , reconstruction plates for 3.5 mm screws 82 mm ( 7 holes ) , reconstruction plates for 3.5 mm screws 94 mm ( 8 holes ) , drill bit dia 3.5 mm, long , drill bit dia 4.5 mm, long , steinman pins dia 5.0 mm x 150 mm long , steinman pins dia 5.0 mm x 175 mm schanz screws , steinman pins dia 5mm x 150 mm long schanz screws , steinman pins dia 5mm x 175 mm long , steinman pins dia 4.5 mm x 175 mm long ( with short thread 18 mm ) , protective cap for steinman pins dia 5 mm. , fixation tube dia11 mm x 150mm , fixation tube dia dia 11 mm x 250mm , fixation tube dia dia 11 mm x 300mm , fixation tube dia dia 11 mm x 400mm , connecting rods 4mm x 12 , connecting rods 4mm x 6 , connecting rods small l , connecting rods large l , connecting rods z rod , clamps 4 x 4 , clamps 4 x 2.5 , distractors 6mm x 8 , connecting rods 3 mm x 10 , connecting rods 3 mm x 6 , connecting rods 3 mm x 5 , connecting rods small l , connecting rods large l , connecting rods z rod , link joints 3 x 3 , distractors 6 mm x 6 , distractors 6 mm x 8 , foot plate ( medium ) , connecting rods 3 mm x 8 , connecting rods 3 mm x 6 , connecting rods 3 mm x 4 , connecting rod small l , connecting rod large l , connecting rods z , link joints 3 x 3 , distractors 4 mm x 6 , distractors 4 mm x 4 , foot plate ( small ) , allen key 2.5 mm , half ring 130mm , half ring 140mm , half ring 150mm , half ring 160mm , half ring 180mm , 5 / 8 ring 130 mm , 5 / 8 ring 150 mm , 5 / 8 ring 160 mm , threaded rod, 60mm , threaded rod, 80mm , threaded rod, 100mm , threaded rod, 120mm , threaded rod, 150mm , threaded rod, 200mm , threaded rod, 250mm , threaded rod, 300mm , threaded rod, 350mm , threaded rod, 400mm , threaded rod, slotted 40mm , threaded rod, slotted 60mm , grad tele rod, 100 mm , grad tele rod, 150mm , grad tele rod, 200mm , support, male 2 hole , support, male 3 hole , support, male 4 hole , post, female 2 hole 2 , post, female 3 hole , post, female 4 hole , hinge, male high / low profile , hinge, female high / low profile , hinge, 90º low / high , long conn plate, 8 h 155 mm , thread end plate, 5 h, 135 mm , thread end plate, 7 h, 175 mm , short conn plate, 2h, 35mm , short conn plate, 3h, 45mm , twisted plate 2 h, 45mm , twisted plate 3 h, 65mm , wire, 1.5* 300mm bay , wire, 1.8* 370mm bay , olive wire, 1.5* 300mm , olive wire, 1.8* 400mm , washer 3* 14mm slotted , washer 1.5* 12mm slotted , washer 2* 14mm , washer locking 10mm , washer 2mm fixation bd , washer 4mm fixation bd , conical washer pair , thread socket 30 mm , thread socket 40 mm , thread socket 60 mm , pin fixation bits 5 mm , blocks 01 h , blocks 02 h , blocks 03 h , inter locking femoral nails dia 10 mm. l 360mm , inter locking femoral nails dia 10 mm. l 380mm. , inter locking femoral nails dia 10 mm. l 400mm. , inter locking femoral nails dia 10 mm. l 420mm. , inter locking femoral nails dia 10 mm. l 440mm. , inter locking femoral nails dia 10 mm. l 460mm. , inter locking femoral nails dia 10 mm. l 480mm. , inter locking femoral nails dia 11 mm. l 360mm. , inter locking femoral nails dia 11 mm. l 380mm. , inter locking femoral nails dia 11 mm. l 400mm. , inter locking femoral nails dia 11 mm. l 420mm. , inter locking femoral nails dia 11 mm. l 440mm. , inter locking femoral nails dia 11 mm. l 460mm. , inter locking femoral nails dia 11 mm. l 480mm. , inter locking femoral nails dia 12 mm. l 380mm. , inter locking femoral nails dia 12 mm. l 400mm. , inter locking femoral nails dia 12 mm. l 420mm. , inter locking femoral nails dia 12 mm. l 440mm. , inter locking femoral nails dia 12 mm. l 460mm. , inter locking femoral nails dia 12 mm. l 480mm. , inter locking tibial nails dia 11 mm. l 315mm. , inter locking tibial nails dia 11 mm. l 330mm. , inter locking tibial nails dia 11 mm. l 345mm. , inter locking universal tibial nails 10 x 300 mm. , inter locking universal tibial nails 10 x 315 mm. , inter locking universal tibial nails 10 x 330mm. , inter locking universal tibial nails 10 x 345mm. , inter locking universal tibial nails 10 x 360mm. , inter locking universal tibial nails 10 x 380mm. , inter locking universal tibial nails dia 11mm, l 360mm. , inter locking universal tibial nails dia 11mm, l 380mm. , inter locking universal tibial nails dia 11mm, l 400mm. , interlocking nail for femur 9 mm x 360 mm , interlocking nail for femur 9 mm x 380 mm , interlocking nail for femur 9 mm x 400 mm , interlocking nail for femur 9 mm x 420 mm , interlocking nail for femur 9 mm x 440 mm , interlocking nail for femur 12 mm x 360 mm , interlocking nail for tibia 8 mm x 300 mm , interlocking nail for tibia 8 mm x 315 mm , interlocking nail for tibia 8 mm x 330 mm , interlocking nail for tibia 8 mm x 345 mm , interlocking nail for tibia 8 mm x 360 mm , interlocking nail for tibia 9 mm x 300 mm , interlocking nail for tibia 9 mm x 315 mm , interlocking nail for tibia 9 mm x 330 mm , interlocking nail for tibia 9 mm x 345 mm , interlocking nail for tibia 9 mm x 360 mm , cement nozzles ( disposable ) , cpt stem size 0 , cpt stem size 1 , cpt stem size 2 , cpt stem size 3 , cpt stem size 4 , zimtron head short dia 22 , zimtron head medium dia 22 , zimtronhead large dia 22 , zimtron head short dia 28 , zimtron head medium dia 28 , zimtron head large dia 28 , cpt centralizer , k nail impactor nail setter , k nail reamer 6mm , k nail reamer 7mm , k nail reamer 8mm , k nail reamer 9mm , k nail reamer 10mm , k nail reamer 11mm , k nail reamer 12mm , k nail guide wire 3mm , k nail guide wire 3mm , kuntschers nail driver , kuntschers clover leaf nail 8mm x 360mm , kuntschers clover leaf nail 8mm x 380mm , kuntschers clover leaf nail 8mm x 400mm , kuntschers clover leaf nail 8mm x 420mm , kuntschers clover leaf nail 8mm x 440mm , kuntschers clover leaf nail 9mm x 360mm , kuntschers clover leaf nail 9mm x 380mm , kuntschers clover leaf nail 9mm x 400mm , kuntschers clover leaf nail 9mm x 420mm , kuntschers clover leaf nail 9mm x 440mm , kuntschers clover leaf nail 9mm x 460mm , kuntschers clover leaf nail 10mm x 380mm , kuntschers clover leaf nail 10mm x 400mm , kuntschers clover leaf nail 10mm x 420mm , kuntschers clover leaf nail 10mm x 440mm , kuntschers clover leaf nail 10mm x 460mm , kuntschers clover leaf nail 11mm x 380mm , kuntschers clover leaf nail 11mm x 400mm , kuntschers clover leaf nail 11mm x 420mm , kuntschers clover leaf nail 11mm x 440mm , kuntschers clover leaf nail 11mm x 460mm , kuntschers clover leaf nail 12mm x 400mm , kuntschers clover leaf nail 12mm x 420mm , kuntschers clover leaf nail 12mm x 440mm , kuntschers clover leaf nail 12mm x 460mm , knowles guide wire 2mm , knowles pin 3 mm, 65mm length , knowles pin 3 mm, 70mm length , knowles pin 3 mm, 75mm length , knowles pin 3 mm, 80mm length , knowles pin 3 mm, 90mm length , knowles pin 3 mm, 95mm length , knowles pin 3mm x 100mm , knowles pin 4mm x 75mm , knowles pin 4mm x 80mm , knowles pin 4mm x 90mm , knowles pin 4mm x 95mm , knowles pin 4mm x 100mm , drill bit 2.0 mm , drill bit 2.7 mm , periosteal elevator small with straight edge 3mm , cortex screw 2.7mm x 6mm , cortex screw 2.7mm x 8mm , cortex screw 2.7mm x 10mm , cortex screw 2.7mm x 12mm , cortex screw 2.7mm x 14mm , cortex screw 2.7mm x 16mm , cortex screw 2.7mm x 18mm , small washers 7mm ( 2.7mm screws ) , quarter tubular plates 3h x 23mm , quarter tubular plates 4h x 31mm , quarter tubular plates 5h x 39mm , quarter tubular plates 7h x 55mm , quarter tubular plates 8h x 55mm , cervical spine reconstruction plates3.5, 12mm hole spacing, 4 each with 2 and 3 holes, 2 each with 4, 5 & 16 holes , cancellous bone screw 3.5mm, pure titanium length 12mm , cancellous bone screw 3.5mm, pure titanium length 14mm , cancellous bone screw 3.5mm, pure titanium length 16mm , cancellous bone screw 3.5mm, pure titanium length 18mm , cancellous bone screw 3.5mm, pure titanium length 20mm , cancellous bone screw 3.5mm, pure titanium length 22mm , cancellous bone screw 3.5mm, pure titanium length 24mm , kirschner wire 2.0mmwith trocar tip, length 150mm , reconstruction plates 3.5mm, 26mm x 3h ( 8 h spacing ) , oscillating blade 32 x 63.5 mm straight , oscillating blade 19.5 x 63.5 mm straight , oscillating blade 34 x 64 mm , cortical screws 4.5mm 20 tpi, 16mm , cortical screws 4.5mm 20 tpi, 18mm , cortical screws 4.5mm 20 tpi, 20mm , cortical screws 4.5mm 20 tpi, 22mm , cortical screws 4.5mm 20 tpi, 24mm , cortical screws 4.5mm 20 tpi, 28mm , cortical screws 4.5mm 20 tpi, 32mm , cortical screws 4.5mm 20 tpi, 36mm , cortical screws 4.5mm 20 tpi, 40mm , cortical screws 4.5mm 20 tpi, 44mm , cortical screws 4.5mm 20 tpi, 48mm , cortical screws 4.5mm 20 tpi, 52mm , cortical screws 4.5mm 20 tpi, 54mm , cortical screws 4.5mm 20 tpi, 56mm , cortical screws 4.5mm 20 tpi, 60mm , cortical screws 3.5mm 20 tpi, 10mm , cortical screws 3.5mm 20 tpi, 12mm , cortical screws 3.5mm 20 tpi, 14mm , cortical screws 3.5mm 20 tpi, 16mm , cortical screws 3.5mm 20 tpi, 18mm , cortical screws 3.5mm 20 tpi, 20mm , cortical screws 3.5mm 20 tpi, 22mm , cortical screws 3.5mm 20 tpi, 24mm , cortical screws 3.5mm 20 tpi, 26mm , cortical screws 3.5mm 20 tpi, 28mm , cortical screws 3.5mm 20 tpi, 30mm , cortical screws 3.5mm 20 tpi, 32mm , cortical screws 3.5mm 20 tpi, 34mm , cortical screws 3.5mm 20 tpi, 36mm , cortical screws 3.5mm 20 tpi, 38mm , cortical screws 3.5mm 20 tpi, 40mm , cancellous screws 6.5mm fully threaded 35mm , cancellous screws 6.5mm fully threaded 40mm , cancellous screws 6.5mm fully threaded 45mm , cancellous screws 6.5mm fully threaded 50mm , cancellous screws 6.5mm fully threaded 55mm , cancellous screws 6.5mm fully threaded 60mm , cancellous screws 6.5mm fully threaded 65mm , cancellous screws 6.5mm fully threaded 70mm , cancellous screws 6.5mm fully threaded 75mm , cancellous screws 6.5mm fully threaded 80mm , cancellous screws 6.5mm threading : 32mm, 60mm , cancellous screws 6.5mm threading : 32mm, 70mm , cancellous screws 6.5mm threading : 32mm, 80mm , cancellous screws 6.5mm threading : 32mm, 90mm , cancellous screws 6.5mm threading : 32mm, 100mm , cancellous screws 6.5mm threading : 32mm, 110mm , cancellous screws 6.5mm threading : 16mm, 35mm , cancellous screws 6.5mm threading : 16mm, 45mm , cancellous screws 6.5mm threading : 16mm, 55mm , cancellous screws 6.5mm threading : 16mm, 65mm , cancellous screws 6.5mm threading : 16mm, 75mm , cancellous screws 6.5mm threading : 16mm, 85mm , cancellous screws 6.5mm threading : 16mm, 95mm , cancellous screws 6.5mm threading : 16mm, 105mm , cancellous screw 4.0mm dia 24mm x 10mm , cancellous screw 4.0mm dia 26mm x 12mm , cancellous screw 4.0mm dia 28mm x 14mm , cancellous screw 4.0mm dia 30mm x 14mm , cancellous screw 4.0mm dia 35mm x 14mm , cancellous screw 4.0mm dia 40mm x 14mm , cancellous screw 4.0mm dia 45mm x 15mm , cancellous screw 4.0mm dia 50mm x 15mm , malleolar screw 4.5mm, 14 tpi, 45mm , malleolar screw 4.5mm, 14 tpi, 50mm , malleolar screw 4.5mm, 14 tpi, 55mm , malleolar screw 4.5mm, 14 tpi, 60mm , malleolar screw 4.5mm, 14 tpi, 65mm , 6.5mm cancellous bone screw, l 30 / 16mm , 6.5mm cancellous bone screw, l 35 / 16mm , 6.5mm cancellous bone screw, l 40 / 16mm , 6.5mm cancellous bone screw, l 45 / 16mm , 6.5mm cancellous bone screw, l 50 / 16mm , 6.5mm cancellous bone screw, l 55 / 16mm , 6.5mm cancellous bone screw, l 60 / 16mm , 6.5mm cancellous bone screw, l 65 / 16mm , 6.5mm cancellous bone screw, l 70 / 16mm , 6.5mm cancellous bone screw, l 60 / 32mm , 6.5mm cancellous bone screw, l 65 / 32mm , 6.5mm cancellous bone screw, l 70 / 32mm , 6.5mm cancellous bone screw, l 75 / 32mm , cement nozzles ( disposable ) , cpt stem size 0 , cpt stem size 1 , cpt stem size 2 , cpt stem size 3 , cpt stem size 4 , zimtron head short dia 22 , zimtron head medium dia 22 , zimtron head large dia 22 , zimtron head short dia 28 , zimtro head medium dia 28 , zimtron head large dia 28 , cpt centralizer , modular head ( 3 ) , modular head ( +0 ) , modular head ( +3 ) , cup 22.225 / 40mm , cup 22.225 / 43mm , cup 22.225 / 47mm , cup 22.225 / 50mm , cup 22.225 / 53mm , plus stem 1 round back , plus stem 2 flanged , plus stem 3 flanged , plus stem 4 flanged , plus stem 5 flanged / l neck , charnley switch or button ( pk of 100 ) , cmw ( g ) 40 gm antibiotic bone cement , cmw ( g ) 20 gm antibiotic bone cement , charnley trochanteric stample , ferrous acetabular od 44mm, id 22mm , ferrous acetabular od 46mm, id 22mm , ferrous acetabular od 48mm, id 22mm , ferrous acetabular od 50mm, id 22mm , ferrous acetabular od 52mm, id 22mm , ferrous acetabular od 46mm, id 26mm , ferrous acetabular od 48mm, id 26mm , ferrous acetabular od 50mm, id 26mm , ferrous acetabular od 52mm, id 26mm , ferrous acetabular od 54mm, id 26mm , ferrous acetabular od 48mm, id 28mm , ferrous acetabular od 50mm, id 28mm , ferrous acetabular od 52mm, id 28mm , ferrous acetabular od 54mm, id 28mm , ferrous acetabular od 56mm, id 28mm , porous acetabular cortical bone screw, 4.5mm dia, length 15mm , porous acetabular cortical bone screw, 4.5mm dia, length 20mm , porous acetabular cortical bone screw, 4.5mm dia, length 25mm , porous acetabular cortical bone screw, 4.5mm dia, length 30mm , porous acetabular cortical bone screw, 4.5mm dia, length 35mm , porous acetabular cortical bone screw, 6.5mm dia, length 15mm , porous acetabular cortical bone screw, 6.5mm dia, length 20mm , porous acetabular cortical bone screw, 6.5mm dia, length 25mm , porous acetabular cortical bone screw, 6.5mm dia, length 30mm , porous acetabular cortical bone screw, 6.5mm dia, length 35mm , femoral head id 22mm, neck medium , femoral head id 22mm, neck long , femoral head id 26mm, neck short , femoral head id 26mm, neck medium , femoral head id 26mm, neck long , femoral head id 28mm, neck short , femoral head id 28mm, neck medium , femoral head id 28mm, neck long , total hip charnley type round back standard 45 offset , acetabular cup dia 40mm , acetabular cup dia 43mm , acetabular cup dia 46mm , acetabular cup dia 48mm , hohmann retractor , total hip xl straight stem 137mm small , total hip xl straight stem 142mm medium , total hip xl straight stem 147mm large , total hip charnley type chromium cobalt xl series round back 45 , acetabular cups charnley l.p.w. type dia 40mm , acetabular cups charnley l.p.w. type dia 43mm , acetabular cups charnley l.p.w. type dia 46mm , acetabular cups charnley l.p.w. type dia 48mm , bone cement , total condylar knee system femoral component extra small , total condylar knee system femoral component small , total condylar knee system femoral component large , tibial component small 8mm , tibial component small 11mm , tibial component medium 8mm , tibial component medium 11mm , tibial component large 8mm , tibial component large 11mm , patellar component small , patellar component medium , patellar component large , femoral comp, porous coated small+ right , femoral comp, porous coated small+ left , femoral comp, porous coated std right , femoral comp, porous coated std left , femoral comp, porous coated std + right , femoral comp, porous coated std + left , femoral comp, porous coated large right , femoral comp, porous coated large left , femoral comp, textured std right , femoral comp, textured std left , femoral comp, textured std + right , femoral comp, textured std + left , femoral comp, textured std right , femoral comp, textured large right , femoral comp, textured large left , meniscal bearing tibial plateau ( textured ) std , meniscal bearing tibial textured std+ , meniscal bearing tibial textured large , meniscal bearing tibialplateau ( pc ) small + , rotating platform tibial plateau std , rotating platform tibial plateau std+ , rotating platform tibial plateau large , rotating platform tibial plateau ( pc small+ ) , rotating patella all poly std , rotating patella all poly std+ , rotating patella all poly large , rotating patella all poly small + , rotating platform insert std 10mm , rotating platform insert std 12.5mm , rotating platform insert std 15mm , rotating platform insert std+ 10mm , rotating platform insert std+ 12.5mm , rotating platform insert std+ 15mm , rotating platform insert large 10mm , rotating platform insert large 12.5mm , rotating platform insert large 15mm , rotating platform insert small+ 10mm , rotating platform insert small+ 12.5mm , rotating platform insert small+ 15mm , meniscal bearing insert std 10mm , meniscal bearing insert std 12.5mm , meniscal bearing insert std 15mm , meniscal bearing insert std+ 10mm , meniscal bearing insert std+ 12.5mm , meniscal bearing insert std+ 15mm , meniscal bearing insert small+ 10mm , meniscal bearing insert small+ 12.5mm , meniscal bearing insert small+ 15mm , meniscal bearing insert large 10mm , meniscal bearing insert large 12.5mm , meniscal bearing insert large 15mm , femoral 54mm , femoral 59mm , femoral 64mm , patella button 32mm , patella button 34mm , patella button 36mm , tibial articulator surface 08 x 54mm , tibial articulator surface 10 x 54mm , tibial articulator surface 12 x 54mm , tibial articulator surface 15 x 54mm , tibial articulator surface 18 x 54mm , tibial articulator surface 15 x 64mm , tibial articulator surface 18 x 64mm , tibial articulator surface 21 x 64mm , wedge 7º x 54mm full , wedge 13º x 54mm full , wedge 7º x 59mm full , wedge 13º x 59mm full , wedge 7º x 64mm full , wedge 13º x 64mm full , uss rod 6.0mm dia hard straight for fracture 50mm length , uss rod 6.0mm dia hard straight for fracture 75mm length , uss rod 6.0mm dia hard straight for fracture 100mm length , uss rod 6.0mm dia hard straight for fracture 125mm length , uss rod 6.0mm dia hard straight for fracture 150mm length , uss rod 200mm length, for deformities , uss rod 250mm length, for deformities , uss rod 300mm length, for deformities , uss rod 350mm length, for deformities , uss rod 400mm length, for deformities , uss rod 450mm length, for deformities , uss rod 500mm length, for deformities , uss rod 6.0mm dia, 50mm length for degenerative low back indications , uss rod 6.0mm dia, 75mm length for degenerative low back indications , uss rod 6.0mm dia, 100mm length for degenerative low back indications , uss rod 6.0mm dia, 125mm length for degenerative low back indications , uss rod 6.0mm dia, 150mm length for degenerative low back indications , uss rod 3.5mm dia for uss cross link system , uss cross link clamp for uss rods 6mm dia , half ring, uss cross link system , uss open rod connector length 15mm , uss open rod connector length 20mm , uss open rod connector length 25mm , uss rod connector length 15mm , uss rod connector length 20mm , uss rod connector length 25mm , uss parallel connector 6.0: 6 mm dia , uss extension connector 6.0: 6 mm dia , uss clamp with lateral nut for uss rods 6.0mm dia , uss clamp with posterior nut for uss rods , notched spinal plates ( 4.5 / 6.5 ) 13h, total l 168mm, pure titanium , drill bit 3.2mm dia , drill bit 4.5mm dia , cortex screw 4.5mm, total length 22mm pure titanium , cortex screw 4.5mm, total length 24mm pure titanium , cortex screw 4.5mm, total length 26mm pure titanium , cortex screw 4.5mm, total length 28mm pure titanium , cortex screw 4.5mm, total length 30mm pure titanium , cortex screw 4.5mm, total length 32mm pure titanium , cortex screw 4.5mm, total length 34mm pure titanium , cortex screw 4.5mm, total length 36mm pure titanium , cortex screw 4.5mm, total length 38mm pure titanium , cortex screw 4.5mm, total length 40mm pure titanium , cortex screw 4.5mm, total length 42mm pure titanium , cortex screw 4.5mm, total length 44mm pure titanium , cortex screw 4.5mm, total length 46mm pure titanium , cortex screw 4.5mm, total length 48mm pure titanium , cortex screw 4.5mm, total length 50mm pure titanium , cortex screw 4.5mm, total length 52mm pure titanium , cortex screw 4.5mm, total length 54mm pure titanium , cortex screw 4.5mm, total length 56mm pure titanium , cortex screw 4.5mm, total length 58mm pure titanium , cortex screw 4.5mm, total length 60mm pure titanium , cortex screw 4.5mm, total length 62mm pure titanium , cortex screw 4.5mm, total length 64mm pure titanium , cortex screw 4.5mm, tap for, length 110 / 180mm , drill bit 3.2mm core dia 3.0mm , cancellous bone screw fully threaded, thread dia 6.5mm, length 30mm & pure titanium , cancellous bone screw fully threaded, thread dia 6.5mm, length 35mm & pure titanium , cancellous bone screw fully threaded, thread dia 6.5mm, length 40mm & pure titanium , cancellous bone screw fully threaded, thread dia 6.5mm, length 45mm & pure titanium , cancellous bone screw fully threaded, thread dia 6.5mm, length 50mm & pure titanium , cancellous bone screw fully threaded, thread dia 6.5mm, length 55mm & pure titanium , cancellous bone screw fully threaded, thread dia 6.5mm, length 60mm & pure titanium , cancellous bone screw fully threaded, thread dia 6.5mm, length 65mm & pure titanium , 3 flute drill bit 3.2mm dia, total length 145mm, usable length 120mm for quick coupling , 3 flute drill bit 3.2mm dia, total length 195mm, usable length 170mm for quick coupling , universal nail locking instrument set in graphic case , drill bit 3.2mm dia length 225 / 200mm , drill bit 4.5mm dia length 145 / 120mm , 4.9mm locking bolt 2, length 26mm , 4.9mm locking bolt 2, length 28mm , 4.9mm locking bolt 2, length 30mm , 4.9mm locking bolt 2, length 32mm , 4.9mm locking bolt 2, length 34mm , 4.9mm locking bolt 2, length 36mm , 4.9mm locking bolt 2, length 38mm , 4.9mm locking bolt 2, length 40mm , 4.9mm locking bolt 2, length 42mm , 4.9mm locking bolt 2, length 44mm , 4.9mm locking bolt 2, length 46mm , 4.9mm locking bolt 2, length 48mm , 4.9mm locking bolt 2, length 50mm , 4.9mm locking bolt 2, length 52mm , 4.9mm locking bolt 2, length 54mm , 4.9mm locking bolt 2, length 56mm , 4.9mm locking bolt 2, length 58mm , 4.9mm locking bolt 2, length 60mm , 4.9mm locking bolt 2, length 64mm , 4.9mm locking bolt 2, length 68mm , 4.9mm locking bolt 2, length 72mm , 4.9mm locking bolt 2, length 76mm , lc dcp plate small 4 hole , lc dcp plate small 5 hole , lc dcp plate small 6 hole , lc dcp plate small 7 hole , lc dcp plate small 8 hole , lc dcp plate small 9 hole , lc dcp plate narrow 6 hole , lc dcp plate narrow 7 hole , lc dcp plate narrow 8 hole , lc dcp plate narrow 9 hole , lc dcp plate narrow 10 hole , lc dcp plate narrow 11 hole , lc dcp plate narrow 12 hole , lc dcp plate broad 8 hole , lc dcp plate broad 9 hole , lc dcp plate broad 10 hole , lc dcp plate broad 11 hole , lc dcp plate broad 12 hole , lc dcp plate broad 14 hole , lc lcp 3.5, 5 holes , lc lcp 3.5, 6 holes , lc lcp 3.5, 7 holes , lc lcp 3.5, 8 holes , lcp t plate 3.5, right angled, 3+3 holes , lcp t plate 3.5, right angled, 4+4 holes , lcp t plate 3.5, right angled, 5+3 holes , lcp t plate 3.5, right angled, 6+4 holes , lcp t plate 3.5, oblique angled, left, 3+3 holes , lcp t plate 3.5, oblique angled, left, 4+3 holes , lcp t plate 3.5, oblique angled, left, 5+3 holes , lcp t plate 3.5, oblique angled right, 3+3 holes , lcp t plate 3.5, oblique angled right, 4+3 holes , lcp t plate 3.5, oblique angled right, 5+3 holes , locking round hole reconstruction plate 3.5, 5 holes , locking round hole reconstruction plate 3.5, 6 holes , locking round hole reconstruction plate 3.5, 7 holes , locking round hole reconstruction plate 3.5, 8 holes , 3.5mm cortex screw, self tapping, l 12mm , 3.5mm cortex screw, self tapping, l 14mm , 3.5mm cortex screw, self tapping, l 16mm , 3.5mm cortex screw, self tapping, l 18mm , 3.5mm cortex screw, self tapping, l 20mm , 3.5mm cortex screw, self tapping, l 22mm , 3.5mm cortex screw, self tapping, l 24mm , 3.5mm cortex screw, self tapping, l 26mm , 3.5mm cortex screw, self tapping, l 28mm , 3.5mm cortex screw, self tapping, l 30mm , 3.5mm locking head screw, self tapping, l 14mm , 3.5mm locking head screw, self tapping, l 16mm , 3.5mm locking head screw, self tapping, l 18mm , 3.5mm locking head screw, self tapping, l 20mm , 3.5mm locking head screw, self tapping, l 22mm , 3.5mm locking head screw, self tapping, l 24mm , 3.5mm locking head screw, self tapping, l 26mm , 3.5mm locking head screw, self tapping, l 28mm , 3.5mm locking head screw, self tapping, l 30mm , 3.5mm locking head screw, self tapping, l 34mm , 3.5mm locking head screw, self tapping, l 38mm , 3.5mm locking head screw, self tapping, l 40mm , 3.5mm locking head screw, self tapping, l 42mm , 3.5mm locking head screw, self tapping, l 75mm , 3.5mm locking head screw, self tapping, l 80mm , lc lcp 4.5 / 5.0, narrow, 5 holes , lc lcp 4.5 / 5.0, narrow, 6 holes , lc lcp 4.5 / 5.0, narrow, 7 holes , lc lcp 4.5 / 5.0, narrow, 8 holes , lc lcp 4.5 / 5.0, narrow, 9 holes , lc lcp 4.5 / 5.0, narrow, 10 holes , lc lcp 4.5 / 5.0, narrow, 11 holes , lc lcp 4.5 / 5.0, broad, 8 holes , lc lcp 4.5 / 5.0, broad, 9 holes , lc lcp 4.5 / 5.0, broad, 10 holes , lc lcp 4.5 / 5.0, broad, 11 holes , lc lcp 4.5 / 5.0, broad, 12 holes , lc lcp 4.5 / 5.0, broad, 13 holes , lc lcp 4.5 / 5.0, broad, 14 holes , lcp t buttress plate 4.5 / 5.0, 4 holes , lcp t buttress plate 4.5 / 5.0, 5 holes , lcp t buttress plate 4.5 / 5.0, 6 holes , lcp t plate 4.5 / 5.0, 4 holes , lcp t plate 4.5 / 5.0, 5 holes , lcp t plate 4.5 / 5.0, 6 holes , lcp t plate 4.5 / 5.0, 7 holes , lcp t plate 4.5 / 5.0, 8 holes , lcp l buttress plate 4.5 / 5.0, left leg, 4 holes , lcp l buttress plate 4.5 / 5.0, left leg, 5 holes , lcp l buttress plate 4.5 / 5.0, left leg, 6 holes , lcp l buttress plate 4.5 / 5.0, right leg, 4 holes , lcp l buttress plate 4.5 / 5.0, right leg, 5 holes , lcp l buttress plate 4.5 / 5.0, right leg, 6 holes , 4.5mm cortex screw, self tapping, l 14mm , 4.5mm cortex screw, self tapping, l 16mm , 4.5mm cortex screw, self tapping, l 18mm , 4.5mm cortex screw, self tapping, l 20mm , 4.5mm cortex screw, self tapping, l 22mm , 4.5mm cortex screw, self tapping, l 24mm , 4.5mm cortex screw, self tapping, l 26mm , 4.5mm cortex screw, self tapping, l 28mm , 4.5mm cortex screw, self tapping, l 30mm , 4.5mm cortex screw, self tapping, l 32mm , 4.5mm cortex screw, self tapping, l 34mm , 4.5mm cortex screw, self tapping, l 36mm , 4.5mm cortex screw, self tapping, l 38mm , 4.5mm cortex screw, self tapping, l 40mm , 4.5mm cortex screw, self tapping, l 42mm , 4.5mm cortex screw, self tapping, l 44mm , 5.0mm locking head screw, self tapping, l 26mm , 5.0mm locking head screw, self tapping, l 30mm , 5.0mm locking head screw, self tapping, l 34mm , 5.0mm locking head screw, self tapping, l 38mm , 5.0mm locking head screw, self tapping, l 40mm , locking proximal humerus plate, 5 holes, 85mm , locking proximal humerus plate, 8 holes, 121mm , lcp for proximal lateral tibia, 5 holes, right , lcp for proximal lateral tibia, 5 holes, left , lcp for proximal lateral tibia, 7 holes, right , lcp for proximal lateral tibia, 7 holes, left , lcp for proximal lateral tibia, 9 holes, right , lcp for proximal lateral tibia, 9 holes, left , lcp for distal femur, 7 holes, right , lcp for distal femur, 7 holes, left , lcp for distal femur, 9 holes, right , lcp for distal femur, 9 holes, left , lcp for distal femur, 11 holes, right , lcp for distal femur, 11 holes, left , wire mount for lcp 4.5 / 5.0 , spacer, 5.0mm dia., l 2mm , washer, 2.7 / 3.5mm dia. , proximal femoral nail 9 x 250 mm , proximal femoral nail 10 x 250 mm , proximal femoral nail 11 x 250 mm , locking bolt cannulated6.4mm, 50mm , locking bolt cannulated6.4mm, 55mm , locking bolt cannulated6.4mm, 60mm , locking bolt cannulated6.4mm, 65mm , locking bolt cannulated6.4mm, 70mm , locking bolt cannulated6.4mm, 75mm , locking bolt cannulated6.4mm, 80mm , locking bolt cannulated6.4mm, 85mm , locking bolt cannulated6.4mm, 90mm , locking bolt cannulated6.4mm, 95mm , locking bolt cannulated6.4mm, 100mm , locking bolt cannulated 8mm, 50 mm , locking bolt cannulated 8mm, 55 mm , locking bolt cannulated 8mm, 60 mm , locking bolt cannulated 8mm, 65 mm , locking bolt cannulated 8mm, 70 mm , locking bolt cannulated 8mm, 75 mm , locking bolt cannulated 8mm, 80 mm , locking bolt cannulated 8mm, 85 mm , locking bolt cannulated 8mm, 90 mm , locking bolt cannulated 8mm, 95 mm , supra condylar nail size 10 x 150 mm , supra condylar nail size 10 x 200 mm , supra condylar nail size 10 x 250 mm , supra condylar nail size 10 x 300 mm , supra condylar nail size 11 x 150 mm , supra condylar nail size 11 x 200 mm , supra condylar nail size 11 x 250 mm , supra condylar nail size 11 x 300 mm , supra condylar nail size 12 x 150 mm , supra condylar nail size 12 x 200 mm , supra condylar nail size 12 x 250 mm , supra condylar nail size 12 x 300 mm , locking bolt 4.9mm self tapping 28 mm , locking bolt 4.9mm self tapping 30 mm , locking bolt 4.9mm self tapping 32 mm , locking bolt 4.9mm self tapping 34 mm , locking bolt 4.9mm self tapping 36 mm , locking bolt 4.9mm self tapping 38 mm , locking bolt 4.9mm self tapping 40 mm , locking bolt 4.9mm self tapping 42 mm , locking bolt 4.9mm self tapping 44 mm , locking bolt 4.9mm self tapping 46 mm , locking bolt 4.9mm self tapping 48 mm , locking bolt 4.9mm self tapping 50 mm , locking bolt 4.9mm self tapping 52 mm , locking bolt 4.9mm self tapping 54 mm , locking bolt 4.9mm self tapping 56 mm , locking bolt 4.9mm self tapping 60 mm , 10 ft tubing , femoral straight stem small , femoral straight stem medium , femoral straight stem large , bipolar head short neck 39 mm , bipolar head short neck 41 mm , bipolar head short neck 43 mm , bipolar head short neck 45 mm , bipolar head short neck 47 mm , bipolar head short neck 49 mm , bipolar head short neck 51 mm , bipolar head standard neck 39 mm , bipolar head standard neck 41 mm , bipolar head standard neck 43 mm , bipolar head standard neck 45 mm , bipolar head standard neck 47 mm , bipolar head standard neck 49 mm , bipolar head standard neck 51 mm , bipolar head long neck 39 mm , bipolar head long neck 41 mm , bipolar head long neck 43 mm , bipolar head long neck 45 mm , bipolar head long neck 47 mm , bipolar head long neck 49 mm , bipolar head long neck 51 mm , crc stem size 13x170 , crc stem size 13x210 , crc stem size 13x250 , crc stem size 13x300 , crc stem size 15x180 , crc stem size 15x220 , crc stem size 15x250 , crc stem size 15x300 , crc modular build up block size 13 / 15 x 10mm , crc modular build up block size 13 / 15 x 20mm , crc modular build up block size 13 / 15 x 30mm , wagner stem size 14 / 190 , wagner stem size 15 / 190 , wagner stem size 16 / 190 , wagner stem size 17 / 190 , wagner stem size 18 / 190 , wagner stem size 14 / 225 , wagner stem size 15 / 225 , wagner stem size 16 / 225 , wagner stem size 17 / 225 , wagner stem size 18 / 225 , wagner stem size 14 / 265 , wagner stem size 15 / 265 , wagner stem size 16 / 265 , wagner stem size 17 / 265 , wagner stem size 18 / 265 , wagner stem size 14 / 305 , wagner stem size 15 / 305 , wagner stem size 16 / 305 , wagner stem size 17 / 305 , wagner stem size 18 / 305 , muller acetabular reinforcement ring , burch schneider reinforcement ring , expansion shell uncemented , octopus acetabular cage , femoral component sz 38mm , femoral component sz 40mm , femoral component sz 42mm , femoral component sz 44mm , femoral component sz 46mm , femoral component sz 48mm , femoral component sz 50mm , femoral component sz 52mm , femoral component sz 54mm , femoral component sz 56mm , femoral component sz 58mm , femoral component sz 60mm , acetabulum comp sz 44 / 38mm , acetabulum comp sz 46 / 40mm , acetabulum comp sz 48 / 42mm , acetabulum comp sz 50 / 44mm , acetabulum comp sz 52 / 46mm , acetabulum comp sz 54 / 48mm , acetabulum comp sz 56 / 50mm , acetabulum comp sz 58 / 52mm , acetabulum comp sz 60 / 54mm , acetabulum comp sz 62 / 56mm , acetabulum comp sz 64 / 58mm , acetabulum comp sz 66 / 60mm , metasul large head sz 38mm , metasul large head sz 40mm , metasul large head sz 42mm , metasul large head sz 44mm , metasul large head sz 46mm , metasul large head sz 48mm , metasul large head sz 50mm , metasul large head sz 52mm , metasul large head sz 54mm , metasul large head sz 56mm , metasul large head sz 58mm , metasul large head sz 60mm , head adaptor short , head adaptor medium , head adaptor large , head adaptor x large , fem size c, left , fem size c, right , fem size d, left , fem size d, right , fem size e, left , fem size e, right , fem size f, left , fem size f, right , tibial plate, size 2, pmma precoat , tibial plate, size 3, pmma precoat , tibial plate, size 4, pmma precoat , tibial plate, size 5, pmma precoat , tibial plate, size 6, pmma precoat , articular surface, 12mm ( fem size c ) , articular surface, 14mm ( fem size c ) , articular surface, 17mm ( fem size c ) , articular surface, 20mm ( fem size c ) , articular surface, 23mm ( fem size c ) , articular surface, 26mm ( fem size c ) , articular surface, 12mm ( fem size d ) , articular surface, 14mm ( fem size d ) , articular surface, 17mm ( fem size d ) , articular surface, 20mm ( fem size d ) , articular surface, 23mm ( fem size d ) , articular surface, 26mm ( fem size d ) , articular surface, 12mm ( fem size e ) , articular surface, 14mm ( fem size e ) , articular surface, 17mm ( fem size e ) , articular surface, 20mm ( fem size e ) , articular surface, 23mm ( fem size e ) , articular surface, 26mm ( fem size e ) , articular surface, 12mm ( fem size f ) , articular surface, 14mm ( fem size f ) , articular surface, 17mm ( fem size f ) , articular surface, 20mm ( fem size f ) , articular surface, 23mm ( fem size f ) , articular surface, 26mm ( fem size f ) , 10mm full block tib augment, size 2 , 10mm full block tib augment, size 3 , 10mm full block tib augment, size 4 , 10mm full block tib augment, size 5 , 10mm full block tib augment, size 6 , micro patella dome sz 26mm , micro patella dome sz 29mm , micro patella dome sz 32mm , micro patella dome sz 35mm , stand patella dome sz 26mm , stand patella dome sz 29mm , stand patella dome sz 32mm , stand patella dome sz 35mm , leftsmall humeral , left medium humeral , left medium humeral long stem , left large humeral , left small ulnar , left medium ulnar , right small humeral , right medium humeral , right medium humeral long stem , right large humeral , right small ulnar , right medium ulnar , thrust plate head small, medium and large , 6.5 mm cancellous screw titanium – 20, 25, 30, 35, 40, 50 mm , tibial implant sizes 1 5 for rt and lt , tibial insert size 1 5 , talar sizes size 1 5 , lps femoral comp sz a right , lps femoral comp sz b left , lps femoral comp sz b right , lps femoral comp sz c left , lps femoral comp sz c right , lps femoral comp sz d left , lps femoral comp sz d right , lps femoral comp sz e left , lps femoral comp sz e right , lps femoral comp sz f left , lps femoral comp sz f right , tibial tray sz 1 , tibial tray sz 2 , tibial tray sz 3 , tibial tray sz 4 , tibial tray sz 5 , tibial tray sz 6 , lps tibial art surf sz purple 10mm , lps tibial art surf sz purple 12mm , lps tibial art surf sz purple 14mm , lps tibial art surf sz purple 17mm , lps tibial art surf sz purple 20mm , lps tibial art surf sz purple 23mm , lps tibial art surf sz st.purple 10mm , lps tibial art surf sz st.purple 12mm , lps tibial art surf sz st.purple 14mm , lps tibial art surf sz st.purple 17mm , lps tibial art surf sz st.purple 20mm , lps tibial art surf sz st.purple 23mm , lps tibial art surf sz yellow 10mm , lps tibial art surf sz yellow 12mm , lps tibial art surf sz yellow 14mm , lps tibial art surf sz yellow 17mm , lps tibial art surf sz yellow 20mm , lps tibial art surf sz yellow 23mm , lps art surf size ab st.yellow 10mm ( , lps art surf size ab st.yellow 12mm , lps art surf size ab st.yellow 14mm , lps art surf size ab st.yellow 17mm , lps art surf size ab st.yellow 20mm , lps art surf size ab st.yellow 23mm , lps tibial art surf sz ef st.yellow 10mm , lps tibial art surf sz ef st.yellow 12mm , lps tibial art surf sz ef st.yellow 14mm , lps tibial art surf sz ef st.yellow 17mm , lps tibial art surf sz ef st.yellow 20mm , lps tibial art surf sz ef st.yellow 23mm , lps tibial art surf sz green sz 10mm , lps tibial art surf sz green sz 12mm , lps tibial art surf sz green sz 14mm , lps tibial art surf sz green sz 17mm , lps tibial art surf sz green sz 20mm , lps tibial art surf sz green sz 23mm , lps tibial art surf sz st.green sz 10mm , lps tibial art surf sz st.green sz 12mm , lps tibial art surf sz st.green sz 14mm , lps tibial art surf sz st.green sz 17mm , lps tibial art surf sz st.green sz 20mm , lps tibial art surf sz st.green sz 23mm , micro patella dome sz 26mm , micro patella dome sz 29mm , micro patella dome sz 32mm , micro patella dome sz 35mm , stand patella dome sz 26mm , stand patella dome sz 29mm , stand patella dome sz 32mm , stand patella dome sz 35mm , lps flex option fem sz b left ( legacy posterior stabilised ) , lps flex option fem sz c left , lps flex option fem sz d left , lps flex option fem sz e left , lps flex option fem sz f left , lps flex option fem sz b right , lps flex option fem sz c right , lps flex option fem sz d right , lps flex option fem sz e right , lps flex option fem sz f right , lps flex art surf ab 1 2 10mm , lps flex art surf ab 1 2 12mm , lps flex art surf ab 1 2 14mm , lps flex art surf ab 1 2 17mm , lps flex art surf ab 1 2 20mm , lps flex art surf cd 1 2 10mm , lps flex art surf cd 1 2 12mm , lps flex art surf cd 1 2 14mm , lps flex art surf cd 1 2 17mm , lps flex art surf cd 1 2 20mm , lps flex art surf ef 3 4 10mm , lps flex art surf ef 3 4 12mm , lps flex art surf ef 3 4 14mm , lps flex art surf ef 3 4 17mm , lps flex art surf ef 3 4 20mm , lps flex art surf cd 3 4 10mm , lps flex art surf cd 3 4 12mm , lps flex art surf cd 3 4 14mm , lps flex art surf cd 3 4 17mm , lps flex art surf cd 3 4 20mm , lps flex art surf ef 5 6 10mm , lps flex art surf ef 5 6 12mm , lps flex art surf ef 5 6 14mm , lps flex art surf ef 5 6 17mm , lps flex art surf ef 5 6 20mm , lps flex art surf cd 5 6 10mm , lps flex art surf cd 5 6 12mm , lps flex art surf cd 5 6 14mm , lps flex art surf cd 5 6 17mm , lps flex art surf cd 5 6 20mm , stem tib plates pre s#2 , stem tib plates pre s#3 , stem tib plates pre s#4 , stem tib plates pre s#5 , stem tib plates pre s#6 , micro patella dome sz 26mm , micro patella dome sz 29mm , micro patella dome sz 32mm , micro patella dome sz 35mm , stand patella dome sz 26mm , stand patella dome sz 29mm , stand patella dome sz 32mm , stand patella dome sz 35mm , mbk femoral size b, left , mbk femoral size b, right , mbk femoral size c, left , mbk femoral size c, right , mbk femoral size d, left , mbk femoral size d, right , mbk femoral size e, left , mbk femoral size e, right , mbk femoral size f, left , mbk femoral size f, right , mbk tibial plate, size 2 , mbk tibial plate, size 3 , mbk tibial plate, size 4 , mbk tibial plate, size 5 , mbk tibial plate, size 6 , mbk art surf size a, 9mm left , mbk art surf size a, 10mm left , mbk art surf size a, 12mm left , mbk art surf size a, 14mm left , mbk art surf size a, 17mm left , mbk art surf size a, 9mm right , mbk art surf size a, 10mm right , mbk art surf size a, 12mm right , mbk art surf size a, 14mm right , mbk art surf size a, 17mm right , mbk art surf size b, 9mm left , mbk art surf size b, 10mm left , mbk art surf size b, 12mm left , mbk art surf size b, 14mm left , mbk art surf size b, 17mm left , mbk art surf size b, 9mm right , mbk art surf size b, 10mm right , mbk art surf size b, 12mm right , mbk art surf size b, 14mm right , mbk art surf size b, 17mm right , mbk art surf size c, 9mm left , mbk art surf size c, 10mm left , mbk art surf size c, 12mm left , mbk art surf size c, 14mm left , mbk art surf size c, 17mm left , mbk art surf size c, 20mm left , mbk art surf size c, 9mm right , mbk art surf size c, 10mm right , mbk art surf size c, 12mm right , mbk art surf size c, 14mm right , mbk art surf size c, 17mm right , mbk art surf size c, 20mm right , mbk art surf size d, 9mm left , mbk art surf size d, 10mm left , mbk art surf size d, 12mm left , mbk art surf size d, 14mm left , mbk art surf size d, 17mm left , mbk art surf size d, 20mm left , mbk art surf size d, 9mm right , mbk art surf size d, 10mm right , mbk art surf size d, 12mm right , mbk art surf size d, 14mm right , mbk art surf size d, 17mm right , mbk art surf size d, 20mm right , mbk art surf size e, 9mm left , mbk art surf size e, 10mm left , mbk art surf size e, 12mm left , mbk art surf size e, 14mm left , mbk art surf size e, 17mm left , mbk art surf size e, 20mm left , mbk art surf size e, 9mm right , mbk art surf size e, 10mm right , mbk art surf size e, 12mm right , mbk art surf size e, 14mm right , mbk art surf size e, 17mm right , mbk art surf size e, 20mm right , mbk art surf size f, 9mm left , mbk art surf size f, 1omm left , mbk art surf size f, 12mm left , mbk art surf size f, 14mm left , mbk art surf size f, 17mm left , mbk art surf size f, 20mm left , mbk art surf size f, 9mm right , mbk art surf size f, 1omm right , mbk art surf size f, 12mm right , mbk art surf size f, 14mm right , mbk art surf size f, 17mm right , mbk art surf size f, 20mm right , micro patella dome sz 26mm , micro patella dome sz 29mm , micro patella dome sz 32mm , micro patella dome sz 35mm , stand patella dome sz 26mm , stand patella dome sz 29mm , stand patella dome sz 32mm , abg ii femoral stem right, size 1 , abg ii femoral stem right, size 2 , abg ii femoral stem right, size 3 , abg ii femoral stem right, size 4 , abg ii femoral stem right, size 5 , abg ii femoral stem right, size 6 , abg ii femoral stem right, size 7 , abg ii femoral stem right, size 8 , abg ii femoral stem left, size 1 , abg ii femoral stem left, size 2 , abg ii femoral stem left, size 3 , abg ii femoral stem left, size 4 , abg ii femoral stem left, size 5 , abg ii femoral stem left, size 6 , abg ii femoral stem left, size 7 , abg ii femoral stem left, size 8 , v 40 alumina head ( +4 ) , v 40 alumina head ( 0 ) , v 40 alumina head ( 4 ) , abg ii 5 hole cup for ceramic insert 46mm , abg ii 5 hole cup for ceramic insert 48mm , abg ii 5 hole cup for ceramic insert 50mm , abg ii 5 hole cup for ceramic insert 52mm , abg ii 5 hole cup for ceramic insert 54mm , abg ii 5 hole cup for ceramic insert 56mm , abg ii 5 hole cup for ceramic insert 58mm , abg ii 5 hole cup for ceramic insert 60mm , abg ii 5 hole cup for ceramic insert 62mm , abg ii 5 hole cup for ceramic insert 64mm , abg ii alumina insert for od 46, 48, 50mm , abg ii alumina insert for od 52, 54mm , abg ii alumina insert for od 56, 58mm , spike for abg ii cup 7mm , spike for abg ii cup 9mm , screw for abg ii cup 20mm , screw for abg ii cup 25mm , screw for abg ii cup 30mm , screw for abg ii cup 35mm , screw for abg ii cup 40mm , screw for abg ii cup 45mm , obturator screw for abg ii cups , versys fibre metal taper ( std body ) sz 9 , versys fibre metal taper ( std body ) sz 10 , versys fibre metal taper ( std body ) sz 11 , versys fibre metal taper ( std body ) sz 12 , versys fibre metal taper ( std body ) sz 13 , versys fibre metal taper ( std body ) sz 14 , versys fibre metal taper ( std body ) sz 15 , versys fibre metal taper ( std body ) sz 16 , versys fibre metal taper ( large metaphysial body ) sz 12 , versys fibre metal taper ( lm body ) sz 13 , versys fibre metal taper ( lm body ) sz 14 , versys fibre metal taper ( lm body ) sz 15 , versys fibre metal taper ( lm body ) sz 16 , versys beaded full coat plus ( std body 8 200 mm ) sz 11 , versys beaded full coat plus ( std body 8 200 mm ) sz 12 , versys beaded full coat plus ( std body 8 200 mm ) sz 13 , versys beaded full coat plus ( std body 8 200 mm ) sz 14 , versys beaded full coat plus ( std body 8 200 mm ) sz 15 , versys beaded full coat plus ( std body 8 200 mm ) sz 16 , versys beaded full coat plus ( std body 8 200 mm ) sz 17 , versys beaded full coat plus ( std body 8 200 mm ) sz 18 , versys beaded full coat plus ( std body 8 200 mm ) sz 20 , versys femoral head dia 22 size 0 , versys femoral head dia 22 size 2 , versys femoral head dia 22 size +3 , versys femoral head dia 28 size 3.5 , versys femoral head dia 28 size +0 , versys femoral head dia 28 size +3.5 , versys femoral head dia 28 size +7 , versys femoral head dia 28 size +10.5 , triology shell sz 44 , triology shell sz 46 , triology shell sz 48 , triology shell sz 50 , triology shell sz 52 , triology shell sz 54 , triology shell sz 56 , triology shell sz 58 , triology shell sz 60 , triology shell sz 62 , triology 10º liner28 x 44 , triology 10º liner28 x 46 , triology 10º liner28 x 48 , triology 10º liner28 x 50 / 52 / 54 , triology 10º liner28 x 56 , triology 10º liner28 x 58 , triology 10º liner28 x 60 , triology 10º liner28 x 62 , triology bone screw 6.5 x 15 mm , triology bone screw 6.5 x 20 mm , triology bone screw 6.5 x 25 mm , triology bone screw 6.5 x 30 mm , triology bone screw 6.5 x 35 mm , triology bone screw 6.5 x 40 mm , triology bone screw 6.5 x 50 mm , femoral stem szsmall , femoral stem szmedium , femoral stem szlarge , femoral stem szextra large , femoral head dia 28 size 3.5 , femoral head dia 28 size +0 , femoral head dia 28 size +3.5 , femoral head dia 28 size +7 , femoral head dia 28 size +10.5 , femoral head dia 22 size 2 , femoral head dia 22 size +0 , femoral head dia 22 size +3 , skin stapler with 35 / 55 stainless steel staples , synthetic absorabable polyggalactin 910 polyglycolic acid coated with polycarproplate size 1 / 0, 70 90 cm 1 / 2 , synthetic absorabable polyggalactin 910 polyglycolic acid coated with polycarproplate size 2 / 0, 70 90 cm 1 / 2 , chlorhexidine hand scrub brush , disposable gown , disposable shoe cover , marking pen , bandage crape 10cm ( roll of 4 mtr ) , bandage crape 15cm ( roll of 4 mtr ) , bandage elastic adhesive, 6 cm x 3 metres unstretched and 5 6 metres when stretched. , bandage, open woven compressed 2.5 cm x 4 metres , bandage open wove uncompressed: 6 cm x 4 metres , bandage open wove uncompressed: 10 cm x 4 metres , bandage, plaster of paris 10 cm x 3 metres , bandage, plaster of paris 15 cm x 3 metres , silk braided size 0 70 76 cm reverse cutting 3 / 8 circle needle 45 mm , silk braided size 1 / 0 70 76 cms taper cut 1 / 2 circle needle 25mm , bandage triangular , bandage dvt stocking small , bandage dvt stocking medium , bandage dvt stocking large , cotton wool, absorbent pkt of 50 gm , cotton wool, absorbent pkt of 500 gm , cotton wool, non absorbent pkt of 500 gm , dressing pre op adhesive drape 28cm x 30cm , dressing pre op adhesive drape 36cm x 40cm , dressing pre op adhesive drape 50cm x 45cm , dressing woundcare non adhesive 3x3 inches , dressing woundcare non adhesive 4x4 inches , dressing woundcare non adhesive 5x5 inches , dressing woundcare non adhesive 6.5x7.5 inches , dressing post op medicated 6 x 7cm pack of 100 dressings , dressing post op medicated 10 x 12 cm pack of 50 dressings. , dressing wound 10 x 20 cm , dressing sterile 4 x 4 box of 5 , dressing sterile 8 x 8 box of 3 , dressing collagen wound management, size 2 x 3 , dressing collagen wound management, size 8 x 14 , dressing collagen wound management material, 5 ml , dressing collagen wound management material, 15 ml , monofilament polyglyconate synthetic absorbable suture size 1, 90 95 cm, 1 / 2 circle taper cutting 45 50 mm , monofilament polyglyconate synthetic absorbable suture size 1 / 0, 70 75 cm, 1 / 2 circle taper cutting 20 30 mm , monofilament polyglyconate synthetic absorbable suture size 2 / 0, 70 75 cm 1 / 2 circle taper cutting 20 30 mm , monofilament polyglyconate synthetic absorbable suture size 3 / 0, 70 75 cm, 1 / 2 circle taper cutting 20 30 mm , polybutylate coated braided polyester size 2, 1 / 2 circle taper cut, 45 mm single needle , polybutylate coated braided polyster size 5 1 / 2 circle taper cut 55 mm single needle , polydioxanone size 1, 90 cms, 1 / 2 circle needle 40 45 mm , polypropylene blue monofilament 70 75 cm, size 1 3 / 8 circle reverse cutting, 12 mm , polypropylene blue monofilament 70 75 cm, size 1 / 0 3 / 8 circle reverse cutting, 12 mm , bone marrow aspiration and biopsy needle ( disposable ) 8 x 4 cm needle small , bone marrow harvesting needle large , bone marrow harvesting needle small , bone biopsy needle 14g , bone biopsy needle 16g , bone biopsy needle 18g , bone wax box of 12 , tms surgical gown disposable ( gamma sterile ) , tms face masks gamma sterile ( box of 50 ) , tms comfort face masks ( box of 50 ) , hand gloves, size 7 pair of , hand gloves, size 7 1 / 2 pair of , gloves operational size 8 pair of , suction drain ( assorted size ) , bone marrow aspiration and biopsy needle ( disposable ) 8 x 4 cm needle small , hydrogen peroxide solution with stabilizer ip ( 20 volume ) 500 ml bott , chlorhexidine solution containing chlorhexidine gluconate bp 7.5% v / v cetrimide bp 15% w / v 500 ml bott , povidone iodine solution 5% bottle of 100 ml , povidone iodine 10% solution, bott of 100 ml , 0.5% chlorhexidine acetate tulle grass dressing , chlorhexidine gluconate solution equivalent to 4% w / v with isopropanol< 10%, ethoxylated alkylphenol < 10% fatty acid diethanolamide< 10%, acetic acid glacial bott of 500 ml , chlorhexidine gluconate 2% in 70% isopropyl alcohol 500 ml bott , 10% povidone iodine solution, u.s.p equivalent to 1% available iodine 500 ml bott , bandage crepe: 10 cm , bandage crepe:15 cm , bandage elastic adhesive, 6 cm x 3 metres unstretched and 5 6 metres when stretched. , bandage open woven for plaster of paris 10cmx5m , bandage, open woven compressed 2.5 cm x 4 metres , bandage open wove uncompressed: 6 cm x 4 metres , bandage open wove uncompressed 10 cm x 4 metres , bandage, plaster of paris 10 cm x 3 metres , bandage, plaster of paris 15 cm x 3 metres , bandage triangular , bandage self adherent wrap 15cm x 4.5mtr ( box of 10 ) , bandage self adherent wrap ) 10cm x 4.5mtr ( box of 18 ) , bandage dvt stocking small , bandage dvt stocking medium , bandage dvt stocking large , cotton wool, absorbent pkt of 500 gm , cotton wool, non absorbent pkt of 500g , dressing medicated adhesive 25 cm x 6 cm in a single strip pack , dressing medicated gauze paraffin, 10 cm x 10 cm, tin of 24 , dressing, wound care occlusive and hydrocolloid dressing with flexible foam padding for optimum healing 10cm x 10cm ( box of 5 ) , dressing, wound care occlusive and hydrocolloid dressing with flexible foam padding for optimum healing 20cm x 20cm ( box of 3 ) , dressing post op medicated 6 x 7cm pack of 100 dressings flexigrid , dressing post op medicated 10 x 12 cm pack of 50 dressings flexigrid , dressing wound 10 x 20 cm , dressing sterile 4 x 4 box of 5 , dressing sterile 8 x 8 box of 3 , gauze surgical, open wove, unmedicated: 60 cm wide , gauze surgical, open wove, unmedicated : 60 cm x 3 metres packet , pad abdominal swab 25 x 25 cm with tape 30 cm , pad abdominal swab 40 x 25 cm with tape, 30 cm , surgeons caps disposable , surgeons mask disposable , transparent medicated adhesive wound dressing 10 x 25 cm box of 12 , transparent medicated wound 15 x 20 cm box of 10 , adhesive plaster micro porous tape 1 inch box of 12 , adhesive plaster micro porous tape 2 inches box of 6 , adhesive plaster micro porous tape 3 inches box of 4 , knife bard parker, blade size 1 fitting ( commercial no. 15 ) packet of 6 sterile packed , knife bard parker, blade size 2 fitting ( commercial no. 20 ) packet of 6 sterile packed , knife bard parker, blade size 2 fitting ( commercial no. 23 ) packet of 6 sterile packed , adhesive plaster zinc oxide 2.5 cm x 1 mtr , adhesive plaster zinc oxide 7.5 cm x 5 mtr , adhesive incise drape 50x45cm , adhesive incise drape 25x30cm , knife bard parker, blade size 1 fitting ( commercial no.10 ) packet of 6 sterile packed , knife bard parker, blade size 1 fitting ( commercial no. 11 ) packet of 6 sterile packed , knife bard parker, blade size 1 fitting ( commercial no. 12 ) packet of 6 sterile packed , knife bard parker, blade size 2 fitting ( commercial no.22 ) packet of 6 , sterile adhesive post op dressing large , sterile adhesive post op dressing medium , sterile adhesive post op dressing small , sterile post op dressing pack large , sterile post op dressing pack small , 0.5% w / v chlorhexidine gluconate in 70% v / v ethyl alcohol with moisturizer 500 ml bott with dispenser , skin stapler with 35 stainless staples , silicone gel ankle strap , silicone gel boot stirrup pads , silicone gel chest roll , silicone gel heel support pad , sodium chloride solution 0.9% non toxic plastic bottle of 3000ml , slab, plaster of paris: 10 x 38 cm, tin of 50 , slab plaster of paris: 75 x 15 cm, tin of 50 , antiembolic stocking for post op use up to knee large , antiembolic stocking for post op use up to knee medium , antiembolic stocking for post op use up to thigh large , antiembolic stocking for post op use up to thigh medium , antiembolic stocking for post op use up to thigh small , tension band plate guided growth system ( 12mm, 16mm ) , cannulated screws of 16mm, 24mm and 32 mm lenghts for tension band plate guided growth system , solid screws of 24mm and 32mm lenghts for tension band plate guided growth system , telescopic intramedullary system –self extending rod with female and male component ( 3mm, 4mm, 5mm ) , paediatric dhs system dhs screw length 50 145 at 5mm increments, outer diameter 13mm , dhs plate with dcp holes, barrel angle 130 150 2 to 6 holes, barrel length standard and short with cortex screws 4.5mm ( 10 24mm ) at 2mm increments , 3.5 mm proximal femur locking valgus osteotomy plate 140 degrees with 03 x locking screws from 16 60mm and 03 x cortical screws from 16 to 60mm in 5 mm increments , 5.0mm proximal femur locking valgus osteotomy plate 140 degrees woth 05 x locking screws from 16 60 mm and 05 x cortical screw from 16 60mm at 5 mm increments , 2.7mm proximal femur varus osteotomy plate 100 degrees, 110 degrees and 130 degrees with 03x locking screws from 16 to 60mm and 3x cortical screwsfrom 16 to 60mm at 5mm increments , 3.5mm proximal femur varus osteotomy plate 100 degrees, 110 degrees and 130 degrees with 03x locking screws from 16 to 60mm and 3x cortical screwsfrom 16 to 60mm at 5mm increments , 5mm proximal femur varus osteotomy plate 100 degrees, 110 degrees and 130 degrees with 03x locking screws from 16 to 60mm and 3x cortical screwsfrom 16 to 60mm at 5mm increments , paediatric rail fixator system, rail 150mm long, 02 clamps, 2x cd units, threaded schanz screws 2.5 and3.5mmx 4 ( 1 set ) , paediatric fibre cast ( 2inch, 3inch, 4inch ) , walker paediatric , paediatric tourniquet cuff , ortho cotton , paediatric orthopaedic general instrument set , titanium elastic nails 1.5mm to 5.0mm dia ( increments of 0.5 ) , universal mini external stablization system set complete ( jess ) for ctev large , universal mini external stablization system set complete ( jess ) for ctev medium , universal mini external stablization system set complete ( jess ) for ctev small , absorbable calcium sulphate powder ( pharmaceutical grade ) with bead kit with option to addantibiotic of choice 5ml, 10ml , methylcobalamin nasal spray 250mcg / spray , calcium, phosphorus 1000 iu vitamin d3 plus magnesium, zinc, copper & boron , thiocolchicoside & acelofenac 4 mg tablet , thiocolchicoside & acelofenac & paracetamol tablet , febuxostat tablets 40 mg , jointace & combination of glucosamine gel , glucosamine slphate potassium chloride , trysin, bromelain & rutoside trihydrate , glucosamine , chondroitin, vit d , glucosamine, rose hip extract, vit d , calcium, phosphorous, 1000 iu, vit d3 , kirschner wire 0.8mm 150mm double tip , kirschner wire 0.9mm 100mm double tip , kirschner wire 0.9mm 150mm double tip , kirschner wire 1.0mm 100mm double tip , kirschner wire 1.0mm 150mm double tip , kirschner wire 1.0mm 225mm double tip , kirschner wire 1.0mm 250mm double tip , kirschner wire 1.0mm 300mm double tip , kirschner wire 1.1mm 100mm double tip , kirschner wire 1.1mm 125mm double tip , kirschner wire 1.1mm 150mm double tip , kirschner wire 1.1mm 300mm double tip , kirschner wire 1.2mm 125mm double tip , kirschner wire 1.2mm 150mm double tip , kirschner wire 1.2mm 200mm double tip , kirschner wire 1.2mm 225mm double tip , kirschner wire 1.2mm 250mm double tip , kirschner wire 1.2mm 300mm double tip , kirschner wire 1.4mm 100mm double tip , kirschner wire 1.4mm 150mm double tip , kirschner wire 1.4mm 200mm double tip , kirschner wire 1.4mm 225mm double tip , kirschner wire 1.4mm 250mm double tip , kirschner wire 1.4mm 300mm double tip , kirschner wire 1.5mm 100mm double tip , kirschner wire 1.5mm 150mm double tip , kirschner wire 1.5mm 200mm double tip , kirschner wire 1.5mm 250mm double tip , kirschner wire 1.5mm 300mm double tip , kirschner wire 1.5mm 400mm double tip , kirschner wire 1.6mm 150mm double tip , kirschner wire 1.6mm 200mm double tip , kirschner wire 1.6mm 225mm double tip , kirschner wire 1.6mm 300mm double tip , kirschner wire 1.8mm 150mm double tip , kirschner wire 1.8mm 200mm double tip , kirschner wire 1.8mm 225mm double tip , kirschner wire 1.8mm 300mm double tip , kirschner wire 1.8mm 370mm double tip , kirschner wire 2.0mm 100mm double tip , kirschner wire 2.0mm 150mm double tip , kirschner wire 2.0mm 200mm double tip , kirschner wire 2.0mm 225mm double tip , kirschner wire 2.0mm 250mm double tip , kirschner wire 2.0mm 275mm double tip , kirschner wire 2.0mm 300mm double tip , kirschner wire 2.0mm 450mm double tip , kirschner wire 2.0mm 500mm double tip , kirschner wire 2.2mm 150mm double tip , kirschner wire 2.2mm 200mm double tip , kirschner wire 2.2mm 300mm double tip , kirschner wire 2.2mm 400mm double tip , kirschner wire 2.3mm 150mm double tip , kirschner wire 2.3mm 300mm double tip , kirschner wire 2.4mm 300mm double tip , kirschner wire 2.5mm 125mm double tip , kirschner wire 2.5mm 150mm double tip , kirschner wire 2.5mm 200mm double tip , kirschner wire 2.5mm 250mm double tip , kirschner wire 2.5mm 275mm double tip , kirschner wire 2.5mm 300mm double tip , kirschner wire 2.5mm 310mm double tip , kirschner wire 2.6mm 300mm double tip , kirschner wire 2.7mm 300mm double tip , kirschner wire 2.8mm 300mm double tip , kirschner wire 3.0mm 125mm double tip , kirschner wire 3.0mm 150mm double tip , kirschner wire 3.0mm 250mm double tip , kirschner wire 3.0mm 300mm double tip , kirschner wire 3.0mm 310mm double tip , kirschner wire 3.2mm 300mm double tip , kirschner wire 3.5mm 150mm double tip , kirschner wire 3.5mm 300mm double tip , kirschner wire 0.8mm 150mm single tip , kirschner wire 0.9mm 100mm single tip , kirschner wire 0.9mm 150mm single tip , kirschner wire 1.0mm 100mm single tip , kirschner wire 1.0mm 150mm single tip , kirschner wire 1.0mm 225mm single tip , kirschner wire 1.0mm 250mm single tip , kirschner wire 1.0mm 300mm single tip , kirschner wire 1.1mm 100mm single tip , kirschner wire 1.1mm 125mm single tip , kirschner wire 1.1mm 150mm single tip , kirschner wire 1.1mm 300mm single tip , kirschner wire 1.2mm 125mm single tip , kirschner wire 1.2mm 150mm single tip , kirschner wire 1.2mm 200mm single tip , kirschner wire 1.2mm 225mm single tip , kirschner wire 1.2mm 250mm single tip , kirschner wire 1.2mm 300mm single tip , kirschner wire 1.4mm 100mm single tip , kirschner wire 1.4mm 150mm single tip , kirschner wire 1.4mm 200mm single tip , kirschner wire 1.4mm 225mm single tip , kirschner wire 1.4mm 250mm single tip , kirschner wire 1.4mm 300mm single tip , kirschner wire 1.5mm 100mm single tip , kirschner wire 1.5mm 150mm single tip , kirschner wire 1.5mm 200mm single tip , kirschner wire 1.5mm 250mm single tip , kirschner wire 1.5mm 300mm single tip , kirschner wire 1.5mm 400mm single tip , kirschner wire 1.6mm 150mm single tip , kirschner wire 1.6mm 200mm single tip , kirschner wire 1.6mm 225mm single tip , kirschner wire 1.6mm 300mm single tip , kirschner wire 1.8mm 150mm single tip , kirschner wire 1.8mm 200mm single tip , kirschner wire 1.8mm 225mm single tip , kirschner wire 1.8mm 300mm single tip , kirschner wire 1.8mm 370mm single tip , kirschner wire 2.0mm 100mm single tip , kirschner wire 2.0mm 150mm single tip , kirschner wire 2.0mm 200mm single tip , kirschner wire 2.0mm 225mm single tip , kirschner wire 2.0mm 250mm single tip , kirschner wire 2.0mm 275mm single tip , kirschner wire 2.0mm 300mm single tip , kirschner wire 2.0mm 450mm single tip , kirschner wire 2.0mm 500mm single tip , kirschner wire 2.2mm 150mm single tip , kirschner wire 2.2mm 200mm single tip , kirschner wire 2.2mm 300mm single tip , kirschner wire 2.2mm 400mm single tip , kirschner wire 2.3mm 150mm single tip , kirschner wire 2.3mm 300mm single tip , kirschner wire 2.4mm 300mm single tip , kirschner wire 2.5mm 125mm single tip , kirschner wire 2.5mm 150mm single tip , kirschner wire 2.5mm 200mm single tip , kirschner wire 2.5mm 250mm single tip , kirschner wire 2.5mm 275mm single tip , kirschner wire 2.5mm 300mm single tip , kirschner wire 2.5mm 310mm single tip , kirschner wire 2.6mm 300mm single tip , kirschner wire 2.7mm 300mm single tip , kirschner wire 2.8mm 300mm single tip , kirschner wire 3.0mm 125mm single tip , kirschner wire 3.0mm 150mm single tip , kirschner wire 3.0mm 250mm single tip , kirschner wire 3.0mm 300mm single tip , kirschner wire 3.0mm 310mm single tip , kirschner wire 3.2mm 300mm single tip , kirschner wire 3.5mm 150mm single tip , kirschner wire 3.5mm 300mm single tip , kirschner wire 0.8mm 150mm threaded tip , kirschner wire 0.9mm 100mm threaded tip , kirschner wire 0.9mm 150mm threaded tip , kirschner wire 1.0mm 100mm threaded tip , kirschner wire 1.0mm 150mm threaded tip , kirschner wire 1.0mm 225mm threaded tip , kirschner wire 1.0mm 250mm threaded tip , kirschner wire 1.0mm 300mm threaded tip , kirschner wire 1.1mm 100mm threaded tip , kirschner wire 1.1mm 125mm threaded tip , kirschner wire 1.1mm 150mm threaded tip , kirschner wire 1.1mm 300mm threaded tip , kirschner wire 1.2mm 125mm threaded tip , kirschner wire 1.2mm 150mm threaded tip , kirschner wire 1.2mm 200mm threaded tip , kirschner wire 1.2mm 225mm threaded tip , kirschner wire 1.2mm 250mm threaded tip , kirschner wire 1.2mm 300mm threaded tip , kirschner wire 1.4mm 100mm threaded tip , kirschner wire 1.4mm 150mm threaded tip , kirschner wire 1.4mm 200mm threaded tip , kirschner wire 1.4mm 225mm threaded tip , kirschner wire 1.4mm 250mm threaded tip , kirschner wire 1.4mm 300mm threaded tip , kirschner wire 1.5mm 100mm threaded tip , kirschner wire 1.5mm 150mm threaded tip , kirschner wire 1.5mm 200mm threaded tip , kirschner wire 1.5mm 250mm threaded tip , kirschner wire 1.5mm 300mm threaded tip , kirschner wire 1.5mm 400mm threaded tip , kirschner wire 1.6mm 150mm threaded tip , kirschner wire 1.6mm 200mm threaded tip , kirschner wire 1.6mm 225mm threaded tip , kirschner wire 1.6mm 300mm threaded tip , kirschner wire 1.8mm 150mm threaded tip , kirschner wire 1.8mm 200mm threaded tip , kirschner wire 1.8mm 225mm threaded tip , kirschner wire 1.8mm 300mm threaded tip , kirschner wire 1.8mm 370mm threaded tip , kirschner wire 2.0mm 100mm threaded tip , kirschner wire 2.0mm 150mm threaded tip , kirschner wire 2.0mm 200mm threaded tip , kirschner wire 2.0mm 225mm threaded tip , kirschner wire 2.0mm 250mm threaded tip , kirschner wire 2.0mm 275mm threaded tip , kirschner wire 2.0mm 300mm threaded tip , kirschner wire 2.0mm 450mm threaded tip , kirschner wire 2.0mm 500mm threaded tip , kirschner wire 2.2mm 150mm threaded tip , kirschner wire 2.2mm 200mm threaded tip , kirschner wire 2.2mm 300mm threaded tip , kirschner wire 2.2mm 400mm threaded tip , kirschner wire 2.3mm 150mm threaded tip , kirschner wire 2.3mm 300mm threaded tip , kirschner wire 2.4mm 300mm threaded tip , kirschner wire 2.5mm 125mm threaded tip , kirschner wire 2.5mm 150mm threaded tip , kirschner wire 2.5mm 200mm threaded tip , kirschner wire 2.5mm 250mm threaded tip , kirschner wire 2.5mm 275mm threaded tip , kirschner wire 2.5mm 300mm threaded tip , kirschner wire 2.5mm 310mm threaded tip , kirschner wire 2.6mm 300mm threaded tip , kirschner wire 2.7mm 300mm threaded tip , kirschner wire 2.8mm 300mm threaded tip , kirschner wire 3.0mm 125mm threaded tip , kirschner wire 3.0mm 150mm threaded tip , kirschner wire 3.0mm 250mm threaded tip , kirschner wire 3.0mm 300mm threaded tip , kirschner wire 3.0mm 310mm threaded tip , kirschner wire 3.2mm 300mm threaded tip , kirschner wire 3.5mm 150mm threaded tip , kirschner wire 3.5mm 300mm threaded tip , screws , cortex screw 2.4mm 10mm , cortex screw 2.4mm 12mm , cortex screw 2.4mm 14mm , cortex screw 2.4mm 16mm , cortex screw 2.4mm 18mm , cortex screw 2.4mm 20mm , cortex screw 2.4mm 22mm , cortex screw 2.4mm 24mm , cortex screw 2.4mm 26mm , cortex screw 2.4mm 28mm , cortex screw 2.4mm 30mm , cortex screw 2.7mm 6mm , cortex screw 2.7mm 8mm , cortex screw 2.7mm 10mm , cortex screw 2.7mm 12mm , cortex screw 2.7mm 14mm , cortex screw 2.7mm 16mm , cortex screw 2.7mm 18mm , cortex screw 2.7mm 20mm , cortex screw 2.7mm 22mm , cortex screw 2.7mm 24mm , cortex screw 2.7mm 26mm , cortex screw 2.7mm 28mm , cortex screw 2.7mm 30mm , cortex screw 3.5mm 10mm , cortex screw 3.5mm 12mm , cortex screw 3.5mm 14mm , cortex screw 3.5mm 16mm , cortex screw 3.5mm 18mm , cortex screw 3.5mm 20mm , cortex screw 3.5mm 22mm , cortex screw 3.5mm 24mm , cortex screw 3.5mm 26mm , cortex screw 3.5mm 28mm , cortex screw 3.5mm 30mm , cortex screw 3.5mm 32mm , cortex screw 3.5mm 34mm , cortex screw 3.5mm 36mm , cortex screw 3.5mm 38mm , cortex screw 3.5mm 40mm , cortex screw 3.5mm 42mm , cortex screw 3.5mm 44mm , cortex screw 3.5mm 46mm , cortex screw 3.5mm 48mm , cortex screw 3.5mm 50mm , cortex screw 3.5mm 55mm , cortex screw 3.5mm 60mm , cortex screw 3.5mm, self tapping 10mm , cortex screw 3.5mm, self tapping 12mm , cortex screw 3.5mm, self tapping 14mm , cortex screw 3.5mm, self tapping 16mm , cortex screw 3.5mm, self tapping 18mm , cortex screw 3.5mm, self tapping 20mm , cortex screw 3.5mm, self tapping 22mm , cortex screw 3.5mm, self tapping 24mm , cortex screw 3.5mm, self tapping 26mm , cortex screw 3.5mm, self tapping 28mm , cortex screw 3.5mm, self tapping 30mm , cortex screw 3.5mm, self tapping 32mm , cortex screw 3.5mm, self tapping 34mm , cortex screw 3.5mm, self tapping 36mm , cortex screw 3.5mm, self tapping 38mm , cortex screw 3.5mm, self tapping 40mm , cortex screw 3.5mm, self tapping 42mm , cortex screw 3.5mm, self tapping 44mm , cortex screw 3.5mm, self tapping 46mm , cortex screw 3.5mm, self tapping 48mm , cortex screw 3.5mm, self tapping 50mm , cortex screw 3.5mm, self tapping 55mm , cortex screw 3.5mm, self tapping 60mm , cortex screw 4.5mm 14mm , cortex screw 4.5mm 16mm , cortex screw 4.5mm 18mm , cortex screw 4.5mm 20mm , cortex screw 4.5mm 22mm , cortex screw 4.5mm 24mm , cortex screw 4.5mm 26mm , cortex screw 4.5mm 28mm , cortex screw 4.5mm 30mm , cortex screw 4.5mm 32mm , cortex screw 4.5mm 34mm , cortex screw 4.5mm 36mm , cortex screw 4.5mm 38mm , cortex screw 4.5mm 40mm , cortex screw 4.5mm 42mm , cortex screw 4.5mm 44mm , cortex screw 4.5mm 46mm , cortex screw 4.5mm 48mm , cortex screw 4.5mm 50mm , cortex screw 4.5mm 52mm , cortex screw 4.5mm 54mm , cortex screw 4.5mm 56mm , cortex screw 4.5mm 58mm , cortex screw 4.5mm 60mm , cortex screw 4.5mm 62mm , cortex screw 4.5mm 64mm , cortex screw 4.5mm 66mm , cortex screw 4.5mm 68mm , cortex screw 4.5mm 70mm , cortex screw 4.5mm 72mm , cortex screw 4.5mm 74mm , cortex screw 4.5mm 76mm , cortex screw 4.5mm 78mm , cortex screw 4.5mm 80mm , cortex screw 4.5mm, self tapping 14mm , cortex screw 4.5mm, self tapping 16mm , cortex screw 4.5mm, self tapping 18mm , cortex screw 4.5mm, self tapping 20mm , cortex screw 4.5mm, self tapping 22mm , cortex screw 4.5mm, self tapping 24mm , cortex screw 4.5mm, self tapping 26mm , cortex screw 4.5mm, self tapping 28mm , cortex screw 4.5mm, self tapping 30mm , cortex screw 4.5mm, self tapping 32mm , cortex screw 4.5mm, self tapping 34mm , cortex screw 4.5mm, self tapping 36mm , cortex screw 4.5mm, self tapping 38mm , cortex screw 4.5mm, self tapping 40mm , cortex screw 4.5mm, self tapping 42mm , cortex screw 4.5mm, self tapping 44mm , cortex screw 4.5mm, self tapping 46mm , cortex screw 4.5mm, self tapping 48mm , cortex screw 4.5mm, self tapping 50mm , cortex screw 4.5mm, self tapping 52mm , cortex screw 4.5mm, self tapping 54mm , cortex screw 4.5mm, self tapping 56mm , cortex screw 4.5mm, self tapping 58mm , cortex screw 4.5mm, self tapping 60mm , cortex screw 4.5mm, self tapping 62mm , cortex screw 4.5mm, self tapping 64mm , cortex screw 4.5mm, self tapping 66mm , cortex screw 4.5mm, self tapping 68mm , cortex screw 4.5mm, self tapping 70mm , cortex screw 4.5mm, self tapping 72mm , cortex screw 4.5mm, self tapping 74mm , cortex screw 4.5mm, self tapping 76mm , cortex screw 4.5mm, self tapping 78mm , cortex screw 4.5mm, self tapping 80mm , locking bolt 3.4mm, trocar tip 22mm , locking bolt 3.4mm, trocar tip 24mm , locking bolt 3.4mm, trocar tip 26mm , locking bolt 3.4mm, trocar tip 28mm , locking bolt 3.4mm, trocar tip 30mm , locking bolt 3.4mm, trocar tip 32mm , locking bolt 3.4mm, trocar tip 34mm , locking bolt 3.4mm, trocar tip 36mm , locking bolt 3.4mm, trocar tip 38mm , locking bolt 3.4mm, trocar tip 40mm , locking bolt 3.4mm, trocar tip 42mm , locking bolt 3.4mm, trocar tip 44mm , locking bolt 3.9mm, trocar tip 22mm , locking bolt 3.9mm, trocar tip 24mm , locking bolt 3.9mm, trocar tip 26mm , locking bolt 3.9mm, trocar tip 28mm , locking bolt 3.9mm, trocar tip 30mm , locking bolt 3.9mm, trocar tip 32mm , locking bolt 3.9mm, trocar tip 34mm , locking bolt 3.9mm, trocar tip 36mm , locking bolt 3.9mm, trocar tip 38mm , locking bolt 3.9mm, trocar tip 40mm , locking bolt 3.9mm, trocar tip 42mm , locking bolt 3.9mm, trocar tip 44mm , locking bolt 3.9mm, trocar tip 46mm , locking bolt 3.9mm, trocar tip 48mm , locking bolt 3.9mm, trocar tip 50mm , locking bolt 4.9mm, trocar tip 22mm , locking bolt 4.9mm, trocar tip 24mm , locking bolt 4.9mm, trocar tip 26mm , locking bolt 4.9mm, trocar tip 28mm , locking bolt 4.9mm, trocar tip 30mm , locking bolt 4.9mm, trocar tip 32mm , locking bolt 4.9mm, trocar tip 34mm , locking bolt 4.9mm, trocar tip 36mm , locking bolt 4.9mm, trocar tip 38mm , locking bolt 4.9mm, trocar tip 40mm , locking bolt 4.9mm, trocar tip 42mm , locking bolt 4.9mm, trocar tip 44mm , locking bolt 4.9mm, trocar tip 46mm , locking bolt 4.9mm, trocar tip 48mm , locking bolt 4.9mm, trocar tip 50mm , locking bolt 4.9mm, trocar tip 52mm , locking bolt 4.9mm, trocar tip 54mm , locking bolt 4.9mm, trocar tip 56mm , locking bolt 4.9mm, trocar tip 58mm , locking bolt 4.9mm, trocar tip 60mm , locking bolt 4.9mm, trocar tip 64mm , locking bolt 4.9mm, trocar tip 68mm , locking bolt 4.9mm, trocar tip 72mm , locking bolt 4.9mm, trocar tip 76mm , locking bolt 4.9mm, trocar tip 80mm , locking head screw 2.4mm, self tapping 10mm , locking head screw 2.4mm, self tapping 12mm , locking head screw 2.4mm, self tapping 14mm , locking head screw 2.4mm, self tapping 16mm , locking head screw 2.4mm, self tapping 18mm , locking head screw 2.4mm, self tapping 20mm , locking head screw 2.4mm, self tapping 22mm , locking head screw 2.4mm, self tapping 24mm , locking head screw 2.4mm, self tapping 26mm , locking head screw 2.4mm, self tapping 28mm , locking head screw 2.4mm, self tapping 30mm , locking head screw 2.7mm, self tapping 10mm , locking head screw 2.7mm, self tapping 12mm , locking head screw 2.7mm, self tapping 14mm , locking head screw 2.7mm, self tapping 16mm , locking head screw 2.7mm, self tapping 18mm , locking head screw 2.7mm, self tapping 20mm , locking head screw 2.7mm, self tapping 22mm , locking head screw 2.7mm, self tapping 24mm , locking head screw 2.7mm, self tapping 26mm , locking head screw 2.7mm, self tapping 28mm , locking head screw 2.7mm, self tapping 30mm , locking head screw 2.7mm, self tapping 35mm , locking head screw 2.7mm, self tapping 40mm , locking head screw 2.7mm, self tapping 45mm , locking head screw 2.7mm, self tapping 50mm , locking head screw 2.7mm, self tapping 55mm , locking head screw 2.7mm, self tapping 60mm , locking head screw 3.5mm, self tapping 10mm , locking head screw 3.5mm, self tapping 12mm , locking head screw 3.5mm, self tapping 14mm , locking head screw 3.5mm, self tapping 16mm , locking head screw 3.5mm, self tapping 18mm , locking head screw 3.5mm, self tapping 20mm , locking head screw 3.5mm, self tapping 22mm , locking head screw 3.5mm, self tapping 24mm , locking head screw 3.5mm, self tapping 26mm , locking head screw 3.5mm, self tapping 28mm , locking head screw 3.5mm, self tapping 30mm , locking head screw 3.5mm, self tapping 32mm , locking head screw 3.5mm, self tapping 34mm , locking head screw 3.5mm, self tapping 36mm , locking head screw 3.5mm, self tapping 38mm , locking head screw 3.5mm, self tapping 40mm , locking head screw 3.5mm, self tapping 42mm , locking head screw 3.5mm, self tapping 44mm , locking head screw 3.5mm, self tapping 46mm , locking head screw 3.5mm, self tapping 48mm , locking head screw 3.5mm, self tapping 50mm , locking head screw 3.5mm, self tapping 55mm , locking head screw 3.5mm, self tapping 60mm , locking head screw 3.5mm, self tapping 65mm , locking head screw 3.5mm, self tapping 70mm , locking head screw 3.5mm, self tapping 75mm , locking head screw 3.5mm, self tapping 80mm , locking head screw 3.5mm, self tapping 85mm , locking head screw 3.5mm, self tapping 90mm , locking head screw 5.0mm, self tapping 14mm , locking head screw 5.0mm, self tapping 16mm , locking head screw 5.0mm, self tapping 18mm , locking head screw 5.0mm, self tapping 20mm , locking head screw 5.0mm, self tapping 22mm , locking head screw 5.0mm, self tapping 24mm , locking head screw 5.0mm, self tapping 26mm , locking head screw 5.0mm, self tapping 28mm , locking head screw 5.0mm, self tapping 30mm , locking head screw 5.0mm, self tapping 32mm , locking head screw 5.0mm, self tapping 34mm , locking head screw 5.0mm, self tapping 36mm , locking head screw 5.0mm, self tapping 38mm , locking head screw 5.0mm, self tapping 40mm , locking head screw 5.0mm, self tapping 45mm , locking head screw 5.0mm, self tapping 50mm , locking head screw 5.0mm, self tapping 55mm , locking head screw 5.0mm, self tapping 60mm , locking head screw 5.0mm, self tapping 65mm , locking head screw 5.0mm, self tapping 70mm , locking head screw 5.0mm, self tapping 75mm , locking head screw 5.0mm, self tapping 80mm , locking head screw 5.0mm, self tapping 85mm , locking head screw 5.0mm, self tapping 90mm , locking head screw 5.0mm, self tapping 95mm , locking head screw 5.0mm, self tapping 100mm , cancellous screw 4.0mm, short thread 10mm , cancellous screw 4.0mm, short thread 12mm , cancellous screw 4.0mm, short thread 14mm , cancellous screw 4.0mm, short thread 16mm , cancellous screw 4.0mm, short thread 18mm , cancellous screw 4.0mm, short thread 20mm , cancellous screw 4.0mm, short thread 22mm , cancellous screw 4.0mm, short thread 24mm , cancellous screw 4.0mm, short thread 26mm , cancellous screw 4.0mm, short thread 28mm , cancellous screw 4.0mm, short thread 30mm , cancellous screw 4.0mm, short thread 35mm , cancellous screw 4.0mm, short thread 40mm , cancellous screw 4.0mm, short thread 45mm , cancellous screw 4.0mm, short thread 50mm , cancellous screw 4.0mm, short thread 55mm , cancellous screw 4.0mm, short thread 60mm , cancellous screw 4.0mm, short thread 65mm , cancellous screw 4.0mm, short thread 70mm , cancellous screw 4.0mm, short thread 75mm , cancellous screw 4.0mm, full thread 10mm , cancellous screw 4.0mm, full thread 12mm , cancellous screw 4.0mm, full thread 14mm , cancellous screw 4.0mm, full thread 16mm , cancellous screw 4.0mm, full thread 18mm , cancellous screw 4.0mm, full thread 20mm , cancellous screw 4.0mm, full thread 22mm , cancellous screw 4.0mm, full thread 24mm , cancellous screw 4.0mm, full thread 26mm , cancellous screw 4.0mm, full thread 28mm , cancellous screw 4.0mm, full thread 30mm , cancellous screw 4.0mm, full thread 35mm , cancellous screw 4.0mm, full thread 40mm , cancellous screw 4.0mm, full thread 45mm , cancellous screw 4.0mm, full thread 50mm , cancellous screw 4.0mm, full thread 55mm , cancellous screw 4.0mm, full thread 60mm , cancellous screw 4.0mm, full thread 65mm , cancellous screw 4.0mm, full thread 70mm , cancellous screw 4.0mm, full thread 75mm , cancellous screw 4.0mm, full thread 80mm , cancellous screw 6.5mm, 16mm thread 25mm , cancellous screw 6.5mm, 16mm thread 30mm , cancellous screw 6.5mm, 16mm thread 35mm , cancellous screw 6.5mm, 16mm thread 40mm , cancellous screw 6.5mm, 16mm thread 45mm , cancellous screw 6.5mm, 16mm thread 50mm , cancellous screw 6.5mm, 16mm thread 55mm , cancellous screw 6.5mm, 16mm thread 60mm , cancellous screw 6.5mm, 16mm thread 65mm , cancellous screw 6.5mm, 16mm thread 70mm , cancellous screw 6.5mm, 16mm thread 75mm , cancellous screw 6.5mm, 16mm thread 80mm , cancellous screw 6.5mm, 16mm thread 85mm , cancellous screw 6.5mm, 16mm thread 90mm , cancellous screw 6.5mm, 16mm thread 95mm , cancellous screw 6.5mm, 16mm thread 100mm , cancellous screw 6.5mm, 16mm thread 105mm , cancellous screw 6.5mm, 16mm thread 110mm , cancellous screw 6.5mm, 16mm thread 115mm , cancellous screw 6.5mm, 16mm thread 120mm , cancellous screw 6.5mm, 32mm thread 40mm , cancellous screw 6.5mm, 32mm thread 45mm , cancellous screw 6.5mm, 32mm thread 50mm , cancellous screw 6.5mm, 32mm thread 55mm , cancellous screw 6.5mm, 32mm thread 60mm , cancellous screw 6.5mm, 32mm thread 65mm , cancellous screw 6.5mm, 32mm thread 70mm , cancellous screw 6.5mm, 32mm thread 75mm , cancellous screw 6.5mm, 32mm thread 80mm , cancellous screw 6.5mm, 32mm thread 85mm , cancellous screw 6.5mm, 32mm thread 90mm , cancellous screw 6.5mm, 32mm thread 95mm , cancellous screw 6.5mm, 32mm thread 100mm , cancellous screw 6.5mm, 32mm thread 105mm , cancellous screw 6.5mm, 32mm thread 110mm , cancellous screw 6.5mm, 32mm thread 115mm , cancellous screw 6.5mm, full thread 25mm , cancellous screw 6.5mm, full thread 30mm , cancellous screw 6.5mm, full thread 35mm , cancellous screw 6.5mm, full thread 40mm , cancellous screw 6.5mm, full thread 45mm , cancellous screw 6.5mm, full thread 50mm , cancellous screw 6.5mm, full thread 55mm , cancellous screw 6.5mm, full thread 60mm , cancellous screw 6.5mm, full thread 65mm , cancellous screw 6.5mm, full thread 70mm , cancellous screw 6.5mm, full thread 75mm , cancellous screw 6.5mm, full thread 80mm , cancellous screw 6.5mm, full thread 85mm , cancellous screw 6.5mm, full thread 90mm , cancellous screw 6.5mm, full thread 95mm , cancellous screw 6.5mm, full thread 100mm , cancellous screw 6.5mm, full thread 105mm , cancellous screw 6.5mm, full thread 110mm , cancellous screw 6.5mm, full thread 115mm , malleolar screw 4.5mm 25mm , malleolar screw 4.5mm 30mm , malleolar screw 4.5mm 35mm , malleolar screw 4.5mm 40mm , malleolar screw 4.5mm 45mm , malleolar screw 4.5mm 50mm , malleolar screw 4.5mm 55mm , malleolar screw 4.5mm 60mm , malleolar screw 4.5mm 65mm , malleolar screw 4.5mm 70mm , malleolar screw 4.5mm 75mm , malleolar screw 4.5mm 80mm , malleolar screw 4.5mm 85mm , cancellous locking head screw 3.5mm 14mm , cancellous locking head screw 3.5mm 16mm , cancellous locking head screw 3.5mm 18mm , cancellous locking head screw 3.5mm 20mm , cancellous locking head screw 3.5mm 22mm , cancellous locking head screw 3.5mm 24mm , cancellous locking head screw 3.5mm 26mm , cancellous locking head screw 3.5mm 28mm , cancellous locking head screw 3.5mm 30mm , cancellous locking head screw 3.5mm 35mm , cancellous locking head screw 3.5mm 40mm , cancellous locking head screw 3.5mm 45mm , cancellous locking head screw 3.5mm 50mm , cancellous locking head screw 3.5mm 55mm , cancellous locking head screw 3.5mm 60mm , cancellous locking head screw 3.5mm 65mm , cancellous locking head screw 5.0mm 30mm , cancellous locking head screw 5.0mm 32mm , cancellous locking head screw 5.0mm 34mm , cancellous locking head screw 5.0mm 36mm , cancellous locking head screw 5.0mm 38mm , cancellous locking head screw 5.0mm 40mm , cancellous locking head screw 5.0mm 42mm , cancellous locking head screw 5.0mm 44mm , cancellous locking head screw 5.0mm 46mm , cancellous locking head screw 5.0mm 48mm , cancellous locking head screw 5.0mm 50mm , cancellous locking head screw 5.0mm 55mm , cancellous locking head screw 5.0mm 60mm , cancellous locking head screw 5.0mm 65mm , cancellous locking head screw 5.0mm 70mm , cancellous locking head screw 5.0mm 75mm , cancellous locking head screw 5.0mm 80mm , cancellous locking head screw 5.0mm 85mm , cancellous locking head screw 5.0mm 90mm , cancellous locking head screw 5.0mm 95mm , cancellous locking head screw 5.0mm 100mm , cancellous locking head screw 6.5mm, full thread 35mm , cancellous locking head screw 6.5mm, full thread 40mm , cancellous locking head screw 6.5mm, full thread 45mm , cancellous locking head screw 6.5mm, full thread 50mm , cancellous locking head screw 6.5mm, full thread 55mm , cancellous locking head screw 6.5mm, full thread 60mm , cancellous locking head screw 6.5mm, full thread 65mm , cancellous locking head screw 6.5mm, full thread 70mm , cancellous locking head screw 6.5mm, full thread 75mm , cancellous locking head screw 6.5mm, full thread 80mm , cancellous locking head screw 6.5mm, full thread 85mm , cancellous locking head screw 6.5mm, full thread 90mm , cancellous locking head screw 6.5mm, full thread 95mm , cancellous locking head screw 6.5mm, full thread 100mm , cancellous locking head screw 6.5mm, full thread 105mm , cancellous locking head screw 6.5mm, full thread 110mm , cancellous locking head screw 6.5mm, full thread 115mm , cannulated cancellous screw 6.5mm, 16mm thread 30mm , cannulated cancellous screw 6.5mm, 16mm thread 35mm , cannulated cancellous screw 6.5mm, 16mm thread 40mm , cannulated cancellous screw 6.5mm, 16mm thread 45mm , cannulated cancellous screw 6.5mm, 16mm thread 50mm , cannulated cancellous screw 6.5mm, 16mm thread 55mm , cannulated cancellous screw 6.5mm, 16mm thread 60mm , cannulated cancellous screw 6.5mm, 16mm thread 65mm , cannulated cancellous screw 6.5mm, 16mm thread 70mm , cannulated cancellous screw 6.5mm, 16mm thread 75mm , cannulated cancellous screw 6.5mm, 16mm thread 80mm , cannulated cancellous screw 6.5mm, 16mm thread 85mm , cannulated cancellous screw 6.5mm, 16mm thread 90mm , cannulated cancellous screw 6.5mm, 16mm thread 95mm , cannulated cancellous screw 6.5mm, 16mm thread 100mm , cannulated cancellous screw 6.5mm, 16mm thread 105mm , cannulated cancellous screw 6.5mm, 16mm thread 110mm , cannulated cancellous screw 6.5mm, 16mm thread 115mm , cannulated cancellous screw 6.5mm, 32mm thread 45mm , cannulated cancellous screw 6.5mm, 32mm thread 50mm , cannulated cancellous screw 6.5mm, 32mm thread 55mm , cannulated cancellous screw 6.5mm, 32mm thread 60mm , cannulated cancellous screw 6.5mm, 32mm thread 65mm , cannulated cancellous screw 6.5mm, 32mm thread 70mm , cannulated cancellous screw 6.5mm, 32mm thread 75mm , cannulated cancellous screw 6.5mm, 32mm thread 80mm , cannulated cancellous screw 6.5mm, 32mm thread 85mm , cannulated cancellous screw 6.5mm, 32mm thread 90mm , cannulated cancellous screw 6.5mm, 32mm thread 95mm , cannulated cancellous screw 6.5mm, 32mm thread 100mm , cannulated cancellous screw 6.5mm, 32mm thread 105mm , cannulated cancellous screw 6.5mm, 32mm thread 110mm , cannulated cancellous screw 6.5mm, 32mm thread 115mm , cannulated cancellous screw 4.0mm, full thread 10mm , cannulated cancellous screw 4.0mm, full thread 12mm , cannulated cancellous screw 4.0mm, full thread 14mm , cannulated cancellous screw 4.0mm, full thread 16mm , cannulated cancellous screw 4.0mm, full thread 18mm , cannulated cancellous screw 4.0mm, full thread 20mm , cannulated cancellous screw 4.0mm, full thread 22mm , cannulated cancellous screw 4.0mm, full thread 24mm , cannulated cancellous screw 4.0mm, full thread 26mm , cannulated cancellous screw 4.0mm, full thread 28mm , cannulated cancellous screw 4.0mm, full thread 30mm , cannulated cancellous screw 4.0mm, full thread 35mm , cannulated cancellous screw 4.0mm, full thread 40mm , cannulated cancellous screw 4.0mm, full thread 45mm , cannulated cancellous screw 4.0mm, full thread 50mm , cannulated cancellous screw 4.0mm, full thread 55mm , cannulated cancellous screw 4.0mm, full thread 60mm , cannulated cancellous screw 4.0mm, full thread 65mm , cannulated cancellous screw 4.0mm, full thread 70mm , cannulated cancellous screw 4.0mm, short thread 10mm , cannulated cancellous screw 4.0mm, short thread 12mm , cannulated cancellous screw 4.0mm, short thread 14mm , cannulated cancellous screw 4.0mm, short thread 16mm , cannulated cancellous screw 4.0mm, short thread 18mm , cannulated cancellous screw 4.0mm, short thread 20mm , cannulated cancellous screw 4.0mm, short thread 22mm , cannulated cancellous screw 4.0mm, short thread 24mm , cannulated cancellous screw 4.0mm, short thread 26mm , cannulated cancellous screw 4.0mm, short thread 28mm , cannulated cancellous screw 4.0mm, short thread 30mm , cannulated cancellous screw 4.0mm, short thread 35mm , cannulated cancellous screw 4.0mm, short thread 40mm , cannulated cancellous screw 4.0mm, short thread 45mm , cannulated cancellous screw 4.0mm, short thread 50mm , cannulated cancellous screw 4.0mm, short thread 55mm , cannulated cancellous screw 4.0mm, short thread 60mm , cannulated cancellous screw 4.0mm, short thread 65mm , cannulated cancellous screw 4.0mm, short thread 70mm , herbert cannulated screw 3.5mm 12mm , herbert cannulated screw 3.5mm 14mm , herbert cannulated screw 3.5mm 16mm , herbert cannulated screw 3.5mm 18mm , herbert cannulated screw 3.5mm 20mm , herbert cannulated screw 3.5mm 22mm , herbert cannulated screw 3.5mm 24mm , herbert cannulated screw 3.5mm 26mm , herbert cannulated screw 3.5mm 28mm , herbert cannulated screw 3.5mm 30mm , herbert cannulated screw 4.5mm 12mm , herbert cannulated screw 4.5mm 14mm , herbert cannulated screw 4.5mm 16mm , herbert cannulated screw 4.5mm 18mm , herbert cannulated screw 4.5mm 20mm , herbert cannulated screw 4.5mm 22mm , herbert cannulated screw 4.5mm 24mm , herbert cannulated screw 4.5mm 26mm , herbert cannulated screw 4.5mm 28mm , herbert cannulated screw 4.5mm 30mm , herbert cannulated screw 4.5mm 35mm , herbert cannulated screw 4.5mm 40mm , herbert cannulated screw 4.5mm 45mm , herbert cannulated screw 4.5mm 50mm , herbert cannulated screw 4.5mm 55mm , herbert cannulated screw 4.5mm 60mm , herbert cannulated screw 6.5mm 12mm , herbert cannulated screw 6.5mm 14mm , herbert cannulated screw 6.5mm 16mm , herbert cannulated screw 6.5mm 18mm , herbert cannulated screw 6.5mm 20mm , herbert cannulated screw 6.5mm 22mm , herbert cannulated screw 6.5mm 24mm , herbert cannulated screw 6.5mm 26mm , herbert cannulated screw 6.5mm 28mm , herbert cannulated screw 6.5mm 30mm , herbert cannulated screw 6.5mm 35mm , herbert cannulated screw 6.5mm 40mm , herbert cannulated screw 6.5mm 45mm , herbert cannulated screw 6.5mm 50mm , herbert cannulated screw 6.5mm 55mm , herbert cannulated screw 6.5mm 60mm , leg screw for pfn 6.4mm 50mm , leg screw for pfn 6.4mm 55mm , leg screw for pfn 6.4mm 60mm , leg screw for pfn 6.4mm 65mm , leg screw for pfn 6.4mm 70mm , leg screw for pfn 6.4mm 75mm , leg screw for pfn 6.4mm 80mm , leg screw for pfn 6.4mm 85mm , leg screw for pfn 6.4mm 90mm , leg screw for pfn 6.4mm 95mm , leg screw for pfn 6.4mm 100mm , leg screw for pfn 6.4mm 105mm , leg screw for pfn 6.4mm 110mm , leg screw for pfn 6.4mm 115mm , leg screw for pfn 6.4mm 120mm , leg screw for pfn 8.0mm 65mm , leg screw for pfn 8.0mm 70mm , leg screw for pfn 8.0mm 75mm , leg screw for pfn 8.0mm 80mm , leg screw for pfn 8.0mm 85mm , leg screw for pfn 8.0mm 90mm , leg screw for pfn 8.0mm 95mm , leg screw for pfn 8.0mm 100mm , leg screw for pfn 8.0mm 105mm , leg screw for pfn 8.0mm 110mm , leg screw for pfn 8.0mm 115mm , leg screw for pfn 8.0mm 120mm , dhs screw 12.5mm 50mm , dhs screw 12.5mm 55mm , dhs screw 12.5mm 60mm , dhs screw 12.5mm 65mm , dhs screw 12.5mm 70mm , dhs screw 12.5mm 75mm , dhs screw 12.5mm 80mm , dhs screw 12.5mm 85mm , dhs screw 12.5mm 90mm , dhs screw 12.5mm 95mm , dhs screw 12.5mm 100mm , dhs screw 12.5mm 105mm , dhs screw 12.5mm 110mm , dhs compression screw 36mm , schanz screw 2.0mm, 50mm thread, self tapping 175mm , schanz screw 2.5mm, 50mm thread, self tapping 100mm , schanz screw 2.5mm, 50mm thread, self tapping 125mm , schanz screw 2.5mm, 50mm thread, self tapping 150mm , schanz screw 2.5mm, 50mm thread, self tapping 200mm , schanz screw 3.0mm, 50mm thread, self tapping 150mm , schanz screw 3.5mm, 50mm thread, self tapping 100mm , schanz screw 3.5mm, 50mm thread, self tapping 150mm , schanz screw 3.5mm, 50mm thread, self tapping 175mm , schanz screw 3.5mm, 50mm thread, self tapping 200mm , schanz screw 3.5mm, 50mm thread, self tapping 250mm , schanz screw 4.0mm, 50mm thread, self tapping 100mm , schanz screw 4.0mm, 50mm thread, self tapping 125mm , schanz screw 4.0mm, 50mm thread, self tapping 150mm , schanz screw 4.0mm, 50mm thread, self tapping 175mm , schanz screw 4.0mm, 50mm thread, self tapping 200mm , schanz screw 4.5mm, 50mm thread, self tapping 100mm , schanz screw 4.5mm, 50mm thread, self tapping 125mm , schanz screw 4.5mm, 50mm thread, self tapping 150mm , schanz screw 4.5mm, 50mm thread, self tapping 175mm , schanz screw 4.5mm, 50mm thread, self tapping 200mm , schanz screw 4.5mm, 50mm thread, self tapping 225mm , schanz screw 4.5mm, 50mm thread, self tapping 250mm , schanz screw 5.0mm, 50mm thread, self tapping 150mm , schanz screw 5.0mm, 50mm thread, self tapping 175mm , schanz screw 5.0mm, 50mm thread, self tapping 200mm , schanz screw 5.0mm, 50mm thread, self tapping 250mm , schanz screw 5.0mm, 50mm thread, self tapping 275mm , schanz screw 6.0mm, 50mm thread, self tapping 100mm , schanz screw 6.0mm, 50mm thread, self tapping 125mm , schanz screw 6.0mm, 50mm thread, self tapping 150mm , schanz screw 6.0mm, 50mm thread, self tapping 225mm , schanz screw 6.0mm, 50mm thread, self tapping 250mm , schanz screw 6.0mm, 60mm thread, self tapping 100mm , schanz screw 6.0mm, 60mm thread, self tapping 150mm , schanz screw 6.0mm, 60mm thread, self tapping 200mm , schanz screw 2.0mm, 50mm thread 175mm , schanz screw 2.5mm, 25mm thread 100mm , schanz screw 2.5mm, 25mm thread 150mm , schanz screw 2.5mm, 50mm thread 100mm , schanz screw 2.5mm, 50mm thread 125mm , schanz screw 2.5mm, 50mm thread 150mm , schanz screw 2.5mm, 50mm thread 200mm , schanz screw 3.0mm, 50mm thread 150mm , schanz screw 3.5mm, 25mm thread 100mm , schanz screw 3.5mm, 25mm thread 150mm , schanz screw 3.5mm, 50mm thread 100mm , schanz screw 3.5mm, 50mm thread 150mm , schanz screw 3.5mm, 50mm thread 175mm , schanz screw 3.5mm, 50mm thread 200mm , schanz screw 3.5mm, 50mm thread 250mm , schanz screw 4.0mm, 25mm thread 080mm , schanz screw 4.0mm, 25mm thread 100mm , schanz screw 4.0mm, 25mm thread 125mm , schanz screw 4.0mm, 25mm thread 175mm , schanz screw 4.0mm, 50mm thread 100mm , schanz screw 4.0mm, 50mm thread 125mm , schanz screw 4.0mm, 50mm thread 150mm , schanz screw 4.0mm, 50mm thread 175mm , schanz screw 4.0mm, 50mm thread 200mm , schanz screw 4.5mm, 50mm thread 100mm , schanz screw 4.5mm, 50mm thread 125mm , schanz screw 4.5mm, 50mm thread 150mm , schanz screw 4.5mm, 50mm thread 175mm , schanz screw 4.5mm, 50mm thread 200mm , schanz screw 4.5mm, 50mm thread 225mm , schanz screw 4.5mm, 50mm thread 250mm , schanz screw 5.0mm, 50mm thread 150mm , schanz screw 5.0mm, 50mm thread 175mm , schanz screw 5.0mm, 50mm thread 200mm , schanz screw 5.0mm, 50mm thread 250mm , schanz screw 5.0mm, 50mm thread 275mm , schanz screw 6.0mm, 50mm thread 100mm , schanz screw 6.0mm, 50mm thread 125mm , schanz screw 6.0mm, 50mm thread 150mm , schanz screw 6.0mm, 50mm thread 225mm , schanz screw 6.0mm, 50mm thread 250mm , schanz screw 6.0mm, 60mm thread 100mm , schanz screw 6.0mm, 60mm thread 150mm , schanz screw 6.0mm, 60mm thread 200mm , end cap dynamic tibial nail , locking plates , lcp clavicle hook plate 3.5mm 12mm, 04 hole, left , lcp clavicle hook plate 3.5mm 12mm, 05 hole, left , lcp clavicle hook plate 3.5mm 12mm, 06 hole, left , lcp clavicle hook plate 3.5mm 12mm, 04 hole, right , lcp clavicle hook plate 3.5mm 12mm, 05 hole, right , lcp clavicle hook plate 3.5mm 12mm, 06 hole, right , lcp clavicle hook plate 3.5mm 15mm, 04 hole, left , lcp clavicle hook plate 3.5mm 15mm, 05 hole, left , lcp clavicle hook plate 3.5mm 15mm, 06 hole, left , lcp clavicle hook plate 3.5mm 15mm, 04 hole, right , lcp clavicle hook plate 3.5mm 15mm, 05 hole, right , lcp clavicle hook plate 3.5mm 15mm, 06 hole, right , lcp clavicle hook plate 3.5mm 18mm, 04 hole, left , lcp clavicle hook plate 3.5mm 18mm, 05 hole, left , lcp clavicle hook plate 3.5mm 18mm, 06 hole, left , lcp clavicle hook plate 3.5mm 18mm, 04 hole, right , lcp clavicle hook plate 3.5mm 18mm, 05 hole, right , lcp clavicle hook plate 3.5mm 18mm, 06 hole, right , lcp superior anterior clavicle plate 3.5mm with lateral extention 03 hole, left , lcp superior anterior clavicle plate 3.5mm with lateral extention 04 hole, left , lcp superior anterior clavicle plate 3.5mm with lateral extention 05 hole, left , lcp superior anterior clavicle plate 3.5mm with lateral extention 06 hole, left , lcp superior anterior clavicle plate 3.5mm with lateral extention 07 hole, left , lcp superior anterior clavicle plate 3.5mm with lateral extention 08 hole, left , lcp superior anterior clavicle plate 3.5mm with lateral extention 03 hole, right , lcp superior anterior clavicle plate 3.5mm with lateral extention 04 hole, right , lcp superior anterior clavicle plate 3.5mm with lateral extention 05 hole, right , lcp superior anterior clavicle plate 3.5mm with lateral extention 06 hole, right , lcp superior anterior clavicle plate 3.5mm with lateral extention 07 hole, right , lcp superior anterior clavicle plate 3.5mm with lateral extention 08 hole, right , lcp superior anterior clavicle plate 3.5mm 06 hole, left , lcp superior anterior clavicle plate 3.5mm 07 hole, left , lcp superior anterior clavicle plate 3.5mm 08 hole, left , lcp superior anterior clavicle plate 3.5mm 06 hole, right , lcp superior anterior clavicle plate 3.5mm 07 hole, right , lcp superior anterior clavicle plate 3.5mm 08 hole, right , lcp distal fibula plate 3.5mm 04 hole, left , lcp distal fibula plate 3.5mm 06 hole, left , lcp distal fibula plate 3.5mm 08 hole, left , lcp distal fibula plate 3.5mm 04 hole, right , lcp distal fibula plate 3.5mm 06 hole, right , lcp distal fibula plate 3.5mm 08 hole, right , lcp periarticular proximal lateral tibia plate 3.5mm 04 hole, left , lcp periarticular proximal lateral tibia plate 3.5mm 06 hole, left , lcp periarticular proximal lateral tibia plate 3.5mm 08 hole, left , lcp periarticular proximal lateral tibia plate 3.5mm 10 hole, left , lcp periarticular proximal lateral tibia plate 3.5mm 12 hole, left , lcp periarticular proximal lateral tibia plate 3.5mm 14 hole, left , lcp periarticular proximal lateral tibia plate 3.5mm 04 hole, right , lcp periarticular proximal lateral tibia plate 3.5mm 06 hole, right , lcp periarticular proximal lateral tibia plate 3.5mm 08 hole, right , lcp periarticular proximal lateral tibia plate 3.5mm 10 hole, right , lcp periarticular proximal lateral tibia plate 3.5mm 12 hole, right , lcp periarticular proximal lateral tibia plate 3.5mm 14 hole, right , lcp medial distal humerus plate 3.5mm 03 hole, left , lcp medial distal humerus plate 3.5mm 05 hole, left , lcp medial distal humerus plate 3.5mm 07 hole, left , lcp medial distal humerus plate 3.5mm 09 hole, left , lcp medial distal humerus plate 3.5mm 11 hole, left , lcp medial distal humerus plate 3.5mm 03 hole, right , lcp medial distal humerus plate 3.5mm 05 hole, right , lcp medial distal humerus plate 3.5mm 07 hole, right , lcp medial distal humerus plate 3.5mm 09 hole, right , lcp medial distal humerus plate 3.5mm 11 hole, right , lcp posterolateral distal humerus plate 3.5mm with lateral support 03 hole, left , lcp posterolateral distal humerus plate 3.5mm with lateral support 05 hole, left , lcp posterolateral distal humerus plate 3.5mm with lateral support 07 hole, left , lcp posterolateral distal humerus plate 3.5mm with lateral support 09 hole, left , lcp posterolateral distal humerus plate 3.5mm with lateral support 11 hole, left , lcp posterolateral distal humerus plate 3.5mm with lateral support 03 hole, right , lcp posterolateral distal humerus plate 3.5mm with lateral support 05 hole, right , lcp posterolateral distal humerus plate 3.5mm with lateral support 07 hole, right , lcp posterolateral distal humerus plate 3.5mm with lateral support 09 hole, right , lcp posterolateral distal humerus plate 3.5mm with lateral support 11 hole, right , lcp posterolateral distal humerus plate 3.5mm 03 hole, left , lcp posterolateral distal humerus plate 3.5mm 05 hole, left , lcp posterolateral distal humerus plate 3.5mm 07 hole, left , lcp posterolateral distal humerus plate 3.5mm 09 hole, left , lcp posterolateral distal humerus plate 3.5mm 11 hole, left , lcp posterolateral distal humerus plate 3.5mm 03 hole, right , lcp posterolateral distal humerus plate 3.5mm 05 hole, right , lcp posterolateral distal humerus plate 3.5mm 07 hole, right , lcp posterolateral distal humerus plate 3.5mm 09 hole, right , lcp posterolateral distal humerus plate 3.5mm 11 hole, right , lcp one third tubular plate 3.5mm 04 hole , lcp one third tubular plate 3.5mm 05 hole , lcp one third tubular plate 3.5mm 06 hole , lcp one third tubular plate 3.5mm 07 hole , lcp one third tubular plate 3.5mm 08 hole , lcp one third tubular plate 3.5mm 09 hole , lcp one third tubular plate 3.5mm 10 hole , lcp one third tubular plate 3.5mm 12 hole , lcp olecranon plate 3.5mm 02 hole, left , lcp olecranon plate 3.5mm 04 hole, left , lcp olecranon plate 3.5mm 06 hole, left , lcp olecranon plate 3.5mm 08 hole, left , lcp olecranon plate 3.5mm 10 hole, left , lcp olecranon plate 3.5mm 12 hole, left , lcp olecranon plate 3.5mm 02 hole, right , lcp olecranon plate 3.5mm 04 hole, right , lcp olecranon plate 3.5mm 06 hole, right , lcp olecranon plate 3.5mm 08 hole, right , lcp olecranon plate 3.5mm 10 hole, right , lcp olecranon plate 3.5mm 12 hole, right , lcp reconstruction plate 3.5mm with combi hole 05 hole , lcp reconstruction plate 3.5mm with combi hole 06 hole , lcp reconstruction plate 3.5mm with combi hole 07 hole , lcp reconstruction plate 3.5mm with combi hole 08 hole , lcp reconstruction plate 3.5mm with combi hole 09 hole , lcp reconstruction plate 3.5mm with combi hole 10 hole , lcp reconstruction plate 3.5mm with combi hole 11 hole , lcp reconstruction plate 3.5mm with combi hole 12 hole , lcp reconstruction plate 3.5mm with combi hole 14 hole , lcp reconstruction plate 3.5mm with combi hole 16 hole , lcp l buttress plate 4.5mm 04 hole, right , lcp l buttress plate 4.5mm 05 hole, right , lcp l buttress plate 4.5mm 06 hole, right , lcp l buttress plate 4.5mm 07 hole, right , lcp l buttress plate 4.5mm 08 hole, right , lcp l buttress plate 4.5mm 09 hole, right , lcp l buttress plate 4.5mm 10 hole, right , lcp l buttress plate 4.5mm 11 hole, right , lcp l buttress plate 4.5mm 12 hole, right , lcp l buttress plate 4.5mm 13 hole, right , lcp t plate 4.5mm 04 hole , lcp t plate 4.5mm 05 hole , lcp t plate 4.5mm 06 hole , lcp t plate 4.5mm 07 hole , lcp t plate 4.5mm 08 hole , lcp t plate 4.5mm 09 hole , lcp t plate 4.5mm 10 hole , lcp l buttress plate 4.5mm 04 hole, left , lcp l buttress plate 4.5mm 05 hole, left , lcp l buttress plate 4.5mm 06 hole, left , lcp l buttress plate 4.5mm 07 hole, left , lcp l buttress plate 4.5mm 08 hole, left , lcp l buttress plate 4.5mm 09 hole, left , lcp l buttress plate 4.5mm 10 hole, left , lcp l buttress plate 4.5mm 11 hole, left , lcp l buttress plate 4.5mm 12 hole, left , lcp l buttress plate 4.5mm 13 hole, left , lcp t buttress plate 4.5mm 04 hole , lcp t buttress plate 4.5mm 05 hole , lcp t buttress plate 4.5mm 06 hole , lcp t buttress plate 4.5mm 07 hole , lcp t buttress plate 4.5mm 08 hole , lcp dhs plate 130° long barrel 03 hole , lcp dhs plate 130° long barrel 04 hole , lcp dhs plate 130° long barrel 05 hole , lcp dhs plate 130° long barrel 06 hole , lcp dhs plate 130° long barrel 07 hole , lcp dhs plate 130° long barrel 08 hole , lcp dhs plate 130° long barrel 09 hole , lcp dhs plate 130° long barrel 10 hole , lcp dhs plate 130° long barrel 11 hole , lcp dhs plate 130° long barrel 12 hole , lcp dhs plate 130° long barrel 14 hole , lcp dhs plate 130° long barrel 16 hole , lcp dhs plate 135° long barrel 03 hole , lcp dhs plate 135° long barrel 04 hole , lcp dhs plate 135° long barrel 05 hole , lcp dhs plate 135° long barrel 06 hole , lcp dhs plate 135° long barrel 07 hole , lcp dhs plate 135° long barrel 08 hole , lcp dhs plate 135° long barrel 09 hole , lcp dhs plate 135° long barrel 10 hole , lcp dhs plate 135° long barrel 11 hole , lcp dhs plate 135° long barrel 12 hole , lcp dhs plate 135° long barrel 14 hole , lcp dhs plate 135° long barrel 16 hole , lcp dhs plate 135° long barrel 18 hole , lcp dhs plate 130° short barrel 03 hole , lcp dhs plate 130° short barrel 04 hole , lcp dhs plate 130° short barrel 05 hole , lcp dhs plate 130° short barrel 06 hole , lcp dhs plate 130° short barrel 07 hole , lcp dhs plate 130° short barrel 08 hole , lcp dhs plate 130° short barrel 09 hole , lcp dhs plate 130° short barrel 10 hole , lcp dhs plate 130° short barrel 11 hole , lcp dhs plate 130° short barrel 12 hole , lcp dhs plate 130° short barrel 14 hole , lcp dhs plate 130° short barrel 16 hole , lcp proximal humerus philos plate 3.5mm 03 hole , lcp proximal humerus philos plate 3.5mm 04 hole , lcp proximal humerus philos plate 3.5mm 05 hole , lcp proximal humerus long philos 3.5mm 05h , lcp proximal humerus long philos 3.5mm 06h , lcp proximal humerus long philos 3.5mm 07h , lcp proximal humerus long philos 3.5mm 08h , lcp proximal humerus long philos 3.5mm 09h , lcp proximal humerus long philos 3.5mm 10h , lcp proximal humerus long philos 3.5mm 11h , lcp proximal humerus long philos 3.5mm 12h , lcp proximal femur plate 4.5mm 05 hole, left , lcp proximal femur plate 4.5mm 07 hole, left , lcp proximal femur plate 4.5mm 09 hole, left , lcp proximal femur plate 4.5mm 11 hole, left , lcp proximal femur plate 4.5mm 13 hole, left , lcp proximal femur plate 4.5mm 05 hole, right , lcp proximal femur plate 4.5mm 07 hole, right , lcp proximal femur plate 4.5mm 09 hole, right , lcp proximal femur plate 4.5mm 11 hole, right , lcp proximal femur plate 4.5mm 13 hole, right , lcp dhs plate 135° short barrel 03 hole , lcp dhs plate 135° short barrel 04 hole , lcp dhs plate 135° short barrel 05 hole , lcp dhs plate 135° short barrel 06 hole , lcp dhs plate 135° short barrel 07 hole , lcp dhs plate 135° short barrel 08 hole , lcp dhs plate 135° short barrel 09 hole , lcp dhs plate 135° short barrel 10 hole , lcp dhs plate 135° short barrel 12 hole , lcp dhs plate 135° short barrel 14 hole , lcp dhs plate 135° short barrel 16 hole , lcp dhs plate 135° short barrel 18 hole , 950° dcs plates dc hole , 6 holes, 100 mm length , 8 holes, 130 mm , 10 holes, 163 mm , 12 holes, 198 mm , 14 holes, 225 mm , 16 holes, 260 mm , 18 holes, 306 mm , 20 holes, 338 mm , 22 holes, 370 mm , lcp dcs plate 95° 06 hole , lcp dcs plate 95° 08 hole , lcp dcs plate 95° 10 hole , lcp dcs plate 95° 12 hole , lcp dcs plate 95° 14 hole , lcp dcs plate 95° 16 hole , lcp dcs plate 95° 18 hole , lcp plate 3.5mm 04 hole , lcp plate 3.5mm 05 hole , lcp plate 3.5mm 06 hole , lcp plate 3.5mm 07 hole , lcp plate 3.5mm 08 hole , lcp plate 3.5mm 09 hole , lcp plate 3.5mm 10 hole , lcp plate 3.5mm 11 hole , lcp plate 3.5mm 12 hole , lcp plate 3.5mm 13 hole , lcp plate 3.5mm 14 hole , lcp plate 3.5mm 15 hole , lcp plate 3.5mm 16 hole , lcp narrow 4.5mm 04 hole , lcp narrow 4.5mm 05 hole , lcp narrow 4.5mm 06 hole , lcp narrow 4.5mm 07 hole , lcp narrow 4.5mm 08 hole , lcp narrow 4.5mm 09 hole , lcp narrow 4.5mm 10 hole , lcp narrow 4.5mm 11 hole , lcp narrow 4.5mm 12 hole , lcp narrow 4.5mm 13 hole , lcp narrow 4.5mm 14 hole , lcp narrow 4.5mm 15 hole , lcp narrow 4.5mm 16 hole , lcp narrow 4.5mm 17 hole , lcp narrow 4.5mm 18 hole , lcp metaphyseal plate 4.5mm 03 hole , lcp metaphyseal plate 4.5mm 05 hole , lcp metaphyseal plate 4.5mm 07 hole , lcp metaphyseal plate 4.5mm 09 hole , lcp metaphyseal plate 4.5mm 11 hole , lcp metaphyseal plate 4.5mm 13 hole , lcp broad 4.5mm 04 hole , lcp broad 4.5mm 05 hole , lcp broad 4.5mm 06 hole , lcp broad 4.5mm 07 hole , lcp broad 4.5mm 08 hole , lcp broad 4.5mm 09 hole , lcp broad 4.5mm 10 hole , lcp broad 4.5mm 11 hole , lcp broad 4.5mm 12 hole , lcp broad 4.5mm 13 hole , lcp broad 4.5mm 14 hole , lcp broad 4.5mm 15 hole , lcp broad 4.5mm 16 hole , lcp broad 4.5mm 18 hole , lcp broad 4.5mm 20 hole , lcp proximal humerus plate 3.5mm 03 hole , lcp proximal humerus plate 3.5mm 04 hole , lcp proximal humerus plate 3.5mm 05 hole , lcp proximal humerus plate 3.5mm 06 hole , lcp proximal humerus plate 3.5mm 07 hole , lcp proximal humerus plate 3.5mm 08 hole , lcp proximal humerus plate 3.5mm 09 hole , lcp proximal humerus plate 3.5mm 10 hole , lcp proximal humerus plate 3.5mm 11 hole , lcp proximal humerus plate 3.5mm 12 hole , lcp proximal tibia plate 4.5mm 05 hole, right , lcp proximal tibia plate 4.5mm 07 hole, right , lcp proximal tibia plate 4.5mm 09 hole, right , lcp proximal tibia plate 4.5mm 11 hole, right , lcp proximal tibia plate 4.5mm 13 hole, right , lcp proximal tibia plate 4.5mm 15 hole, right , lcp proximal tibia plate 4.5mm 05 hole, left , lcp proximal tibia plate 4.5mm 07 hole, left , lcp proximal tibia plate 4.5mm 09 hole, left , lcp proximal tibia plate 4.5mm 11 hole, left , lcp proximal tibia plate 4.5mm 13 hole, left , lcp proximal tibia plate 4.5mm 15 hole, left , lcp reconstruction plate 3.5mm 04 hole , lcp reconstruction plate 3.5mm 05 hole , lcp reconstruction plate 3.5mm 06 hole , lcp reconstruction plate 3.5mm 07 hole , lcp reconstruction plate 3.5mm 08 hole , lcp reconstruction plate 3.5mm 09 hole , lcp reconstruction plate 3.5mm 10 hole , lcp reconstruction plate 3.5mm 11 hole , lcp reconstruction plate 3.5mm 12 hole , lcp reconstruction plate 3.5mm 13 hole , lcp reconstruction plate 3.5mm 14 hole , lcp reconstruction plate 3.5mm 16 hole , lcp reconstruction plate 3.5mm 17 hole , lcp reconstruction plate 3.5mm 18 hole , lcp reconstruction plate 3.5mm 20 hole , lcp t plate 3.5mm 03 hole, oblique right , lcp t plate 3.5mm 04 hole, oblique right , lcp t plate 3.5mm 05 hole, oblique right , lcp t plate 3.5mm 06 hole, oblique right , lcp t plate 3.5mm 07 hole, oblique right , lcp t plate 3.5mm 08 hole, oblique right , lcp t plate 3.5mm 03 hole, oblique left , lcp t plate 3.5mm 04 hole, oblique left , lcp t plate 3.5mm 05 hole, oblique left , lcp t plate 3.5mm 06 hole, oblique left , lcp t plate 3.5mm 07 hole, oblique left , lcp t plate 3.5mm 08 hole, oblique left , locking calcaneal plate small, left , locking calcaneal plate large, left , locking calcaneal plate small, right , locking calcaneal plate large, right , lcp extra articular distal humerus plate 3.5mm 04 hole, left , lcp extra articular distal humerus plate 3.5mm 06 hole, left , lcp extra articular distal humerus plate 3.5mm 08 hole, left , lcp extra articular distal humerus plate 3.5mm 10 hole, left , lcp extra articular distal humerus plate 3.5mm 12 hole, left , lcp extra articular distal humerus plate 3.5mm 14 hole, left , lcp extra articular distal humerus plate 3.5mm 04 hole, right , lcp extra articular distal humerus plate 3.5mm 06 hole, right , lcp extra articular distal humerus plate 3.5mm 08 hole, right , lcp extra articular distal humerus plate 3.5mm 10 hole, right , lcp extra articular distal humerus plate 3.5mm 12 hole, right , lcp extra articular distal humerus plate 3.5mm 14 hole, right , lcp distal radius plate 2.4mm 03 hole, left , lcp distal radius plate 2.4mm 04 hole, left , lcp distal radius plate 2.4mm 05 hole, left , lcp distal radius plate 2.4mm 03 hole, right , lcp distal radius plate 2.4mm 04 hole, right , lcp distal radius plate 2.4mm 05 hole, right , lcp distal radius plate 2.4mm extraarticular head 04 hole, 03 hole, left , lcp distal radius plate 2.4mm extraarticular head 04 hole, 04 hole, left , lcp distal radius plate 2.4mm extraarticular head 04 hole, 05 hole, left , lcp distal radius plate 2.4mm extraarticular head 04 hole, 03 hole, right , lcp distal radius plate 2.4mm extraarticular head 04 hole, 04 hole, right , lcp distal radius plate 2.4mm extraarticular head 04 hole, 05 hole, right , lcp distal radius plate 2.4mm extraarticular head 05 hole, 03 hole, left , lcp distal radius plate 2.4mm extraarticular head 05 hole, 04 hole, left , lcp distal radius plate 2.4mm extraarticular head 05 hole, 05 hole, left , lcp distal radius plate 2.4mm extraarticular head 05 hole, 03 hole, right , lcp distal radius plate 2.4mm extraarticular head 05 hole, 04 hole, right , lcp distal radius plate 2.4mm extraarticular head 05 hole, 05 hole, right , lcp distal radius l plate 2.4mm head 03 hole, 03 hole, left , lcp distal radius l plate 2.4mm head 03 hole, 04 hole, left , lcp distal radius l plate 2.4mm head 03 hole, 05 hole, left , lcp distal radius l plate 2.4mm head 03 hole, 03 hole, right , lcp distal radius l plate 2.4mm head 03 hole, 04 hole, right , lcp distal radius l plate 2.4mm head 03 hole, 05 hole, right , lcp distal radius plate 2.4mm head 05 hole, 03 hole, left , lcp distal radius plate 2.4mm head 05 hole, 04 hole, left , lcp distal radius plate 2.4mm head 05 hole, 05 hole, left , lcp distal radius plate 2.4mm head 05 hole, 03 hole, right , lcp distal radius plate 2.4mm head 05 hole, 04 hole, right , lcp distal radius plate 2.4mm head 05 hole, 05 hole, right , lcp distal radius l plate 2.4mm head 02 hole, 03 hole, left , lcp distal radius l plate 2.4mm head 02 hole, 04 hole, left , lcp distal radius l plate 2.4mm head 02 hole, 05 hole, left , lcp distal radius l plate 2.4mm head 02 hole, 03 hole, right , lcp distal radius l plate 2.4mm head 02 hole, 04 hole, right , lcp distal radius l plate 2.4mm head 02 hole, 05 hole, right , lcp periarticular proximal lateral tibia plate 5.0mm 04 hole, left , lcp periarticular proximal lateral tibia plate 5.0mm 06 hole, left , lcp periarticular proximal lateral tibia plate 5.0mm 08 hole, left , lcp periarticular proximal lateral tibia plate 5.0mm 10 hole, left , lcp periarticular proximal lateral tibia plate 5.0mm 12 hole, left , lcp periarticular proximal lateral tibia plate 5.0mm 14 hole, left , lcp periarticular proximal lateral tibia plate 5.0mm 04 hole, right , lcp periarticular proximal lateral tibia plate 5.0mm 06 hole, right , lcp periarticular proximal lateral tibia plate 5.0mm 08 hole, right , lcp periarticular proximal lateral tibia plate 5.0mm 10 hole, right , lcp periarticular proximal lateral tibia plate 5.0mm 12 hole, right , lcp periarticular proximal lateral tibia plate 5.0mm 14 hole, right , dhs plate 125° long barrel dc hole 04 hole , dhs plate 125° long barrel dc hole 05 hole , dhs plate 125° long barrel dc hole 06 hole , dhs plate 125° long barrel dc hole 07 hole , dhs plate 125° long barrel dc hole 08 hole , dhs plate 125° long barrel dc hole 09 hole , dhs plate 125° long barrel dc hole 10 hole , dhs plate 125° long barrel dc hole 12 hole , dhs plate 125° long barrel round hole 04 hole , dhs plate 125° long barrel round hole 05 hole , dhs plate 125° long barrel round hole 06 hole , dhs plate 125° long barrel round hole 07 hole , dhs plate 125° long barrel round hole 08 hole , dhs plate 125° long barrel round hole 09 hole , dhs plate 125° long barrel round hole 10 hole , dhs plate 125° long barrel round hole 11 hole , dhs plate 125° long barrel round hole 12 hole , dhs plate 125° long barrel round hole 14 hole , dhs plate 125° long barrel round hole 16 hole , dhs plate 130° long barrel dc hole 04 hole , dhs plate 130° long barrel dc hole 05 hole , dhs plate 130° long barrel dc hole 06 hole , dhs plate 130° long barrel dc hole 07 hole , dhs plate 130° long barrel dc hole 08 hole , dhs plate 130° long barrel dc hole 09 hole , dhs plate 130° long barrel dc hole 10 hole , dhs plate 130° long barrel dc hole 11 hole , dhs plate 130° long barrel dc hole 12 hole , dhs plate 130° long barrel dc hole 14 hole , dhs plate 130° long barrel dc hole 16 hole , dhs plate 130° long barrel round hole 04 hole , dhs plate 130° long barrel round hole 05 hole , dhs plate 130° long barrel round hole 06 hole , dhs plate 130° long barrel round hole 07 hole , dhs plate 130° long barrel round hole 08 hole , dhs plate 130° long barrel round hole 09 hole , dhs plate 130° long barrel round hole 10 hole , dhs plate 130° long barrel round hole 11 hole , dhs plate 130° long barrel round hole 12 hole , dhs plate 130° long barrel round hole 14 hole , dhs plate 130° long barrel round hole 16 hole , dhs plate 135° long barrel dc hole 04 hole , dhs plate 135° long barrel dc hole 05 hole , dhs plate 135° long barrel dc hole 06 hole , dhs plate 135° long barrel dc hole 07 hole , dhs plate 135° long barrel dc hole 08 hole , dhs plate 135° long barrel dc hole 09 hole , dhs plate 135° long barrel dc hole 10 hole , dhs plate 135° long barrel dc hole 12 hole , dhs plate 135° long barrel dc hole 14 hole , dhs plate 135° long barrel dc hole 16 hole , dhs plate 135° long barrel round hole 04 hole , dhs plate 135° long barrel round hole 05 hole , dhs plate 135° long barrel round hole 06 hole , dhs plate 135° long barrel round hole 07 hole , dhs plate 135° long barrel round hole 08 hole , dhs plate 135° long barrel round hole 09 hole , dhs plate 135° long barrel round hole 10 hole , dhs plate 135° long barrel round hole 11 hole , dhs plate 135° long barrel round hole 12 hole , dhs plate 135° long barrel round hole 14 hole , dhs plate 135° long barrel round hole 16 hole , dhs plate 125° short barrel dc hole 04 hole , dhs plate 125° short barrel dc hole 05 hole , dhs plate 125° short barrel dc hole 06 hole , dhs plate 125° short barrel dc hole 07 hole , dhs plate 125° short barrel dc hole 08 hole , dhs plate 125° short barrel dc hole 09 hole , dhs plate 125° short barrel dc hole 10 hole , dhs plate 125° short barrel dc hole 12 hole , dhs plate 125° short barrel round hole 04 hole , dhs plate 125° short barrel round hole 05 hole , dhs plate 125° short barrel round hole 06 hole , dhs plate 125° short barrel round hole 07 hole , dhs plate 125° short barrel round hole 08 hole , dhs plate 125° short barrel round hole 09 hole , dhs plate 125° short barrel round hole 10 hole , dhs plate 125° short barrel round hole 12 hole , dhs plate 130° short barrel dc hole 04 hole , dhs plate 130° short barrel dc hole 05 hole , dhs plate 130° short barrel dc hole 06 hole , dhs plate 130° short barrel dc hole 07 hole , dhs plate 130° short barrel dc hole 08 hole , dhs plate 130° short barrel dc hole 09 hole , dhs plate 130° short barrel dc hole 10 hole , dhs plate 130° short barrel dc hole 11 hole , dhs plate 130° short barrel dc hole 12 hole , dhs plate 130° short barrel dc hole 14 hole , dhs plate 130° short barrel dc hole 16 hole , dhs plate 130° short barrel round hole 04 hole , dhs plate 130° short barrel round hole 05 hole , dhs plate 130° short barrel round hole 06 hole , dhs plate 130° short barrel round hole 07 hole , dhs plate 130° short barrel round hole 08 hole , dhs plate 130° short barrel round hole 09 hole , dhs plate 130° short barrel round hole 10 hole , dhs plate 130° short barrel round hole 11 hole , dhs plate 130° short barrel round hole 12 hole , dhs plate 130° short barrel round hole 14 hole , dhs plate 130° short barrel round hole 16 hole , dhs plate 135° short barrel dc hole 04 hole , dhs plate 135° short barrel dc hole 05 hole , dhs plate 135° short barrel dc hole 06 hole , dhs plate 135° short barrel dc hole 07 hole , dhs plate 135° short barrel dc hole 08 hole , dhs plate 135° short barrel dc hole 09 hole , dhs plate 135° short barrel dc hole 10 hole , dhs plate 135° short barrel dc hole 12 hole , dhs plate 135° short barrel dc hole 14 hole , dhs plate 135° short barrel dc hole 16 hole , dhs plate 135° short barrel round hole 04 hole , dhs plate 135° short barrel round hole 05 hole , dhs plate 135° short barrel round hole 06 hole , dhs plate 135° short barrel round hole 07 hole , dhs plate 135° short barrel round hole 08 hole , dhs plate 135° short barrel round hole 09 hole , dhs plate 135° short barrel round hole 10 hole , dhs plate 135° short barrel round hole 12 hole , dhs plate 135° short barrel round hole 14 hole , dhs plate 135° short barrel round hole 16 hole , dynamic tibial nail 8.0mm 260mm , dynamic tibial nail 8.0mm 280mm , dynamic tibial nail 8.0mm 300mm , dynamic tibial nail 8.0mm 320mm , dynamic tibial nail 8.0mm 340mm , dynamic tibial nail 8.0mm 360mm , dynamic tibial nail 8.0mm 380mm , dynamic tibial nail 9.0mm 260mm , dynamic tibial nail 9.0mm 280mm , dynamic tibial nail 9.0mm 300mm , dynamic tibial nail 9.0mm 320mm , dynamic tibial nail 9.0mm 340mm , dynamic tibial nail 9.0mm 360mm , dynamic tibial nail 9.0mm 380mm , dynamic tibial nail 10.0mm 260mm , dynamic tibial nail 10.0mm 280mm , dynamic tibial nail 10.0mm 300mm , dynamic tibial nail 10.0mm 320mm , dynamic tibial nail 10.0mm 340mm , dynamic tibial nail 10.0mm 360mm , dynamic tibial nail 10.0mm 380mm , dynamic tibial nail 11.0mm 260mm , dynamic tibial nail 11.0mm 280mm , dynamic tibial nail 11.0mm 300mm , dynamic tibial nail 11.0mm 320mm , dynamic tibial nail 11.0mm 340mm , dynamic tibial nail 11.0mm 360mm , dynamic tibial nail 11.0mm 380mm , dynamic tibial nail 12.0mm 260mm , dynamic tibial nail 12.0mm 280mm , dynamic tibial nail 12.0mm 300mm , dynamic tibial nail 12.0mm 320mm , dynamic tibial nail 12.0mm 340mm , dynamic tibial nail 12.0mm 360mm , dynamic tibial nail 12.0mm 380mm , solid humeral nail 6.7mm 205mm , solid humeral nail 6.7mm 220mm , solid humeral nail 6.7mm 230mm , solid humeral nail 6.7mm 240mm , solid humeral nail 6.7mm 250mm , solid humeral nail 6.7mm 260mm , solid humeral nail 6.7mm 270mm , solid humeral nail 6.7mm 280mm , solid humeral nail 6.7mm 295mm , solid humeral nail 6.7mm 310mm , solid humeral nail 7.5mm 205mm , solid humeral nail 7.5mm 220mm , solid humeral nail 7.5mm 230mm , solid humeral nail 7.5mm 240mm , solid humeral nail 7.5mm 250mm , solid humeral nail 7.5mm 260mm , solid humeral nail 7.5mm 270mm , solid humeral nail 7.5mm 280mm , solid humeral nail 7.5mm 295mm , solid humeral nail 7.5mm 310mm , short proximal femoral nail 135° 9.0mm 250mm , short proximal femoral nail 135° 10.0mm 250mm , short proximal femoral nail 135° 11.0mm 250mm , short proximal femoral nail 135° 12.0mm 250mm , short proximal femoral nail 130° 9.0mm 250mm , short proximal femoral nail 130° 10.0mm 250mm , short proximal femoral nail 130° 11.0mm 250mm , short proximal femoral nail 130° 12.0mm 250mm , supra condylar nail 9.0mm 150mm , supra condylar nail 9.0mm 200mm , supra condylar nail 9.0mm 250mm , supra condylar nail 9.0mm 300mm , supra condylar nail 9.0mm 350mm , supra condylar nail 10.0mm 150mm , supra condylar nail 10.0mm 200mm , supra condylar nail 10.0mm 250mm , supra condylar nail 10.0mm 300mm , supra condylar nail 10.0mm 350mm , supra condylar nail 11.0mm 150mm , supra condylar nail 11.0mm 200mm , supra condylar nail 11.0mm 250mm , supra condylar nail 11.0mm 300mm , supra condylar nail 11.0mm 350mm , supra condylar nail 12.0mm 150mm , supra condylar nail 12.0mm 200mm , supra condylar nail 12.0mm 250mm , supra condylar nail 12.0mm 300mm , supra condylar nail 12.0mm 350mm , proximal femoral nail 135° 9.0mm 340mm, right , proximal femoral nail 135° 9.0mm 360mm, right , proximal femoral nail 135° 9.0mm 380mm, right , proximal femoral nail 135° 9.0mm 400mm, right , proximal femoral nail 135° 9.0mm 420mm, right , proximal femoral nail 135° 9.0mm 440mm, right , proximal femoral nail 135° 10.0mm 340mm, right , proximal femoral nail 135° 10.0mm 360mm, right , proximal femoral nail 135° 10.0mm 380mm, right , proximal femoral nail 135° 10.0mm 400mm, right , proximal femoral nail 135° 10.0mm 420mm, right , proximal femoral nail 135° 10.0mm 440mm, right , proximal femoral nail 135° 11.0mm 340mm, right , proximal femoral nail 135° 11.0mm 360mm, right , proximal femoral nail 135° 11.0mm 380mm, right , proximal femoral nail 135° 11.0mm 400mm, right , proximal femoral nail 135° 11.0mm 420mm, right , proximal femoral nail 135° 11.0mm 440mm, right , proximal femoral nail 135° 12.0mm 340mm, right , proximal femoral nail 135° 12.0mm 360mm, right , proximal femoral nail 135° 12.0mm 380mm, right , proximal femoral nail 135° 12.0mm 400mm, right , proximal femoral nail 135° 12.0mm 420mm, right , proximal femoral nail 135° 12.0mm 440mm, right , proximal femoral nail 130° 9.0mm 340mm, left , proximal femoral nail 130° 9.0mm 360mm, left , proximal femoral nail 130° 9.0mm 380mm, left , proximal femoral nail 130° 9.0mm 400mm, left , proximal femoral nail 130° 9.0mm 420mm, left , proximal femoral nail 130° 9.0mm 440mm, left , proximal femoral nail 130° 10.0mm 340mm, left , proximal femoral nail 130° 10.0mm 360mm, left , proximal femoral nail 130° 10.0mm 380mm, left , proximal femoral nail 130° 10.0mm 400mm, left , proximal femoral nail 130° 10.0mm 420mm, left , proximal femoral nail 130° 10.0mm 440mm, left , proximal femoral nail 130° 11.0mm 340mm, left , proximal femoral nail 130° 11.0mm 360mm, left , proximal femoral nail 130° 11.0mm 380mm, left , proximal femoral nail 130° 11.0mm 400mm, left , proximal femoral nail 130° 11.0mm 420mm, left , proximal femoral nail 130° 11.0mm 440mm, left , proximal femoral nail 130° 12.0mm 340mm, left , proximal femoral nail 130° 12.0mm 360mm, left , proximal femoral nail 130° 12.0mm 380mm, left , proximal femoral nail 130° 12.0mm 400mm, left , proximal femoral nail 130° 12.0mm 420mm, left , proximal femoral nail 130° 12.0mm 440mm, left , proximal femoral nail 135° 9.0mm 340mm, left , proximal femoral nail 135° 9.0mm 360mm, left , proximal femoral nail 135° 9.0mm 380mm, left , proximal femoral nail 135° 9.0mm 400mm, left , proximal femoral nail 135° 9.0mm 420mm, left , proximal femoral nail 135° 9.0mm 440mm, left , proximal femoral nail 135° 10.0mm 340mm, left , proximal femoral nail 135° 10.0mm 360mm, left , proximal femoral nail 135° 10.0mm 380mm, left , proximal femoral nail 135° 10.0mm 400mm, left , proximal femoral nail 135° 10.0mm 420mm, left , proximal femoral nail 135° 10.0mm 440mm, left , proximal femoral nail 135° 11.0mm 340mm, left , proximal femoral nail 135° 11.0mm 360mm, left , proximal femoral nail 135° 11.0mm 380mm, left , proximal femoral nail 135° 11.0mm 400mm, left , proximal femoral nail 135° 11.0mm 420mm, left , proximal femoral nail 135° 11.0mm 440mm, left , proximal femoral nail 135° 12.0mm 340mm, left , proximal femoral nail 135° 12.0mm 360mm, left , proximal femoral nail 135° 12.0mm 380mm, left , proximal femoral nail 135° 12.0mm 400mm, left , proximal femoral nail 135° 12.0mm 420mm, left , proximal femoral nail 135° 12.0mm 440mm, left , universal femoral nail 11.0mm 340mm , universal femoral nail 11.0mm 360mm , universal femoral nail 11.0mm 380mm , universal femoral nail 11.0mm 400mm , universal femoral nail 11.0mm 420mm , universal femoral nail 11.0mm 440mm , universal femoral nail 12.0mm 340mm , universal femoral nail 12.0mm 360mm , universal femoral nail 12.0mm 380mm , universal femoral nail 12.0mm 400mm , universal femoral nail 12.0mm 420mm , universal femoral nail 12.0mm 440mm , universal tibial nail 10.0mm 285mm , universal tibial nail 10.0mm 300mm , universal tibial nail 10.0mm 315mm , universal tibial nail 10.0mm 330mm , universal tibial nail 10.0mm 345mm , universal tibial nail 10.0mm 360mm , universal tibial nail 10.0mm 380mm , universal tibial nail 10.0mm 400mm , universal tibial nail 13.0mm 285mm , universal tibial nail 13.0mm 300mm , universal tibial nail 13.0mm 315mm , universal tibial nail 13.0mm 330mm , universal tibial nail 13.0mm 345mm , universal tibial nail 13.0mm 360mm , universal tibial nail 13.0mm 380mm , universal tibial nail 13.0mm 400mm , universal tibial nail 11.0mm 285mm , universal tibial nail 11.0mm 300mm , universal tibial nail 11.0mm 315mm , universal tibial nail 11.0mm 330mm , universal tibial nail 11.0mm 345mm , universal tibial nail 11.0mm 360mm , universal tibial nail 11.0mm 380mm , universal tibial nail 11.0mm 400mm , universal femoral nail 8.0mm 340mm , universal femoral nail 8.0mm 360mm , universal femoral nail 8.0mm 380mm , universal femoral nail 8.0mm 400mm , universal femoral nail 8.0mm 420mm , universal femoral nail 8.0mm 440mm , universal femoral nail 9.0mm 340mm , universal femoral nail 9.0mm 360mm , universal femoral nail 9.0mm 380mm , universal femoral nail 9.0mm 400mm , universal femoral nail 9.0mm 420mm , universal femoral nail 9.0mm 440mm , universal tibial nail 12.0mm 285mm , universal tibial nail 12.0mm 300mm , universal tibial nail 12.0mm 315mm , universal tibial nail 12.0mm 330mm , universal tibial nail 12.0mm 345mm , universal tibial nail 12.0mm 360mm , universal tibial nail 12.0mm 380mm , universal tibial nail 12.0mm 400mm , universal femoral nail 10.0mm 340mm , universal femoral nail 10.0mm 360mm , universal femoral nail 10.0mm 380mm , universal femoral nail 10.0mm 400mm , universal femoral nail 10.0mm 420mm , universal femoral nail 10.0mm 440mm , cortex screw 2.7mm, self tapping 10mm tit , cortex screw 2.7mm, self tapping 12mm tit , cortex screw 2.7mm, self tapping 14mm tit , cortex screw 2.7mm, self tapping 16mm tit , cortex screw 2.7mm, self tapping 18mm tit , cortex screw 2.7mm, self tapping 20mm tit , cortex screw 2.7mm, self tapping 22mm tit , cortex screw 2.7mm, self tapping 24mm tit , cortex screw 2.7mm, self tapping 26mm tit , cortex screw 2.7mm, self tapping 28mm tit , cortex screw 2.7mm, self tapping 30mm tit , cortex screw 3.5mm, self tapping 10mm tit , cortex screw 3.5mm, self tapping 12mm tit , cortex screw 3.5mm, self tapping 14mm tit , cortex screw 3.5mm, self tapping 16mm tit , cortex screw 3.5mm, self tapping 18mm tit , cortex screw 3.5mm, self tapping 20mm tit , cortex screw 3.5mm, self tapping 22mm tit , cortex screw 3.5mm, self tapping 24mm tit , cortex screw 3.5mm, self tapping 26mm tit , cortex screw 3.5mm, self tapping 28mm tit , cortex screw 3.5mm, self tapping 30mm tit , cortex screw 3.5mm, self tapping 32mm tit , cortex screw 3.5mm, self tapping 34mm tit , cortex screw 3.5mm, self tapping 36mm tit , cortex screw 3.5mm, self tapping 38mm tit , cortex screw 3.5mm, self tapping 40mm tit , cortex screw 3.5mm, self tapping 42mm tit , cortex screw 3.5mm, self tapping 44mm tit , cortex screw 3.5mm, self tapping 46mm tit , cortex screw 3.5mm, self tapping 48mm tit , cortex screw 3.5mm, self tapping 50mm tit , cortex screw 3.5mm, self tapping 55mm tit , cortex screw 3.5mm, self tapping 60mm tit , cortex screw 4.5mm, self tapping 16mm tit , cortex screw 4.5mm, self tapping 18mm tit , cortex screw 4.5mm, self tapping 20mm tit , cortex screw 4.5mm, self tapping 22mm tit , cortex screw 4.5mm, self tapping 24mm tit , cortex screw 4.5mm, self tapping 26mm tit , cortex screw 4.5mm, self tapping 28mm tit , cortex screw 4.5mm, self tapping 30mm tit , cortex screw 4.5mm, self tapping 32mm tit , cortex screw 4.5mm, self tapping 34mm tit , cortex screw 4.5mm, self tapping 36mm tit , cortex screw 4.5mm, self tapping 38mm tit , cortex screw 4.5mm, self tapping 40mm tit , cortex screw 4.5mm, self tapping 42mm tit , cortex screw 4.5mm, self tapping 44mm tit , cortex screw 4.5mm, self tapping 46mm tit , cortex screw 4.5mm, self tapping 48mm tit , cortex screw 4.5mm, self tapping 50mm tit , cortex screw 4.5mm, self tapping 52mm tit , cortex screw 4.5mm, self tapping 54mm tit , cortex screw 4.5mm, self tapping 56mm tit , cortex screw 4.5mm, self tapping 58mm tit , cortex screw 4.5mm, self tapping 60mm tit , cortex screw 4.5mm, self tapping 64mm tit , cortex screw 4.5mm, self tapping 66mm tit , cortex screw 4.5mm, self tapping 68mm tit , cortex screw 4.5mm, self tapping 70mm tit , cortex screw 4.5mm, self tapping 72mm tit , cortex screw 4.5mm, self tapping 74mm tit , cortex screw 4.5mm, self tapping 76mm tit , cortex screw 4.5mm, self tapping 78mm tit , cortex screw 4.5mm, self tapping 80mm tit , malleolar screw 4.5mm 25mm tit , malleolar screw 4.5mm 30mm tit , malleolar screw 4.5mm 35mm tit , malleolar screw 4.5mm 40mm tit , malleolar screw 4.5mm 45mm tit , malleolar screw 4.5mm 50mm tit , malleolar screw 4.5mm 55mm tit , malleolar screw 4.5mm 60mm tit , malleolar screw 4.5mm 65mm tit , malleolar screw 4.5mm 70mm tit , malleolar screw 4.5mm 75mm tit , malleolar screw 4.5mm 80mm tit , malleolar screw 4.5mm 85mm tit , cancellous screw 4.0mm, short thread 10mm tit , cancellous screw 4.0mm, short thread 12mm tit , cancellous screw 4.0mm, short thread 14mm tit , cancellous screw 4.0mm, short thread 16mm tit , cancellous screw 4.0mm, short thread 18mm tit , cancellous screw 4.0mm, short thread 20mm tit , cancellous screw 4.0mm, short thread 22mm tit , cancellous screw 4.0mm, short thread 24mm tit , cancellous screw 4.0mm, short thread 26mm tit , cancellous screw 4.0mm, short thread 28mm tit , cancellous screw 4.0mm, short thread 30mm tit , cancellous screw 4.0mm, short thread 35mm tit , cancellous screw 4.0mm, short thread 40mm tit , cancellous screw 4.0mm, short thread 45mm tit , cancellous screw 4.0mm, short thread 50mm tit , cancellous screw 4.0mm, short thread 55mm tit , cancellous screw 4.0mm, short thread 60mm tit , cancellous screw 4.0mm, short thread 65mm tit , cancellous screw 4.0mm, short thread 70mm tit , cancellous screw 4.0mm, short thread 75mm tit , cancellous screw 4.0mm, full thread 10mm tit , cancellous screw 4.0mm, full thread 12mm tit , cancellous screw 4.0mm, full thread 14mm tit , cancellous screw 4.0mm, full thread 16mm tit , cancellous screw 4.0mm, full thread 18mm tit , cancellous screw 4.0mm, full thread 20mm tit , cancellous screw 4.0mm, full thread 22mm tit , cancellous screw 4.0mm, full thread 24mm tit , cancellous screw 4.0mm, full thread 26mm tit , cancellous screw 4.0mm, full thread 28mm tit , cancellous screw 4.0mm, full thread 30mm tit , cancellous screw 4.0mm, full thread 35mm tit , cancellous screw 4.0mm, full thread 40mm tit , cancellous screw 4.0mm, full thread 45mm tit , cancellous screw 4.0mm, full thread 50mm tit , cancellous screw 4.0mm, full thread 55mm tit , cancellous screw 4.0mm, full thread 60mm tit , cancellous screw 4.0mm, full thread 65mm tit , cancellous screw 4.0mm, full thread 70mm tit , cancellous screw 4.0mm, full thread 75mm tit , cancellous screw 6.5mm, 16mm thread 25mm tit , cancellous screw 6.5mm, 16mm thread 30mm tit , cancellous screw 6.5mm, 16mm thread 35mm tit , cancellous screw 6.5mm, 16mm thread 40mm tit , cancellous screw 6.5mm, 16mm thread 45mm tit , cancellous screw 6.5mm, 16mm thread 50mm tit , cancellous screw 6.5mm, 16mm thread 55mm tit , cancellous screw 6.5mm, 16mm thread 60mm tit , cancellous screw 6.5mm, 16mm thread 65mm tit , cancellous screw 6.5mm, 16mm thread 70mm tit , cancellous screw 6.5mm, 16mm thread 75mm tit , cancellous screw 6.5mm, 16mm thread 80mm tit , cancellous screw 6.5mm, 16mm thread 85mm tit , cancellous screw 6.5mm, 16mm thread 90mm tit , cancellous screw 6.5mm, 16mm thread 95mm tit , cancellous screw 6.5mm, 16mm thread 100mm tit , cancellous screw 6.5mm, 16mm thread 105mm tit , cancellous screw 6.5mm, 16mm thread 110mm tit , cancellous screw 6.5mm, 16mm thread 115mm tit , cancellous screw 6.5mm, 32mm thread 45mm tit , cancellous screw 6.5mm, 32mm thread 50mm tit , cancellous screw 6.5mm, 32mm thread 55mm tit , cancellous screw 6.5mm, 32mm thread 60mm tit , cancellous screw 6.5mm, 32mm thread 65mm tit , cancellous screw 6.5mm, 32mm thread 70mm tit , cancellous screw 6.5mm, 32mm thread 75mm tit , cancellous screw 6.5mm, 32mm thread 80mm tit , cancellous screw 6.5mm, 32mm thread 85mm tit , cancellous screw 6.5mm, 32mm thread 90mm tit , cancellous screw 6.5mm, 32mm thread 95mm tit , cancellous screw 6.5mm, 32mm thread 100mm tit , cancellous screw 6.5mm, 32mm thread 105mm tit , cancellous screw 6.5mm, 32mm thread 110mm tit , cancellous screw 6.5mm, 32mm thread 115mm tit , cancellous screw 6.5mm, full thread 25mm tit , cancellous screw 6.5mm, full thread 30mm tit , cancellous screw 6.5mm, full thread 35mm tit , cancellous screw 6.5mm, full thread 40mm tit , cancellous screw 6.5mm, full thread 45mm tit , cancellous screw 6.5mm, full thread 50mm tit , cancellous screw 6.5mm, full thread 55mm tit , cancellous screw 6.5mm, full thread 60mm tit , cancellous screw 6.5mm, full thread 65mm tit , cancellous screw 6.5mm, full thread 70mm tit , cancellous screw 6.5mm, full thread 75mm tit , cancellous screw 6.5mm, full thread 80mm tit , cancellous screw 6.5mm, full thread 85mm tit , cancellous screw 6.5mm, full thread 90mm tit , cancellous screw 6.5mm, full thread 95mm tit , cancellous screw 6.5mm, full thread 100mm tit , cancellous screw 6.5mm, full thread 105mm tit , cancellous screw 6.5mm, full thread 110mm tit , cancellous screw 6.5mm, full thread 115mm tit , cancellous locking head screw 6.5mm, full thread 35mm tit , cancellous locking head screw 6.5mm, full thread 40mm tit , cancellous locking head screw 6.5mm, full thread 45mm tit , cancellous locking head screw 6.5mm, full thread 50mm tit , cancellous locking head screw 6.5mm, full thread 55mm tit , cancellous locking head screw 6.5mm, full thread 60mm tit , cancellous locking head screw 6.5mm, full thread 65mm tit , cancellous locking head screw 6.5mm, full thread 70mm tit , cancellous locking head screw 6.5mm, full thread 75mm tit , cancellous locking head screw 6.5mm, full thread 80mm tit , cancellous locking head screw 6.5mm, full thread 85mm tit , cancellous locking head screw 6.5mm, full thread 90mm tit , cancellous locking head screw 6.5mm, full thread 95mm tit , cancellous locking head screw 6.5mm, full thread 100mm tit , cancellous locking head screw 6.5mm, full thread 105mm tit , cancellous locking head screw 6.5mm, full thread 110mm tit , cancellous locking head screw 6.5mm, full thread 115mm tit , cannulated cancellous screw 4.0mm, short thread 10mm tit , cannulated cancellous screw 4.0mm, short thread 12mm tit , cannulated cancellous screw 4.0mm, short thread 14mm tit , cannulated cancellous screw 4.0mm, short thread 16mm tit , cannulated cancellous screw 4.0mm, short thread 18mm tit , cannulated cancellous screw 4.0mm, short thread 20mm tit , cannulated cancellous screw 4.0mm, short thread 22mm tit , cannulated cancellous screw 4.0mm, short thread 24mm tit , cannulated cancellous screw 4.0mm, short thread 26mm tit , cannulated cancellous screw 4.0mm, short thread 28mm tit , cannulated cancellous screw 4.0mm, short thread 30mm tit , cannulated cancellous screw 4.0mm, short thread 35mm tit , cannulated cancellous screw 4.0mm, short thread 40mm tit , cannulated cancellous screw 4.0mm, short thread 45mm tit , cannulated cancellous screw 4.0mm, short thread 50mm tit , cannulated cancellous screw 4.0mm, short thread 55mm tit , cannulated cancellous screw 4.0mm, short thread 60mm tit , cannulated cancellous screw 4.0mm, short thread 65mm tit , cannulated cancellous screw 4.0mm, full thread 10mm tit , cannulated cancellous screw 4.0mm, full thread 12mm tit , cannulated cancellous screw 4.0mm, full thread 14mm tit , cannulated cancellous screw 4.0mm, full thread 16mm tit , cannulated cancellous screw 4.0mm, full thread 18mm tit , cannulated cancellous screw 4.0mm, full thread 20mm tit , cannulated cancellous screw 4.0mm, full thread 22mm tit , cannulated cancellous screw 4.0mm, full thread 24mm tit , cannulated cancellous screw 4.0mm, full thread 26mm tit , cannulated cancellous screw 4.0mm, full thread 28mm tit , cannulated cancellous screw 4.0mm, full thread 30mm tit , cannulated cancellous screw 4.0mm, full thread 35mm tit , cannulated cancellous screw 4.0mm, full thread 40mm tit , cannulated cancellous screw 4.0mm, full thread 45mm tit , cannulated cancellous screw 4.0mm, full thread 50mm tit , cannulated cancellous screw 4.0mm, full thread 55mm tit , cannulated cancellous screw 4.0mm, full thread 60mm tit , cannulated cancellous screw 4.0mm, full thread 65mm tit , cannulated cancellous screw 6.5mm, 16mm thread 30mm tit , cannulated cancellous screw 6.5mm, 16mm thread 35mm tit , cannulated cancellous screw 6.5mm, 16mm thread 40mm tit , cannulated cancellous screw 6.5mm, 16mm thread 45mm tit , cannulated cancellous screw 6.5mm, 16mm thread 50mm tit , cannulated cancellous screw 6.5mm, 16mm thread 55mm tit , cannulated cancellous screw 6.5mm, 16mm thread 60mm tit , cannulated cancellous screw 6.5mm, 16mm thread 65mm tit , cannulated cancellous screw 6.5mm, 16mm thread 70mm tit , cannulated cancellous screw 6.5mm, 16mm thread 75mm tit , cannulated cancellous screw 6.5mm, 16mm thread 80mm tit , cannulated cancellous screw 6.5mm, 16mm thread 85mm tit , cannulated cancellous screw 6.5mm, 16mm thread 90mm tit , cannulated cancellous screw 6.5mm, 16mm thread 95mm tit , cannulated cancellous screw 6.5mm, 16mm thread 100mm tit , cannulated cancellous screw 6.5mm, 16mm thread 105mm tit , cannulated cancellous screw 6.5mm, 16mm thread 110mm tit , cannulated cancellous screw 6.5mm, 16mm thread 115mm tit , cannulated cancellous screw 6.5mm, 32mm thread 45mm tit , cannulated cancellous screw 6.5mm, 32mm thread 50mm tit , cannulated cancellous screw 6.5mm, 32mm thread 55mm tit , cannulated cancellous screw 6.5mm, 32mm thread 60mm tit , cannulated cancellous screw 6.5mm, 32mm thread 65mm tit , cannulated cancellous screw 6.5mm, 32mm thread 70mm tit , cannulated cancellous screw 6.5mm, 32mm thread 75mm tit , cannulated cancellous screw 6.5mm, 32mm thread 80mm tit , cannulated cancellous screw 6.5mm, 32mm thread 85mm tit , cannulated cancellous screw 6.5mm, 32mm thread 90mm tit , cannulated cancellous screw 6.5mm, 32mm thread 95mm tit , cannulated cancellous screw 6.5mm, 32mm thread 100mm tit , cannulated cancellous screw 6.5mm, 32mm thread 105mm tit , cannulated cancellous screw 6.5mm, 32mm thread 110mm tit , cannulated cancellous screw 6.5mm, 32mm thread 115mm tit , locking head screw 2.7mm, self tapping 10mm tit , locking head screw 2.7mm, self tapping 12mm tit , locking head screw 2.7mm, self tapping 14mm tit , locking head screw 2.7mm, self tapping 16mm tit , locking head screw 2.7mm, self tapping 18mm tit , locking head screw 2.7mm, self tapping 20mm tit , locking head screw 2.7mm, self tapping 22mm tit , locking head screw 2.7mm, self tapping 24mm tit , locking head screw 2.7mm, self tapping 26mm tit , locking head screw 2.7mm, self tapping 28mm tit , locking head screw 2.7mm, self tapping 30mm tit , locking head screw 2.4mm, self tapping 10mm tit , locking head screw 2.4mm, self tapping 12mm tit , locking head screw 2.4mm, self tapping 14mm tit , locking head screw 2.4mm, self tapping 16mm tit , locking head screw 2.4mm, self tapping 18mm tit , locking head screw 2.4mm, self tapping 20mm tit , locking head screw 2.4mm, self tapping 22mm tit , locking head screw 2.4mm, self tapping 24mm tit , locking head screw 2.4mm, self tapping 26mm tit , locking head screw 2.4mm, self tapping 28mm tit , locking head screw 2.4mm, self tapping 30mm tit , cortex screw 2.4mm , self tapping 10mm tit , cortex screw 2.4mm , self tapping 12mm tit , cortex screw 2.4mm , self tapping 14mm tit , cortex screw 2.4mm , self tapping 16mm tit , cortex screw 2.4mm , self tapping 18mm tit , cortex screw 2.4mm , self tapping 20mm tit , cortex screw 2.4mm , self tapping 22mm tit , cortex screw 2.4mm , self tapping 24 mm tit , cortex screw 2.4mm , self tapping 26mm tit , cortex screw 2.4mm , self tapping 28mm tit , cortex screw 2.4mm , self tapping 30mm tit , locking head screw 3.5mm , self tapping 10mm tit , locking head screw 3.5mm , self tapping 12mm tit , locking head screw 3.5mm , self tapping 14mm tit , locking head screw 3.5mm , self tapping 16mm tit , locking head screw 3.5mm, self tapping 18mm tit , locking head screw 3.5mm , self tapping 20mm tit , locking head screw 3.5mm , self tapping 22mm tit , locking head screw 3.5mm, self tapping24mm tit , locking head screw 3.5mm , self tapping 26mm tit , locking head screw 3.5mm , self tapping 28mm tit , locking head screw 3.5mm , self tapping 30mm tit , locking head screw 3.5mm , self tapping 32mm tit , locking head screw 3.5mm , self tapping 34mm tit , locking head screw 3.5mm, self tapping 36mm tit , locking head screw 3.5mm , self tapping 38mm tit , locking head screw 3.5mm , self tapping 40mm tit , locking head screw 3.5mm, self tapping42mm tit , locking head screw 3.5mm, self tapping44mm tit , locking head screw 3.5mm, self tapping46mm tit , locking head screw 3.5mm , self tapping 48mm tit , locking head screw 3.5mm , self tapping 50mm tit , locking head screw 3.5mm, self tapping55mm tit , locking head screw 3.5mm, self tapping60mm tit , locking head screw 3.5mm, self tapping65mm tit , locking head screw 3.5mm, self tapping70mm tit , locking head screw 3.5mm, self tapping75mm tit , locking head screw 3.5mm, self tapping80mm tit , locking head screw 3.5mm, self tapping85mm tit , locking head screw 3.5mm, self tapping 90mm tit , locking head screw 5.0mm, self tapping 14mm tit , locking head screw 5.0mm, self tapping 16mm tit , locking head screw 5.0mm, self tapping 18mm tit , locking head screw 5.0mm, self tapping 20mm tit , locking head screw 5.0mm, self tapping 22mm tit , locking head screw 5.0mm, self tapping 24mm tit , locking head screw 5.0mm, self tapping 26mm tit , locking head screw 5.0mm, self tapping 28mm tit , locking head screw 5.0mm, self tapping 30mm tit , locking head screw 5.0mm, self tapping 32mm tit , locking head screw 5.0mm, self tapping 34mm tit , locking head screw 5.0mm, self tapping 36mm tit , locking head screw 5.0mm, self tapping 38mm tit , locking head screw 5.0mm, self tapping 40mm tit , locking head screw 5.0mm, self tapping 45mm tit , locking head screw 5.0mm, self tapping 50mm tit , locking head screw 5.0mm, self tapping 55mm tit , locking head screw 5.0mm, self tapping 60mm tit , locking head screw 5.0mm, self tapping 65mm tit , locking head screw 5.0mm, self tapping 70mm tit , locking head screw 5.0mm, self tapping 75mm tit , locking head screw 5.0mm, self tapping 80mm tit , locking head screw 5.0mm, self tapping 85mm tit , locking head screw 5.0mm, self tapping 90mm tit , locking head screw 5.0mm, self tapping 95mm tit , locking head screw 5.0mm, self tapping 100mm tit , dhs screw 12.5mm 50mm tit , dhs screw 12.5mm 55mm tit , dhs screw 12.5mm 60mm tit , dhs screw 12.5mm 65mm tit , dhs screw 12.5mm 70mm tit , dhs screw 12.5mm 75mm tit , dhs screw 12.5mm 80mm tit , dhs screw 12.5mm 85mm tit , dhs screw 12.5mm 90mm tit , dhs screw 12.5mm 95mm tit , dhs screw 12.5mm 100mm tit , dhs screw 12.5mm 105mm tit , dhs screw 12.5mm 110mm tit , dhs screw 12.5mm 115mm tit , dhs screw 12.5mm 120mm tit , dhs compression screw 36mm tit , leg screw for pfn 6.4mm 50mm tit , leg screw for pfn 6.4mm 55mm tit , leg screw for pfn 6.4mm 60mm tit , leg screw for pfn 6.4mm 65mm tit , leg screw for pfn 6.4mm 70mm tit , leg screw for pfn 6.4mm 75mm tit , leg screw for pfn 6.4mm 80mm tit , leg screw for pfn 6.4mm 85mm tit , leg screw for pfn 6.4mm 90mm tit , leg screw for pfn 6.4mm 95mm tit , leg screw for pfn 6.4mm 100mm tit , leg screw for pfn 6.4mm 105mm tit , leg screw for pfn 6.4mm 110mm tit , leg screw for pfn 6.4mm 115mm tit , leg screw for pfn 6.4mm 120mm tit , leg screw for pfn 8.0mm 50mm tit , leg screw for pfn 8.0mm 55mm tit , leg screw for pfn 8.0mm 60mm tit , leg screw for pfn 8.0mm 65mm tit , leg screw for pfn 8.0mm 70mm tit , leg screw for pfn 8.0mm 75mm tit , leg screw for pfn 8.0mm 80mm tit , leg screw for pfn 8.0mm 85mm tit , leg screw for pfn 8.0mm 90mm tit , leg screw for pfn 8.0mm 95mm tit , leg screw for pfn 8.0mm 100mm tit , leg screw for pfn 8.0mm 105mm tit , leg screw for pfn 8.0mm 110mm tit , leg screw for pfn 8.0mm 115mm tit , leg screw for pfn 8.0mm 120mm tit , end cap pfn nail ext 05mm tit , end cap pfn nail ext 10mm tit , end cap pfn nail ext 15mm tit , cancellous locking head screw 3.5mm 22mm tit , cancellous locking head screw 3.5mm 24mm tit , cancellous locking head screw 3.5mm 26mm tit , cancellous locking head screw 3.5mm 28mm tit , cancellous locking head screw 3.5mm 30mm tit , cancellous locking head screw 3.5mm 35mm tit , cancellous locking head screw 3.5mm 40mm tit , cancellous locking head screw 3.5mm 45mm tit , cancellous locking head screw 3.5mm 50mm tit , cancellous locking head screw 3.5mm 55mm tit , cancellous locking head screw 3.5mm 60mm tit , cancellous locking head screw 3.5mm 65mm tit , cancellous locking head screw 3.5mm 70mm tit , cancellous locking head screw 3.5mm 75mm tit , cancellous locking head screw 3.5mm 80mm tit , cancellous locking head screw 5.0mm 30mm tit , cancellous locking head screw 5.0mm 32mm tit , cancellous locking head screw 5.0mm 34mm tit , cancellous locking head screw 5.0mm 36mm tit , cancellous locking head screw 5.0mm 38mm tit , cancellous locking head screw 5.0mm 40mm tit , cancellous locking head screw 5.0mm 42mm tit , cancellous locking head screw 5.0mm 44mm tit , cancellous locking head screw 5.0mm 46mm tit , cancellous locking head screw 5.0mm 48mm tit , cancellous locking head screw 5.0mm 50mm tit , cancellous locking head screw 5.0mm 55mm tit , cancellous locking head screw 5.0mm 60mm tit , cancellous locking head screw 5.0mm 65mm tit , cancellous locking head screw 5.0mm 70mm tit , cancellous locking head screw 5.0mm 75mm tit , cancellous locking head screw 5.0mm 80mm tit , cancellous locking head screw 5.0mm 85mm tit , cancellous locking head screw 5.0mm 90mm tit , cancellous locking head screw 5.0mm 95mm tit , cancellous locking head screw 5.0mm 100mm tit , end cap dynamic tibial nail tit , herbert cannulated screw 3.5mm 12mm tit , herbert cannulated screw 3.5mm 14mm tit , herbert cannulated screw 3.5mm 14mm tit , herbert cannulated screw 3.5mm 18mm tit , herbert cannulated screw 3.5mm 20mm tit , herbert cannulated screw 3.5mm 22mm tit , herbert cannulated screw 3.5mm 24mm tit , herbert cannulated screw 3.5mm 26mm tit , herbert cannulated screw 3.5mm 28mm tit , herbert cannulated screw 3.5mm 30mm tit , locking bolt 4.9mm, trocar tip 22mm tit , locking bolt 4.9mm, trocar tip 24mm tit , locking bolt 4.9mm, trocar tip 26mm tit , locking bolt 4.9mm, trocar tip 28mm tit , locking bolt 4.9mm, trocar tip 30mm tit , locking bolt 4.9mm, trocar tip 32mm tit , locking bolt 4.9mm, trocar tip 34mm tit , locking bolt 4.9mm, trocar tip 36mm tit , locking bolt 4.9mm, trocar tip 38mm tit , locking bolt 4.9mm, trocar tip 40mm tit , locking bolt 4.9mm, trocar tip 42mm tit , locking bolt 4.9mm, trocar tip 44mm tit , locking bolt 4.9mm, trocar tip 46mm tit , locking bolt 4.9mm, trocar tip 48mm tit , locking bolt 4.9mm, trocar tip 50mm tit , locking bolt 4.9mm, trocar tip 52mm tit , locking bolt 4.9mm, trocar tip 54mm tit , locking bolt 4.9mm, trocar tip 56mm tit , locking bolt 4.9mm, trocar tip 58mm tit , locking bolt 4.9mm, trocar tip 60mm tit , locking bolt 4.9mm, trocar tip 64mm tit , locking bolt 4.9mm, trocar tip 68mm tit , locking bolt 4.9mm, trocar tip 72mm tit , locking bolt 4.9mm, trocar tip 76mm tit , locking bolt 4.9mm, trocar tip 80mm tit , locking bolt 3.9mm, trocar tip 22mm tit , locking bolt 3.9mm, trocar tip 24mm tit , locking bolt 3.9mm, trocar tip 26mm tit , locking bolt 3.9mm, trocar tip 28mm tit , locking bolt 3.9mm, trocar tip 30mm tit , locking bolt 3.9mm, trocar tip 32mm tit , locking bolt 3.9mm, trocar tip 34mm tit , locking bolt 3.9mm, trocar tip 36mm tit , locking bolt 3.9mm, trocar tip 38mm tit , locking bolt 3.9mm, trocar tip 40mm tit , locking bolt 3.9mm, trocar tip 42mm tit , locking bolt 3.9mm, trocar tip 44mm tit , locking bolt 3.9mm, trocar tip 46mm tit , locking bolt 3.9mm, trocar tip 48mm tit , locking bolt 3.9mm, trocar tip 50mm tit , locking bolt 3.4mm, trocar tip 22mm tit , locking bolt 3.4mm, trocar tip 24mm tit , locking bolt 3.4mm, trocar tip 26mm tit , locking bolt 3.4mm, trocar tip 28mm tit , locking bolt 3.4mm, trocar tip 30mm tit , locking bolt 3.4mm, trocar tip 32mm tit , locking bolt 3.4mm, trocar tip 34mm tit , locking bolt 3.4mm, trocar tip 36mm tit , locking bolt 3.4mm, trocar tip 38mm tit , locking bolt 3.4mm, trocar tip 40mm tit , locking bolt 3.4mm, trocar tip 42mm tit , locking bolt 3.4mm, trocar tip 44mm tit , end cap humerus nail ext 00mm tit , end cap humerus nail ext 05mm tit , end cap humerus nail ext 10mm tit , end cap humerus nail ext 15mm tit , dynamic tibial nail 8.0mm 260mm tit , dynamic tibial nail 8.0mm 280mm tit , dynamic tibial nail 8.0mm 300mm tit , dynamic tibial nail 8.0mm 320mm tit , dynamic tibial nail 8.0mm 340mm tit , dynamic tibial nail 8.0mm 360mm tit , dynamic tibial nail 8.0mm 380mm tit , dynamic tibial nail 9.0mm 260mm tit , dynamic tibial nail 9.0mm 280mm tit , dynamic tibial nail 9.0mm 300mm tit , dynamic tibial nail 9.0mm 320mm tit , dynamic tibial nail 9.0mm 340mm tit , dynamic tibial nail 9.0mm 360mm tit , dynamic tibial nail 9.0mm 380mm tit , dynamic tibial nail 10.0mm 260mm tit , dynamic tibial nail 10.0mm 280mm tit , dynamic tibial nail 10.0mm 300mm tit , dynamic tibial nail 10.0mm 320mm tit , dynamic tibial nail 10.0mm 340mm tit , dynamic tibial nail 10.0mm 360mm tit , dynamic tibial nail 10.0mm 380mm tit , dynamic tibial nail 11.0mm 260mm tit , dynamic tibial nail 11.0mm 280mm tit , dynamic tibial nail 11.0mm 300mm tit , dynamic tibial nail 11.0mm 320mm tit , dynamic tibial nail 11.0mm 340mm tit , dynamic tibial nail 11.0mm 360mm tit , dynamic tibial nail 11.0mm 380mm tit , dynamic tibial nail 12.0mm 260mm tit , dynamic tibial nail 12.0mm 280mm tit , dynamic tibial nail 12.0mm 300mm tit , dynamic tibial nail 12.0mm 320mm tit , dynamic tibial nail 12.0mm 340mm tit , dynamic tibial nail 12.0mm 360mm tit , dynamic tibial nail 12.0mm 380mm tit , proximal femoral nail 130° 9.0mm 340mm, right tit , proximal femoral nail 130° 9.0mm 360mm, right tit , proximal femoral nail 130° 9.0mm 380mm, right tit , proximal femoral nail 130° 9.0mm 400mm, right tit , proximal femoral nail 130° 9.0mm 420mm, right tit , proximal femoral nail 130° 9.0mm 440mm, right tit , proximal femoral nail 130° 10.0mm 340mm, right tit , proximal femoral nail 130° 10.0mm 360mm, right tit , proximal femoral nail 130° 10.0mm 380mm, right tit , proximal femoral nail 130° 10.0mm 400mm, right tit , proximal femoral nail 130° 10.0mm 420mm, right tit , proximal femoral nail 130° 10.0mm 440mm, right tit , proximal femoral